AIDS RESEARCH AND HUMAN RETROVIRUSES

Volume 19, Number 7, 2003, pp. 597–607

© Mary Ann Liebert, Inc.

Expression and Functional Activity of Isotype and Subclass

Switched Human Monoclonal Antibody Reactive with
the Base of the V3 Loop of HIV-1 gp120

FANGBING LIU, PABLO LOPEZ BERGAMI, MARK DUVAL, DAVID KUHRT,

MARSHALL POSNER, and LISA CAVACINI

ABSTRACT

Immunoglobulins undergo isotype switching in response to antigenic stimulation. The CH domains, in par-
ticular the hinge region, impose structural constraints on the interaction of antibody with antigen, especially
multivalent antigens such as HIV. We previously showed that switching the IgG1 anti-HIV human monoclo-
nal antibody (HMAb) F105 to an IgG3 resulted in significantly enhanced neutralization of HIV. To further
investigate the influence of isotype, including the functional activity of HMAbs switched to IgA, which may
be important in mucosal defenses, isotype switched antibodies have been generated for the anti-V3 loop base
IgG2 HMAb F425B4e8. Reactivity of the IgG1 antibody was greater than the parental IgG2 antibody for SF2
infected cells but less for primary isolate virions. In contrast, there was less reactivity of the IgG3 with either
infected cells or virions. IgA reacted significantly more with infected cells and virions as compared to the IgG
subclasses. In contrast to previous studies whereby IgG3 enhanced neutralization, comparable neutralization
of primary isolate virus was observed for IgG subclasses (IgG1, IgG2, IgG3) and IgA. This may reflect dif-
ferences in the exposure of epitopes recognized by the HMAb with antibody flexibility being important to neu-
tralization by antibodies reactive with obscured epitopes (e.g., CD4 binding site). Further analysis of the in
vitro activity of isotype or subclass switched antibodies, IgA in particular, alone and in combination with other
HMAbs, will provide important information on the role of IgG subclass and IgA antibodies on protective im-
munity to HIV.

INTRODUCTION generally induced: IgM, IgG, and IgA. IgM, a pentameric im-
munoglobulin, appears first in a typical immune response, and

I NFECTION OF TARGET CELLS by HIV involves sequential in-

teraction of cell receptors (CD4 and co-receptors), and HIV
envelope (env).1 Neutralizing and/or broad cross-reactive anti-
bodies which specifically recognize and bind to env may block
the interaction with target cells or the conformational changes
of the env glycoproteins and neutralize virus.2 There are five
classes of immunoglobulins (Ig), IgA, IgD, IgE, IgG and IgM,
each with its own class of heavy chains—a, d, e, g, and m, re-
spectively. Human IgG can be further divided into subclasses
IgG1, IgG2, IgG3, and IgG4. IgA class has IgA1 and IgA2 sub-
classes. The heavy chains impart a distinctive conformation to
the hinge and tail regions of antibodies, and give each class and
subclass characteristic properties of its own.
In the humoral immune response to HIV, three classes are
is generally of low affinity. In contrast to monomeric serum
IgA, secretory dimeric IgA is the predominant isotype found in
mucosal tissue and is believed to be involved in the inhibition
of bacterial attachment and neutralization of viruses at these
sites.3,4 IgG is the major class of immunoglobulin in the blood,
and is produced in large quantities during secondary immune
response.5 Subclass IgG1 is dominantly produced, while IgG2,
IgG3, and IgG4, are less or rarely produced in response to HIV
infection. Besides activating the complement system, the heavy
chain constant region or Fc region of an IgG molecule binds to
specific receptors on macrophages and neutrophils.6 Phagocytic
cells and lymphocytes expressing Fc receptors (FcR) ingest or
bind and destroy antibody-coated microorganisms. Differences
in valence and Fc domain composition are reflected in antigen

Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215.

