Vous êtes sur la page 1sur 166

DEPARTEMENT DE BIOTECHNOLOGIE

Thèse présentée en vue de l’obtention du diplôme de Doctorat en Science

Option : Microbiologie

Par Mme GUERMOUCHE M’RASSI Amel

Sujet de thèse :

Caractérisation moléculaire des


bactéries impliquées dans la
biodégradation des hydrocarbures

Devant le jury composé de :

Président Pr ABI AYAD Sidi Mohammed El-Amine Université d’Oran (Es-Sénia)

Promoteur Pr BENSALAH Farid Université d’Oran (Es-Sénia)

Examinateur Pr MESLI TALEB BENDIAB Farida Université d’Oran (Es-Sénia)

Examinateur Pr SLIMANI Miloud Université de Saida

Examinateur Pr ABDELOUAHID Djamel Eddine Université de Tlemcen

Examinateur Pr BENYAHIA Mohamed Université de Sidi Belabbes

Invité Mr RAIS Ali Abdelhamid Directeur Raffinerie Arzew-


Oran- Sonatrach

2013-2014
REMERCIEMENTS

Merci au bon Dieu de m’avoir aidé à réaliser cet ouvrage.


J’exprime ma gratitude aux membres du jury pour avoir accepté d’examiner ce travail ainsi
que pour la discussion apportée sur ce projet. Je témoigne mes plus vifs remerciements au
Pr Abi Ayad Sidi Mohammed El-Amine qui a bien voulu présider le jury de ce Doctorat, au
Pr Mesli Taleb Bendiab Farida, au Pr Benyahya Mohamed, au Pr Abdelouahid Djamel
Eddine et au Pr Slimani Miloud qui nous ont honoré de leur présence et pour avoir accepté
de juger ce travail.
Par ailleurs, j’adresse mes sincères salutations à Mr Rais Ali abdelhamid Directeur de la
raffinerie d’Arzew-Oran d’avoir accepté notre invitation.
Un projet de thèse ne se réalise jamais seul, c’est pourquoi je souhaiterai ici remercier toutes
les personnes qui ont participé à des années d’aventure scientifique et humaine.
Je souhaiterai tout d’abord exprimer mes remerciements au professeur Bensalah Farid,
directeur du Laboratoire de Génétique Microbienne (LGM) à l’Université d’Oran- Es-Sénia,
pour m’avoir accueilli au sein de son laboratoire et permis de réaliser une partie de cette
thèse dans de bonnes conditions. Je lui dis merci également pour m’avoir fait profiter de ses
connaissances scientifiques, pour toute l'aide qu'il m'a apporté sur mes travaux, pour ses
encouragements durant ces années au sein de l’équipe.
Je voudrai dire un grand merci au Pr Robert Duran et au Dr Jérôme Gury du Laboratoire
de l’Environnement Ecologie Microbienne (EEM) de l’Université de Pau et des Pays de
l’Adour en France pour leur accueil et leur collaboration, pour les connaissances qu’ils
m’ont fait partager durant 18 mois de travail. Merci à Jérôme pour l’aide précieuse en
biologie moléculaire et pour les discussions enrichissantes que nous avons eu sur le projet.
Cela m’a permis d’explorer les données selon de nouvelles perspectives et de développer mon
esprit critique sur les méthodes moléculaires que nous utilisons.
Merci à tous les membres de l’équipe LGM et EEM pour m’avoir donné un environnement de
travail agréable grâce à leur présence, leur bonne humeur et leur soutien.
Un merci particulier à Neil Gray du Laboratoire de l’École de génie civil et de géosciences
de l'Université de Newcastle en Angleterre, qui m’a accueillie dans son laboratoire afin de
travailler sur les analyses TLC/FID, pour sa gentillesse, son aide scientifique, et sa
disponibilité.
Pour terminer, je souhaiterai remercier ma famille et mes amis pour leur soutien non
seulement tout au long de la thèse mais aussi depuis de nombreuses années. Merci pour leur
présence, leur aide, leur compréhension et leur amour. Merci aussi à mon mari, pour son
soutien et son amour indéfectible. Je leur dédie cette thèse.
Enfin, je tiens à remercier le Groupe de la plateforme SONATRACH, de nous avoir ouvert
les portes pour entamer ce travail avec les échantillons de sol contaminé, sans qui cette thèse
aurait été encore plus difficile.

