Molecular Ecology Resources (2008) 8, 587–589 doi: 10.1111/j.1471-8286.2007.02004.

PERMANENT GENETIC RESOURCES

Blackwell Publishing Ltd

Microsatellite loci isolated from the scleractinian coral,

Acropora nobilis
N A O K O I S O M U R A * and M I C H I O H I D A K A †
*Graduate School of Engineering and Science, University of the Ryukyus, Nishihara, Okinawa 903-0213, Japan,
†Department of Chemistry, Biology and Marine Science, University of the Ryukyus, Nishihara, Okinawa 903-0213, Japan

Abstract
We report the isolation and characterization of eight microsatellite loci from the scleractinian
coral, Acropora nobilis. The microsatellite loci were obtained using compound SSR primers
or an enrichment protocol. All the loci were polymorphic with four to eight alleles per locus
and observed heterozygosities ranging from 0.22 to 0.76. Some of the primers developed for
the two congeners, Acropora palmata and Acropora millepora were applicable to A. nobilis.
These loci are useful for studying the connectivity among A. nobilis populations in Okinawa,
southern Japan.
Keywords: Acropora nobilis, compound SSR primers, connectivity, coral, microsatellites

Received 8 July 2007; revision accepted 29 August 2007

In 1998, Acropora had suffered severe damage from mass
coral bleaching in Okinawa, southern Japan (Fujioka 1999).
Restoration of coral community after the 1998 bleaching
event has been observed in Kerama Islands (Taniguchi
2004), while coral community in Okinawa Island showed
little restoration (Loya et al. 2001). Allozyme studies of
Acropora tenuis and Stylophora pistillata showed that Kerama
Islands can be considered as ‘source of coral larvae’ for
Okinawa Island (Nishikawa et al. 2003). Polymorphic
microsatellite markers are needed to understand the
detailed connectivity among populations of Acropora species,
which are important components of Okinawan coral
community.
Although obtaining microsatellites had been difficult
in scleractinian corals (Marquez et al. 2003), the isolation
of microsatellite markers in genus Acropora has been
performed recently (Acropora palmata: Baums et al. 2005;
Acropora millepora: Van Oppen et al. 2006). Here we describe
the isolation and characterization of polymorphic micro-
satellite markers for Acropora nobilis using compound
SSR primers described by Lian et al. (2006) in addition to
an enrichment protocol described by Carleton et al.
(2002). Compound SSR method was shown to reduce time
and cost in the development of polymorphic markers
Correspondence: Naoko Isomura, Fax: +81-98-895-8576; E-mail:
h066121@sci.u-ryukyu.ac.jp
because we can use a common compound SSR primer as
the fluorescence-labelled primer (Lian et al. 2006) and we
checked whether primers developed for A. palmata (Baums
et al. 2005) and A. millepora (van Oppen et al. 2006) were
applicable to A. nobilis.
Genomic DNA was extracted from sperm of A. nobilis
using SDS-Proteinase K method. Total DNA (4 μg) was
digested with EcoRV in a 100-μL reaction. Digested total
DNA (about 50 ng) was ligated to a blunt adaptor (consisting
of a 48-mer: 5′-GTAATACGACTCACTATAGGGCACGC-
GTGGTCGACGGCCCGGGCTGGT-3′ and an 8-mer with
the 3′-end capped by an amino residue: 5′-ACCAGCCC-
NH2–3′) using T4 DNA ligase (TaKaRa) in a 40-μL reaction.
A 200 ng of the adaptor-total DNA ligation was amplified
in a 20 μL polymerase chain reaction (PCR) containing
2.5 mm MgCl2, 4 μL of 5×LA Reaction Buffer (TaKaRa),
0.5 μm compound SSR primer (AC)6(AG)5 or (TC)6(AC)5,
and an adaptor primer AP2 (5′-CTATAGGGCACGCGT-
GGT-3′), 0.4 mm dNTPs and 0.5 U LA Taq polymerase
(TaKaRa). Thermal cycling was under the following condi-
tions: 35 cycles of 1 min at 94 °C, 30 s at 62 °C and 2 min at
72 °C, followed by 1 cycle of 1 min at 94 °C, 30 s at 62 °C
and 5 min at 72 °C. The amplified fragments were directly
ligated into pCR 2.1-TOPO vector (Invitrogen) and the
plasmids were transformed into Escherichia coli. Single
clones were PCR-amplified using 0.2 μm each of M13
primers under the following PCR conditions: 94 °C for
5 min followed by 30 cycles of 30 s at 94 °C, 30 s at 55 °C

