Please cite this article in press as: Esposito et al.

, Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019

Cancer Cell

Review

Hacking the Cancer Genome: Profiling

Therapeutically Actionable Long Non-coding RNAs
Using CRISPR-Cas9 Screening
Roberta Esposito,1,2 Núria Bosch,1,2,3 Andrés Lanzós,1,2,3 Taisia Polidori,1,2,3 Carlos Pulido-Quetglas,1,2,3
and Rory Johnson1,2,*
1Department of Medical Oncology, Inselspital, Bern University Hospital, University of Bern, Bern, Switzerland
2Department for BioMedical Research, University of Bern, Bern, Switzerland
3Graduate School of Cellular and Biomedical Sciences, University of Bern, Bern, Switzerland

*Correspondence: rory.johnson@dbmr.unibe.ch
https://doi.org/10.1016/j.ccell.2019.01.019

Long non-coding RNAs (lncRNAs) represent a huge reservoir of potential cancer targets. Such ‘‘onco-
lncRNAs’’ have resisted traditional RNAi methods, but CRISPR-Cas9 genome editing now promises func-
tional screens at high throughput and low cost. The unique biology of lncRNAs demands screening strategies
distinct from protein-coding genes. The first such screens have identified hundreds of onco-lncRNAs pro-
moting cell proliferation and drug resistance. Ongoing developments will further improve screen perfor-
mance and translational relevance. This Review aims to highlight the potential of CRISPR screening technol-
ogy for discovering new onco-lncRNAs, and to guide molecular oncologists wishing to apply it to their cancer
of interest.

Introduction
The past decade has witnessed a dramatic expansion in both the
number and nature of cancer-related genes (Khurana et al.,
2016; Bhan et al., 2017). Technological advances in tumor
genome sequencing and functional genomics have identified a
diverse cast of genomic elements whose mutation, epigenetic
modification or altered expression contribute to ‘‘cancer hall-
marks’’ (Hanahan and Weinberg, 2000; Futreal et al., 2004; Li
et al., 2014a). Among these, long non-coding RNAs (lncRNAs)
are a numerous yet poorly understood gene class that have
generated widespread interest as novel cancer targets (Du
et al., 2013; Yan et al., 2015; Zhu et al., 2016; Lanzós et al.,
2017; Liu et al., 2017).
LncRNAs are defined for what they are not: RNA transcripts, in
the range of 200–10,000 nucleotides, where no evidence can be
found for protein-coding capacity (Derrien et al., 2012). They
comprise a large and heterogeneous class that, in contrast
to other ncRNAs, have resisted functional classification and pre-
diction (Ulitsky and Bartel, 2013; Kopp and Mendell, 2018). With
exceptions, lncRNAs have gene structures, chromatin, tran-
scriptional regulation, and post-transcriptional processing remi-
niscent of protein-coding genes (Derrien et al., 2012). Although
many are species specific, a core shows evidence for ancient
evolutionary conservation (Ulitsky et al., 2011). In general,
lncRNAs are characterized by low expression and high tissue-
and cell-specificity (Derrien et al., 2012). While the biological
functionality of many lncRNAs remains debated (Engreitz et al.,
2016; Kopp and Mendell, 2018), it is beyond doubt that func-
tional examples exist (Wutz et al., 2002; Gutschner et al., 2013;
Lee et al., 2016; Leucci et al., 2016; Hosono et al., 2017),
including those with clearly established cancer roles.
The molecular mechanisms of lncRNAs are highly heteroge-
neous and can be interpreted along three principal axes: molec-
ular interactions, subcellular localization, and regulatory relation-
ship to target gene (cis or trans). With exceptions, lncRNAs are
thought to function as mature RNAs (Guttman and Rinn, 2012).
They interact with other RNAs, genomic DNA (gDNA) sites, and
proteins, through both structural and sequence-specific ele-
ments (Guttman and Rinn, 2012; Johnson and Guigó, 2014).
Their presumed ability to adopt complex tertiary structures un-
derlies the formation of multi-component complexes, increasing
lncRNAs’ potential biological roles, but hugely complicating the
study of their mechanisms (Guttman and Rinn, 2012; Johnson
and Guigó, 2014). They are found in both the nucleus and cyto-
plasm of the cell, with a slight nuclear tendency (Ulitsky and Bar-
tel, 2013; Cabili et al., 2015). Finally, they can act both in cis or
trans, influencing the chromatin structure, gene transcription,
and RNA processing of either neighboring or distantly encoded
target genes (Quinodoz and Guttman, 2014; Vance and Ponting,
2014; Kopp and Mendell, 2018). So far, they have been impli-
cated in diverse cellular processes, ranging from the control of
gene expression to protein translation to ion channel activity
(Ulitsky and Bartel, 2013; Johnson and Guigó, 2014).
The numerical population of lncRNAs is particularly daunting:
recent estimates have up to 50,000 or more, far exceeding the
number of protein-coding genes (Uszczynska-Ratajczak et al.,
2018). Ever-increasing volumes of transcriptome sequence
data are unlikely to have yet saturated the full extent of lncRNAs
(Nellore et al., 2016; Lagarde et al., 2017). Thus, even in a pessi-
mistic scenario where just a fraction of lncRNAs are functional,
there are likely to remain many thousands of undiscovered genes
with therapeutic potential.
For a number of years, we have been unable to capitalize on
this wealth of novel genes due to lack of effective and econom-
ical loss-of-function (LOF) tools. The widely used RNAi has
proven generally ineffective for lncRNAs, due to their unique
localization and expression (Gutschner et al., 2011; Maamar
et al., 2013). A solution has recently appeared thanks to recent

Cancer Cell 35, April 15, 2019 ª 2019 Elsevier Inc. 1

 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019
Growth
ANRIL supression GAS5
Apoptosis
PANDA MEG3
- 3’
5’-
Tumor-suppressor
Onco-lncRNA
lncRNA
- 3’
5’-
HULC NBAT1
Proliferation
HOTAIR Invasion LINC-PINT
Figure 1. LncRNAs in Cancer Phenotypes
Selected examples of onco-lncRNAs (left) and tumor-suppressor lncRNAs
(right) shown to contribute to four cancer hallmarks. Green and red arrows
represent positive and negative regulation, respectively. Colored ovals
represent proteins or RNAs that bind to lncRNAs and are necessary for their
function.
advances in genome-engineering technology. The CRISPR-
Cas9 technology is a potent and versatile toolkit with which
to manipulate a wide variety of genomic elements (Cong et al.,
2013). Most importantly, CRISPR appears to overcome the
drawbacks of previous methods and can effectively target
lncRNAs (Aparicio-Prat et al., 2015).
The aim of this Review is to provide a comprehensive introduc-
tion to CRISPR-based screening for cancer-promoting lncRNAs.
We summarize recent successful screens of lncRNAs involved in
cell proliferation and drug resistance. We advise the reader on
achieving high-sensitivity, high-specificity screens by means of
optimal design and analysis strategies, while avoiding common
pitfalls. Finally, we discuss how future developments in CRISPR
screens promise to unlock a new generation of treatments for
unmet clinical needs in cancer.
LncRNAs: The Next Frontier of Cancer Targets
In a remarkably short period of time, lncRNAs have been linked
to essentially every major cancer type (for a detailed review
see Huarte, 2015; DiStefano, 2018; Lin and Yang, 2018), contrib-
uting to each of the ten cancer hallmarks (Hanahan and Wein-
berg, 2000, 2011; Gutschner and Diederichs, 2012; Bartonicek
et al., 2016; Arun et al., 2018) (Figure 1). We here define lncRNAs
that positively contribute to cancer hallmarks as ‘‘onco-
lncRNAs,’’ and those that contribute either negatively or posi-
tively as ‘‘cancer-lncRNAs.’’
Iconic onco-lncRNAs such as HOTAIR, NEAT1, ANRIL, and
MALAT1 fulfill the definitions of conventional oncogenes: they
are recurrently overexpressed in tumors, their introduction to
or removal from cultured cancer cells alters growth and invasive-
ness, and they are involved in core biological processes in
healthy cells (Gupta et al., 2010; Yap et al., 2010; Gutschner
et al., 2013; Chakravarty et al., 2014; Leucci et al., 2016; Sun
et al., 2016). HOTAIR, originally identified in metastatic breast
cancer (Gupta et al., 2010), was subsequently linked to a variety
of cancers (revised in Tang and Hann, 2018). However, the
mechanisms of action remain uncertain and debated (Portoso
et al., 2017). NEAT1 is upregulated and shows oncogenic prop-
2 Cancer Cell 35, April 15, 2019
Cancer Cell
Review
erties in most types of solid tumors (Chakravarty et al., 2014),
through diverse and complex mechanisms (Chakravarty et al.,
2014). Perhaps the best studied of these is through the organiza-
tion of nuclear architecture. It has been shown that NEAT1 is
necessary for the formation of paraspeckles, poorly understood
nuclear structures (Clemson et al., 2009; West et al., 2014).
Recently, NEAT1 was shown to be a direct target of p53
(Adriaens et al., 2016; Mello et al., 2017). ANRIL is an antisense
lncRNA, transcribed from the locus INK4b-ARF-INK4a, encod-
ing for three tumor-suppressor proteins, p15(INK4b), p14(ARF),
and p16(INK4a). ANRIL overexpression in tumors results in the
transcriptional repression of the three genes, and subsequent
evading of growth suppression mechanism (Yap et al., 2010).
In addition, MALAT1 has been reclassified as a cancer-lncRNA
instead of onco-lncRNA, since Kim et al. (2018) characterized
it as tumor-suppressor in in vivo models of breast cancer.
The number of known oncogenic lncRNAs is growing rapidly,
of which a small number of illustrative cases are described here.
The lncRNA PANDA, induced in a p53-dependent manner, re-
presses apoptosis by interacting with the transcription factor
NF-YA and preventing the transcription of pro-apoptotic genes
(Hung et al., 2011). SAMMSON is a direct target of the metas-
tasis marker, SOX10, and promotes melanoma cell survival by
enhancing mitochondrial metabolism. It interacts with a key
regulator of mitochondria metabolism, p32, involved in formation
of functional 12S ribosomal RNA (Leucci et al., 2016). Another,
LINK-A, localizes to the cytosolic membrane, directly interacts
with phosphatidylinositol-3,4,5-trisphosphate and AKT (Lin
et al., 2017), mediating AKT recruitment and activation. Hyperac-
tivation of this signal has been associated with tumorigenesis
and resistance to AKT inhibitors in breast cells (Lin et al., 2017).
LncRNAs can act also as tumor-suppressors: GAS5, MEG3,
NBAT, and LINC-PINT, often downregulated in cancer, play
important roles in key cellular processes (Zhou et al., 2012;
Marin-Bejar et al., 2013; Pandey et al., 2014; Pickard and Wil-
liams, 2015) (Figure 1). For example, LINC-PINT lies downstream
of p53 and acts as its regulatory effector, inhibiting tumor cell in-
vasion (Marin-Bejar et al., 2013). LINC-PINT downregulation
leads to increased tumorigenesis in mouse models, and its
expression is lost in many tumors (Marin-Bejar et al., 2017).
The rapid growth in known onco-lncRNAs has begun to feed
into therapies. This has been facilitated by progress in devel-
oping reagents capable of downregulating RNAs in vivo. Anti-
sense oligonucleotides (ASOs) are a broad class of nucleic acids
that bind to RNAs and trigger their degradation by the RNaseH
pathway (Dias and Stein, 2002). In contrast to RNAi, this degra-
dation takes place in the nucleus, meaning that nuclear, chro-
matin-associated, and even primary (unspliced) lncRNAs, can
be efficiently targeted (Fang and Fullwood, 2016). Chemical
modifications can improve the stability of ASOs in vivo, most
notably DNA:RNA chimeric ‘‘Gapmers’’ (Watts and Corey,
2012). Other methods may be used to tune the tissue- or cell-
specific targeting of ASOs (Juliano, 2016; Ross et al., 2017;
Scharner et al., 2018).
Attempts to discover functional lncRNAs have historically
relied on indirect transcriptomic evidence, using microarrays or
RNA sequencing (RNA-seq) to find differentially expressed
genes between tumor and healthy samples (Iyer et al., 2015).
For example, HULC was first detected through its deregulation
 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019
Cancer Cell
Review
Table 1. CRISPR-Based Screens for Cancer-lncRNAs
Pooled Library
Perturbation Cas9 Variant In Vitro Model Size (Targets)
CRISPR-del wild-type Cas9 Huh7.5OC 671
CRISPRi dCas9-KRAB K562, U87, HeLa, 16,401
HEK293T, MCF-7,
MDA-MB-231, iPSC
CRISPRa dCas9-VP64 + MCF-7 241
pSM2-p65-HSF1
CRISPRa dCas9-VP64 + A375 10,504
pSM2-p65-HSF1
CRISPRa dCas9-VP64 + MOLM14 14,701
pSM2-p65-HSF1
CRISPR-del wild-type Cas9 K562 10,996
in hepatocellular carcinoma (Panzitt et al., 2007), while RMRP
has been linked to multiple cancers through expression deregu-
lation (Meng et al., 2016; Shao et al., 2016; Feng et al., 2017).
This approach suffers from the underlying assumptions that
differential expression implies function, and, inversely, that can-
cer functions must be reflected in tumor-specific expression
changes.
Cancer-lncRNAs have been also identified through copy-
number alterations (CNAs) in tumor genomes. For example,
PVT1 and SAMMSON were initially detected due to their co-
amplification with nearby protein-coding oncogenes MYC and
MITF, respectively. Further experiments revealed key roles for
these lncRNAs in tumor progression (Shtivelman and Bishop,
1989; Leucci et al., 2016). Recently, the advent of whole-genome
sequencing has enabled the search for ‘‘driver’’ mutations in
lncRNAs, which are under positive selection (Rheinbay et al.,
2017). For example, SAMMSON (Lanzós et al., 2017), MIAT (Mu-
laroni et al., 2016), and RMRP (Rheinbay et al., 2017) are en-
riched for somatic mutations in tumors. Although promising,
driver discovery methods are restricted by presently small
numbers of entire tumor genome sequences. Both driver and
CNA analyses only identify relatively early mutations in tumori-
genesis, and likely represent a small subset of clinically action-
able onco-lncRNAs.
Despite their value, these methods for identifying onco-
lncRNAs have failed to keep pace with the rate at which new
lncRNAs are annotated, and generally do not yield direct func-
tional evidence for cancer roles. What is more, lncRNAs’ unique
biology present challenges compared with protein-coding
genes, and their functions cannot be predicted based on primary
sequence. The result is that just a tiny fraction of lncRNAs,
500
(
1%), have been linked to cancer so far (Chen et al., 2013; Quek
et al., 2015; Ning et al., 2016; Carlevaro-Fita et al., 2017). This
has created a pressing need for methods capable of functionally
screening thousands of lncRNAs at low cost.
CRISPR Screening for Onco-LncRNAs
CRISPR-Cas9 technology represents the long-awaited break-
through technology for perturbing lncRNAs at high throughput,
using a pooled screening format requiring low capital invest-
ment. Recent landmark studies have demonstrated CRISPR-
Cas9’s power to discover onco-lncRNAs. These studies have
Library lncRNA Identified PubMed
Addgene IDs Phenotype (Validated) ID
89640 cell growth 51 (9) 27798563
86538–86550 cell growth 499 (65) 27980086
– AKT activation 5 (1) 28176758
1000000106 vemurafenib 16 (16) 28792927
resistance
– Ara-C 2,874 (13) 29677511
resistance
– cell growth 230 (35) 30395134
been successful across diverse perturbation modalities, lncRNA
targets, cell models, and phenotypes (Table 1).
Three LOF screens have been presented, using CRISPR-dele-
tion (CRISPR-del) and CRISPR-inhibition (CRISPRi) (explained in
detail in the next section). Zhu and colleagues used a paired-
sgRNA (pgRNA) promoter deletion strategy with a library target-
ing 700 previously identified cancer-associated lncRNAs (Du
et al., 2013), yielding 51 hits (7%) for proliferation-regulating
lncRNAs in a liver cancer cell line (Zhu et al., 2016). Forty-
three of these promoted proliferation, corresponding to onco-
lncRNAs. Very recently, the same group developed an alterna-
tive LOF screen targeting the splice site of 10,996 multi-exonic
lncRNAs and identified 230 (2%) to be essential for cell growth
of K562 cells (Liu et al., 2018).
A CRISPRi-based study screened a much larger library target-
ing 16,401 lncRNAs in seven cell lines (Liu et al., 2017). Here, 499
hits (3%) were identified (Liu et al., 2017). Surprisingly, the major-
ity yielded phenotypes in just one cell type, despite being ex-
pressed in multiple cells, suggesting that lncRNAs exert cell-
type-specific functions independent of steady-state expression
levels and highlighting the advantage of CRISPR screening
over expression-based methods.
Other studies have used the gain-of-function (GOF) perturba-
tion, CRISPR-activation (CRISPRa). A screen in MCF7 cells iden-
tified 5 out 241 lncRNAs (2%) to be involved in the AKT activation
pathway (Koirala et al., 2017). Another study in melanoma cells
identified 16 lncRNA loci involved in resistance to the targeted
therapeutic vemurafenib (Joung et al., 2017a, 2017b). Bester
et al. (2018) identified 2,874 hits out of 14,701 (
19%) lncRNAs
for their response to Ara-C drug, in an acute myeloid leukemia
cell lines.
Independently from the different modalities used (LOF, GOF),
these studies provide several insights. First, they confirm that
many novel lncRNAs mediate cancer hallmarks, and may be
identified using cell-based genome-wide screens. Second, hit
rates appear to lie in the range
2%–20%––surprisingly high,
considering that neither LOF study specifically targeted lncRNAs
that were expressed in their respective cell lines.
CRISPR-Cas9 Toolkit for LncRNAs
CRISPR-Cas9 genome engineering is an adaptation of the
Streptococcus pyogenes immunity system (Cong et al., 2013;
Cancer Cell 35, April 15, 2019 3
 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019