Merci a tous.
Résumé

Les produits pétroliers, du fait de leur utilisation massive, constituent des polluants importants
des aquifères et des sols. Le devenir de ces polluants rejetés dans l’environnement est
principalement gouverné par les processus de biodégradation. L’existence de ces phénomènes
dépend de la biodégradabilité intrinsèque du polluant mais aussi de la présence de microflores
dégradatrices compétentes dans les eaux souterraines et dans les sols.
Au cours de ce travail, nous avons développé une méthodologie permettant d’évaluer la
biodégradabilité des hydrocarbures pétroliers en conditions aérobies. Elle consiste à mesurer,
par méthodes analytiques telles: Chromatographie en Phase Gazeuse (CPG) et
Chromatographie sur Couche Mince (CCM) couplées à un Détecteur à Flamme d’Ionisation
(FID), après incubation dans des conditions optimales, la consommation de chacun des
hydrocarbures présents dans différentes fractions du pétrole (saturés et aromatiques).
En utilisant une méthode de séquençage des gènes codant l’ADNr 16S, les compositions en
micro-organismes des bactéries adaptées au sol contaminé par les hydrocarbures ont été
déterminées. Des arbres phylogénétiques ont été élaborés. Les capacités de dégradation des
bactéries sélectionnées et la présence ou non de gènes fonctionnels de dégradation codant
pour l’oxydation initiale des hydrocarbures (alkB, nahAc, nidA) ont été étudiées.
Les résultats indiquent que le groupe Gamma-Protéobactéries était le principal acteur de cette
dégradation. Pseudomonas sp. groupe bactérien majoritaire spécifique adapté à la pollution
aux hydrocarbures à la capacité de métaboliser (en culture simple) certains hydrocarbures
récalcitrants (alcanes ramifiés tel le Pristane (n-C19) à 35.11% et les aromatiques lourds tels le
Benzo[a]Pyrène (n-C20) à 33.93% et de cométaboliser (en consortium) les différentes
fractions du pétrole brut à 50.44% pour les saturés et à 30.42% pour les aromatiques
polycycliques. L’efficacité de la biodégradation des microflores est liée à la présence de voies
métaboliques particulières chez certains micro-organismes et à la coopération entre les
différents micro-organismes composant les microflores. Ces bactéries hydrocarbonoclastes
peuvent être utilisées pour concevoir des cultures mixtes (consortium) avec des capacités de
biodégradation spécifiques pour les différentes fractions pétrolières dans les traitements des
stations d’épuration.