© 2007 The Authors

Journal compilation © 2007 Blackwell Publishing Ltd
588 P E R M A N E N T G E N E T I C R E S O U R C E S

Table 1 Characteristics of eight microsatellites isolated from Acropora nobilis and five microsatellites isolated from two congeners, Acropora
palmata and Acropora millepora (n = 20 individuals)

Repeat Ta Size Accession

Locus sequence Primer sequences (5′–3′) (°C) ranqe (bp) A HO HE no.

AnCA-51 (TTTG)7 F: GTTTGTGCAAACGGTTGTTG 60 156–204 6 0.48 0.42 AB326925

R: dye4-CAACATTTAACGGGAACGAA
AnCA-60 (CA)8 F: CCAAAGGGATTCTGGGAAAT 60 120–188 5 0.35 0.41 AB326926
R: dye4-CGGACACGTGTGGTAATTTG
AnCA-5B (TG)7 F: ACCGAGTTGGCCAGGTAAG 60 180–238 5 0.45 0.39 AB326927
R: dye4-TTGCCAACAGGACAGTTCAC
AnH1-8 (AC)6(AG)6 F: TATTCCGCTAAGGCTCCAGA 50 206–242 7 0.51 0.48 AB326928
R: dye4-(AC)6(AG)5
AnS1-2 (AC)6(AG)5 F: AGGGCAAGATTCGTTCCTTT 50 96–152 8 0.76 0.79 AB326929
R: dye4-(AC)6(AG)5
AnS1-4 (AC)6(AG)5 F: CAGGGTGGCCTGTATATTGC 50 80–150 6 0.59 0.61 AB326930
R: dye4-(AC)6(AG)5
AnS2-1 (TC)5(AC)7 F: AGCACCATTACGCTTTACCG 50 170–230 4 0.22 0.28 AB326931
R: dye4-(TC)6(AC)5
AnS2-12 (TC)5(AC)8 F: GCTGCCAAATGAGAAAGACC 50 220–302 5 0.33 0.37 AB326932
R: dye4-(TC)6(AC)5
*Apam3_181 (AAT)10 F: TTCTCCACATGCAAACAAACA 50 146–191 6 0.51 0.49 —
R: dye4-GCCAGGATAGCGGATAATGA
*Apam3_182 (AAT)18 F: TCCCACAACTCACACTCTGC 50 141–162 4 0.33 0.31 —
F: dye4-ACGCGGAAATAGTGATGCTC
†Amil2_008 (CA)9 F: AGGTTTCTATGGGAACGTCG 50 90–150 5 0.41 0.44 —
R: dye4-TGAACTTCAAGTAATTTTGCCAG
†Amil2_022 (AC)10 F: CTGTGGCCTTGTTAGATAG 50 140–210 5 0.65 0.62 —
R: dye4-AGATTTGTGTTGTCCTGCTT
†Amil2_023 (AC)7 F: GCAAGTGTTACTGCATCAAA 50 110–180 4 0.32 0.36 —
R: dye4-TCATGATGCTTTACAGGAGA

Ta, annealing temperature of the primer pair; A, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity; dye4,
fluorescent label for analysis on CEQ 8800. *Baums et al. (2005); †van Oppen et al. (2006).