Cancer Cell

Review

A Cas9 B Wild-type CRISPR-deletion

Cas9

LOF
-3’

GTACATCGTACGCATTGTACNCC 0.5-5 kb
5’- CATGTTACGCATGCTACATG

Protospacer (20 nt)

NGG

PAM

CRISPR-inhibition
KRAB
C
dCas9

Cargo

F
LO
25-75 bp

CRISPR-activation
VP64
G
O
F

100-150 bp

Figure 2. Flavors of CRISPR Perturbations

(A) CRISPR-Cas9 system. The basic CRISPR-Cas9 system consists of two components. The single guide RNA (sgRNA) hybridizes to the 20-nt protospacer in
genomic DNA through its variable region, while recruiting Cas9 protein through a constant, structured domain. The protospacer must precede a protospacer-
associated motif (PAM), which in the case of Cas9 is ‘‘NGG.’’ Recruitment of Cas9 results in a double-strand break (DSB) three nucleotides upstream the PAM.
(B) CRISPR-deletion. LncRNA knockout may be achieved by CRISPR-deletion (CRISPR-del). Here, a pair of wild-type Cas9 endonucleases are recruited to sites
flanking the target transcription start site (TSS) (arrow). Non-homologous end-joining (NHEJ) repairs the lesion, resulting in promoter deletion and gene silencing.
(C) CRISPR-inhibition/activation. Transient perturbations may be achieved through mutated nuclease-deficient Cas9 (dCas9). dCas9 can be fused with a variety
of cargoes, i.e., effector domains, to modulate lncRNA expression. The KRAB domain (red, upper panel) inhibits transcription (CRISPR-inhibition [CRISPRi]),
while activators such as VP64 (green, lower panel) activate transcription (CRISPR-activation [CRISPRa]). Efficiency of all methods depends strongly on relative
locations of sgRNAs to lncRNA TSS, shown below.

Mali et al., 2013). It comprises two components: Cas9 endonu-
clease protein, capable of inducing a double-strand break
(DSB) in bound DNA, and a single guide RNA (sgRNA)
(Figure 2A). The sgRNA is itself a synthetic fusion of the
CRISPR-RNA (crRNA), containing a variable 20-nt sequence
complementary to the targeted protospacer, and a constant
trans-activating crRNA (tracrRNA) recognized by Cas9 (Fig-
ure 2A) (Jinek et al., 2012). The Cas9 will only cut when an
NGG protospacer adjacent motif is found immediately 30 to the
protospacer (Jinek et al., 2012) (Figure 2A). In effect, CRISPR-
Cas9 may be considered a genomic search engine serving to
deliver the Cas9 cargo to a defined genomic site. One of the
key benefits of CRISPR/Cas9 is its versatility: the Cas9 protein
can be modified to deliver protein cargoes––and hence, pertur-
bations––of choice to desired genomic locations.
LncRNAs introduce special constraints to CRISPR-Cas9 as
originally designed for protein-coding genes. For the latter, it is
sufficient to recruit a single Cas9 to the open reading frame
(ORF), where indel mutations lead to frameshifts and complete
LOF of the encoded peptide (Shalem et al., 2014). As lncRNAs
have no ORF, it is unlikely their functional domains can be inac-
tivated in this way (Guttman and Rinn, 2012). Consequently,
elaborations of the basic CRISPR-Cas9 approach have been
developed to target lncRNAs. These can be divided into perma-
nent genome editing (deletions) or transitory transcriptional
modulation (inhibition and activation) (Figures 2B and 2C). Dis-
cussion is restricted to methods that can presently be scaled
to screening throughputs.
Genomic Deletion
Perhaps the most obvious LOF method is by genomic deletion.
CRISPR-del uses a pair of CRISPR-Cas9 complexes to intro-
duce simultaneous DSBs at sites flanking the target region,
relying on a non-homologous end-joining (NHEJ) process to
repair the break and remove the intervening fragment (Ho
et al., 2015; Vidigal and Ventura, 2015) (Figure 2B). CRISPR-
del has been widely used on lncRNAs and other genomic
targets, and typically yields target homozygous deletion effi-
ciencies in the range 10%–40% (Canver et al., 2014; Ho et al.,
2015). Factors affecting this efficiency are poorly understood,
but likely include target length (Canver et al., 2014) and the
rate of NHEJ. This approach suffers from a number of chal-
lenges, in terms of co-delivery of two sgRNAs, and efficiency
of the NHEJ process.
An important first decision is what exactly to delete: the entire
lncRNA gene, or just part of it? The first lncRNA targeted through
genomic deletion was the mouse Rian lncRNA gene, where a
23-kb fragment was eliminated (Han et al., 2014). This was sub-
sequently extended to other lncRNAs (Ho et al., 2015; Holdt
et al., 2016; Koirala et al., 2017; Xing et al., 2017). Full-gene dele-
tion has two main drawbacks. First, when deleting large regions,
there is the risk of false-positive phenotypes by inadvertently
removing other overlapping genomic elements (Bassett et al.,
2014; Groff et al., 2016). An example is provided by Linc-p21,
thought to be a cis-acting lncRNA, which actually contains mul-
tiple enhancer elements within the DNA sequence. The deletion
of these elements is responsible for the transcriptional regulation
of surrounding genes (Groff et al., 2016). Second, long gene-
sized deletions have low efficiency (Canver et al., 2014).
As a result, subsequent studies have silenced lncRNAs by
removing smaller regions of 0.5–5 kb encompassing promoter
and transcriptional start site (TSS) (Zhu et al., 2016) (Figure 2B).
This has been successfully applied to lncRNAs such as Meteor