Mots-clés : bioremédiation, hydrocarbures pétroliers, Pseudomonas, HAP, alcanes,


ADNr16S, biomarqueurs alkB;nahAc; nidA, consortium.
Abstract

Because of their massive utilization, hydrocarbons are major pollutants of soils and aquifers.
Biodegradation is a key aspect of the fate of pollutants in the environment. Such knowledge
concerns in particular the intrinsic biodegradability of the products and the distribution in the
environment of competent degradative microflorae.
In this study, a methodology has been developed to assess the aerobic biodegradability of
petroleum hydrocarbons. It is based on the Gas Chromatographic and Thin Layer
Chromatography (TLC) coupled with a Flame Ionization Detector (FID) analysis of
hydrocarbons, after incubation in optimal conditions of major compounds in crude oil
(saturates and aromatics fractions).
Using a method of gene sequencing 16S rDNA, the identification of bacteria adapted to soil
was determined. Based on nearly full length 16S rRNA gene sequencing analysis, a
phylogenetic trees was constructed. Capacity of degradation of selected bacteria and the
presence or absence of functional genes coding for the initial oxidation of hydrocarbons
(alkB, nahAc, nidA) were studied.
The results indicate that the Gamma-Proteobacteria group was the main actor of this
degradation. Pseudomonas sp, specific bacterial group suitable for petroleum hydrocarbon
pollution has the ability to metabolize (single culture) a high mass residues, Pristane (n-C19)
at 35.11% and Benzo[a]Pyrene (n-C20) at 33.93% and co-metabolize (in consortium) fractions
in petroleum-hydrocarbon, 50.44% of saturates and 30.42% of aromatics compounds.
Biodegradation efficiency of soil microflorae depended on the specific metabolic pathways of
some microorganisms and on the cooperation within microbial population. This study
provides a better understanding of the adaptation of bacteria inhabiting polluted environments
and for developing and implanting adequate bio-strategies in the future to enhance oil in
contaminated soil and the biotreatment of oily waste water in refineries.

Keywords: bioremediation, petroleum hydrocarbons, Pseudomonas, PAH, alkanes,


DNAr16S, biomarqueurs alkB, nahAc, nidA, consortium.
‫ملخص‬

‫انًؼبندت انح‪ٕٚٛ‬ت نهًحزٔلبث انُفط‪ٛ‬ت ف‪ ٙ‬انخزبت انًهٕثت ببنُفط ػٍ طز‪ٚ‬ك بكخ‪ٛ‬ز‪ٚ‬ب يحه‪ٛ‬ت حزاب‪ٛ‬ت ‪ :‬حؼ‪ ٔ ٍٛٛ‬حؼز‪ٚ‬ف حزك‪ٛ‬ب‬
‫انكبئُبث انذل‪ٛ‬مت انًخخصصت ف‪ ٙ‬ححه‪ٛ‬م انًٕاد انُفط‪ٛ‬ت ػٍ طز‪ٚ‬ك انب‪ٕٛ‬نٕخ‪ٛ‬ب اندش‪ٚ‬ئ‪ٛ‬ت (ػًه‪ٛ‬بث حضخ‪ٛ‬ى خ‪ُٛ‬بث يخخصصت‬
‫نهحًض انُٕٔ٘ (‪ ) ADN‬ػٍ طز‪ٚ‬ك سهسهت حفبػم انبٕن‪ًٛٛ‬زاس )‪(Polymérase Chain Réaction‬‬

‫نكثزة إَخبج ٔاسخخذاو انًحزٔلبث انُفط‪ٛ‬ت ػهٗ َطبق ٔاسغ فٓ‪ ٙ‬حؼخبزيٍ انًهٕثبث انزئ‪ٛ‬س‪ٛ‬ت ف‪ ٙ‬انخزبت ٔ انً‪ٛ‬بِ اندٕف‪ٛ‬ت‪.‬‬
‫‪ٚ‬خضغ أسبسب يص‪ٛ‬ز ْذِ انًهٕثبث ف‪ ٙ‬انب‪ٛ‬ئت نؼًه‪ٛ‬ت انخحهم انب‪ٕٛ‬نٕخ‪ٔ .ٙ‬خٕد ْذِ انظبْزة ‪ٚ‬ؼخًذ ػهٗ انخحهم انح‪ٕ٘ٛ‬‬
‫انًخخص ببنًهٕثبث ٔ نكٍ أ‪ٚ‬ضب بٕخٕد كبئُبث دل‪ٛ‬مت فؼبنت ف‪ ٙ‬انخزبت ٔ انً‪ٛ‬بِ اندٕف‪ٛ‬ت‪.‬‬

