Processing

Food
od
Puniya et al., J Food Process Technol 2016, 7:1

&
Fo

Tec
http://dx.doi.org/10.4172/2157-7110.1000545
rnal of

hnology
Processing & Technology
Jou

ISSN: 2157-7110

Research Article Open Access

Screening of Lactic Acid Bacteria of Different Origin for their Probiotic

Potential
Monica Puniya1, Ravinder Kumar M1, Harsh Panwar2, Nikhil Kumar2, Ramneek3 and Anil Kumar P1*
1
Dairy Microbiology Division, ICAR-National Dairy Research Institute, Haryana, India
2
Basic and Applied Sciences, National Institute of Food Technology Entrepreneurship and Management, Haryana, India
3
School of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Sciences University, Punjab, India

Abstract
This study was to isolate lactic acid bacteria (LAB) from different dairy and non-dairy sources and to evaluate the probiotic
potential of the isolated microorganism(s). Sixteen Lactobacillus isolates viz. seven human (LHI), six dairy (LMI) and three from
kimchi (LKI) were subjected to screening for probiotic attributes: simulated stomach deudenum passage, bile salt hydrolase;
cell surface hydrophobicity, adhesion, auto-aggregation, antimicrobial activity, antibiotic susceptibility and antioxidative potential,
following standard protocols. The isolates exhibited resistance to stomach pH (pH=3.0) and tolerance against gastric juice and
bile. The isolates also displayed antimicrobial activity against Escherichia coli, Klebsiella sp., S. typhimurium and were uniformly
sensitive towards amikacin, amoxycillin, ampicillin, chloramphenicol, clindamycin, erythromycin, oxytetracyclin and cefuroxime.
Highest hydrophobicity of up to 86 and 44% against both n-hexadecane and xylene were recorded with LHI7 followed by LHI6.
Moreover, LMI5 and LKI2 showed high anti-oxidative and auto-aggregation properties, respectively. Bacterial adherence increased
with a decrease in pH with highest affinity for Caco-2 cells in LHI7, showing 68.7 ± 0.53% adhesion, followed by LHI6 with 65.4 ±
0.15%. Overall, these selective strains may possibly be utilized as probiotics after further validation through in vivo studies and/
or human clinical trials.

Keywords: Probiotics; Lactic acid bacteria; Lactobacilli; Acid
tolerance; Bile tolerance; Hydrophobicity
Abbreviations: LAB: Lactic Acid Bacteria; CSH: Cell Surface
Hydrophobicity; SSDP: Simulated Stomach Duodenum Passage
Introduction
Lactic acid bacteria (LAB) having GRAS status, consists of
genetically and physiologically diverse group of Gram positive,
catalase negative, non-spore forming, non-pathogen [1,2], known
for their health benefits. Members of this family, Lactobacillus and
Bifidobacterium are recognized as probiotics; live bacteria, which
when administered in adequate amount confer some health benefits
to the host [3]; and have wider applications in food, feed, dairy and
fermentation industry, as non-pharmacological approaches for
health management [2]. The concept that food-borne bacteria can
have health promoting effects is credited to Russian Nobel laureate,
Ellie Metchnikoff, who hypothesized that consuming large amounts
of fermented milk products could prolong the life of Bulgarians [4].
Newer applications of probiotics are studied for their potential in
lactose intolerance [5,6], natural resistance to infections of GIT [7],
improved digestion [8], cancer suppression [9], cholesterol lowering
[10], anti-obesity [11,12], anti-diabetic [13], anti-allergic [14], anti-
hypertensive [15], anti-inflammatory [16], enzyme inhibitions [17,18],
mood changer [19] etc. Thus, the concept of using beneficial microbes,
as bio-therapeutics and for improved health has become an area of
immense interest [20].
Although, several strains of LAB viz. L. acidophilus [21,22], L. brevis
[23], L. casei [22,24], L. fermentum [25], L. gasseri [26], L. helveticus
[22], L. plantarum [27], L. rhamnosus [28] etc. have been isolated and
validated as probiotics; studies are still focusing on potential strains of
LAB. It is a fact that probiotic attributes and health benefits are strain
specific [29], yet it is of high significance to screen for new strains with
more potent health benefits.
In order to survive and colonize the GIT, probiotics should have
resistance to acid and bile of GIT, followed by adhesion to the host
gut, which is prerequisite for sufficient interaction with host [30].
Good adherence to GIT enables the probiotics to persist enhancing the
host-bacteria interactions [31]. Adherence of probiotics also helps to
overcome peristalsis of stomach [32]. Other essential characteristics
include cell surface hydrophobicity (CSH), auto-aggregation,
antimicrobial properties and safety. The CSH of bacterial surfaces is
a determinant of adhesion and biofilms formation on animate and
inanimate surfaces [33]. It is likely due to a complex interplay between
negatively-charged, positively charged, hydrophobic and hydrophilic
components on bacterial cell surface. Display of antimicrobial
activity against pathogens is also preferred [34-38]. In addition, these
need to compete with resident micro biota. Furthermore, antibiotic
resistance may help them to survive in the presence of administered
drugs and other antimicrobial compounds [39]. However, the genes
coding for resistance in probiotics should be natural and located over
chromosomal DNA i.e. non-transferable to other fellow microbes [40].
The identification of unique probiotics for newer applications is a
very complex process that takes substantial research effort. Thus the
aim of this study was to identify LAB isolates as probiotics, based on
assessment of attributes necessary to qualify them as potential probiotic
agent.
*Corresponding author: Anil Kumar Puniya, College of Dairy Science and
Technology, Guru Angad Dev Veterinary and Animal Sciences University,
Ludhiana, Punjab, India, Tel: +91-161-2553308; E-mail: akpuniya@gmail.com
Received December 03, 2015; Accepted December 29, 2015; Published January
02, 2016
Citation: Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek, et al.
(2016) Screening of Lactic Acid Bacteria of Different Origin for their Probiotic
Potential. J Food Process Technol 7: 545. doi:10.4172/2157-7110.1000545
Copyright: © 2016 Puniya M, et al. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and
source are credited.