4 Cancer Cell 35, April 15, 2019

 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019
Cancer Cell
Review
(Alexanian et al., 2017) and MALAT1 (Aparicio-Prat et al., 2015).
Cells carrying promoter deletions display strongly reduced
lncRNA expression levels, with allelic deletion efficiencies up to
60% in unsorted cells (Pulido-Quetglas et al., 2017). Anecdotally,
one problem arising is that mutated genes may switch expres-
sion to nearby, cryptic promoters, although this has not been
tested systematically. Certainly, residual expression of the
lncRNA is often observed (Bassett et al., 2014); therefore, in in-
stances where complete silencing is required, a full-gene dele-
tion might be preferable.
Transcriptional Repression by CRISPRi
Cas9 can also be engineered for transient LOF. Here, a catalyt-
ically inactive version of Cas9 (dCas) is used as an RNA-guided
targeting platform to which effector domain cargoes are fused
(Qi et al., 2013) (Figure 2C). Strong repression is achieved by
addition of repressor domains, such as the Kru €ppel-associated
box or concatenated mSin3 interaction domains (SID4X) (Gilbert
et al., 2013; Dominguez et al., 2016). Such configurations typi-
cally achieve knockdown efficiencies up to 15-fold, and are
applicable to both protein-coding and lncRNA genes (Gilbert
et al., 2013; Stojic et al., 2018). CRISPRi produces fewer false-
positive results than RNAi (Buehler et al., 2012; Smith et al.,
2017a, 2017b; Peretz et al., 2018). In contrast to CRISPR-del,
LOF is reversible because no genetic mutation takes place (Man-
degar et al., 2016).
Transcriptional Activation by CRISPRa
Analogous to CRISPRi, transient GOF can be achieved by
CRISPRa (Figure 2C). Although early setups gave relatively
weak effects (Gilbert et al., 2013; Perez-Pinera et al., 2013; Cha-
vez et al., 2015), more complex systems achieve potent activa-
tion, such as the fusion of dCas9 with a SunTag array that re-
cruits multiple copies of VP64 (Tanenbaum et al., 2014). The
combination of p65 and HSF1 fused to the sgRNA (by means
of an aptamer) showed among the best activation profile by re-
cruiting numerous downstream activation proteins (Konermann
et al., 2015). CRISPRa overcomes numerous drawbacks associ-
ated with cDNA overexpression. CRISPRa achieves endoge-
nous gene upregulation, which is expected to more accurately
recreate natural patterns of transcript isoform expression (Ko-
nermann et al., 2015), and also to faithfully model cis transcrip-
tional effects that appear to be lost with plasmid overexpression
(Seiler et al., 2017). Finally, CRISPRa oversteps the difficulty of
cloning large cDNAs into vectors with limited capacity.
The major concern of CRISPRi/a is the risk of off-target effects
arising through perturbations of nearby genes (Goyal et al.,
2017). Therefore, these techniques should ideally only be applied
for the manipulation of lncRNA promoters distal from protein-
coding genes (Goyal et al., 2017).
Direct RNA Targeting: The Future of Screening?
Although not yet implemented for screening, a new CRISPR mo-
dality holds great promise: ‘‘CRISPR-R,’’ or direct degradation of
RNA. Wild-type Cas9 can recognize, bind, and cut RNA mole-
cules, even in the absence of DNA (O’Connell et al., 2014; Nelles
et al., 2016). Degradation has also been achieved by fusing
dCas9 to the PIN RNA endonuclease domain from SMG6 (Batra
et al., 2017), or using another Cas homolog, Cas13 (Abudayyeh
et al., 2017).
Knocking down RNA without altering transcriptional rates
potentially gives CRISPR-R advantages over other perturba-
tions. Because it targets exonic sequences, it should specifically
target lncRNAs without affecting any overlapping protein-coding
genes. Moreover, it could resolve the present controversy over
lncRNAs’ (non-mutually exclusive) modes-of-action: whether
they function (1) as mature RNA molecules or (2) simply through
the ‘‘act of transcription’’ (Latos et al., 2012; Kopp and Men-
dell, 2018).
Screening for LncRNAs: A User’s Guide
When designing a CRISPR/Cas9 screen, one must address
three key considerations: Which perturbation––activation,
repression or deletion? Which sgRNA library to choose (i.e.,
targeting which lncRNAs)? Which cell model and pheno-
typic assay?
Here we guide new users in addressing these questions. We
introduce the pooled CRISPR screening workflow, and guide
the reader through challenges and benefits of CRISPR ap-
proaches, with key design considerations for achieving high-
sensitivity, high-specificity screens.
Pooled Screening
Pooled CRISPR screening allows one to assay hundreds to thou-
sands of lncRNAs in a rapid and cost-effective way, without the
requirement of robotic equipment. The approach is based on a
decade of development of analogous short hairpin RNA (shRNA)
screens utilizing the RNAi pathway, but avoiding its pitfalls
of low knockdown efficacy and frequent off-targeting (Stojic
et al., 2018).
Pooled screens entail a ‘‘phenotype-to-genotype’’ evaluation
of gene function, and, in common with all screening modalities,
follow a common three-step structure: (1) perturbation, (2) selec-
tion, and (3) hit identification (Figure 3). What sets pooled screens
apart from more common arrayed screening, is that instead of
introducing perturbations one-by-one in separate culture wells,
they are performed in a single mixed population of cells.
The perturbation step of pooled library screening is achieved
by means of a library of sgRNAs in a lentiviral backbone
(Figure 3A), where virions carry one of many thousands of
distinct targeting constructs (either shRNAs or sgRNAs). This is
used to infect the cell model (Figure 3B), at low multiplicity of
infection (MOI,
0.3), thereby ensuring that each individual cell
receives a single virion and hence perturbation (Figure 3C). Every
infected cell carries a unique, retrievable record of this perturba-
tion, in the form of a genomically inserted sgRNA sequence.
Cells are cultured under antibiotic selection for a determined
period post-infection, to allow perturbation to take place and re-
move uninfected cells.
In the selection step, sgRNA-expressing cells are subjected to
an assay that is capable of physically selecting cells according
to the phenotype of interest (Pheno+). As a reference, non-
phenotype cells (Pheno) are also harvested as appropriate
(Figure 3C). Commonly used assays are cell proliferation (where
faster proliferating cells dominate the population over time), sort-
ing by a fluorescent marker, or resistance to a drug. sgRNAs
from selected cells can be retrieved, sequenced, and used to
infer the identity of genes whose perturbation led to the pheno-
type of interest. The requirement for a selectable phenotypic
assay is a key constraint of such screens. Fortunately, a
range of widely used assays are available that model cancer
hallmarks.
Cancer Cell 35, April 15, 2019 5
 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019

Cancer Cell

Review

A B Figure 3. Pooled Screening Workflow of the

CRISPR-Del Approach for lncRNAs
Library design Oligo synthesis
(A) Library construction. A pooled oligonucleotide
library of pgRNAs is designed, targeting pro-
dCas9 dCas9 moters of
1,000 lncRNAs with n = 10 indepen-
Cas9 or KRAB or VPR
LcnRNA1 LcnRNA2 dent constructs. Here the perturbation is CRISPR-
10 pgRNA designs 10K Oligos del, but the same workflow also applies for
x 1000 LncRNAs Transduction CRISPRi/a, which only differ in employing one
sgRNA rather than a pair (represented by scis-
sors). The resulting library of 103 unique se-
Virus production Plasmid library cloning
Cell model quences are synthesized as on oligonucleotide
Selection pool, cloned into a vector backbone, and used to
produce infectious lentivirus.
(B) Stable cell line production. Cells stably ex-
>500K colonies for 50x coverage Cas9-expressing population pressing Cas9/dCas9 are established by trans-
fection or infection, and selected by antibiotics to
remove non-expressing cells.
(C) Screening. Stable cells are infected with the
C lentivirus pool, at a low multiplicity of infction (MOI,

0.3), so that the majority of cells receive one
Pooled infection Expansion single genomically inserted library sequence. After
MOI 0.3
antibiotic selection to remove uninfected cells,
30M cells Proliferation cells are subjected to the phenotypic assay, which
Drug response separates those displaying phenotype of interest
Phenotypic selection Invasion (Pheno+) from the rest (Pheno). Finally, cell pop-
Migration ulations are harvested and stored. It is crucial to
Apoptosis maintain sufficient coverage of the library at every
point in the protocol, so that each library sequence
is represented by a large number of individual
cells, and no bottlenecks occur that could
10M cells randomly eliminate certain library sequences.
Coverage 1000x (D) PCR amplification. Genomic DNA is purified,
and PCR used to amplify lentivirally inserted
sgRNAs. PCR primers contain adaptamers and
barcodes, in yellow and blue, respectively, needed
Pheno- Pheno+
for the subsequent NGS sequencing. The PCR
product is sequenced and mapped to the library
design, in order to count the instances of each li-
D brary sequence.
(E) Sequencing, read alignment and statistical
Barcode analysis. Three different lncRNAs are shown, each
Adaptamer gDNA – vector – sgRNA – vector – sgRNA – vector – gDNA represented by three unique sgRNAs. In the
example, NGS reads are represented by colored
bars. Examples of neutral (in gray), depleted
(in red) and enriched (in green) lncRNAs, are
E provided.

Neutral Depleted Enriched

lncRNA lncRNA lncRNA
is compared between Pheno+ and
sgRNAs 1 2 3 1 2 3 1 2 3 Pheno cell populations, and statistically
significantly enriched or depleted
Pheno- sgRNAs implicate their target genes as
modulators of the phenotype of interest
Pheno+
(Figure 3E). Correctly performed, pooled
screens can be rapid, economical, and
yield hits with strong statistical confi-
Fold
~1 <1 >1 dence and direct relevance to cancer.
change
Choosing an Optimal Perturbation
FDR >0.05 ≤0.05 ≤0.05 Selecting your CRISPR perturbation
should begin with several considerations.
LncRNA LncRNA
Function None promotes represses Are the lncRNAs of interest expressed in
phenotype phenotype the selected cell model? If the answer is
affirmative, then LOF by CRISPR-del or
CRISPRi are obvious choices. Inciden-
In the final hit identification step, gDNA is extracted, the lenti- tally, for lncRNA screens, no study has yet systematically inves-
virally inserted sgRNA sequences are amplified by PCR and the tigated which is most effective (for a systemic comparison
frequency of all sgRNAs in the library quantified by next-genera- of platforms see Rosenbluh et al., 2017; Sanson et al.,
tion sequencing (NGS) (Figure 3D). The frequency of each sgRNA 2018). CRISPRi involves cloning single sgRNAs, whereas the