‫ف‪ْ ٙ‬ذا انؼًم لًُب بخطب‪ٛ‬ك يُٓد‪ٛ‬ت نخم‪ٛٛ‬ى لببه‪ٛ‬ت انبكخ‪ٛ‬ز‪ٚ‬ب ػهٗ انًؼبندت انب‪ٕٛ‬نٕخ‪ٛ‬ت نهًحزٔلبث انبخزٔك‪ًٛٛ‬بئ‪ٛ‬ت بٕخٕد‬
‫‪ :‬كزٔيبحٕغزاف‪ٛ‬ب بٕخٕد انغبس )‪(CPG‬‬ ‫األكسد‪ (O2) ٍٛ‬انخ‪ ٙ‬ححث ػهٗ انم‪ٛ‬بص يٍ خالل أسبن‪ٛ‬ب ححه‪ٛ‬ه‪ٛ‬ت يثم‬
‫ٔكزٔيبحٕغزاف‪ٛ‬ب ػٍ طز‪ٚ‬ك انطبمت انزل‪ٛ‬مت )‪ (TLC‬انًؼخًذح‪ ٍٛ‬ػهٗ ٔخٕد كبشف انخأ‪ ٍٚ‬ببنهٓب )‪ .(FID‬بؼذ يزٔر فخزة‬
‫انحضبَت ٔ ححج ظزٔف يٓ‪ٛ‬ئت ‪ٚ‬خى ححه‪ٛ‬م انًٕاد انُفط‪ٛ‬ت انًٕخٕدة ٔانًشكهت نألخشاء انزئ‪ٛ‬س‪ٛ‬ت انًكَٕت نهبخزٔل انخبو‬
‫(انًشبؼت ٔ انؼطز‪ٚ‬ت)‪.‬‬

‫ببسخخذاو طز‪ٚ‬مت انخسهسم اند‪ ُٙٛ‬انذ٘ ‪ٚ‬حث ػهٗ ‪ ADNr 16S‬حى حؼ‪ ٔ ٍٛٛ‬حؼز‪ٚ‬ف حزك‪ٛ‬ب انكبئُبث انح‪ٛ‬ت انذل‪ٛ‬مت انًخخبرة‬
‫ٔ انًٕخٕدة ف‪ ٙ‬انخزبت‪ .‬حًج دراست لذرة ٔ إيكبَ‪ٛ‬بث انبكخ‪ٛ‬ز‪ٚ‬ب انًخخبرة ػهٗ ححه‪ٛ‬م انًهٕثبث انب‪ٛ‬خزٔكً‪ٛ‬بئ‪ٛ‬ت ٔ انبحث ػٍ‬
‫اند‪ُٛ‬بث ٔظ‪ٛ‬ف‪ٛ‬ت انخزي‪ٛ‬ش ٔ انًخخصت ف‪ ٙ‬األكسذة األٔنٗ نهًٕاد انُفط‪ٛ‬ت )‪( alkB, nahAc, nidA‬ػُذ انبكخ‪ٛ‬ز‪ٚ‬ب انًحصهت‬
‫ػه‪ٓٛ‬ب‪.‬‬

‫‪ ْٙ Gamma-Protéobactéries‬انًًثم انزئ‪ٛ‬س‪ ٙ‬نٓذا انخحه‪ٛ‬م انب‪ٕٛ‬نٕخ‪ .ٙ‬انُٕع‬ ‫حش‪ٛ‬ز انُخبئح إنٗ أٌ يدًٕػت‬
‫‪ Pseudomonas‬يخخصص ف‪ ٙ‬حفك‪ٛ‬ك انًهٕثبث انُفط‪ٛ‬ت ٔ نّ انمذرة نخحه‪ٛ‬م انًهٕثبث نٕحذِ يثم انًكَٕبث انًشبؼت انثم‪ٛ‬هت ‪:‬‬
‫‪ )n-C19( Pristane‬بحٕان‪ ٔ %35.11 ٙ‬انًكَٕبث انؼطز‪ٚ‬ت ‪ )n-C20 ( Benzo [a] Pyrène :‬بحٕان‪ٔ % 33.93 ٙ‬نّ‬
‫‪ %50.44‬نهًكَٕبث انًشبؼت ٔ بحٕان‪ٙ‬‬ ‫انمذرة ػهٗ ححه‪ٛ‬م انبخزٔل ببالسخؼبَت ٔانخزب‪ٛ‬ت يغ أح‪ٛ‬بء دل‪ٛ‬مت أخزٖ بحٕان‪ٙ‬‬
‫‪ %30.42‬نهًكَٕبث انؼطز‪ٚ‬ت‪.‬‬