J Food Process Technol

ISSN: 2157-7110 JFPT, an open access journal Volume 7 • Issue 1 • 1000545
Citation: Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek, et al. (2016) Screening of Lactic Acid Bacteria of Different Origin for their
Probiotic Potential. J Food Process Technol 7: 545. doi:10.4172/2157-7110.1000545
Materials and Methods
Isolation of LAB
Samples of dahi, lassi and raw milk (i.e. cow, goat and buffalo) were
collected from the experimental dairy plant and cattle yard of ICAR-
NDRI, Karnal, as well from the local market and rural areas of Karnal
and Chandigarh. Commercially available samples from organized
sectors were also collected from local market. Faecal samples from
healthy human adults and infants, with no recent history of antibiotic
treatment (≥ 6 months) or infection, were also collected from Karnal
with consent from parents. Also, Kimchi, a fermented Korean product
was procured from ‘microbial metabolite lab’ for isolation. Following
sampling, one gram/ml of food/faecal samples were suspended in 9.0
ml of peptone water, homogenized exhaustively, serially diluted (10-5-
10-8), pour plated in BCP-MRS agar and incubated an-aerobically at
37°C for 24-48h for the development of typical yellow coloured rice
shape colonies.
Identification of LAB
Individual colonies were picked and transferred to MRS broth for
further examination and selection at morphological, bio-chemical and
molecular levels. Isolates were screened for catalase activity by placing
a loop of 16-18h grown cultures on slide followed by the addition of
a drop of H2O2 (3%) and effervescence was noted as positive. Isolates
were further characterized at molecular level by genus specific
PCR. Genomic DNA was extracted by Neumann and Pospiech [41]
method following quantification using Nanodrop (Shimadzu Bio
Spec-nano). PCR reactions were performed using oligo-nucleotide
primer sets (LbLMA-1, CTCAAAACTAAACAAAGTTTC and R-161,
CTTGTACACACCGCCCGTCA) described by Dubernet et al., [42].
PCR reaction was carried out in Eppendorf thermalcycler including
initial denaturation at 95°C/5 min, followed by 35 cycles each of
denaturation, 95°C/30 sec; annealing, 55°C/30 sec; and extension,
72°C/30 sec; and final extension at 72°C for 7 min and final holding
at 4°C. PCR products were electrophoreses in 1.5% agarose gel
(Mini submarine, Hoeffer, USA) following the standard protocol of
Sambrook et al. [43]. A product size of ~250 bp confirmed the presence
of Lactobacillus isolates.
All identified Lactobacillus isolates were subjected to series in vitro
tests for confirming their probiotic attributes as recommended by
FAO/WHO [3]. All experiments were conducted in vitro, anticipating
that the qualified isolates may also mimic their activities under in vivo
conditions.
Simulated Stomach Duodenum Passage (SSDP) assay
SSDP assay is designed to represent a simplified and standardized
test giving predictable values for survival of test strain in human
stomach and duodenum under normal gut conditions [44]. The
principle involves an initial simulation of stomach containing ingested
LAB after a meal. After 1h, bile and artificial duodenum secretions were
added to simulate the further gastric passage. Counts refer to the log
cfu/ml at 0h. Synthetic duodenum juice was prepared by dissolving
NaHCO3 (6.4 g/l), KCl (0.239 g/l), NaCl (1.28 g/l) in distilled water. The
pH was adjusted to 7.5 using 5M HCl. The oxgal solution was prepared
by reconstituting 10 g of oxgal in 100ml distilled water. All the solutions
were sterilized by autoclaving at 121°C/15 min. The required volumes
of the overnight grown cultures and MRS broth adjusted at pH 3.0 were
aseptically mixed in sterile flasks to give a final concentration of 108cfu/
ml. After mixing initial counts were determined by spread plating.
Samples were drawn after 1h of incubation at 37°C and viable counts
J Food Process Technol
ISSN: 2157-7110 JFPT, an open access journal
Page 2 of 9
determined. Four milliliters of oxgal solutions were added to the culture
in flasks, followed by 17 ml of duodenum juice. After mixing, the flasks
were further incubated at 37°C. Samples were withdrawn after 2 and
3h and counts were taken. Experiment was carried out in duplicate and
repeated three times.
Cell surface hydrophobicity
Ability of the organisms to adhere to hydrocarbons is a measure
of their adherence to the epithelial cells in the gut i.e. CSH. The CSH
was determined according to the method described by Rosenberg
et al. [45] with slight modification using n-hexadecane and xylene.
Overnight grown cultures were centrifuged at 5,000 g and the cell
pellets were washed twice with phosphate urea magnesium (PUM)
buffer. The washed pellets were re-suspended in PUM buffer and the
absorbance (A610) was adjusted to 0.7-0.9. The cell suspension (3.0ml)
and n-hexadecane (1.0ml) were vortex and incubated at 37°C for
10 min. The mixture was again vortex briefly and incubated at 37°C
for 1h for phase separations and the hydrocarbon layer was allowed
to rise completely. After 1h, aqueous phase was removed carefully
with a Pasteur pipette and absorbance (A610) was measured using
Spectrophotometer (Jenway Genova, Jenway Ltd. UK). The decrease
in absorbance was taken as a measure of the CSH (H%) calculated as:
H (%)=ODinitial-ODfinal× 100/ODinitial
Where, ODinitial=initial absorbance and ODfinal=final absorbance;
with the two hydrocarbons at 610 nm.
Cell auto-aggregation
Cell auto-aggregation was determined using the method of Tomas
et al. [46]. Overnight grown Lactobacillus cultures were harvested by
centrifugation and the cell pellets washed twice with Phosphate Buffer
Saline (PBS) and re-suspended again in PBS to an absorbance of ~0.5
at 600 nm (Absinitial). The suspension was centrifuged and the pellets
were re-suspended in equal volume of broth removed at step 1. The
mixture was allowed to stand at 37°C for 2 h. Thereafter, 1.0 ml of the
upper suspension was taken to measure the absorbance (Absfinal) using
broth as reference. The percent difference between the initial and final
absorbance gives an index of cellular auto-aggregation as follows.
Aggregation (%)=(Absinitial-Absfinal) × 100/Absinitial
Adhesion of lactobacilli isolates to Caco-2 cell lines
The quantitative binding of Lactobacillus cultures was also
investigated on Caco-2 cell line by two independent methods i.e. direct
microscopic examination after Giemsa staining and enumeration by
plating on MRS. The human adenocarcinoma cell line, Caco-2 (non-
mucus secreting) for adhesion assay were procured from National
Center of Cell Sciences, Pune, India. The cell lines were cultured in
Dulbecco’s Modified Eagle’s Minimal Essential Medium (DMEM;
Sigma, USA) supplemented with 10 % (v/v) heat-inactivated (30 min,
56°C) fetal bovine serum, 25 mM HEPES (Sigma, USA), 100 U/ml
penicillin, and 100 μg/ml streptomycin at 37°C in an atmosphere of
5% CO2.
Adhesion assay
Adhesion of the Lactobacillus cultures was measured as per the
method of Jacobsen et al. [47]. The cell suspension with 1 × 105 cells
prepared in 4mL complete DMEM was transferred to each well of
six-well tissue culture plates. The medium was changed on alternate
day. When cells reached 80% confluency, the medium was replenished
each day for 20 days. The spent medium was completely removed 24h
Volume 7 • Issue 1 • 1000545
Citation: Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek, et al. (2016) Screening of Lactic Acid Bacteria of Different Origin for their
Probiotic Potential. J Food Process Technol 7: 545. doi:10.4172/2157-7110.1000545
before adhesion assay and cells were fed with antibiotic free DMEM.
Cells were then washed twice with 3mL PBS (pH 7.4). An aliquot of 2
mL of DMEM (without serum and antibiotics) was added to each well
and incubated at 37°C for 30 min. Different Lactobacillus cultures (1
× 109cfu) suspended in 1mL DMEM (without serum and antibiotics)
were added to different wells. The plates were incubated at 37°C in 5%
CO2 for 2 h. The monolayers were washed 5 times with sterile PBS (pH
7.4). Percent adhesion was determined by plating method.
Cells from monolayers were detached by trypsinization.
The detached cells were repeatedly but gently aspirated to make
homogenous suspension. The cell suspension was then serially diluted
with saline solution, plated on MRS agar, incubated for 24-48 h at 37°C
and colonies were counted (B1cfu/ml). Bacterial cells initially added to
each well of six-well plates were also counted (B0cfu/ml). The adhesion
percent was calculated as:
Adhesion (%) = (B1/B0) ×100
Where B1= Number of bacterial colonies after incubation and
B0=no of bacterial cells added initially.
Antimicrobial activity
Antimicrobial activities of probiotics are thought to be a significant
functional criterion for competitively excluding or inhibiting the
activities of pathogenic intestinal microflora via production of
antimicrobial compounds like organic acids (e.g. acetic and lactic
acids), hydrogen peroxide, bacteriocins etc. Antimicrobial activity
of Lactobacillus isolates were recorded against Klebsiella sp., S.
typhimurium and E. coli following agar spot test by Schillinger and
Lucke [48]. Lactobacillus cultures for spot inoculation of agar surfaces
were grown in MRS broth at 37°C by three consecutive transfers at 24
h intervals. Indicator strains for seeding the soft agar for overlay were
also grown in BHI broths by three successive transfers at 24h intervals
at their optimum growth temperatures. The surface of the solidified
and dried (overnight at 37°C) tryptone glucose yeast extract (TGE)
agar plates were spot inoculated with 5 µL of Lactobacillus cultures.
The inoculated agar plates were incubated at 37°C for 18-24 h and then
overlaid with 7.0 ml of TGE soft agar (0.7% agar), seeded with 30 µL of
the indicator culture. The diameter of zone of inhibition was measured
and a clear zone of 1 mm or more was considered positive inhibition.
Antibiotic susceptibility
Antibiotic resistance/susceptibility of lactobacilli isolates were
studied against large spectra of clinically important antibiotics by
disc diffusion method as recommended by Clinical and Laboratory
Standards Institute (CLSI; Wayne, USA) [49]. A total number of 12
antibiotics (HiMedia Ltd, Mumbai, India) viz. Amikacin (AK, 30 µg),
Amoxycillin (AM, 10 µg), Ampicillin (AMP, 10 µg), Ciprofloxacin
(CIP, 10 µg), Cephalothin (CET, 30 µg), Chloramphenicol (C, 10
µg), Clindamycin (CD, 2 µg), Erythromycin (E, 10 µg), Novobiocin
(NV, 30 µg), Kenamycin (K, 30 µg), Oxytetracyclin (OXT, 30 µg) and
Cefuroxime (CXM, 30 µg) were applied. Fifteen milliliters of MRS
agar was poured in petriplate and allowed to solidify. These were
subsequently over laid with 4mL of soft agar tempered at 45°C and
seeded with 200 µL of active cultures. Petriplates were allowed to stand
at room temperature for 15 min and then the antibiotic discs were
dispensed onto agar using disc dispenser under aseptic conditions. The
agar plates were incubated at 37°C aerobically for 24 h. Diameter (mm)
of zone of inhibition was measured using antibiotic zone scale and
results were expressed in terms of resistant, moderately susceptibile or
J Food Process Technol
ISSN: 2157-7110 JFPT, an open access journal
Page 3 of 9
susceptible by comparing with the interpretative zone diameters given
by ‘Performance Standards for Antimicrobial Disk Susceptibility’ tests
[49] for disc diffusion antibiotic susceptibility test.
Antioxidative potential
Measurement of anti-oxidative capacity of the selected
Lactobacillus cultures was performed according to Re et al. [50]
based on the principle of scavenging ABTS+ radicals by test cultures.
Overnight grown culture supernatant was collected by centrifugation
at 5400 × g for 15 min at 4°C. The ABTS working solution was prepared
by mixing 88 µl of 140 mM potassium persulphate with 5ml of 7 mM
ABTS stock solution and incubating overnight in dark bottles for
generation of radicals. An aliquot of 200 µl of this solution was added
to 15 ml PBS to adjust the absorbance at 734 nm to 0.7 ± 0.02. An
aliquot of 10 µl of cell supernatant collected in step 1 was added to 1.0
ml ABTS in PBS solution in an optical cuvette and the contents were
mixed for 10 sec and decrease in absorbance at 734 nm was recorded
over a period of 10 min at 10 sec intervals using SPECORD-200 double
beam spectrophotometer (Analytical zena).
Bile salt hydrolase (BSH) assay
Direct plate assay method of Singh et al. [52] was employed for
detection of BSH activity. BSH activity was examined by streaking
the fully activated culture on MRS agar containing 0.5% (w/v) bile
salt viz. sodium taurocholate, sodium taurodeoxycholate and sodium
tauroglycocholate and 0.37 g/l of CaCl2. Petriplates were then incubated
at 37°C anaerobically for three days. BSH activity was indicated, when
the hydrolyzed products of salts, viz. cholic acid or deoxycholic acid,
precipitated in agar medium in and around the spots.
Results and Discussion
Isolation of LAB
A total of 125 colonies were selected from raw milk (cow, 20;
goat, 5; buffalo, 25); Dahi (10); lassi (5); faeces (adult, 25; infant,
30) and Kimchi (5) on basis of variations in colonial morphology
(i.e. size: small, medium and large i.e. 0.7 mm to 2.1 mm; margins:
entire and undulate; shape and colour: circular, rough, smooth and
compact, irregular, white, greyish-white, dark-centered, cream) clearly
indicating a wider diversity. Isolates were identified as member of
Lactobacillaceae by negative and Gram’s staining. Figures 1a and 1b
are representative for negative and Gram’s staining, respectively. Based
on morphological screening, out of the total 125 isolates, a total of 101,
were identified as Gram positive rods. After subjecting to genus specific
PCR, as described in materials and methods, a total of 16 isolates were
confirmed as Lactobacillus isolates, on basis of observed band size of
250 bp (Figure 2).
Figure 1: (a) Representative smears for Negative staining and (b) Gram’s
staining performed with bacterial isolates randomly collected from BCP-
MRS agar plates.
Volume 7 • Issue 1 • 1000545
Citation: Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek, et al. (2016) Screening of Lactic Acid Bacteria of Different Origin for their
Probiotic Potential. J Food Process Technol 7: 545. doi:10.4172/2157-7110.1000545