6 Cancer Cell 35, April 15, 2019

 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019
Cancer Cell
Review
pgRNA-expressing vectors for CRISPR-del require a two-step
cloning process (Aparicio-Prat et al., 2015). On the other hand,
GOF by CRISPRa is useful when lncRNAs are not expressed in
the cell model (Joung et al., 2017a, 2017b). From a therapeutic
point of view, LOF methods are preferable over GOF, because
they more closely model available ASO drugs, which are gener-
ally inhibitory. Ideally, studies should integrate multiple parallel
CRISPR perturbations to maximize sensitivity and specificity
of results, for example CRISPR-del and CRISPRi in the same
cell model. However, for laboratories embarking on CRISPR
screening for the first time, we would suggest that CRISPRi
probably represents the best starting point for LOF screens at
this point, thanks to the availability of tools, pre-constructed li-
braries, and previous literature.
Library Selection and Design
The sgRNA library should ideally target the entire set of lncRNAs
expressed in the cell model of interest. In practice, this is impos-
sible to achieve, due to our relatively poor annotations of
lncRNAs, even for deeply studied cell lines (Uszczynska-Ratajc-
zak et al., 2018). In practice, researchers face the choice of (1)
using an available pre-made library targeting lncRNAs that
may not be an ideal match to the user’s cell type of interest,
or (2) create a new custom library for the cell type of interest,
but with the considerable expertise and investment that this
entails.
Pre-made libraries are available from AddGene’s collection
(https://www.addgene.org/crispr/libraries/) (see Table 1). They
target generic sets of cancer-associated lncRNAs, or sets of
lncRNAs that are expressed in a specific cell line (the latter tar-
gets far more genes, and hence entails larger-scale screens).
Using such libraries in a first project is clearly a practical option,
provided they cover reasonable numbers of lncRNAs expressed
in the cells of interest.
For the majority of cancers, pre-made libraries are not yet
available, necessitating creation of a customized library. This op-
tion is more challenging and time-consuming, but allows one to
create a reagent tailored closely to the experimental objective.
Library design is composed of three main steps: (1) selection
of candidate target genes, (2) identification of their transcription
start site (TSS), and (3) design of optimal sgRNAs (Horlbeck
et al., 2016a; Sanson et al., 2018).
Candidate Selection. LncRNAs may be selected on the basis of
two main criteria: their suspected involvement in the cancer of in-
terest, and their favorable gene properties. Suspected lncRNAs
could be identified by expression in a cancer of interest (Du et al.,
2013; Zhu et al., 2016). Our ability to specifically target lncRNAs
depends on organization of their gene locus. More specifically,
for the
50% of lncRNA overlapping protein-coding genes, there
is a risk of off-target effects through inadvertently affecting the
latter (Derrien et al., 2012; Goyal et al., 2017; Bester et al.,
2018). For this reason, one should consider selecting only inter-
genic (non-overlapping) lncRNAs (Goyal et al., 2017). In addition,
a number of control elements should be included: positive
controls (targeting mRNAs and lncRNA known to be involved
in the phenotype under study), negative controls (sgRNAs target-
ing non-genic genomic regions), and non-targeting controls
(sgRNAs that do not match any genomic region). The distinction
between the latter two is that although non-targeting controls
may better represent neutral controls, using negative controls
better represents the baseline impact caused by DSBs (Aguirre
et al., 2016; Haapaniemi et al., 2018).
TSS Annotation. TSSs of lncRNAs are often mis-annotated
by hundreds of kilobases (Lahens et al., 2014; Lagarde
et al., 2017). Correct TSS identification is crucial because
dCas9 and CRISPR-del constructs are only effective within a
small window around the TSS. Consequently, public lncRNA
gene annotations like GENCODE (Derrien et al., 2012) should
be combined with other experimental evidence to validate
TSS predictions. Most prominently Cap Analysis of Gene
Expression (CAGE) is regarded as the single most valuable ev-
idence, and datasets are available for thousands of human and
mouse organs and cell types (FANTOM Consortium and the
RIKEN PMI and CLST (DGT) et al., 2014). Additional evidence
sources are DNAseI hypersensitive regions and chromatin
states (ChromHMM) (Ernst and Kellis, 2017). Ideally such
data should have been collected from cells or organs of rele-
vance to the screening cells. More detailed discussion of this
topic may be found in (Radzisheuskaya et al., 2016; Sanson
et al., 2018).
sgRNA Design. Design tools aim to select optimal 20-mer pro-
tospacer sequences to create sgRNAs with maximal on-target
efficacy and minimal off-target effects. Typical libraries are de-
signed with three to ten unique constructs per target lncRNA,
in order to remove false-positive sgRNAs and boost statistical
power at the analysis stage (Figure 3A). As a consequence,
off-target filters may be set less stringent than for other applica-
tions. Recent sgRNA design tools incorporate nucleotide/dinu-
cleotide composition, favored and disfavored nucleotides at
each position, length, and RNA thermodynamics, to successfully
distinguish high-efficacy sgRNAs (Doench et al., 2014, 2016;
Moreno-Mateos et al., 2015; Xu et al., 2015).
Perhaps more important is the relative position of the proto-
spacer to TSS of targeted lncRNA (Horlbeck et al., 2016a; San-
son et al., 2018). CRISPRi and CRISPRa have strong require-
ments for proximity to the TSS: 25–250 bp downstream and
approximately 150–75 bp upstream of the TSS, respectively
(Figures 2B and 2C) (Horlbeck et al., 2016a, 2016b; Radzisheus-
kaya et al., 2016; Rosenbluh et al., 2017; Sanson et al., 2018). On
the other hand, CRISPR-del constraints are less well under-
stood, but certainly deletion efficiency is inversely correlated
with pgRNA distance (Canver et al., 2014).
An important hurdle is that most sgRNA design tools either
require some bioinformatics knowledge to create large-scale li-
brary designs (Hodgkins et al., 2015; Xu et al., 2015; Doench
et al., 2016), or else only provide low-throughput webservers,
like GPP Web Portal for CRISPRi/a/del (Sanson et al., 2018),
MiT for CRISPR-del (Hsu et al., 2013), and CRISPOR (Haeussler
et al., 2016). An exception is CRISPETa, which performs large-
scale designs via webserver but presently only for CRISPR-del
(Pulido-Quetglas et al., 2017).
Cell Model
Screens performed in vitro in cancer cell lines will be the focus
here, although shRNA studies have demonstrated the feasibility
of in vivo screens (Delas et al., 2017). Cell lines have several ad-
vantages in terms of handling and culture, rapid and indefinite
growth, and ease in deriving stable expressing clones. Selected
cell lines should model the cancer of interest as closely as
possible. Furthermore, cells should ideally have available
Cancer Cell 35, April 15, 2019 7
 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019
genomic data, such as RNA-seq, CAGE, and histone modifica-
tions. Particularly valuable in this regard are ENCODE and
the Cancer Cell Atlas (https://www.genome.gov/26524238/
encode-project-common-cell-types/) (ENCODE Project Con-
sortium et al., 2012).
An important drawback of CRISPR-del screens in cancer cell
models is the somatic CNAs of genes. Two studies have shown
that double-stranded breaks caused by targeting amplified
genomic regions in human cancer cell lines reduces proliferation
or survival, and may cause false-positive results (Aguirre et al.,
2016; Munoz et al., 2016). Although these false-positive hits
affect only a small fraction of essential genes identified by
CRISPR (Munoz et al., 2016), it is fundamental to control these
potential artifacts. Delivery of Cas9 is another key consideration.
The Cas9 sequence is long (4 kb) (Graham and Root, 2015),
sharply reducing the infection efficiency of lentivirus. Two main
alternatives are to deliver the Cas9 gene in the same lentiviral
vectors as the sgRNA, or separately. The former option suffers
from low library infection efficiency, due to length. Improved li-
brary infection efficiency can be achieved by separate delivery:
stable cell lines expressing Cas9 are first created (Figure 3B),
and the sgRNA library is subsequently delivered from a separate
vector at high efficiency (Sanjana et al., 2014). It is preferable to
work with heterogeneous populations of Cas9-expressing cells,
rather than isolated clonal lines, due to artifactual epigenetic
characteristics of the latter (Stojic et al., 2018).
Phenotypic Assay
In principle, CRISPR screens can be combined with a wide variety
of established cell-based phenotypic assays, ranging from the
simplest, such as proliferation, to more complex phenotypes
including drug resistance, migration, and marker gene expression.
Pooled screening suffers from an important trade-off between
practicality and biomedical relevance. Under a phenotypic
screen, cells can experience one of two outcomes when a can-
cer-lncRNA is perturbed: negative and positive selection. Nega-
tively selected perturbations are particularly relevant in cancer
LOF screens, where the overarching goal is to identify drug tar-
gets, which, when inhibited, lead to a loss in cancer phenotype.
In LOF screens, negatively selected sgRNAs will be depleted or
lost in the selected (Pheno+) population, and are commonly known
as ‘‘dropouts.’’ A classic dropout screen is represented by simple
LOF proliferation screens, where sgRNAs that disappear from the
population after a defined period identify genes that positively
regulate growth (Shalem et al., 2014). The drawback of relying
on dropouts is limited sensitivity: the dynamic range of detection
of dropouts is between 1-fold (of the Pheno population) and
zero, and will be proportionally reduced where perturbation effi-
ciency is <100%. False-positive dropouts can also appear if bot-
tlenecks occur in the cell population due to low library coverage.
Conversely, positively selected cells are collected because
they display an aberrant phenotype, and will be enriched in
Pheno+ populations. If the perturbation is LOF, then such cells
will have developed a cancer phenotype due to loss of a targeted
lncRNA––for example, a growth-inhibitory gene in a proliferation
assay. Such lncRNAs have lower biomedical relevance (due to
the difficulty of therapeutically activating a target gene), but are
typically more readily identified, because their dynamic range
of detection varies from 1 to infinity, and, in contrast to dropouts,
should be largely unaffected by perturbation efficiency.
8 Cancer Cell 35, April 15, 2019
Cancer Cell
Review
One approach to overcome this impasse is to convert negative
selection screens to positive selection screens. Take as an