597
598 LIU ET AL.

binding avidity, complement activity, and interaction with FcR
expressing cells.7 For instance, Rituximab, a monoclonal anti-
body with human IgG1 constant domains mediates ADCC ac-
tivity but not so with an IgG2 constant domain.8 Recently, us-
ing IgG subclasses enriched from pooled human HIV immune
globulin (HIVIG),9 it was shown that all of the IgG subclasses
bound to HIV-1 antigens by ELISA with IgG1 binding better
than IgG3 which was essentially equivalent to IgG2. In con-
trast, IgG3 neutralized better than IgG1 and IgG2. These results
suggest that the IgG3 hinge region enables enhanced HIV neu-
tralization. We have shown that switching the IgG1 HMAb
F105 to an IgG3 resulted in significantly enhanced neutraliza-
tion of T cell line adapted (TCLA) HIV-1 without obvious
changes in binding characteristics.10 These findings suggested
that structural differences of the constant regions (Fc domain
and hinge) of the different classes and isotypes of antibodies
influence the interactions of the variable regions with target
antigens. In order to investigate the functional effects and mech-
anisms of antibody isotype and class on human antibody dif-
ferences in binding and neutralization of HIV-1, we sought to
develop a method to class- and isotype-switch a panel of neu-
tralizing and non-neutralizing human monoclonal antibodies re-
active with a number of epitopes on the HIV-1 envelope glyco-
proteins. We report here on the subclass (IgG1 and IgG3) and
isotype (IgA) switch of the IgG2 anti-V3 loop base HMAb,
F425B4e8.11
MATERIALS AND METHODS
Molecular cloning and sequencing of F425B4e8
Total mRNA was isolated and prepared from the hybridoma
HMMA cells secreting human monoclonal antibody F425B4e8
(IgG2, kappa) using Fast Track mRNA kit (Invitrogen) ac-
cording to the manufacturer’s suggestions. cDNA was synthe-
sized from the mRNA, and the heavy and light chain variable
regions amplified using a combination of primers based on V-
region gene family consensus sequences as previously de-
scribed.12 PCR amplified product was gel-purified and cloned
into pCR Blunt vector (Invitrogen) 0 for sequencing. Alignment
and comparison of the HMAb F425B4e8 variable regions with
germline genes were done with DNAPLOT software at IMGT,
the International ImMunoGeneTics. Germline homology was
verified using the Gene bank database. The VDJ rearrangements
were assessed with the JunctionAnalysis tool at IMGT. 13 The
DNA sequences of F425B4e8 have been deposited in GenBank
(VL, AY056841; and VH , AY056842).
Cloning the variable regions into immunoglobulin
expression vectors
VH and VL were PCR amplified respectively from pCR-
Blunt using the specific primers introducing restriction enzymes
as shown in Table 1. The VH and VL DNA were cloned into
the pNg1.16 (Asp718 and XhoI sites) and pGk.11 (XhoI and
NruI sites) vectors, respectively. Plasmids pNg1.16 and pGk.11
were provided by Linda Harris.14 The resulting complete ex-
pression vectors containing VH gene of F425B4e8 were desig-
nated pHMG1 (IgG1), and the plasmid containing VL of
F425B4e8 were named pHMK. After cloning into expression
vectors, the sequence of the variable regions of F425B4e8 were
verified by dideoxy sequencing.
Transfection of myeloma cells for expression
of the isotype-switched antibodies
Human and murine myeloma cells, HMMA15 and X653,16
respectively, were grown in RPMI 1640 containing 10% FBS.
Log phase cells (106) were transfected with 4 mg of endotoxin-
free plasmid containing the heavy chain which was mixed with
the light chain plasmid using GenePORTER2 (GTS, Inc.) ac-
cording to the manufacturer’s instructions. G418 (400 mg/mL)
was added 14–16 h after transfection and cells were distributed
into a 96-well plate for selection of stable growth clones. The
cultures were fed weekly with growth media containing G418.
G418 resistant clones were ready for screening after 3 or 4
weeks. Antibody producing clones were identified by heavy
chain–specific ELISA. Briefly, plates were coated with goat
anti-human IgG or goat anti-human IgA and blocked with 1%
BSA in PBS (Pierce). Supernatants were added and the plates
washed after 30 min. Bound antibody was detected using HRP-
conjugated goat anti-human IgG or IgA followed by OPD as
substrate. Clones secreting isotype switched antibodies were

TABLE 1. PRIMERS FOR THE CONSTRUCTION OF P HMG1 VECTORS

F425B4e8 Variable heavy chain

Sense primer
AGTTCCGGTACC TTCTGATAACGGTGTCCTTCTGTTTG CAGGTG
TCCTGTCCCAGGTGCTGCTGGTGCAGTCTGGGGGAGGCC
Antisense primer
TAGGATCTCGAG ACTCACCTGAAGAGACGACGACCATTGTT
F425 B4e8 Variable light chain
Sense primer
AAGCTTTCGCGA TCCTGACTACATGAGTGCATTTCTGTTTTATTTCCA
ATTTCAGATACCACCGGA AATTCCTGCTGGACCCAGTCTCCATCC
Antisense primer
TAGGATCTCGAG ACTTACGTTTGATCTCCACCTTGGTCCC