Page 4 of 9

Response to simulated stomach duodenum passage (SSDP)
As the two stresses of stomach and small intestinal transit might
interact and thereby, affect the viability of strains in a synergistic
fashion, therefore, it is important to evaluate low pH, bile salts and
duodenum juice in one system, rather than evaluating the effect of each
separately [44]. In this study, combined effect of gastric and intestinal
fluids in simulated GIT transit resistance was tested. Ten strains
showed higher survival and tolerance to acid and bile environments
after 2 h incubation presented as log cfu/ml (Table 1 and Figure 3).
However, 13 isolates maintained viability after 3 h of stress. Survival of
bacterial strains in human gastric juice is a more accurate indication of
the ability of strains to survive passage through the stomach. Resistance
to bile salts is considered as an important property in strains envisaged
as probiotics. The physiological concentration of bile acids in the small
intestine is between 5,000 and 20,000 μM [44]. A concentration of 0.5%
bile salts, equivalent to 12,255 μM, was used similar to Kociubinsky et
al. [52], which is higher than 0.3 or 0.15% used by other investigators
[53-55]. Mathara et al. [44] reported that all the Lactobacillus strains
survived successfully through simulated stomach duodenum passage.
Figure 2: Agarose gel electrophoresis. Representative blot of genus specific
PCR carried out with DNA from bacterial isolates from different sources. A
band size of 250bp represents Lactobacillusgenera.
Results in Figure 3 suggest that fecal isolates could effectively transit
human stomach and may reach intestine, adhere, replicate and
function effectively [56]. In a study by Singh et al. [51], nine L. reuteri
strains showed high rates of survival and tolerance to acid and bile
environments. As already reported [57,58], in vitro studies can partially
mimic the gut ecosystem.
Cell surface hydrophobicity
CSH of Lactobacillus isolates was measured using the microbial
partition to xylene and n-hexadecane. Results indicated wide variations
in CSH ranging from 11.88 to 86.79% between different isolates (Table
2 and Figure 4). Highest hydrophobicity of 86.79 ± 2.03 and 44.82 ±
0.63% against both n-hexadecane and xylene were recorded with LHI7
followed by LHI6, having 72.22 ± 0.28 and 42.85 ± 0.94% adhesion
against both the hydrocarbons. As depicted in Table 2, other isolates
showed moderate to low affinity against both the hydrocarbons. The
variations in hydrophobicity can be correlated with the earlier reports
[59-62]. This variable affinity of different isolates may be attributed to
their net negative surface charge. The hydrophobic potential varies
between different organisms, strains and is also influenced by age and
surface chemistry of strains along with the medium constituents [63].
Among several factors responsible for adhesion of bacterial cells to host
tissues, CSH plays a key role [64] and might also play an important
role in biofilm formation [63]. The significant hydrophobicity observed
with selected isolates could indicate their upper hand in establishing
firmly in GIT [65]. However, few studies contradict the correlation
usually established between hydrophobicity and adhesion. Schillinger
et al. (2005) [65] showed that L. acidophilus BFE 719, having poor
hydrophobicity of only 2%, showed good adhesion to HT29 cells. This
study suggests that the strains depicting low CSH values may have
higher adhesion capabilities under in vitro and in vivo.
Cell auto-aggregation
Sedimentation rate of all isolates was determined for a period

Figure 3: Response of LAB isolates to Simulated Stomach Duodenum Figure 4: Cell surface hydrophobicity of LAB isolates against n-Hexadecane (a)
Passage for different time intervals. and Xylene (b). Error bars represents ± SEM.