example an LOF screen for genes that protect cells from death
in response to a drug. In a conventional negative selection
(dropout) setup, one would collect surviving cells as Pheno+,
and search for dropout sgRNAs. This can be converted to a pos-
itive selection screen by collecting dying cells as Pheno+. Now,
sgRNAs targeting protective lncRNAs will be enriched in Pheno+
cells (Arroyo et al., 2016).
The screening phenotypes attempted to date (Table 1) repre-
sent a small fraction of the wide variety of available assays (Zhu
et al., 2016; Joung et al., 2017a, 2017b; Liu et al., 2017; Bester
et al., 2018). Genes affecting migration or apoptosis have been
dissected in the past for mRNA shRNA screening (Li et al.,
2014a; Seo et al., 2014). Adapting such phenotypic assays to
CRISPR screening will allow the exploration of lncRNAs
involved in other cancer hallmarks with high biomedical rele-
vance. For instance, it is possible to sort apoptotic cells by
fluorescence-activated cell sorting (FACS) after annexin V
staining (Arroyo et al., 2016). Similarly, Transwell inserts can
be adapted to physically sort cells on the basis of migration
rate (Smolen et al., 2010; Seo et al., 2014). Nevertheless, the
technical challenges of such assays should not be underesti-
mated. FACS can be time-consuming: genome-wide screens
require tens of millions of cells, equating to several hours of
sorting. Similarly, scaling presently available Transwell sizes
to the number of cells will involve hundreds of parallel experi-
ments, and may also require multiple rounds of selection to
achieve sufficient population separation (Smolen et al., 2010;
Seo et al., 2014).
Optimal Screening Considerations
During library creation and screening there are certain critical pa-
rameters that must be controlled to ensure sensitivity and spec-
ificity of final results.
Firstly, it is fundamentally important to maintain adequate li-
brary representation throughout the experiment. Representation
refers to the number of unique molecules (i.e., plasmids, infected
cells, NGS reads) that carry each library sequence, and should
far exceed the number of sequences in the library (ideally,
500-fold or more). This ensures that individual library sequences
do not randomly disappear from the population due to stochastic
effects, and yield sufficient statistical power for hit identification.
Suggestions for maintaining library coverage are shown in
Figure 3.
A second critical issue relates to various artifacts that can arise
during two main PCR steps, being amplification of (1) the oligo-
nucleotide pool during library cloning, and (2) genomic inserts for
NGS. For both, it is important to rigorously minimize amplifica-
tion cycles. A promising solution is to track individual library mol-
ecules using unique molecular identifiers (UMI), which can be
incorporated into the library design (Roy et al., 2018), or before
PCR amplification of the library preparation for sequencing
(Hong and Gresham, 2017; Smith et al., 2017a, 2017b) or into
the lentiviral backbone (Michlits et al., 2017). By enabling one
to count individual cells and molecules, instead of PCR ampli-
cons, UMIs should improve the accuracy of final hit identifica-
tion. However, even without them, the use of multiple unique tar-
geting constructs per lncRNA should go a long way to eliminating
PCR artifacts.
 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019
Cancer Cell
Review
Finally, it is recommended to perform at least biological dupli-
cates for each screen for reasons of statistical sensitivity in hit
identification (Li et al., 2014b).
Identification of Screen Hits
The final step of a CRISPR-screen is the identification of lncRNA
‘‘hits’’ from raw NGS data. Hits are defined on the basis of enrich-
ment or depletion of their sgRNAs in Pheno+ cells, compared
with Pheno (Figure 3).
From each selected cell sample, gDNA is extracted and lenti-
viral inserts amplified by PCR using generic, barcoded primers
flanking single or paired gRNAs (Figure 3D). gPCR products
carry unique sequence identifying their target, in a fragment
compatible with Illumina HiSeq, while barcodes allow one
to track individual samples and multiplex samples during NGS.
When working with pgRNAs for CRISPR-del, paired-end
sequencing should be used to capture both sgRNA sequences.
After NGS, raw sequencing reads are mapped to the original
library design and used to count instances of each sequence
in the library (Figure 3E). The output will be a file containing the
read counts for each sgRNA across all the Pheno+/– and repli-
cated samples. A table of these counts represents the input for
bioinformatic hit identification software.
Several statistical algorithms have been used to identify hits
in pooled screens using read counts: negative binomial distri-
butions (MAGeCK and ENCoRE), Bayesian analysis (BAGEL),
or probability mass function of a binomial distribution (STARS)
(Li et al., 2014b; Doench et al., 2016; Hart and Moffat, 2016).
Requirements are different for each tool; while STARS and
BAGEL require as input file the read count table, MAGeCK
and ENCoRE accept raw reads and perform median normaliza-
tion on read counts of the different samples to adjust for the
effect of library sizes and read count distributions. Finally,
ENCoRE provides a graphical interface, enabling non-bio-
informaticians to perform a complete analysis starting from
raw sequencing data (Trumbach et al., 2017). Of these
methods, MAGeCK would appear to be the most widely
used. Importantly, all these methods leverage the presence of
multiple sgRNAs per target and experimental replicates to
improve statistical confidence in hits.
The final outcome is a ranked series of lncRNA hit predictions
with false discovery rate (FDR) estimates and effect sizes to
serve as the starting point for experimental validation and
follow-up. Before embarking on time-consuming experimental
validation, it is prudent to first examine the performance of nega-
tive and positive control sgRNAs and targets. Furthermore, given
that the FDR correction of some methods appears to be exces-
sively stringent (specifically, MAGeCK; Zhu et al., 2016), a helpful
parallel method for hit identification is through the generation
of quantile-quantile plots, to examine the behavior of uncorrec-
ted p values.
Validations can be carried out using different perturbations to
deeply characterize lncRNA functions. For example, the PVT1
promoter was predicted to have tumor-suppressor activity by
a CRISPRi screen (Liu et al., 2017), in contrast to the PVT1
mature RNA, known to act as an oncogene (Tseng et al.,
2014). In a follow-up study, Cho et al. (2018) integrated
CRISPR-del, CRISPRa, CRISPRi, and other additional methods,
to validate the tumor-suppressor hypothesis.
The Path Ahead
CRISPR screening promises to unlock the potential of lncRNAs
as therapeutic targets in cancer. Its simplicity, low cost, and flex-
ibility bring transcriptome-wide screens within reach of the
average molecular oncology laboratory. We anticipate that
CRISPR screening for lncRNAs will be widely implemented
across all the major cancer types in the coming years. Neverthe-
less, it has clear conceptual differences to classical arrayed
screening, and labs embarking on such a project for the first
time must have a clear understanding of the optimal screen set
up for their system of interest. We have sought here to address
this, by introducing the rationale for CRISPR screening and prac-
tical steps for its implementation.
We foresee a number of future developments that will improve
the sensitivity and selectivity of screens, while improving the
biomedical relevance of hits. Firstly, screening phenotypes will
become more sophisticated and focused. So far, published
screens have been limited to the two most straightforward
phenotypes: proliferation and drug resistance. However, the
oncology field has developed a wide array of in vitro cell-based
phenotypic assays that model classical cancer ‘‘hallmarks,’’
and can often be readily adapted to pooled screening format.
We see the exciting prospect of such assays being used to
screen for lncRNAs mediating more focused hallmarks such as
migration, invasion, or sensitivity to apoptosis.
With the broad adoption of CRISPR screening technology for
studying the function of lncRNAs, a systematic evaluation of
CRISPR is essential. An important goal for the field is to create
confident gold standard sets of lncRNAs known to influence
phenotypes such as proliferation. Such sets can be incorporated
into targeting libraries, in order to benchmark screen perfor-
mance across cell lines and labs. Such efforts will benefit from
previous efforts such as ProjectDRIVE, which created lists of
essential protein-coding genes across hundreds of cell lines us-
ing RNAi (McDonald et al., 2017).
Although cell lines are the most widespread model used for
screening up-to-date, they often do not faithfully recapitulate
the complex biology of their original tumor. In theory, any cell
type can be screened, including primary cells (Parnas et al.,
2015), organoids (Matano et al., 2015), and in vivo xenografts
(Parnas et al., 2015). Although they carry important limitations,
these models better represent the tumor environment and
should be adapted to screens. The most obvious challenge for
all these models is generating sufficient cell numbers, and this
may be overcome by screening smaller libraries of candidates
obtained from prior, larger screens performed in cell lines (Wil-
liams et al., 2017).
Another area for improvement is lncRNA annotation: present
gene collections are poor, both in terms of missing many
lncRNAs, and in the TSS definition of included genes (Uszczyn-
ska-Ratajczak et al., 2018). The effectiveness of CRISPRi/a and
CRISPR-del depend crucially on identifying the correct TSS, so
inaccurate annotations are likely to result in numerous false-
negative predictions. Advances in lncRNA annotations will result
in larger and more potent CRISPR libraries.
CRISPR technologies themselves are in a phase of rapid
development. CRISPRi and CRISPRa enzymes are being engi-
neered for increased potency. Similarly, CRISPR-del efficiency
falls far short of 100% and may be improved in the future
Cancer Cell 35, April 15, 2019 9
 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019
(Song et al., 2017). Indeed, future technologies might implement
some kind of blunt end insertion to silence and tag edited cells
simultaneously (Roy et al., 2018).
In summary, we anticipate that CRISPR screening will
continue to evolve and improve in the coming years to become
an indispensable part of the functional cancer genomics toolkit
and uncover a wealth of new lncRNA drug targets.
ACKNOWLEDGMENTS
We acknowledge administrative support from Deborah Re and Silvia Roesse-
let (DBMR). Work in the Johnson laboratory is funded by the Swiss National
Science Foundation through the National Center of Competence in Research
(NCCR) ‘‘RNA & Disease,’’ the Medical Faculty of the University and University