‫حزحبط فؼبن‪ٛ‬ت انخحهم انب‪ٕٛ‬نٕخ‪ ٙ‬ػٍ طز‪ٚ‬ك انبكخ‪ٛ‬ز‪ٚ‬ب انًحه‪ٛ‬ت انخزاب‪ٛ‬ت بٕخٕد يسبراث ا‪ٚ‬ض‪ٛ‬ت يحذدة ٔ يخخصت نُٕع يؼ‪ٍٛ‬‬
‫نبؼض انبكخ‪ٛ‬ز‪ٚ‬ب ٔ نٕخٕد انخؼبٌٔ ٔانخزب‪ٛ‬ت يغ يخخهف انكبئُبث انح‪ٛ‬ت انذل‪ٛ‬مت انًٕخٕدة ف‪ ٙ‬انخزبت‪.‬‬

‫انكهًبث انذانت ‪ :‬يؼبندت ب‪ٕٛ‬نٕخ‪ٛ‬ت ‪ -‬انًحزٔلبث انُفط‪ٛ‬ت – ‪ - Pseudomonas‬انًحزٔلبث انؼطز‪ٚ‬ت ‪ -‬انًحزٔلبث انًشبؼت‬
‫االنكبٌ ‪ -ADNr 16S -‬حؼ‪ ٍٛٛ‬اند‪ُٛ‬بث انٕظ‪ٛ‬ف‪ٛ‬ت ‪ - alkB nahAc, nidA‬حزب‪ٛ‬ت بس‪ٛ‬طت ٔ يخؼذدة نهبكخ‪ٛ‬ز‪ٚ‬ب‪.‬‬
Table des matières
INTRODUCTION .......................................................................................................................................... 1

CHAPITRE 1 : ÉTUDE BIBLIOGRAPHIQUE ............................................................................................ 5

1. HYDROCARBURES PETROLIERS ......................................................................................................... 6

1.1. DEFINITION ................................................................................................................................................. 6


1.2. CLASSIFICATION ......................................................................................................................................... 6
1.2.1. Hydrocarbures saturés ........................................................................................................................ 6
1.2.2. Hydrocarbures aromatiques (HAPs) .................................................................................................. 6
1.2.3. Composés polaires ............................................................................................................................... 7
I.2.4. Résines et asphaltènes .......................................................................................................................... 7
1.3. LES TYPE DE PETROLES............................................................................................................................... 8

2. POLLUTION DE L’ENVIRONNEMENT PAR LES HYDROCARBURES ET LEUR IMPACT .......... 8

2.1. IMPACT ECO-TOXICOLOGIQUE ................................................................................................................... 9


2.2. TOXICITE ET PROPRIETES PHYSICO-CHIMIQUES DES HAPS ................................................................... 11
2.3. EFFLUENTS INDUSTRIELS -PROBLEMATIQUE ET ENJEUX SUR LA SANTE ET L’ENVIRONNEMENT........... 14
2.4. MESURE DE PROTECTION CONTRE LA POLLUTION .................................................................................. 14
2.4.1. Evaluation des sites pollués ............................................................................................................... 14
2.4.2. Réglementation au niveau national .................................................................................................. 15
2.4.3. Le Règlement et normes de rejets internationales sur les effluents liquides des raffineries de
pétrole 16

3. HYDROCARBURES EN ALGERIE ....................................................................................................... 17