Isolate 0h 2h 3h Isolate 0h 2h 3h
LHI1 9.3 ± 0.60 8.14 ± 0.06 6 ± 0.29 LMI2 9 ± 0.33 8.59 ± 0.18 -
LHI2 10.2 ± 0.37 8.17 ± 0.16 6 ± 0.16 LMI3 8.5 ± 0.76 8.38 ± 0.11 -
LHI3 7.8 ± 0.52 6.41 ± 0.35 - LMI4 9 ± 0.66 8.54 ± 0.15 7.54 ± 0.22
LHI4 8.8 ± 0.26 8.23 ± 0.09 7.14 ± 0.09 LMI5 8.7 ± 0.29 8.34 ± 0.11 7.07 ± 0.17
LHI5 9 ± 0.57 8.3 ± 0.20 6.77 ± 0.22 LMI6 11 ± 0.57 8.65 ± 0.19 7.65 ± 0.28
LHI6 8.9 ± 0.31 8.74 ± 0.44 7.57 ± 0.16 LKI1 10 ± 0.57 8.41 ± 0.12 7.38 ± 0.41
LHI7 8.8 ± 0.23 8.54 ± 0.15 7.68 ± 0.19 LKI2 9 ± 0.55 8.67 ± 0.22 7.71 ± 0.27
LMI1 10 ± 0.33 8.54 ± 0.15 7.68 ± 0.20 LMI3 8.4 ± 0.78 8.23 ± 0.14 7.00 ± 0.26

Values are presented in triplicate ± SEM

Table 1: Response to SSDP (log cfu/ml).

J Food Process Technol

ISSN: 2157-7110 JFPT, an open access journal Volume 7 • Issue 1 • 1000545
Citation: Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek, et al. (2016) Screening of Lactic Acid Bacteria of Different Origin for their
Probiotic Potential. J Food Process Technol 7: 545. doi:10.4172/2157-7110.1000545

Page 5 of 9

Isolate n-Hexadecane Xylene Isolate n-Hexadecane Xylene Adhesion of Lactobacilli on Caco-2 cell lines
LHI1 51.61 ± 0.46 16.86 ± 0.63 LMI2 43.75 ± 1.28 38.48 ± 0.66
Adhesion of LAB isolates viz. LHI6, LHI7, LMI5 and LKI1; showing
LHI2 14.99 ± 0.36 13.88 ± 0.35 LMI3 19.32 ± 1.34 19.32 ± 0.59
promising CSH, were assessed for their adhesion potential over Caco-2
LHI3 11.88 ± 0.60 12.81 ± 0.77 LMI4 62.35 ± 2.14 29.67 ± 1.58 cells (Table 4 and Figure 6). Highest affinity for Caco-2 cells was with
LHI4 15.83 ± 0.37 21.23 ± 0.87 LMI5 69.35 ± 0.58 12.96 ± 0.75 LHI7, showing 68.7 ± 0.53% adhesion, followed by LHI6 with 65.4 ±
LHI5 31.09 ± 1.01 18.50 ± 1.59 LMI6 34.63 ± 1.78 17.18 ± 0.33 0.15%. Interestingly, the results were in accordance with CSH. LMI5
LHI6 72.22 ± 0.28 42.85 ± 0.94 LKI1 36.90 ± 2.16 17.88 ± 0.71 showed moderate adhesion of 30.2 ± 0.30%. Studies support varied
LHI7 86.79 ± 2.03 44.82 ± 0.63 LKI2 14.42 ± 1.77 13.79 ± 0.43 Caco-2 adhesion potential of Lactobacillus [69-71]. However, in
LMI1 18.75 ± 15.85 15.85 ± 1.77 LKI3 17.10 ± 1.01 12.26 ± 0.65 contrast to earlier reports, our study reported high adhesion around 30
-68%, in comparison to those in range of 3-15% [69-71]. Out of the four
Values are presented in triplicate, ± SEM
Table 2: Cell surface hydrophobicity (%).
strains screened, only LKI1 showed very low i.e. 12 ± 1.18% adhesion.
Schillinger and co-workers [65], reported that it is not mandatory
to have direct correlation between CSH and adhesion. Adhesion of
Isolate Aggregation Isolate Aggregation
lactobacilli to Caco-2 cells, representing intestine, increases their
LHI1 58.4 ± 0.92 LMI2 49.5 ± 2.68
possibility of adherence and survival in GIT. Also, this activity varies
LHI2 70.8 ± 1.79 LMI3 48 ± 0.75
from strain to strain that support our results [72]. Adhesion to the
LHI3 68.7 ± 0.49 LMI4 59 ± 0.87
gastrointestinal cells offers an additional advantage to cells, protecting
LHI4 73.0 ± 0.2 LMI5 67.7 ± 2.24
them from frequent removal by gut contractions and peristaltic flow
LHI5 57.8 ± 0.76 LMI6 56.1 ± 1.87 [71]. The present study documents adhesion of Lactobacillus strains to
LHI6 62.4 ± 0.81 LKI1 50 ± 2.09 in vitro cell line model. However, studies in animal models are required
LHI7 72.4 ± 1.04 LKI2 72 ± 0.45 to further support their candidature as probiotic.
LMI1 69.0 ± 1.70 LKI3 65.4 ± 0.61
Antimicrobial activity
Values are presented in triplicate, ± SEM
Table 3: Cell Auto-aggregation (%). Antagonistic activity exhibited by different lactobacilli isolates
was determined against enteric pathogens viz. Klebsiella sp., S.
typhimurium and E. coli ATCC. All the isolates tested were inhibitory
against the pathogens employed (Table 5). Among all, LHI4 and LHI7,
LMI5 and LKI2 showed highest zone of inhibition against all the tested
pathogens. Highest potency against tested pathogens was exhibited by
LHI4 and LHI7. This indicates that the Lactobacillus strains exhibited
inhibitory activity against enteric pathogens and may have similar
effect over other pathogens. Klebsiella sp. and S. typhimurium were
inhibited by all the test isolates at high or moderate level. However,
E. coli showed resistance against three isolates viz. LKI1, LKI2, LKI3.

Lactobacillus isolates Adhesion (%)

LHI7 68.7 ± 0.53
LHI6 65.4 ± 0.15
LMI5 30.2 ± 0.30
LKI1 12 ± 1.18

Figure 5: Cell Aggregation potential of LAB isolates. Error bars represents Values are presented in triplicate, ± SEM
± SEM. Table 4: Adhesion to Caco-2 cells (%).

of 2 h. The aggregation of the isolates ranged between 48-73%. Four

isolates viz. LHI4, LHI7, LKI2 and LHI2 exhibited auto-aggregation
over 70% with values of 73 ± 0.2, 72.4 ± 1.04, 72 ± 0.45 and 70.8 ±
1.79, respectively (Table 3 and Figure 5). Auto-aggregation potential
of cells plays an important role in adhesion to intestinal cells [58]
and prevention of pathogens colonization [66]. Auto-aggregation is
the ability of bacteria to interact themselves in a nonspecific way, a
prerequisite for colonization of the GIT [67]. As reported by del Re
et al. (2000) [67], probiotics should have auto-aggregation potential
over 40%. All the isolates evaluated showed affinity over 40% and have
moderate to high degree of aggregation, which can be correlated to earlier
findings [68]. Our results are in line with Kassaa et al. [61], who reported
auto-aggregation values 30-76% of different Lactobacillus strains. Among
other strains, showing good aggregation, LHI7, also showed highest affinity
to hydrocarbons. This confirms the ability of LHI7 to adhere, persist and Figure 6: Caco-2 cell adhesion of shortlisted LAB isolates. Error bars
divide in GIT, qualifying it as potential probiotic [61]. represents ± SEM.