Hospital of Bern, the Helmut Horten Stiftung, and the Swiss Cancer League.
REFERENCES
Abudayyeh, O.O., Gootenberg, J.S., Essletzbichler, P., Han, S., Joung, J., Be-
lanto, J.J., Verdine, V., Cox, D.B.T., Kellner, M.J., Regev, A., et al. (2017). RNA
targeting with CRISPR-Cas13. Nature 550, 280–284.
Adriaens, C., Standaert, L., Barra, J., Latil, M., Verfaillie, A., Kalev, P., Boeckx,
B., Wijnhoven, P.W., Radaelli, E., Vermi, W., et al. (2016). p53 induces forma-
tion of NEAT1 lncRNA-containing paraspeckles that modulate replication
stress response and chemosensitivity. Nat. Med. 22, 861–868.
Aguirre, A.J., Meyers, R.M., Weir, B.A., Vazquez, F., Zhang, C.Z., Ben-David,
U., Cook, A., Ha, G., Harrington, W.F., Doshi, M.B., et al. (2016). Genomic copy
number dictates a gene-independent cell response to CRISPR/Cas9 targeting.
Cancer Discov. 6, 914–929.
Alexanian, M., Maric, D., Jenkinson, S.P., Mina, M., Friedman, C.E., Ting, C.C.,
Micheletti, R., Plaisance, I., Nemir, M., Maison, D., et al. (2017). A transcribed
enhancer dictates mesendoderm specification in pluripotency. Nat. Commun.
8, 1806.
Aparicio-Prat, E., Arnan, C., Sala, I., Bosch, N., Guigó, R., and Johnson, R.
(2015). DECKO: single-oligo, dual-CRISPR deletion of genomic elements
including long non-coding RNAs. BMC Genomics 16, 846.
Arroyo, J.D., Jourdain, A.A., Calvo, S.E., Ballarano, C.A., Doench, J.G., Root,
D.E., and Mootha, V.K. (2016). A genome-wide CRISPR death screen identifies
genes essential for oxidative phosphorylation. Cell Metab. 24, 875–885.
Arun, G., Diermeier, S.D., and Spector, D.L. (2018). Therapeutic targeting of
long non-coding RNAs in cancer. Trends Mol. Med. 24, 257–277.
Bartonicek, N., Maag, J.L.V., and Dinger, M.E. (2016). Long noncoding RNAs
in cancer: mechanisms of action and technological advancements. Mol.
Cancer 15, 43.
Bassett, A.R., Akhtar, A., Barlow, D.P., Bird, A.P., Brockdorff, N., Duboule, D.,
Ephrussi, A., Ferguson-Smith, A.C., Gingeras, T.R., Haerty, W., et al. (2014).
Considerations when investigating lncRNA function in vivo. Elife 3, e03058.
Batra, R., Nelles, D.A., Pirie, E., Blue, S.M., Marina, R.J., Wang, H., Chaim, I.A.,
Thomas, J.D., Zhang, N., Nguyen, V., et al. (2017). Elimination of toxic micro-
satellite repeat expansion RNA by RNA-targeting Cas9. Cell 170, 899–
912.e10.
Bester, A.C., Lee, J.D., Chavez, A., Lee, Y.R., Nachmani, D., Vora, S., Victor, J.,
Sauvageau, M., Monteleone, E., Rinn, J.L., et al. (2018). An integrated
genome-wide CRISPRa approach to functionalize lncRNAs in drug resistance.
Cell 173, 649–664.e20.
Bhan, A., Soleimani, M., and Mandal, S.S. (2017). Long noncoding RNA and
cancer: a new paradigm. Cancer Res. 77, 3965–3981.
Buehler, E., Khan, A.A., Marine, S., Rajaram, M., Bahl, A., Burchard, J., and
Ferrer, M. (2012). siRNA off-target effects in genome-wide screens identify
signaling pathway members. Sci. Rep. 2, 428.
Cabili, M.N., Dunagin, M.C., McClanahan, P.D., Biaesch, A., Padovan-Merhar,
O., Regev, A., Rinn, J.L., and Raj, A. (2015). Localization and abundance anal-
ysis of human lncRNAs at single-cell and single-molecule resolution. Genome
Biol. 16, 20.
10 Cancer Cell 35, April 15, 2019
Cancer Cell
Review
Canver, M.C., Bauer, D.E., Dass, A., Yien, Y.Y., Chung, J., Masuda, T., Maeda,
T., Paw, B.H., and Orkin, S.H. (2014). Characterization of genomic deletion
efficiency mediated by CRISPR/Cas9 in mammalian cells. J. Biol. Chem.
289, 21312–21324.
Carlevaro-Fita, J., Lanzós, A., Feuerbach, L., Chen, H., Mas-Ponte, D.,
PCAWG Driver Identification Working Group, Guigó, R., Pedersen, J.S., and
Johnson, R. (2017). Unique genomic features and deeply-conserved functions
of long non-coding RNAs in the Cancer LncRNA Census (CLC). bioRxiv,
152769.
Chakravarty, D., Sboner, A., Nair, S.S., Giannopoulou, E., Li, R., Hennig, S.,
Mosquera, J.M., Pauwels, J., Park, K., Kossai, M., et al. (2014). The oestrogen
receptor alpha-regulated lncRNA NEAT1 is a critical modulator of prostate
cancer. Nat. Commun. 5, 5383.
Chavez, A., Scheiman, J., Vora, S., Pruitt, B.W., Tuttle, M., P R Iyer, E., Lin, S.,
Kiani, S., Guzman, C.D., Wiegand, D.J., et al. (2015). Highly efficient Cas9-
mediated transcriptional programming. Nat. Methods 12, 326–328.
Chen, G., Wang, Z., Wang, D., Qiu, C., Liu, M., Chen, X., Zhang, Q., Yan, G.,
and Cui, Q. (2013). LncRNADisease: a database for long-non-coding RNA-
associated diseases. Nucleic Acids Res. 41 (Database issue), D983–D986.
Cho, S.W., Xu, J., Sun, R., Mumbach, M.R., Carter, A.C., Chen, Y.G., Yost,
K.E., Kim, J., He, J., Nevins, S.A., et al. (2018). Promoter of lncRNA gene
PVT1 is a tumor-suppressor DNA boundary element. Cell 173, 1398–1412.e22.
Clemson, C.M., Hutchinson, J.N., Sara, S.A., Ensminger, A.W., Fox, A.H.,
Chess, A., and Lawrence, J.B. (2009). An architectural role for a nuclear non-
coding RNA: NEAT1 RNA is essential for the structure of paraspeckles. Mol.
Cell 33, 717–726.
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X.,
Jiang, W., Marraffini, L.A., et al. (2013). Multiplex genome engineering using
CRISPR/Cas systems. Science 339, 819–823.
Delas, M.J., Sabin, L.R., Dolzhenko, E., Knott, S.R., Munera Maravilla, E.,
Jackson, B.T., Wild, S.A., Kovacevic, T., Stork, E.M., Zhou, M., et al. (2017).
lncRNA requirements for mouse acute myeloid leukemia and normal differen-
tiation. Elife 6, https://doi.org/10.7554/eLife.25607.
Derrien, T., Johnson, R., Bussotti, G., Tanzer, A., Djebali, S., Tilgner, H., Guer-
nec, G., Martin, D., Merkel, A., Knowles, D.G., et al. (2012). The GENCODE v7
catalog of human long noncoding RNAs: analysis of their gene structure, evo-
lution, and expression. Genome Res. 22, 1775–1789.
Dias, N., and Stein, C.A. (2002). Antisense oligonucleotides: basic concepts
and mechanisms. Mol. Cancer Ther. 1, 347–355.
DiStefano, J.K. (2018). The emerging role of long noncoding RNAs in human
disease. Methods Mol. Biol. 1706, 91–110.
Doench, J.G., Hartenian, E., Graham, D.B., Tothova, Z., Hegde, M., Smith, I.,
Sullender, M., Ebert, B.L., Xavier, R.J., Root, D.E., et al. (2014). Rational design
of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat.
Biotechnol. 32, 1262–1267.
Doench, J.G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E.W., Donovan,
K.F., Smith, I., Tothova, Z., Wilen, C., Orchard, R., et al. (2016). Optimized
sgRNA design to maximize activity and minimize off-target effects of
CRISPR-Cas9. Nat. Biotechnol. 34, 184–191.
Dominguez, A.A., Lim, W.A., and Qi, L.S. (2016). Beyond editing: repurposing
CRISPR-Cas9 for precision genome regulation and interrogation. Nat. Rev.
Mol. Cell Biol. 17, 5–15.
Du, Z., Fei, T., Verhaak, R.G., Su, Z., Zhang, Y., Brown, M., Chen, Y., and Liu,
X.S. (2013). Integrative genomic analyses reveal clinically relevant long non-
coding RNAs in human cancer. Nat. Struct. Mol. Biol. 20, 908–913.
ENCODE Project Consortium (2012). An integrated encyclopedia of DNA ele-
ments in the human genome. Nature 489, 57–74.
Engreitz, J.M., Haines, J.E., Perez, E.M., Munson, G., Chen, J., Kane, M.,
McDonel, P.E., Guttman, M., and Lander, E.S. (2016). Local regulation of
gene expression by lncRNA promoters, transcription and splicing. Nature
539, 452–455.
Ernst, J., and Kellis, M. (2017). Chromatin-state discovery and genome anno-
tation with ChromHMM. Nat. Protoc. 12, 2478–2492.
 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019
Cancer Cell
Review
Fang, Y., and Fullwood, M.J. (2016). Roles, functions, and mechanisms of long
non-coding RNAs in cancer. Genomics Proteomics Bioinformatics 14, 42–54.
Feng, W., Li, L., Xu, X., Jiao, Y., and Du, W. (2017). Up-regulation of the long
non-coding RNA RMRP contributes to glioma progression and promotes gli-
oma cell proliferation and invasion. Arch. Med. Sci. 13, 1315–1321.
FANTOM Consortium and the RIKEN PMI and CLST (DGT), Forrest, A.R., Ka-
waji, H., Rehli, M., Baillie, J.K., de Hoon, M.J., Haberle, V., Lassmann, T., Ku-
lakovskiy, I.V., Lizio, M., et al. (2014). A promoter-level mammalian expression
atlas. Nature 507, 462–470.
Futreal, P.A., Coin, L., Marshall, M., Down, T., Hubbard, T., Wooster, R., Rah-
man, N., and Stratton, M.R. (2004). A census of human cancer genes. Nat. Rev.
Cancer 4, 177–183.
Gilbert, L.A., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., Stern-
Ginossar, N., Brandman, O., Whitehead, E.H., Doudna, J.A., et al. (2013).
CRISPR-mediated modular RNA-guided regulation of transcription in eukary-
otes. Cell 154, 442–451.
Goyal, A., Myacheva, K., Groß, M., Klingenberg, M., Duran Arqué, B., and
Diederichs, S. (2017). Challenges of CRISPR/Cas9 applications for long non-
coding RNA genes. Nucleic Acids Res. 45, e12.
Graham, D.B., and Root, D.E. (2015). Resources for the design of CRISPR
gene editing experiments. Genome Biol. 16, 260.
Groff, A.F., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., Stern-Gi-
nossar, N., Brandman, O., Whitehead, E.H., Doudna, J.A., et al. (2016). In vivo
characterization of linc-p21 reveals functional cis-regulatory DNA elements.
Cell Rep. 16, 2178–2186.
Gupta, R.A., Shah, N., Wang, K.C., Kim, J., Horlings, H.M., Wong, D.J., Tsai,
M.C., Hung, T., Argani, P., Rinn, J.L., et al. (2010). Long non-coding RNA
HOTAIR reprograms chromatin state to promote cancer metastasis. Nature
464, 1071–1076.
€mmerle, M., Eissmann, M., Hsu, J., Kim, Y., Hung, G., Re-
Gutschner, T., Ha
venko, A., Arun, G., Stentrup, M., Gross, M., et al. (2013). The noncoding
RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer
cells. Cancer Res. 73, 1180–1189.
Gutschner, T., Baas, M., and Diederichs, S. (2011). Noncoding RNA gene
silencing through genomic integration of RNA destabilizing elements using
zinc finger nucleases. Genome Res. 21, 1944–1954.
Gutschner, T., and Diederichs, S. (2012). The hallmarks of cancer: a long non-
coding RNA point of view. RNA Biol. 9, 703–719.
Guttman, M., and Rinn, J.L. (2012). Modular regulatory principles of large non-
coding RNAs. Nature 482, 339–346.
Haapaniemi, E., Botla, S., Persson, J., Schmierer, B., and Taipale, J. (2018).
CRISPR-Cas9 genome editing induces a p53-mediated DNA damage
response. Nat. Med. 24, 927–930.
Haeussler, M., Schönig, K., Eckert, H., Eschstruth, A., Mianné, J., Renaud,
J.B., Schneider-Maunoury, S., Shkumatava, A., Teboul, L., Kent, J., et al.
(2016). Evaluation of off-target and on-target scoring algorithms and integra-
tion into the guide RNA selection tool CRISPOR. Genome Biol. 17, 148.
Han, J., Zhang, J., Chen, L., Shen, B., Zhou, J., Hu, B., Du, Y., Tate, P.H.,
Huang, X., Zhang, W., et al. (2014). Efficient in vivo deletion of a large imprinted
lncRNA by CRISPR/Cas9. RNA Biol. 11, 829–835.
Hanahan, D., and Weinberg, R.A. (2000). The hallmarks of cancer. Cell
100, 57–70.
Hanahan, D., and Weinberg, R.A. (2011). Hallmarks of cancer: the next gener-
ation. Cell 144, 646–674.
Hart, T., and Moffat, J. (2016). BAGEL: a computational framework for identi-
fying essential genes from pooled library screens. BMC Bioinformatics
17, 164.
Ho, T.-T., Zhou, N., Huang, J., Koirala, P., Xu, M., Fung, R., Wu, F., and Mo,