3.1. HISTORIQUE ET SITUATION GEOGRAPHIQUE DE LA RAFFINERIE D’ARZEW ........................................... 17


3.1.1. Présentation du complexe ................................................................................................................. 17
3.2. PROBLEMATIQUE LIEE AUX HYDROCARBURES PETROLIERS EN ALGERIE.............................................. 19
3.3. DESCRIPTION DES UNITES DE TRAITEMENT DES REJETS DE LA RAFFINERIE D'ARZEW .......................... 20
3.3.1. Nature et composition des effluents avant épuration ....................................................................... 20
3.3.2. Station de traitement PPI/API (zone 28) .......................................................................................... 21
3.3.3. Station de traitement des effluents huileux U1800 (STEP) ............................................................. 21
3.3.4. Caractéristiques des effluents............................................................................................................ 23
3.3.5. Principe de traitements des effluents pour rejet ............................................................................... 23

4. DEVENIR DES HYDROCARBURES DANS L’ENVIRONNEMENT ................................................... 24

4.1. TRANSFORMATIONS ABIOTIQUES ............................................................................................................ 24


4.1.1. Evaporation........................................................................................................................................ 24
4.1.2. Solubilisation ..................................................................................................................................... 24
4.1.3. Emulsification.................................................................................................................................... 24
4.1.4. Sédimentation .................................................................................................................................... 24
4.1.5. Photo-oxydation................................................................................................................................. 24
4.1.6. L'hydrolyse......................................................................................................................................... 25
4.2. TRANSFORMATION BIOTIQUE ................................................................................................................... 25
4.2.1. Biodégradation par les micro-organismes ........................................................................................ 25
4.3. TRAITEMENT ET METHODES DE REMEDIATION DES SITES POLLUES PAR LES HYDROCARBURES....... 26
4.3.1. Traitements des effluents contaminés par des hydrocarbures ......................................................... 26
4.3.2. Traitements biologiques des sols ....................................................................................................... 30
4.4.3. Les principales technologies utilisées dans la bioremédiation sont les suivantes ....................... 30
5. BIODEGRADATION AEROBIE DES HYDROCARBURES PETROLIERS PAR LES BACTERIES 32

5.1. PROCESSUS GENERAUX DE BIODEGRADATION DES COMPOSES ORGANIQUES ......................................... 32


5.1.1. La dégradation primaire (Minéralisation) ....................................................................................... 34
5.1.2. Le co-métabolisme des substrats ...................................................................................................... 34
5.2. MICROORGANISMES APTES A BIODEGRADER LES HYDROCARBURES ...................................................... 35
5.2.1. Rôle des Protéobactéries dans la dégradation des hydrocarbures ................................................... 37
5.2.2. Exemples de biodégradation ............................................................................................................. 37
5.3. MECANISME D’ACCESSION DES MICROORGANISMES AUX COMPOSES ORGANIQUES HYDROPHOBES .... 40
5.4. ADAPTATION DES MICRO-ORGANISMES AUX SITES POLLUES .................................................................. 42
5.5. ADAPTATION GENETIQUE DES BACTERIES ............................................................................................... 42
5.6. BIODETECTION DE LA POLLUTION PAR LES HYDROCARBURES ............................................................... 43
5.7. FACTEURS AFFECTANT LA BIODEGRADATION DES HYDROCARBURES DANS L’ENVIRONNMENT ............ 44
5.8. FACTEURS BIOLOGIQUES FAVORISANT L’ACCESSIBILITE ET LA DEGRADATION DES HYDROCARBURES 46

6. BIODEGRADATION DU PETROLE BRUT .......................................................................................... 47

7. BIODEGRADATION PAR TYPE D’HYDROCARBURE...................................................................... 49

7.1. BIODEGRADATION DES HYDROCARBURES SATURES ................................................................................ 49


7.1.1. Voies de dégradation des alcanes linéaires ....................................................................................... 49
7.1.2. Voies de dégradation des alcanes branchés ...................................................................................... 52
7.2. BIODEGRADATION OXYDATIVE DES HAPS PAR LES BACTERIES ............................................................. 56
7.2.1. Biodégradation des HAPs à 2 ou 3 noyaux aromatiques ................................................................. 58
7.2.2. Dégradation des HAPs à 4 noyaux aromatiques ou plus ................................................................. 58
7.2.3. Diversité des genres bactériens dégradant les HAPs et des gènes codant une HAP-dioxygènase .. 60