J Food Process Technol

ISSN: 2157-7110 JFPT, an open access journal Volume 7 • Issue 1 • 1000545
Citation: Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek, et al. (2016) Screening of Lactic Acid Bacteria of Different Origin for their
Probiotic Potential. J Food Process Technol 7: 545. doi:10.4172/2157-7110.1000545

Page 6 of 9

Isolate Klebsiella sp. Salmonella E. coli Isolate Klebsiella sp. Salmonella E. coli
typhimurium typhimurium
LHI1, LHI2, LHI3, LMI5, LKI3 +++ +++ ++ LMI1 ++ +++ ++
LHI4, LHI7, LKI1, LKI2 +++ +++ +++ LMI3 +++ + +
LHI5 ++ +++ + LMI6 ++ ++ ++
LHI6, LMI2, LMI4 +++ ++ ++

Zone of inhibition (mm) > 10 mm = +++, > 5 mm = ++, < 5 mm = +

Table 5: Antimicrobial activity.

Isolate AK AM AMP CIP CET C CD E NV K OXT CXM Isolate Anti-oxidative Isolate Anti-oxidative
LHI1, LMI4 S S S I S S S S I R S S activity activity
LHI1 42.07 ± 0.83 LMI2 59.27 ± 0.65
LHI2 S S S I I S S S I R S S
LHI2 46.49 ± 0.95 LMI3 78.82 ± 0.98
LHI3 S I S I S S S S R R S S
LHI3 32.84 ± 0.82 LMI4 43.42 ± 0.42
LHI4 S S S S S S S S S R S S
LHI4 60.49 ± 0.76 LMI5 76.48 ± 0.71
LHI5 R S S R S S I S I R S S
LHI5 36.04 ± 0.34 LMI6 72.83 ± 0.82
LHI6, LHI7, S S S S S S S S S S S S
LKI3 LHI6 85.79 ± 0.76 LKI1 54.37 ± 0.68
LMI1 S S S R S S S S S I S I LHI7 39.61 ± 0.61 LKI2 43.42 ± 0.50
LMI2 S S S I S S S S R I S S LMI1 43.42 ± 0.64 LKI3 47.23 ± 0.59
LMI3 S S S I S S S S R R S S
Values are presented in triplicate, ± SEM
LMI5 S S I I S S S S I R S S Table 7: Anti-oxidative potential (%).
LMI6 S S S S S I S S S I S I
LKI1 R S S I S S S S I S S S
LKI2 S S S I S S S S I S S S regions [2,61,83,84]. It is a matter of debate, whether probiotics, having
GRAS status should be resistant or sensitive against commonly used
R-Resistant, I-Intermediate sensitive, S-Sensitive
antimicrobials. As hypothesized by Cebeci and Gurakan [86]; and
Table 6: Antibiotic susceptibility.
Kim and Austin [87], resistance to specific antimicrobials, enhances
application of probiotics, as these can be administered along with
Based on these preliminary findings, majority of test strains possess antibiotic therapy, secondly, these help to recover the gastrointestinal
antimicrobial activity and may be utilized for applications in food and microflora quickly. On the contrary, these safe strains showing
dairy products. Our results can be justified with earlier [73-76] and antimicrobial resistance possess risk of transferring resistance to
recent studies [77-79] reporting antimicrobial activity of probiotic pathogens, making them resistant to antibiotic therapy. In this regard,
Lactobacillus sp. Although different isolates has not been identified further safety parameters are to be studied, before making these eligible
at species and strain level, but our results can be substantiated with for human consumption or product development. Strains exhibiting
reports describing antimicrobial activity as common parameter for natural resistance to antibiotics are not considered as a risk to animal
most LAB that may be attributed to production of organic acids, or human health [61]. However, the probiotics must be safe for human
antimicrobial peptides and bacteriocins [79,80]. Studies are required to consumption and should not possess transmissible antibiotic resistance
elucidate the actual antimicrobial component of LAB metabolism. The determinants.
difference in activity may be attributed to the varied metabolic profile
Antioxidative potential
of different Lactobacillus isolates [81] and also to the distinct response
of test pathogen against different antimicrobial components. Many lactobacilli possess antioxidant activities that are able to
decrease the risk of accumulation of reactive oxygen species during
Antibiotic susceptibility cellular metabolism in body. LAB isolates were studied for their
All the isolates were tested for their susceptibility to 12 commonly antioxidative potential following ABTS assay. Against ABTS radical
administered antimicrobial agents, against whom variable responses cation, the inhibition ranged from 32.84-85.79% (Table 7). Highest
were observed. It is evident that all the isolates were uniformly sensitive inhibitions of 85.79 and 78.82% were recorded with LHI6 and
to AK, AM, AMP, C, CD, E, OXT and CXM. However, against other LMI3, respectively, and the least 32.84% with LHI3 (Figure 7). These
antimicrobials; sensitive, intermediate and resistant profiles were differences could be due to different proteolytic activity of individual
observed (Table 6). In contrast to results showing resistance of few cultures, which results in release of antioxidative peptides [88,89].
strains (LHI3, LMI3) towards novobiocin and kanamycin. Anandharaj Several studies have reported antioxidative potential of live, heat killed
and Sivasankari [2], reported that all the isolates were sensitive and cell free extracts of LABs [90]. This property may be attributed to
to both the antibiotics. Zhou et al. [82] also reported high level of enzymatic processes such as coupled NADH oxidase/peroxidase and
kanamycin resistance in Lactobacillus isolates. These report supports catalase [91,92]. Keeping in view, high antioxidative potential, these
that antimicrobial susceptibility or resistance is highly variable at isolates can be considered as health promoting probiotics.
strain level, and it is important to screen isolates for their susceptibility
Bile salt hydrolase assay
profile. Among all isolates, LHI14, LHI16, LHI17 and LKI2 were
sensitive to all the 12 antimicrobials. Only LHI5 showed multiple BSH activity is important for bacteria to grow in and colonize in
drug resistance against AK, CIP and KN. Our results are supported the intestine [93] by deconjugating bile salts, which are readily excreted
with several such reports mentioning variable antibiotic susceptibility in GIT. The relevant physiological concentrations of human bile
profiles of different isolates from different host [83] and geographical range from 0.3 to 0.5% [58]. All the isolates precipitated TC (sodium