Y.Y. (2015). Targeting non-coding RNAs with the CRISPR/Cas9 system in hu-
man cell lines. Nucleic Acids Res. 43, e17.
Hodgkins, A., Farne, A., Perera, S., Grego, T., Parry-Smith, D.J., Skarnes,
W.C., and Iyer, V. (2015). WGE: a CRISPR database for genome engineering.
Bioinformatics 31, 3078–3080.
Holdt, L.M., Stahringer, A., Sass, K., Pichler, G., Kulak, N.A., Wilfert, W., Kohl-
maier, A., Herbst, A., Northoff, B.H., Nicolaou, A., et al. (2016). Circular non-
coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis
in humans. Nat. Commun. 7, 12429.
Hong, J., and Gresham, D. (2017). Incorporation of unique molecular identifiers
in TruSeq adapters improves the accuracy of quantitative sequencing.
BioTechniques 63, 221–226.
Horlbeck, M.A., Gilbert, L.A., Villalta, J.E., Adamson, B., Pak, R.A., Chen, Y.,
Fields, A.P., Park, C.Y., Corn, J.E., Kampmann, M., et al. (2016a). Compact
and highly active next-generation libraries for CRISPR-mediated gene repres-
sion and activation. Elife 5, https://doi.org/10.7554/eLife.19760.
Horlbeck, M.A., Witkowsky, L.B., Guglielmi, B., Replogle, J.M., Gilbert, L.A.,
Villalta, J.E., Torigoe, S.E., Tjian, R., and Weissman, J.S. (2016b). Nucleo-
somes impede Cas9 access to DNA in vivo and in vitro. Elife 5, https://doi.
org/10.7554/eLife.12677.
Hosono, Y., Niknafs, Y.S., Prensner, J.R., Iyer, M.K., Dhanasekaran, S.M.,
Mehra, R., Pitchiaya, S., Tien, J., Escara-Wilke, J., Poliakov, A., et al. (2017).
Oncogenic role of THOR, a conserved cancer/testis long non-coding RNA.
Cell 171, 1559–1572.e20.
Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V.,
Li, Y., Fine, E.J., Wu, X., Shalem, O., et al. (2013). DNA targeting specificity of
RNA-guided Cas9 nucleases. Nat. Biotechnol. 31, 827–832.
Huarte, M. (2015). The emerging role of lncRNAs in cancer. Nat. Med. 21,
1253–1261.
Hung, T., Wang, Y., Lin, M.F., Koegel, A.K., Kotake, Y., Grant, G.D., Horlings,
H.M., Shah, N., Umbricht, C., Wang, P., et al. (2011). Extensive and coordi-
nated transcription of noncoding RNAs within cell-cycle promoters. Nat.
Genet. 43, 621–629.
Iyer, M.K., Niknafs, Y.S., Malik, R., Singhal, U., Sahu, A., Hosono, Y., Barrette,
T.R., Prensner, J.R., Evans, J.R., Zhao, S., et al. (2015). The landscape of long
noncoding RNAs in the human transcriptome. Nat. Genet. 47, 199–208.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier,
E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive
bacterial immunity. Science 337, 816–821.
Johnson, R., and Guigó, R. (2014). The RIDL hypothesis: transposable ele-
ments as functional domains of long noncoding RNAs. RNA 20, 959–976.
Joung, J., Engreitz, J.M., Konermann, S., Abudayyeh, O.O., Verdine, V.K.,
Aguet, F., Gootenberg, J.S., Sanjana, N.E., Wright, J.B., Fulco, C.P., et al.
(2017a). Genome-scale activation screen identifies a lncRNA locus regulating
a gene neighbourhood. Nature 548, 343–346.
Joung, J., Konermann, S., Gootenberg, J.S., Abudayyehv, O.O., Platt, R.J.,
Brigham, M.D., Sanjana, N.E., and Zhang, F. (2017b). Genome-scale
CRISPR-Cas9 knockout and transcriptional activation screening. Nat. Protoc.
12, 828–863.
Juliano, R.L. (2016). The delivery of therapeutic oligonucleotides. Nucleic
Acids Res. 44, 6518–6548.
Khurana, E., Fu, Y., Chakravarty, D., Demichelis, F., Rubin, M.A., and Gerstein,
M. (2016). Role of non-coding sequence variants in cancer. Nat. Rev. Genet.
17, 93–108.
Kim, J., Piao, H.L., Kim, B.J., Yao, F., Han, Z., Wang, Y., Xiao, Z., Siverly, A.N.,
Lawhon, S.E., Ton, B.N., et al. (2018). Long noncoding RNA MALAT1 sup-
presses breast cancer metastasis. Nat. Genet. 50, 1705–1715.
Koirala, P., Huang, J., Ho, T.T., Wu, F., Ding, X., and Mo, Y.Y. (2017). LncRNA
AK023948 is a positive regulator of AKT. Nat. Commun. 8, 14422.
Konermann, S., Brigham, M.D., Trevino, A.E., Joung, J., Abudayyeh, O.O.,
Barcena, C., Hsu, P.D., Habib, N., Gootenberg, J.S., Nishimasu, H., et al.
(2015). Genome-scale transcriptional activation by an engineered CRISPR-
Cas9 complex. Nature 517, 583–588.
Kopp, F., and Mendell, J.T. (2018). Functional classification and experimental
dissection of long noncoding RNAs. Cell 172, 393–407.
Lagarde, J., Uszczynska-Ratajczak, B., Carbonell, S., Pérez-Lluch, S., Abad,
A., Davis, C., Gingeras, T.R., Frankish, A., Harrow, J., Guigo, R., et al.
(2017). High-throughput annotation of full-length long noncoding RNAs with
capture long-read sequencing. Nat. Genet. 49, 1731–1740.
Cancer Cell 35, April 15, 2019 11
 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019
Lahens, N.F., Kavakli, I.H., Zhang, R., Hayer, K., Black, M.B., Dueck, H., Pi-
zarro, A., Kim, J., Irizarry, R., Thomas, R.S., et al. (2014). IVT-seq reveals
extreme bias in RNA sequencing. Genome Biol. 15, R86.
Lanzós, A., Carlevaro-Fita, J., Mularoni, L., Reverter, F., Palumbo, E., Guigó,
R., and Johnson, R. (2017). Discovery of cancer driver long noncoding RNAs
across 1112 tumour genomes: new candidates and distinguishing features.
Sci. Rep. 7, 41544.
Latos, P.A., Pauler, F.M., Koerner, M.V., Sxenergin, H.B., Hudson, Q.J., Stoc-
sits, R.R., Allhoff, W., Stricker, S.H., Klement, R.M., Warczok, K.E., et al.
(2012). Airn transcriptional overlap, but not its lncRNA products, induces im-
printed Igf2r silencing. Science 338, 1469–1472.
Lee, S., Kopp, F., Chang, T.C., Sataluri, A., Chen, B., Sivakumar, S., Yu, H., Xie,
Y., and Mendell, J.T. (2016). Noncoding RNA NORAD regulates genomic sta-
bility by sequestering PUMILIO proteins. Cell 164, 69–80.
Leucci, E., Vendramin, R., Spinazzi, M., Laurette, P., Fiers, M., Wouters, J., Ra-
daelli, E., Eyckerman, S., Leonelli, C., Vanderheyden, K., et al. (2016). Mela-
noma addiction to the long non-coding RNA SAMMSON. Nature 531,
518–522.
Li, H., Zhang, Y., Ströse, A., Tedesco, D., Gurova, K., and Selivanova, G.
(2014a). Integrated high-throughput analysis identifies Sp1 as a crucial deter-
minant of p53-mediated apoptosis. Cell Death Differ. 21, 1493–1502.
Li, W., Xu, H., Xiao, T., Cong, L., Love, M.I., Zhang, F., Irizarry, R.A., Liu, J.S.,
Brown, M., Liu, X.S., et al. (2014b). MAGeCK enables robust identification
of essential genes from genome-scale CRISPR/Cas9 knockout screens.
Genome Biol. 15, 554.
Lin, A., Hu, Q., Li, C., Xing, Z., Ma, G., Wang, C., Li, J., Ye, Y., Yao, J., Liang, K.,
et al. (2017). The LINK-A lncRNA interacts with PtdIns(3,4,5)P3 to hyperacti-
vate AKT and confer resistance to AKT inhibitors. Nat. Cell Biol. 19, 238–251.
Lin, C., and Yang, L. (2018). Long noncoding RNA in cancer: wiring signaling
circuitry. Trends Cell Biol. 28, 287–301.
Liu, S.J., Horlbeck, M.A., Cho, S.W., Birk, H.S., Malatesta, M., He, D., Atte-
nello, F.J., Villalta, J.E., Cho, M., Chen, Y., et al. (2017). CRISPRi-based
genome-scale identification of functional long noncoding RNA loci in human
cells. Science 355, https://doi.org/10.1126/science.aah7111.
Liu, Y., Cao, Z., Wang, Y., Guo, Y., Xu, P., Yuan, P., Liu, Z., He, Y., and Wei, W.
(2018). Genome-wide screening for functional long noncoding RNAs in human
cells by Cas9 targeting of splice sites. Nat. Biotechnol. 36, 1203–1210.
Maamar, H., Cabili, M.N., Rinn, J., and Raj, A. (2013). linc-HOXA1 is a noncod-
ing RNA that represses HoXa1 transcription in cis. Genes Dev. 27, 1260–1271.
Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E.,
and Church, G.M. (2013). RNA-guided human genome engineering via Cas9.
Science 339, 823–826.
Mandegar, M.A., Huebsch, N., Frolov, E.B., Shin, E., Truong, A., Olvera, M.P.,
Chan, A.H., Miyaoka, Y., Holmes, K., Spencer, C.I., Judge, L.M., et al. (2016).
CRISPR interference efficiently induces specific and reversible gene silencing
in human iPSCs. Cell Stem Cell 18, 541–553.
Marin-Bejar, O., Marchese, F.P., Athie, A., Sánchez, Y., González, J., Segura,
V., Huang, L., Moreno, I., Navarro, A., Monzó, M., Garcı́a-Foncillas, J., et al.
(2013). Pint lincRNA connects the p53 pathway with epigenetic silencing by
the Polycomb repressive complex 2. Genome Biol. 14, R104.
Marin-Bejar, O., Mas, A.M., González, J., Martinez, D., Athie, A., Morales, X.,
Galduroz, M., Raimondi, I., Grossi, E., Guo, S., Rouzaut, A., et al. (2017). The
human lncRNA LINC-PINT inhibits tumor cell invasion through a highly
conserved sequence element. Genome Biol. 18, 202.
Matano, M., Date, S., Shimokawa, M., Takano, A., Fujii, M., Ohta, Y., Wata-
nabe, T., Kanai, T., and Sato, T. (2015). Modeling colorectal cancer using
CRISPR-Cas9-mediated engineering of human intestinal organoids. Nat.
Med. 21, 256–262.
McDonald, E.R., 3rd, de Weck, A., Schlabach, M.R., Billy, E., Mavrakis, K.J.,
Hoffman, G.R., Belur, D., Castelletti, D., Frias, E., Gampa, K., et al. (2017). Proj-
ect DRIVE: a compendium of cancer dependencies and synthetic lethal rela-
tionships uncovered by large-scale, deep RNAi screening. Cell 170, 577–
592.e10.
Mello, S.S., Sinow, C., Raj, N., Mazur, P.K., Bieging-Rolett, K., Broz, D.K.,
Imam, J.F.C., Vogel, H., Wood, L.D., Sage, J., Hirose, T., et al. (2017). Neat1
12 Cancer Cell 35, April 15, 2019
Cancer Cell
Review
is a p53-inducible lincRNA essential for transformation suppression. Genes
Dev. 31, 1095–1108.
Meng, Q., Ren, M., Li, Y., and Song, X. (2016). LncRNA-RMRP acts as an
oncogene in lung cancer. PLoS One 11, e0164845.
Michlits, G., Hubmann, M., Wu, S.H., Vainorius, G., Budusan, E., Zhuk, S.,
Burkard, T.R., Novatchkova, M., Aichinger, M., Lu, Y., et al. (2017). CRISPR-
UMI: single-cell lineage tracing of pooled CRISPR-Cas9 screens. Nat.
Methods 14, 1191–1197.
Moreno-Mateos, M.A., Vejnar, C.E., Beaudoin, J.D., Fernandez, J.P., Mis, E.K.,
Khokha, M.K., and Giraldez, A.J. (2015). CRISPRscan: designing highly effi-
cient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat. Methods 12, 982–988.
Mularoni, L., Sabarinathan, R., Deu-Pons, J., Gonzalez-Perez, A., and López-
Bigas, N. (2016). OncodriveFML: a general framework to identify coding and
non-coding regions with cancer driver mutations. Genome Biol. 17, 128.
Munoz, D.M., Cassiani, P.J., Li, L., Billy, E., Korn, J.M., Jones, M.D., Golji, J.,
Ruddy, D.A., Yu, K., McAllister, G., et al. (2016). CRISPR screens provide a
comprehensive assessment of cancer vulnerabilities but generate false-posi-
tive hits for highly amplified genomic regions. Cancer Discov. 6, 900–913.
Nelles, D.A., Fang, M.Y., O’Connell, M.R., Xu, J.L., Markmiller, S.J., Doudna,
J.A., and Yeo, G.W. (2016). Programmable RNA tracking in live cells with
CRISPR/Cas9. Cell 165, 488–496.
Nellore, A., Jaffe, A.E., Fortin, J.P., Alquicira-Hernández, J., Collado-Torres, L.,
Wang, S., Phillips, R.A., III, Karbhari, N., Hansen, K.D., Langmead, B., et al.
(2016). Human splicing diversity and the extent of unannotated splice junctions
across human RNA-seq samples on the Sequence Read Archive. Genome
Biol. 17, 266.
Ning, S., Zhang, J., Wang, P., Zhi, H., Wang, J., Liu, Y., Gao, Y., Guo, M., Yue,
M., Wang, L., et al. (2016). Lnc2Cancer: a manually curated database of exper-
imentally supported lncRNAs associated with various human cancers. Nucleic
Acids Res. 44, D980–D985.