and 1.5 min at 72 °C and final 72 °C extension for 7 min.
Amplified 120 fragments were sequenced directly using an
automatic sequencer (ABI 3700 or ABI 3730XL).
For each fragment containing (AC)6(AG)n or (TC)6(AC)n
compound SSR sequences at one end, a specific primer was
designed in flanking sequences using primer 3 software
(http://www.virus.kyoto-u.ac.jp/cgi-bin/primer3.cgi). Com-
pound SSR primers were labelled with a fluorescent 5′-dye
4 for fragment analysis on CEQ 8800 (Beckman Coulter).
Fifteen out of 120 loci were amplifiable from field samples
of A. nobilis. Five out of 15 loci were polymorphic and
amplifiable from 20 samples of A. nobilis from three
geographically distinct regions. Using the enrichment
protocol described by Carleton et al. (2002), we obtained
three polymorphic and amplifiable loci (Table 1: AnCA-51,
AnCA-60 and AnCA-5B). The estimated number of alleles,
mean observed and expected heterozygosities were calcu-
lated using genepop (Raymond & Rousset 1995). Signifi-
cant departure from Hardy–Weinberg equilibrium and
linkage disequilibrium was not observed in any the loci
(Table 1) when tested using genepop (Raymond & Rousset
1995). Twenty samples from three geographically distinct
regions were genotyped in this study, the analysis showed
that the usefulness of the microsatellite loci for the study
of connectivity among A. nobilis populations in Okinawa,
southern Japan.
Additionally, primers developed for the microsatellite
markers, Apam 181 and 182 of A. palmata, and Amil 008, 22
and 23 of A. millepora produced polymorphic products in
A. nobilis (Table 1). Significant departure from Hardy–
Weinberg equilibrium and linkage disequilibrium was
not observed in any the loci (Table 1) when tested using
genepop (Raymond & Rousset 1995).
Acknowledgements
We would like to thank Ms. H. Yamamoto (Okinawa Churaumi
Aquarium) and the staff of Akajima Marine Science Laboratory for
collecting Acropora nobilis for this experiment. This work was
supported by COE program of the University of the Ryukyus.

© 2007 The Authors

Journal compilation © 2007 Blackwell Publishing Ltd

References
Baums IB, Hughes CR, Hellberg ME (2005) Mendelian micro-
satellite loci for the Caribbean coral Acropora palmata. Marine
Ecology Progress Series, 288, 115–117.
Carleton KL, Streelman JT, Lee BY, Garnhart N, Kidd M, Kocher
TD (2002) Rapid isolation of CA microsatellites from the tilapia
genome. Animal Genetics, 33, 140–144.
Fujioka Y (1999) Mass destruction of the hermatypic corals during
a bleaching event in Ishigaki Island, Southwestern Japan.
Galaxea, 1, 41–50.
Lian C, Wadund MA, Geng Q, Shimatani K, Hogetsu T (2006)
An improved technique for isolating codominant compound
microsatellite markers. Journal of Plant Research, 119, 415–417.
Loya Y, Sakai K, Yamazato K, Nakano Y, Sambali H, van Woesik R
(2001) Coral bleaching: the winners and the losers. Ecology Letters,
4, 122–131.
Marquez LM, MacKenzie JB, Takabayashi M, Smith CR, Chen CA
© 2007 The Authors
Journal compilation © 2007 Blackwell Publishing Ltd
P E R M A N E N T G E N E T I C R E S O U R C E S 589
(2003) Difficulties in obtaining microsatellites from acroporids
corals. Proceedings of the 9th International Coral Reef Symposium, 1,
139–143.
Nishikawa A, Kato M, Sakai K (2003) Larval settlement rates and
gene flow of broadcast-spawning (Acropora tenuis) and planula-
brooding (Stylophora pistillata) corals. Marine Ecology Progress
Series, 256, 87–97.
Raymond M, Rousset F (1995) genepop, version 1.2: population
genetics software for exact tests and ecumenicism. Journal of
Heredity, 86, 248–249.
Taniguchi H (2004) Changing of coral coverage around Akajima
Island in recent 6 years — observation after and during the coral
bleaching events and outbreaks of crown-of –thorns starfish.
Midoriishi, 15, 16–19 (in Japanese).
Van Oppen MJH, Underwood JN, Muirhead AN, Peplow L (2006)
Ten microsatellite loci for the reef-building coral Acropora
millepora (Cnidaria, Scleractinia) from the Great Barrier Reef.
Australia. Molecular Ecology Notes, 7, 436–438.