8. DIVERSITE BACTERIENNE ET CLASSIFICATION DES MICROORGANISMES


(TAXONOMIE)………………………………………………………………………………………………………………………………………… 62

8.1. MICROBIOLOGIE « CLASSIQUE » .............................................................................................................. 62


8.2. APPORT DE LA BIOLOGIE MOLECULAIRE ................................................................................................. 63
8.2.1. Le choix de l’ADNr 16S .................................................................................................................... 63
8.3. LA DIVERSITE DU DOMAINE « BACTERIA » ............................................................................................... 65

9. ETUDE DE LA REPONSE DES COMMUNAUTES BACTERIENNES SOUMISES A UNE


CONTAMINATION PETROLIERE 67

10. DETECTION ET ANALYSE DES HYDROCARBURES PETROLIERS ............................................ 69

10.1. TECHNIQUES BASEES SUR LA BIOLOGIE MOLECULAIRE ........................................................................ 69


10.2. TECHNIQUES ANALYTIQUES BASEES SUR LA CHROMATOGRAPHIE ....................................................... 70
10.2.1. Chromatographie sur couche mince avec détection à ionisation de flamme ................................ 71
10.2.2. Quantification des hydrocarbures résiduels par chromatographie en phase gazeuse CPG/FID 72

CHAPITRE II : PROCÉDURES ÉXPÉRIMENTALES ............................................................................ 73

PARTIE 1 : APPLICATION DES METHODES MOLECULAIRES COMME BIOMARQUEURS EN


BIOREMEDIATION .................................................................................................................................... 74

AVANT-PROPOS ......................................................................................................................................... 75

1. MATERIELS ET METHODES ............................................................................................................... 76

1.1. SITE DE PRELEVEMENT DES ECHANTILLONS ............................................................................................ 76


1.2. ENRICHISSEMENT ET ISOLEMENT DES BACTERIES AEROBIES DEGRADANT LES HYDROCARBURES ....... 76
1.3. LE CRIBLAGE ET LA CONSERVATION DES SOUCHES ISOLEES................................................................... 77
1.4. DETERMINATION DU POTENTIEL DE BIODEGRADATION BACTERIENNE PAR TURBIDIMETRIE ............... 77
1.5. EXTRACTION DE L'ADN GENOMIQUE DES SOUCHES BACTERIENNES SELECTIONNEES .......................... 77
1.6. AMPLIFICATION DE L’ADNR 16S, SEQUENÇAGE ET ANALYSE PHYLOGENETIQUE................................. 78
1.7. DETECTION DE GENE DE DEGRADATION ALKB ......................................................................................... 78
1.8. ANALYSE DE LA BIODEGRADATION DES FRACTIONS PETROLIERES PAR TLC/FID ................................ 78

2. RÉSULTATS ............................................................................................................................................ 79

2.1. ISOLEMENT ET CRIBLAGE DES SOUCHES ISOLEES .................................................................................... 79


2.2. ÉVALUATION DE L'UTILISATION DES HYDROCARBURES PAR TURBIDIMETRIE ....................................... 80
2.3. LA CARACTERISATION MOLECULAIRE DES BACTERIES SELECTIONNEES ............................................... 80
2.4. LA DETECTION DE GENE DE DEGRADATION: ALCANES OXYGENASE ....................................................... 80
2.5. LA BIODEGRADATION DES HYDROCARBURES PETROLIERS PAR UN CONSORTIUM SELECTIONNE .......... 81

3. DISCUSSION ........................................................................................................................................... 81

PARTIE 2 : CARACTERISATION MOLECULAIRE DES BACTERIES AEROBIES CAPABLES DE


DEGRADER DES POLLUANTS ALIPHATIQUES ET AROMATIQUES DE DIFFERENTES
FRACTIONS DES HYDROCARBURES PETROLIERS ........................................................................... 91