O’Connell, M.R., Oakes, B.L., Sternberg, S.H., East-Seletsky, A., Kaplan, M.,
and Doudna, J.A. (2014). Programmable RNA recognition and cleavage by
CRISPR/Cas9. Nature 516, 263–266.
Pandey, G.K., Mitra, S., Subhash, S., Hertwig, F., Kanduri, M., Mishra, K., Frans-
son, S., Ganeshram, A., Mondal, T., Bandaru, S., et al. (2014). The risk-associ-
ated long noncoding RNA NBAT-1 controls neuroblastoma progression by regu-
lating cell proliferation and neuronal differentiation. Cancer Cell 26, 722–737.
Panzitt, K., Tschernatsch, M.M., Guelly, C., Moustafa, T., Stradner, M., Stroh-
maier, H.M., Buck, C.R., Denk, H., Schroeder, R., Trauner, M., et al. (2007).
Characterization of HULC, a novel gene with striking up-regulation in hepato-
cellular carcinoma, as noncoding RNA. Gastroenterology 132, 330–342.
Parnas, O., Jovanovic, M., Eisenhaure, T.M., Herbst, R.H., Dixit, A., Ye, C.J.,
Przybylski, D., Platt, R.J., Tirosh, I., Sanjana, N.E., Shalem, O., et al. (2015).
A genome-wide CRISPR screen in primary immune cells to dissect regulatory
networks. Cell 162, 675–686.
Peretz, L., Besser, E., Hajbi, R., Casden, N., Ziv, D., Kronenberg, N., Gigi, L.B.,
Sweetat, S., Khawaled, S., Aqeilan, R., et al. (2018). Combined shRNA over
CRISPR/cas9 as a methodology to detect off-target effects and a potential
compensatory mechanism. Sci. Rep. 8, 93.
Perez-Pinera, P., Kocak, D.D., Vockley, C.M., Adler, A.F., Kabadi, A.M., Pol-
stein, L.R., Thakore, P.I., Glass, K.A., Ousterout, D.G., Leong, K.W., et al.
(2013). RNA-guided gene activation by CRISPR-Cas9-based transcription
factors. Nat. Methods 10, 973–976.
Pickard, M.R., and Williams, G.T. (2015). Molecular and cellular mechanisms of
action of tumour suppressor GAS5 LncRNA. Genes 6, 484–499.
Portoso, M., Ragazzini, R., Brencic  Moiani, A., Michaud, A., Vassilev, I., Was-
, Z.,
sef, M., Servant, N., Sargueil, B., Margueron, R., et al. (2017). PRC2 is dispens-
able for HOTAIR-mediated transcriptional repression. EMBO J. 36, 981–994.
Pulido-Quetglas, C., Aparicio-Prat, E., Arnan, C., Polidori, T., Hermoso, T., Pal-
umbo, E., Ponomarenko, J., Guigo, R., and Johnson, R. (2017). Scalable
design of paired crispr guide RNAs for genomic deletion. PLoS Comput.
Biol. 13, e1005341.
Qi, L.S., Larson, M.H., Gilbert, L.A., Doudna, J.A., Weissman, J.S., Arkin, A.P.,
and Lim, W.A. (2013). Repurposing CRISPR as an RNA-guided platform for
sequence-specific control of gene expression. Cell 152, 1173–1183.
 Please cite this article in press as: Esposito et al., Hacking the Cancer Genome: Profiling Therapeutically Actionable Long Non-coding RNAs Using
CRISPR-Cas9 Screening, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.01.019
Cancer Cell
Review
Quek, X.C., Thomson, D.W., Maag, J.L., Bartonicek, N., Signal, B., Clark, M.B.,
Gloss, B.S., and Dinger, M.E. (2015). lncRNAdb v2.0: expanding the reference
database for functional long noncoding RNAs. Nucleic Acids Res. 43, D168–D173.
Quinodoz, S., and Guttman, M. (2014). Long noncoding RNAs: an emerging
link between gene regulation and nuclear organization. Trends Cell Biol. 24,
651–663.
Radzisheuskaya, A., Shlyueva, D., Mu €ller, I., and Helin, K. (2016). Optimizing
sgRNA position markedly improves the efficiency of CRISPR/dCas9-mediated
transcriptional repression. Nucleic Acids Res. 44, e141.
Rheinbay, E., Nielsen, M.M., Abascal, F., Tiao, G., Hornshøj, H., Hess, J.M.,
Pedersen, R.I.I., Feuerbach, L., Sabarinathan, R., Madsen, H.T., et al. (2017).
Discovery and characterization of coding and non-coding driver mutations in
more than 2,500 whole cancer genomes. bioRxiv, 237313.
Rosenbluh, J., Xu, H., Harrington, W., Gill, S., Wang, X., Vazquez, F., Root,
D.E., Tsherniak, A., and Hahn, W.C. (2017). Complementary information
derived from CRISPR Cas9 mediated gene deletion and suppression. Nat.
Commun. 8, 15403.
Ross, S.J., Revenko, A.S., Hanson, L.L., Ellston, R., Staniszewska, A.,
Whalley, N., Pandey, S.K., Revill, M., Rooney, C., Buckett, L.K., et al. (2017).
Targeting KRAS-dependent tumors with AZD4785, a high-affinity therapeutic
antisense oligonucleotide inhibitor of KRAS. Sci. Transl Med. 9, https://doi.
org/10.1126/scitranslmed.aal5253.
Roy, K.R., Smith, J.D., Vonesch, S.C., Lin, G., Tu, C.S., Lederer, A.R., Chu, A.,
Suresh, S., Nguyen, M., Horecka, J., et al. (2018). Multiplexed precision
genome editing with trackable genomic barcodes in yeast. Nat. Biotechnol.
36, 512–520.
Sanjana, N.E., Shalem, O., and Zhang, F. (2014). Improved vectors and
genome-wide libraries for CRISPR screening. Nat. Methods 11, 783–784.
Sanson, K.R., Hanna, R.E., Hegde, M., Donovan, K.F., Strand, C., Sullender,
M.E., Vaimberg, E.W., Goodale, A., Root, D.E., Piccioni, F., et al. (2018). Up,
down, and out: optimized libraries for CRISPRa, CRISPRi, and CRISPR-
knockout genetic screens. bioRxiv, 356626.
Scharner, J., Rigo, F., Bennett, C.F., and Krainer, A.R. (2018). Delivery of Gal-
NAc-conjugated splice-switching ASOs to non-hepatic cells through ectopic
expression of asialoglycoprotein receptor. bioRxiv, 382606.
Seiler, J., Breinig, M., Caudron-Herger, M., Polycarpou-Schwarz, M., Boutros,
M., and Diederichs, S. (2017). The lncRNA VELUCT strongly regulates viability
of lung cancer cells despite its extremely low abundance. Nucleic Acids Res.
45, 5458–5469.
Seo, M., Lee, S., Kim, J.H., Lee, W.H., Hu, G., Elledge, S.J., and Suk, K. (2014).
RNAi-based functional selection identifies novel cell migration determinants
dependent on PI3K and AKT pathways. Nat. Commun. 5, 5217.
Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelson, T.,
Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G., et al. (2014). Genome-scale
CRISPR-Cas9 knockout screening in human cells. Science 343, 84–87.
Shao, Y., Shao, Y., Ye, M., Li, Q., Sun, W., Ye, G., Zhang, X., Yang, Y., Xiao, B.,
Guo, J., et al. (2016). LncRNA-RMRP promotes carcinogenesis by acting as a
miR-206 sponge and is used as a novel biomarker for gastric cancer. Oncotar-
get 7, 37812–37824.
Shtivelman, E., and Bishop, J.M. (1989). The PVT gene frequently amplifies
with MYC in tumor cells. Mol. Cell. Biol. 9, 1148–1154.
Smith, I., Greenside, P.G., Natoli, T., Lahr, D.L., Wadden, D., Tirosh, I., Nar-
ayan, R., Root, D.E., Golub, T.R., Subramanian, A., et al. (2017a). Evaluation
of RNAi and CRISPR technologies by large-scale gene expression profiling
in the connectivity map. PLoS Biol. 15, e2003213.
Smith, T., Heger, A., and Sudbery, I. (2017b). UMI-tools: modeling sequencing
errors in Unique Molecular Identifiers to improve quantification accuracy.
Genome Res. 27, 491–499.
Smolen, G.A., Zhang, J., Zubrowski, M.J., Edelman, E.J., Luo, B., Yu, M., Ng,
L.W., Scherber, C.M., Schott, B.J., Ramaswamy, S., et al. (2010). A genome-
wide RNAi screen identifies multiple RSK-dependent regulators of cell migra-
tion. Genes Dev. 24, 2654–2665.
Song, Y., Lai, L., and Li, Z. (2017). Large-scale genomic deletions mediated by
CRISPR/Cas9 system. Oncotarget 8, 5647.
Stojic, L., Lun, A.T.L., Mangei, J., Mascalchi, P., Quarantotti, V., Barr, A.R., Ba-
kal, C., Marioni, J.C., Gergely, F., Odom, D.T., et al. (2018). Specificity of RNAi,
LNA and CRISPRi as loss-of-function methods in transcriptional analysis. Nu-
cleic Acids Res. 46, 5950–5966.
Sun, R., Qin, C., Jiang, B., Fang, S., Pan, X., Peng, L., Liu, Z., Li, W., Li, Y., Li,
G., et al. (2016). Down-regulation of MALAT1 inhibits cervical cancer cell inva-
sion and metastasis by inhibition of epithelial-mesenchymal transition. Mol.
Biosyst. 12, 952–962.
Tanenbaum, M.E., Gilbert, L.A., Qi, L.S., Weissman, J.S., and Vale, R.D.
(2014). A protein-tagging system for signal amplification in gene expression
and fluorescence imaging. Cell 159, 635–646.
Tang, Q., and Hann, S.S. (2018). HOTAIR: an oncogenic long non-coding RNA
in human cancer. Cell Physiol. Biochem. 47, 893–913.
Trumbach, D., Pfeiffer, S., Poppe, M., Scherb, H., Doll, S., Wurst, W., and
Schick, J.A. (2017). ENCoRE: an efficient software for CRISPR screens iden-
tifies new players in extrinsic apoptosis. BMC Genomics 18, 905.
Tseng, Y.-Y., Moriarity, B.S., Gong, W., Akiyama, R., Tiwari, A., Kawakami, H.,
Ronning, P., Reuland, B., Guenther, K., Beadnell, T.C., et al. (2014). PVT1
dependence in cancer with MYC copy-number increase. Nature 512, 82–86.
Ulitsky, I., Shkumatava, A., Jan, C.H., Sive, H., and Bartel, D.P. (2011).
Conserved function of lincRNAs in vertebrate embryonic development despite
rapid sequence evolution. Cell 147, 1537–1550.
Ulitsky, I., and Bartel, D.P. (2013). XLincRNAs: genomics, evolution, and
mechanisms. Cell 154, 26–46.
Uszczynska-Ratajczak, B., Lagarde, J., Frankish, A., Guigó, R., and Johnson,
R. (2018). Towards a complete map of the human long non-coding RNA tran-
scriptome. Nat. Rev. Genet. 19, 535–548.
Vance, K.W., and Ponting, C.P. (2014). Transcriptional regulatory functions of
nuclear long noncoding RNAs. Trends Genet. 30, 348–355.
Vidigal, J.A., and Ventura, A. (2015). Rapid and efficient one-step generation of
paired gRNA CRISPR-Cas9 libraries. Nat. Commun. 6, 8083.
Watts, J.K., and Corey, D.R. (2012). Silencing disease genes in the laboratory
and the clinic. J. Pathol. 226, 365–379.
West, J.A., Davis, C.P., Sunwoo, H., Simon, M.D., Sadreyev, R.I., Wang, P.I.,
Tolstorukov, M.Y., and Kingston, R.E. (2014). The long noncoding RNAs
NEAT1 and MALAT1 bind active chromatin sites. Mol. Cell 55, 791–802.
Williams, S.P., Barthorpe, A.S., Lightfoot, H., Garnett, M.J., and McDermott, U.
(2017). High-throughput RNAi screen for essential genes and drug synergistic
combinations in colorectal cancer. Sci. Data 4, 170139.
Wutz, A., Rasmussen, T.P., and Jaenisch, R. (2002). Chromosomal silencing
and localization are mediated by different domains of Xist RNA. Nat. Genet.
30, 167–174.
Xing, Y.-H., Yao, R.W., Zhang, Y., Guo, C.J., Jiang, S., Xu, G., Dong, R., Yang,
L., and Chen, L.L. (2017). SLERT regulates DDX21 rings associated with Pol I
transcription. Cell 169, 664–678.e16.
Xu, H., Xiao, T., Chen, C.H., Li, W., Meyer, C.A., Wu, Q., Wu, D., Cong, L.,
Zhang, F., Liu, J.S., et al. (2015). Sequence determinants of improved CRISPR
sgRNA design. Genome Res. 25, 1147–1157.
Yan, X., Hu, Z., Feng, Y., Hu, X., Yuan, J., Zhao, S.D., Zhang, Y., Yang, L.,
Shan, W., He, Q., et al. (2015). Comprehensive genomic characterization of
long non-coding RNAs across human cancers. Cancer Cell 28, 529–540.
Yap, K.L., Li, S., Muñoz-Cabello, A.M., Raguz, S., Zeng, L., Mujtaba, S., Gil, J.,
Walsh, M.J., and Zhou, M.M. (2010). Molecular interplay of the noncoding RNA
ANRIL and methylated histone H3 lysine 27 by polycomb CBX7 in transcrip-
tional silencing of INK4a. Mol. Cell 38, 662–674.
Zhou, Y., Zhang, X., and Klibanski, A. (2012). MEG3 noncoding RNA: a tumor
suppressor. J. Mol. Endocrinol. 48, R45–R53.
Zhu, S., Li, W., Liu, J., Chen, C.H., Liao, Q., Xu, P., Xu, H., Xiao, T., Cao, Z.,
Peng, J., et al. (2016). Genome-scale deletion screening of human long non-
coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nat. Biotechnol.
34, 1279–1286.
Cancer Cell 35, April 15, 2019 13