J Food Process Technol

ISSN: 2157-7110 JFPT, an open access journal Volume 7 • Issue 1 • 1000545
Citation: Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek, et al. (2016) Screening of Lactic Acid Bacteria of Different Origin for their
Probiotic Potential. J Food Process Technol 7: 545. doi:10.4172/2157-7110.1000545
taurocholate) and TDC (sodium taurodeoxycholate) to a great extent
(Table 8) but none of the isolates either not precipitated TGC or at a
slighter extent. It can be inferred from results that LHI3, LHI6, LHI7,
LMI3, LMI5 and LKI1 not only tolerated the toxicity of these salts but
also carryout BSH mediated deconjugation of TC and TDC, which
helps their colonization in intestine. Growth of our isolates in presence
of high bile salts in medium suggested that these produced BSH activity
specific to TC, TGC (sodium tauroglycocholate) and TDC hydrolysis.
The inhibition of common intestinal bacteria has been related to the
presence of free (deconjugated) bile acids rather than conjugated ones
[94]. McAuliffe et al. [95] had identified genes responsible for BSH
activity in L. acidophilus NCFM, which further support BSH activity
in our cultures. Tanaka et al. [96] accounted that certain strains of a
species do not possess deconjugation activity, while others show that
bacteria without this enzyme can either survive in this environment or
survive the passage through it.
Conclusion
Our preliminary findings highlights that Lactobacillus isolates,
viz. LHI7, LHI6, LMI5 and LKI2 fulfils the primary requirements of
a probiotic and may be a reliable candidate for further validation in
vitro and animal models. However, studies are required to characterize
them at molecular level, their safety assessment before exploring for
any functional product development.
Acknowledgement
Authors would like to acknowledge the funding from Department of
Biotechnology, Govt. of India to Dr. Monica Puniya, in frame of BioCARe Women
Scientist Award. We also greatly thanks Director, ICAR-NDRI for providing
necessary infrastructure facilities for the execution of this project and Vice-
Chancellor, GADVASU, Ludhiana for providing permission for further work.
Figure 7: Anti-oxidative activity of LAB isolates assessed through ABTS assay.
Error bars represents ± SEM.
Isolate DC TC
LHI1, LHI2, LMI1 ++ +++
LHI3 , LKI1 ++ +++
LHI4, LMI2 +++ ++
LHI5, LMI6 ++ + +
LHI6 +++ +++
+++ Intense ppt; ++ Moderate ppt; +Slight ppt; - No ppt
Table 8: Bile salt hydrolase activity.
J Food Process Technol
ISSN: 2157-7110 JFPT, an open access journal
Page 7 of 9
References
1. MacFaddin JF (2000) Biochemical Tests for Identification of Medical Bacteria.
Lippincott Williams and Wilkins, USA.
2. Anandharaj M, Sivasankari B (2014) Isolation of potential probiotic Lactobacillus
oris HMI68 from mother's milk with cholesterol-reducing property. J Biosci
Bioeng 118: 153-159.
3. FAO (2001) Evaluation of Health and Nutritional Properties of Powder Milk and
Live Lactic Acid Bacteria. Food and Agriculture Organization and World Health
Organization Expert Consultation, Cordoba, Argentina.
4. Binns N (2013) Probiotics, prebiotics and the gut microbiota. International Life
Sciences Institutes Europe Concise Monograph Series.
5. Staudacher H (2015) Probiotics for lactose intolerance and irritable bowel
syndrome. Br J Community Nurs Suppl Nutrition.
6. Silanikove N, Leitner G, Merin U (2015) The Interrelationships between Lactose
Intolerance and the Modern Dairy Industry: Global Perspectives in Evolutional
and Historical Backgrounds. Nutrients 7: 7312-7331.
7. Saez-Lara MJ, Gomez-Llorente C, Plaza-Diaz J, Gil A (2015) The Role
of Probiotic Lactic Acid Bacteria and Bifidobacteria in the Prevention and
Treatment of Inflammatory Bowel Disease and Other Related Diseases: A
Systematic Review of Randomized Human Clinical Trials. BioMed Research
International.
8. Bokhorst VV, Van H, Bron PA, Kleerebezem M (2015) Improving the digestive
tract robustness of probiotic Lactobacilli. Probiotics and Prebiotics: Current
Research and Future Trends. Caister Academic Press, Norfolk, UK.
9. Hirayama K, Rafter J (2000) The role of probiotic bacteria in cancer prevention.
Microbes Infect 2: 681-686.
10. Kumar M, Nagpal R, Kumar R, Hemalatha R, Verma V, et al. (2012).
Cholesterol-lowering probiotics as potential biotherapeutics for metabolic
diseases. Experimental Diabetes Research.
11. Aazmi S, The LK, Ramasamy K, Rahman T, Salleh MZ, et al. (2015)
Comparison of the anti-obesity and hypocholesterolaemic effects of single
Lactobacillus casei strain Shirota and probiotic cocktail. International Journal of
Food Science and Technology 50: 1589-1597
12. Cheng MC, Tsai TY, Pan TM (2015) Anti-obesity activity of the water extract
of Lactobacillus paracasei subsp. paracasei NTU 101 fermented soy milk
products. Food Funct 6: 3522-3530.
13. Panwar H, Rashmi HM, Batish VK, Grover S (2013) Probiotics as potential
biotherapeutics in the management of type 2 diabetes-prospects and
perspectives. Diabetes Metab Res Rev 29: 103-112.
14. Lee NK, Kim SY, Han KJ, Eom SJ, Paik HD (2014) Probiotic potential of
Lactobacillus strains with anti-allergic effects from kimchi for yogurt starters.
LWT - Food Science and Technology 58: 130-134
15. Gomez-Guzman M, Toral M, Romero M, Jimenez R, Galindo P, et. al. (2015)
Antihypertensive effects of probiotics Lactobacillus strains in spontaneously
hypertensive rats. Molecular Nutrition & Food Research.
16. Lorea Baroja M, Kirjavainen PV, Hekmat S, Reid G (2007) Anti-inflammatory
effects of probiotic yogurt in inflammatory bowel disease patients. Clinical and
Experimental Immunology 149: 470-479.
17. Panwar H, Calderwood D, Grant IR, Grover S, Green BD, et al. (2014)
Lactobacillus strains isolated from infant faeces possess potent inhibitory
activity against intestinal alpha-and beta-glucosidases suggesting anti-diabetic
potential. European Journal of Nutrition 53: 1465-1474
TGC Isolate DC TC TGC
- LHI7, LMI3 ++ +++ ++
+ LMI4 ++ ++ -
- LMI5 +++ ++ ++
LKI2 + +++ -
++ LKI3 ++ + -
Volume 7 • Issue 1 • 1000545
Citation: Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek, et al. (2016) Screening of Lactic Acid Bacteria of Different Origin for their
Probiotic Potential. J Food Process Technol 7: 545. doi:10.4172/2157-7110.1000545
18. Panwar H, Calderwood D, Grant IR, Grover S, Green BD, et al. (2015)
Lactobacilli possess inhibitory activity against dipeptidyl peptidase-4 (DPP-4).
Annals of Microbiology.
19. Steenbergen L, Sellaro R, Hemert S, Bosch JA, Colzato LS, et al. (2015)
A randomized controlled trial to test the effect of multispecies probiotics on
cognitive reactivity to sad mood. Brain Behav Immun 48: 258-264.
20. Dhewa T, Bajpai V, Saxena RK, Pant S, Mishra V, et al. (2010) Selection
of Lactobacillus strains as potential probiotics on basis of in vitro attributes.
International Journal of Probiotics and Prebiotics 5: 45-52.
21. Sanders ME, Klaenhammer TR (2001) Invited review: the scientific basis of
Lactobacillus acidophilus NCFM functionality as a probiotic. J Dairy Sci 84:
319-331.
22. Kapila R, Kapila S, Kapasiya M, Pandey D, Dang A, et al. (2012) Comparative
evaluation of oral administration of probiotic lactobacilli fermented milks on
macrophage function. Probiotics and antimicrobial proteins 4: 73-179.
23. Yakabe T, Moore EL, Yokota S, Sui H, Nobuta Y, et al. (2009) Safety
assessment of Lactobacillus brevis KB290 as a probiotic strain. Food Chem
Toxicol 47: 2450-2453.