Underline sequence (from up to down) 5 induced sites Asp 718, Xho I, Nru I, and
Xho I, respectively. Bold sequence 5 variable region of F425 B4e8. Sequence
between underlined and bold sequence 5 regulatory signal.
ENHANCED IgA BINDING TO VIRIONS 603

TABLE 2. PRIMERS FOR SITE -DIRECTED MUTATION

Hind III forward primer

GTATTTAGAATTAAGCTT TCTGGGGCAG
Spe I reverse
GGGAAGACCGATGGGCCACTAGT GGAGGCTGCAAGAGAGG
Spe I forward
CCTCTCTTGCAGCCTCCACTAGT GGCCCATCGGTCTTCCC
Age I reverse primer
TCCACGACACCGTCACCGGT TCGGGGAAGT

Underline sequence 5 Hind III, Spe I, and Age I sites. Spe I forward
and reverse primers are reverse complement. These oligonucleotides are
identical with the internal sequence of pHMG1, except for the SpeI
recognized sequence.

clones were expanded for characterization of these isotype
switched antibodies. Once cloned, there was no difference in
the amount of antibody produced between X653 and HMMA
cells.
Reactivity with HIV
Reactivity of the parental and isotype switched F425B4e8
monoclonal antibodies with native HIV virions was determined
in two ways. Reactivity of the antibodies with the TCLA iso-
late SF2 expressed on infected cells was determined by flow
cytometry. As shown by the histograms in Figure 5, all isotype
and subclass switched variants of F425B4e8 reacted with SF2
infected cells. However, there was a 25% decrease in the IgG3
(average mean fluorescent intensity or MFI, 8.8, Fig. 5C) re-
activity as compared to the parental antibody IgG2 antibody
(MFI, 12.5, Fig. 5B). In contrast, both the IgG1 (MFI of 15.9,
Fig. 5A) and the IgA (MFI, 16.1, Fig. 5D) variants reacted 25%
more with SF2 than the parental IgG2. It should be noted that
these histograms utilize a log scale (x-axis) and these differ-
ences in MFI are substantial.
Reactivity with primary isolates 92HT593 (R5X4) and
92US660 (R5) virions was determined using a virion binding
assay17 and as shown in Figure 6, when tested at 2 mg/mL, all
antibodies captured both R5 (92US660) and R5X4 (92HT593)
virus. Both the IgG1 (260 pg/mL for 92US660 and 275 pg/mL
for 92HT593) and IgG3 (261 pg/mL for 92US660 and 219
pg/mL for 92HT593) variant captured less virus than the
parental IgG2 (428 pg/mL for 92US660 and 425 pg/mL for
92HT593). Binding of the IgA to 92US660 virions was simi-
lar to the parental IgG2, there was a 74% increase in the bind-
ing of the IgA variant (741 pg/mL) to 92HT593 virions. Sub-
class and isotype switch to IgG3 and IgA, respectively, resulted
in consistent effects of antibody binding to native antigen on
infected cells and virions. Of note, the isotype switched IgA
has the greatest binding to both SF2-infected cells and cell-free
virus (92HT593).
Neutralization of primary isolates
The results of the primary isolate 92HT593 (R5X4) neutral-
ization by all isotypes of B4e8 are shown as Figure 7A. Con-
centrations of less than 0.3 mg/mL and 2.5 mg/mL of B4e8 IgG1
mediated 50% and 90% inhibition of R5X4 virus, respectively.
Similarly, concentrations of 0.9 mg/mL and 2.5 mg/mL for
IgG2, 0.6 mg/mL and 10 mg/mL for IgG3 and 0.6 mg/mL and
2.5 mg/mL for IgA inhibited infection by 50% and 90%, re-
spectively. These differences were not statistically significant.
Similar results were obtained for 92US660.