24. Srinivasan R, Meyer R, Padmanabhan R, Britto J (2006) Clinical safety of
Lactobacillus casei shirota as a probiotic in critically ill children. J Pediatr
Gastroenterol Nutr 42: 171-173.
25. Archer AC, Halami PM (2015) Probiotic attributes of Lactobacillus fermentum
isolated from human feces and dairy products. Appl Microbiol Biotechnol 99:
8113-8123.
26. Selle K, Klaenhammer TR (2013) Genomic and phenotypic evidence for
probiotic influences of Lactobacillus gasseri on human health. FEMS Microbiol
Rev 37: 915-935.
27. Huang R, Tao X, Wan C, Li S, Xu H, et al. (2015) In vitro probiotic characteristics
of Lactobacillus plantarum ZDY 2013 and its modulatory effect on gut microbiota
of mice. J Dairy Sci 98: 5850-5861.
28. Pithva S, Shekh S, Dave J, Vyas BR (2014) Probiotic attributes of autochthonous
Lactobacillus rhamnosus strains of human origin. Applied Biochemistry
Biotechnology 173: 259-277.
29. Ramos CL, Thorsen L, Schwan RF, Jespersen L (2013) Strain-specific probiotics
of Lactobacillus fermentum, Lactobacillus plantarum and Lactobacillus brevis
isolates from Brazilian food products. Food Microbiology 36: 22-29.
30. Lin MY, Chang FJ (2000) Antioxidative effect of intestinal bacteria
Bifidobacterium longum ATCC 15708 and Lactobacillus acidophilus ATCC
4356. Dig Dis Sci 45: 1617-1622.
31. Gueimonde M, Salminen S (2006) New methods for selecting and evaluating
probiotics. Dig Liver Dis 38 Suppl 2: 242-247.
32. Suvarna VC, Boby VU (2005) Probiotics in human health: A current assessment.
Current Science 88: 1744-1748.
33. Doyle RJ, Rosenberg M (1990) Microbiol cell surface hydrophobicity. American
Society for Microbiology, Washington DC, USA.
34. Kirjavainen PV, Ouwehand AC, Isolauri E, Salminen SJ (1998) The ability of
probiotic bacteria to bind to human intestinal mucus. FEMS Microbiol Lett 167:
185-189.
35. Lee YK, Salminen S (1995) The coming of age of probiotics. Trends in Food
Science & Technology 6: 241-245.
36. Kechagia M, Basoulis D, Konstantopoulou S, Dimitriadi D, Gyftopoulou K, et al.
(2013) Health benefits of probiotics: a review. ISRN Nutr.
37. Shah NP (2000) Probiotic bacteria: selective enumeration and survival in dairy
foods. J Dairy Sci 83: 894-907.
38. Ranadheera CS, Evans CA, Adams MC, Baines SK (2012) In vitro analysis of
gastrointestinal tolerance and intestinal cell ashesion of probiotics in goat’s milk
ice cream and yogurt. Food Research International 49: 619-625.
39. Mombelli B, Gismondo MR (2000) The use of probiotics in medical practice. Int
J Antimicrob Agents 16: 531-536.
40. Jose NM, Bunt CR, Hussain MA (2015) Implications of antibiotic resistance in
probiotics. Food Reviews International 31: 52-62.
41. Pospiech A, Neumann B (1995) A versatile quick-prep of genomic DNA from
gram-positive bacteria. Trends Genet 11: 217-218.
J Food Process Technol
ISSN: 2157-7110 JFPT, an open access journal
Page 8 of 9
42. Dubernet S, Desmasures N, Guéguen M (2002) A PCR-based method for
identification of lactobacilli at the genus level. FEMS Microbiol Lett 214: 271-
275.
43. Sambrook J, Russel DW (2001) Molecular Cloning. Cold spring Harbor
Laboratory Press, Cold Spring Laboratory Press, NY, USA.
44. Mathara JM, Schillinger U, Guigas C, Franz C, Kutima PM, et al. (2008)
Functional characteristics of Lactobacillus spp. from traditional Maasai
fermented milk products in Kenya. Int J Food Microbiol 126: 57-64.
45. Rosenberg M (2006) Microbial adhesion to hydrocarbons: twenty-five years of
doing MATH. FEMS Microbiol Lett 262: 129-134.
46. Tomas JS, Ocan, VS, Wiese B, Nader-Macias ME (2003a) Growth and lactic
acid production by vaginal Lactobacillus acidophilus CRL1259, and inhibition
of uropathogenic Escherichia coli. Journal of Medical Microbiology 52: 1117-
1124.
47. Jacobsen CN, Nielsen VR, Hayford AE (1999) Screening of probiotic activities
of forty-seven strains of Lactobacillus spp by in vitro techniques and evaluation
of the colonization ability of five selected strains in humans. Applied and
Environmental Microbiology 65: 4949 4956.
48. Schillinger U, Guigas C, Heinrich HW (2005) In vitro adherence and other
properties of lactobacilli used in probiotic yoghurt-like products. International
Dairy Journal 15: 1289-1297.
49. CLSI (2007) Performance Standards for antimicrobial Disk Susceptibility tests.
50. Re R, Pellegrini N, Proteggente A, Pannala A, Yang M, et al. (1999) Antioxidant
activity applying an improved ABTS radical cation decolorization assay. Free
Radic Biol Med 26: 1231-1237.
51. Singh TP, Kaur G, Malik RK, Schillinger U, Guias C, et al. (2012) Characterization
of Intestinal Lactobacillus reuteri Strains as Potential Pr.
52. Kociubinski G, Pérez P, De Antoni G (1999) Screening of bile resistance and
bile precipitation in lactic acid bacteria and bifidobacteria. J Food Prot 62: 905-
912.
53. Zarate G, Perez A, Gonzalez S, Oliver G (2000) Viability and bgalactosidase
activity Of dairy propionibacteria subjected to digestion by artificial gastric and
intestinal fluids. Journal of Food Protection 63: 1214-1221.
54. Fernández MF, Boris S, Barbés C (2003) Probiotic properties of human
lactobacilli strains to be used in the gastrointestinal tract. J Appl Microbiol 94:
449-455.
55. Pisano B, Patrignani F, Cosentino S, Guerzoni EM, Franz C, et al. (2011)
Diversity and functional properties of Lactobacillus plantarum-group strains
isolated from Italian cheese products. Dairy science & technology 91: 65-76.
56. Jose NM, Bunt CR, Hussain MA (2015) Comparison of Microbiological and
Probiotic Characteristics of Lactobacilli Isolates from Dairy Food Products and
Animal Rumen Contents Microorganisms 3: 198-212.
57. Bezkorovainy A (2001) Probiotics: determinants of survival and growth in the
gut. Am J Clin Nutr 73: 399-405.
58. Dunne C, O'Mahony L, Murphy L, Thornton G, Morrissey D, et al. (2001) In vitro
selection criteria for probiotic bacteria of human origin: correlation with in vivo
findings. Am J Clin Nutr 73: 386-392.
59. Gupta A, Tiwari SK (2014) Probiotic Potential of Lactobacillus plantarum LD1
Isolated from Batter of Dosa, a South Indian Fermented Food. Probiotics
Antimicrob Proteins 6: 73-81.
60. Valeriano VD, Parungao-Balolong MM, Kang DK (2014) In vitro evaluation of
the mucin-adhesion ability and probiotic potential of Lactobacillus mucosae
LM1. J Appl Microbiol 117: 485-497.
61. Kassaa IA, HAmze M, Hober D, Chihib NE, Drider D, et al. (2014) Identification
of vaginal lactobacilli with potential probiotic properties isolated from women in
north Lebanon. Microbial Ecology 67: 722-734.
62. Zhang J, Zhang X, Zhang L, Zhao Y, Niu C, et al. (2014) Potential probiotic
characterization of Lactobacillus plantarum strains isolated from Inner Mongolia
"Hurood" cheese. J Microbiol Biotechnol 24: 225-235.
63. García-Cayuela T, Korany AM, Bustos I, Gómez de Cadiñanos LP, Requena T,
et al. (2014) Adhesion abilities of dairy Lactobacillus Applied plantarum strains
showing an aggregation phenotype. Food Research International 57: 44-50.
64. Loosdrecht MC, Lyklema J, Norde W, Schraa G, Zehnder AJ, et al. (1987) The
Volume 7 • Issue 1 • 1000545
Citation: Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek, et al. (2016) Screening of Lactic Acid Bacteria of Different Origin for their
Probiotic Potential. J Food Process Technol 7: 545. doi:10.4172/2157-7110.1000545
role of bacterial cell wall hydrophobicity in adhesion. Appl Environ Microbiol
53: 1893-1897.
65. Greco M, Mazzette R, De Santis EP, Corona A, Cosseddu AM, et al. (2005)