TABLE 3. ISOLATION OF STABLE CLONES EXPRESSING ISOTYPE

OR SUBCLASS SWITCHED ANTIBODIES a

Positive wellsb

HMMA X653

IgG1 2.9% (14/478) 6.6% (24/365)

IgG3 4.1% (12/291) 7.1% (15/211)
IgA 3.3% (1/30) 4.8% (8.165)
aHuman and mouse myeloma cells, HMMA and X653, respectively,

were transfected with vectors expressing the indicated antibody. When

the G418-resistant cells covered more than 80% of the well, they were
screened for antibody by heavy chain–specific ELISA.
b Results are shown as percent positive wells and (number of positive

wells/number of wells screened). For each cell line and antibody, two
separate transfections were performed and the data represents the sum of
both experiments.
606
However, the role of specific isotypes or subclasses of antibody
and protection against HIV warrants further study. Consider-
able evidence exists that specific isotype or IgG subclasses are
important in the control of different pathogens.32,33 The study
of isotype and subclass switch variants of HMAbs should pro-
vide useful information on the role of isotypes or subclasses in
mediating protection. Generation and evaluation of the IgG sub-
classes and IgA isotype of human antibodies will allow us to
elucidate the complexity of the interactions of env glycopro-
teins of HIV-1 and antibodies in preparation for developments
in vaccine technology that will help focus the optimal immune
response.
ACKNOWLEDGMENTS
This work was supported by Public Health Service grants
AI-26926 (M.R.P., L.A.C., F.L.) and AI-45320 (L.A.C) from
the NIAID, NIH and a fellowship through the American Soci-
ety of Microbiology (P.L.B.).
SEQUENCE DATA
The sequence for the F425B4e8 heavy and light chains can
be found in Genbank under accession numbers AY056842 and
AY056841, respectively.
REFERENCES
1. Rizzuto CDWR, Hernandez-Ramos N, Sun Y, et al.: A conserved
HIV gp120 glycoprotein structure involved in chemokine receptor
binding. Science 1998;280:1949–1953.
2. Parren PWMJ, Burton DR, Sattentau QJ: The neutralizing antibody
response to HIV-1: viral evasion and escape from humoral immu-
nity. AIDS Res Hum Retrovirus 1999;13(Suppl A):S137–162.
3. Kaul RPF, Clerici M, Bomsel M, et al.: Mucosal IgA in exposed,
uninfected subjects: evidence for a role in protection against HIV
infection. AIDS Res Hum Retroviruses 2001;15:431–432.
4. van Egmond MDC, van Spriel AB, Vidarsson G, et al.: IgA and
the IgA Fc receptor. Trends Immunol 2001;22:205–211.
5. Deenick EKHJ, Hodgkin PD: Switching to IgG3, IgG2b, and IgA
is division linked and independent, revealing a stochastic frame-
work for describing differentiation. J Immunol 1999;163:4707–
4714.
6. van Spriel AB vDH-OI, van De Winkel JG: Neutrophil Fc gamma
RI as target for immunotherapy of invasive candidiasis. J Immunol
2001;166:7019–7022.
7. Harris LJLS, McPherson A: Comparison of intact antibody struc-
tures and the implications for effector function. Adv Immunol
1999;72:191–208.
8. Idusogie EEWP, Presta LG, Gazzano-Santoro H, et al.: Engineered
antibodies with increased activity to recruit complement. J Im-
munol 2001;166:2571–2575.
9. Scharf OGH, King LR, Eller N, et al.: Immunoglobulin G3 from
polyclonal human immunodeficiency virus (HIV) immune globu-
lin is more potent than other subclasses in neutralizing HIV type
1. J Virol 2001;75:6558–6565.
10. Cavacini LAEC, Power J, Desharnais FD, et al.: Influence of heavy
chain constant regions on antigen binding and HIV-1 neutraliza-
tion by a human monoclonal antibody. J Immunol 1995;155:
3638–3644.
LIU ET AL.
11. Cavacini L, Duval M, Song L, et al.: Conformational changes in
env oligomer induced by an antibody dependent on the V3 loop
base. AIDS 2003;17:685–689.
12. Welschof M, Terness P, Kolbinger F, et al.: Amino acid sequence
based PCR primers for amplification of rearranged human heavy
and light chain immunoglobulin variable region genes. J Immunol
Methods 1995;179:203–214.
13. Lefranc MPGV, Ginestoux C, Bodmer J, et al.: IMGT, the inter-
national ImMunoGeneTics database. Nucleic Acids Res 1999;27:
209–212.
14. Walls MAHK, Harris LJ: Vectors for the expression of PCR-
amplified immunoglobulin variable domains with human constant
regions. Nucleic Acids Res 1993;21:2921–2929.
15. Posner M, Elboim H, Santos D: The construction and use of a hu-
man–mouse myeloma analogue suitable for the routine production
of hybridomas secreting human monoclonal antibodies. Hybridoma
1987;6:611–625.
16. Kearney JFRA, Liesegang B, Rajewsky K: A new mouse myeloma
cell line that has lost immunoglobulin expression but permits the
construction of antibody-secreting hybrid cell lines. J Immunol
1979;123:1548–1550.
17. Cavacini LAPJ, Nappi E, Duval M, et al.: Minimal incidence of
serum antibodies reactive with intact primary isolate virions in hu-
man immunodeficiency virus type 1–infected individuals. J Virol
1999;73:9638–9641.
18. Cavacini LAEC, Wisnewski AV, Power J, et al.: Functional and
molecular characterization of human monoclonal antibody reactive
with the immunodominant region of HIV type 1 glycoprotein 41.
AIDS Res Hum Retroviruses 1998;14:1271–1280.
19. Kabat E, Wu T, Perry H, et al.: Sequences of Proteins of Im-
munological Interest, 5th ed. U.S. Department of Health and Hu-
man Services, Public Health Service, National Institutes of Health,
Bethesda, MD, 1991.
20. Coloma MJHA, Wims LA, Morrison SL: Novel vectors for the ex-
pression of antibody molecules using variable regions generated by
polymerase chain reaction. J Immunol Methods 1992;152:89–104.
21. Posner M, Elboim H, Cannon T, et al.: Functional activity of an
HIV-1 neutralizing IgG human monoclonal antibody: ADCC and
complement mediated lysis. AIDS Res Hum Retroviruses 1992;
8:553–558.
22. Forthal DN, Landucci G, Daar ES: Antibody from patients with
acute human immunodeficiency virus (HIV) infection inhibits pri-
mary strains of HIV type 1 in the presence of natural-killer effec-
tor cells. J Virol 2001;75:6953–6961.
23. Keler TGP, Vitale LA, Sundarapandiyan K, et al.: Targeting weak
antigens to CD64 elicits potent humoral responses in human CD64
transgenic mice. J Immunol 2000;165:6738–6742.
24. Coloma MJTK, Wims LA, Morrison SL: The hinge as a spacer
contributes to covalent assembly and is required for function of
IgG. J Immunol 1997;158:733–740.
25. Corthesy BSF: Secretory immunoglobulin A: from mucosal pro-
tection to vaccine development. Biol Chem 1999;380:1251–1262.
26. Stubbe HBJ, Kraehenbuhl JP, Corthesy B: Polymeric IgA is supe-
rior to monomeric IgA and IgG carrying the same variable domain
in preventing Clostridium difficile toxin A damaging of T84 mono-
layers. J Immunol 2000;164:1952–1960.
27. Preston MJ, Gerceker AA, Reff ME, et al.: Production and char-
acterization of a set of mouse-human chimeric immunoglobulin G
(IgG) subclass and IgA monoclonal antibodies with identical vari-
able regions specific for Pseudomonas aeruginosa serogroup O6
lipopolysaccharide. Infec Immun 1998;66:4134–4142.
28. Devito CBK, Kaul R, Svensson L, et al.: Mucosal and plasma IgA
from HIV-1–exposed uninfected individuals inhibit HIV-1 trans-
cytosis across human epithelial cells. J Immunol 2000;165:5170–
5176.
29. Moore JPPP, Burton DR: Genetic subtypes, humoral immunity,
ENHANCED IgA BINDING TO VIRIONS 607