Evolution and identification of lactic acid bacteria isolated during the ripening of
Sardinian sausages. Meat Sci 69: 733-739.
66. Boris S, Suárez JE, Vázquez F, Barbés C (1998) Adherence of human vaginal
lactobacilli to vaginal epithelial cells and interaction with uropathogens. Infect
Immun 66: 1985-1989.
67. Del Re B, Sgorbati B, Miglioli M, Palenzona D (2000) Adhesion, autoaggregation
and hydrophobicity of 13 strains of Bifidobacterium longum. Lett Appl Microbiol
31: 438-442.
68. Pithva S, Shekh S, Dave J, Vyas BR (2014) Probiotic attributes of autochthonous
Lactobacillus rhamnosus strains of human origin. Appl Biochem Biotechnol
173: 259-277.
69. Lehto EM, Salminen SJ (1997) Inhibition of Salmonella typhimurium adhesion
to Caco-2 cell cultures by Lactobacillus strain GG spent culture supernate: only
a pH effect? FEMS Immunol Med Microbiol 18: 125-132.
70. Tuomola EM, Salminen SJ (1998) Adhesion of some probiotic and dairy
Lactobacillus strains to Caco-2 cell cultures. Int J Food Microbiol 41: 45-51.
71. Peres CM, Alves M, Hernandez-Mendoza A, Moreira L, Silva S, (2014) Novel
isolates of lactobacilli from fermented Portuguese olive as potential probiotics.
LWT - Food Science and Technology.
72. Darilmaz DO, Aslim B, Suludere Z, Akca G (2011) Influence of gastrointestinal
system conditions on adhesion of exopolysaccharide-producing Lactobacillus
delbrueckii subsp. bulgaricus strains to caco-2 cells. Brazilian Archives of
Biology and Technology.
73. Musikasang H, Tani A, H-kittikun A, Maneerat S (2009) Probiotic potential of
lactic acid bacteria isolated from chicken gastrointestinal digestive tract. World
Journal of Microbiology and Biotechnolog 25: 1337-1345
74. Dhewa T (2008) Studies on probiotic attributes of indigenous and exogenous
lactobacilli for development of a synbiotic formulation. Bundelkhand University,
Jhansi, India.
75. Fooks LJ, Gibson GR (2002) In vitro investigations of the effect of probiotics
and prebiotics on selected human intestinal pathogens. FEMS Microbiol Ecol
39: 67-75.
76. Asli A, Oktay Y, Sevda K (2011) Antimicrobial activity and antibiotic resistance
of Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus thermophilus
strains isolated from Turkish homemade yoghurts. African Journal of
Microbiology Research 5: 675-682.
77. Oliveira DA, Salvador AA, Smânia A, Smânia EF, Maraschin M, et al. (2013)
Antimicrobial activity and composition profile of grape (Vitis vinifera) pomace
extracts obtained by supercritical fluids. J Biotechnol 164: 423-432.
78. Njoki WJ, Boga HI, Kutima PM, Maina MJ, Kadira TT, et al. (2015) Probiotic
potential of lactic acid bacteria isolated from coconut (Cocos nucifera) Wine
(Mnazi) in Kenya. International Journal of Life Sciences Research 3: 113-120.
79. Rolim JP, Melo MA, Guedes SF, Albuquerque-Filho FB, de Souza JR, et. al.
(2007) The antimicrobial activity of photodynamic therapy against Streptococcus
mutans using different photosensitizers. Journal of Photochemistry and
Photobiology B 106: 40-46
80. Chen J, Cai W, Feng Y (2007) Development of intestinal bifidobacteria and
lactobacilli in breast-fed neonates. Clin Nutr 26: 559-566.
81. Douillard FP, Kant R, Ritari J, Paulin L, Palva A, et al. (2013) Comparative
genome analysis of Lactobacillus casei strains isolated from Actimel and
Yakult products reveals marked similarities and points to a common origin.
Microbiology and Biotechnology 6: 576-587.
Citation: Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek, et al.
(2016) Screening of Lactic Acid Bacteria of Different Origin for their Probiotic
Potential. J Food Process Technol 7: 545. doi:10.4172/2157-7110.1000545
J Food Process Technol
ISSN: 2157-7110 JFPT, an open access journal
Page 9 of 9
82. Zhou JS, Pillidge CJ, Gopal PK, Gill HS (2005) Antibiotic susceptibility profiles
of new probiotic Lactobacillus and Bifidobacterium strains. Int J Food Microbiol
98: 211-217.
83. Bujnakova D, Strakova E, Kmet V (2014) In vitro evaluation of the safety and
probiotic properties of Lactobacilli isolated from chicken and calves. Anaerobe
29: 118-127.
84. Allameh SK, Daud H, Yusoff FM, Saad CR, Ideris A, et al. (2012) Isolation,
identification and characterization of Leuconostoc mesenteroides as a new
probiotic from intestine of snakehead fish (Channastriatus). African Journal of
Biotechnology 11: 3810-3816.
85. Guidone A, Zotta T, Ross RP, Stanton C, Rea MC, et. al. (2014) Functional
properties of Lactobacillus plantarum strains: A multivariate screening study.
LWT - Food Science and Technology.
86. Cebeci A, Gurakan C (2003) Properties of potensial probiotic Lactobacillus
plantarumstrains. Food Microbiology 20: 511-518.
87. Kim DH, Austin B (2008) Characterization of probiotic carnobacteria isolated
from rainbow trout (Oncorhynchus mykiss) intestine. Lett Appl Microbiol 47:
141-147.
88. Virtanen T, Pihlanto A, Akkanen S, Korhonen H (2007) Development of
antioxidant activity in milk whey during fermentation with lactic acid bacteria. J
Appl Microbiol 102: 106-115.
89. Saide JA, Gilliland SE (2005) Antioxidative activity of lactobacilli measured by
oxygen radical absorbance capacity. J Dairy Sci 88: 1352-1357.
90. Lin WH, Hwang CF, Chen LW, Tsen HY (2006) Viable counts, characteristic
evaluation for commercial lactic acid bacteria products. Food Microbiol 23: 74-81.
91. Bruno-Bárcena JM, Andrus JM, Libby SL, Klaenhammer TR, Hassan HM, et al.
(2004) Expression of a heterologous manganese superoxide dismutase gene
in intestinal lactobacilli provides protection against hydrogen peroxide toxicity.
Appl Environ Microbiol 70: 4702-4710.
92. Lee J, Hwang KT, Heo MS, Lee JH, Park KY, et al. (2005) Resistance of
Lactobacillus plantarum KCTC 3099 from Kimchi to oxidative stress. J Med
Food 8: 299-304.
93. Moser SA, Savage DC (2001) Bile salt hydrolase activity and resistance to
toxicity of conjugated bile salts are unrelated properties in lactobacilli. Appl
Environ Microbiol 67: 3476-3480.
94. Grill JP, Perrin S, Schneider F (2000) Bile salt toxicity to some bifidobacteria
strains: role of conjugated bile salt hydrolase and pH. Can J Microbiol 46: 878-884.
95. McAuliffe O, Cano RJ, Klaenhammer TR (2005) Genetic analysis of two bile
salt hydrolase activities in Lactobacillus acidophilus NCFM. Appl Environ
Microbiol 71: 4925-4929.
96. Tanaka Y, Mochizuki K, Fukaya N, Shimada M, Goda T, et al. (2009) The
a-glucosidase inhibitor miglitol suppresses postprandial hyperglycaemia and
interleukin-1ß and tumour necrosis factor- a gene expression in rat peripheral
leucocytes induced by intermittent sucrose loading. British Journal of Nutrition
102: 221-225.
OMICS International: Open Access Publication Benefits &
Features
Unique features:
• Increased global visibility of articles through worldwide distribution and indexing
• Showcasing recent research output in a timely and updated manner
• Special issues on the current trends of scientific research
Special features:
• 700 Open Access Journals
• 50,000 editorial team
• Rapid peer review process
• Quality and quick editorial, review and publication processing
• Indexing at PubMed (partial), Scopus, EBSCO, Index Copernicus and Google Scholar etc
• Sharing Option: Social Networking Enabled for better prominence and citations
• Authors, Reviewers and Editors rewarded with online Scientific Credits
• Best discounts for your subsequent articles
Submit your manuscript at: http://www.omicsgroup.org/journals/submission
Volume 7 • Issue 1 • 1000545