and human immunodeficiency virus type 1 vaccine development. 33. Zeitlin LCP, Whaley KJ, Moench TR, et al.: Comparison of an
J Virol 2001;75:5721–5729. anti-HSV-2 monoclonal IgG and its IgA switch variant for topical
30. Baba TWLV, Hofmann-Lehmann R, Vlasak J, et al.: Human neu- immunoprotection of the mouse vagina. J Reprod Immunol 1998;
tralizing monoclonal antibodies of the IgG1 subtype protect against 40:93–101.
mucosal simian-human immunodeficiency virus infection. Nat
Med 2000;6:200–206. Address reprint requests to:
31. Reimann KACR, Wu Y, Palmer L, et al.: In vivo administration of Lisa Cavacini
CD4-specific monoclonal antibody: effect on provirus load in rhe-
Beth Israel Deaconess Medical Center
sus monkeys chronically infected with the simian immunodeficiency
virus of macaques. AIDS Res Hum Retroviruses 1995;11:517–525.
330 Brookline Avenue, BURL556
32. Lloyd-Evans PGJ: Expression of neutralizing recombinant human Boston, MA 02215
antibodies against varicella zoster virus for use as a potential pro-
phylactic. Hybridoma 2000;19:143–149. E-mail: lcavacin@bidmc.harvard.edu