AVANT-PROPOS ......................................................................................................................................... 92

1. MATERIELS ET METHODES ............................................................................................................... 94

1.1. SITE DE PRELEVEMENT ............................................................................................................................. 94


1.2. ENRICHISSEMENT, ISOLEMENT DES BACTERIES AEROBIES ..................................................................... 94
1.3. CRIBLAGE DES SOUCHES ISOLEES ET CARACTERISATION PHENOTYPIQUE............................................. 94
1.4. TEST INT EN PRESENCE DE DIFFERENTES SOURCES DE CARBONES, PETROLE ET (HAPS) SEPAREMENT
.......................................................................................................................................................................... 95
1.5. EXTRACTION DE L'ADN GENOMIQUE ...................................................................................................... 95
1.6. ELECTROPHORESE SUR GEL D’AGAROSE ................................................................................................. 95
1.7. AMPLIFICATION DES GENES D’ADNR 16S PAR REACTION DE POLYMERISATION EN CHAINE (PCR) .... 96
1.8. PURIFICATION DES PRODUITS PCR .......................................................................................................... 96
1.9. SEQUENÇAGE DES FRAGMENTS AMPLIFIES .............................................................................................. 96
1.10. DETECTION ET AMPLIFICATION DES GENES DE DEGRADATION EN UTILISANT DES AMORCES
SPECIFIQUES PAR PCR..................................................................................................................................... 96
1.11. ANALYSE PHYLOGENETIQUE DES SEQUENCES ....................................................................................... 98
1.12. TESTS DE BIODEGRADATION DES SOUCHES SELECTIONNEES ................................................................ 99
1.13. DOSAGE DES HYDROCARBURES RESIDUELS PAR CPG/FID ................................................................. 100
1.14. PERFORMANCES FINALES DES BACTERIES TESTEES EN POURCENTAGE (%) DE BIODEGRADATION.. 102

2. RESULTATS ET DISCUSSIONS .......................................................................................................... 102

2.1. CARACTERISATION PHENOTYPIQUE ....................................................................................................... 102


2.2. IDENTIFICATION DES SOUCHES PAR AMPLIFICATION ET SEQUENÇAGE D’ADNR 16S .......................... 104
2.3. RECHERCHE DES GENES D’INTERET (BIOMARQUEURS) PAR PCR ......................................................... 105
2.4. BIODEGRADATION (%) DES BACTERIES SELECTIONNEES VIS-A-VIS DES SUBSTRATS CHOISIS ............. 107

CHAPITRE III : CONCLUSIONS GÉNÉRALES & PERSPECTIVES................................................. 124

RÉFÉRENCES BIBLIOGRAPHIQUES ................................................................................................... 130


LISTE DES FIGURES
Figure 1: Représentation schématique des principales familles d’hydrocarbures et autres composés d’un
pétrole avec quelques exemples de molécules. Modifié d’après Syakti (2004). ...................................... 8
Figure 2: Vue aérienne de la raffinerie d’Arzew .......................................................................................... 18
Figure 3: Schéma général de la raffinerie d’Arzew- (Boudjillouli, 2001) .................................................... 19
Figure 4: Schéma représentatif de l’unité de traitement des éffluents de la raffinerie d’Arzew U1800-
(Naftec Spa, 2010b). .............................................................................................................................. 22
Figure 5: Représentation schématique du devenir d’une pollution pétrolière à la surface du sol (Morgan et
Watkinson, 1989). ................................................................................................................................. 25
Figure 6: Schéma d’une filière de traitement des eaux de raffinerie (Royal Haskoning, 2003). ................. 28
Figure 7: Schéma de principe du traitement biologique des eaux et mécanismes principaux d’élimination
des substances prioritaires dans un réacteur biologique conventionnel (Lesage, 2009) ...................... 29
Figure 8: Principe simplifié de la biodégradation aérobie des hydrocarbures (Lecomte, 1995). ............ 33
Figure 9: Les mécanismes d’accession des microorganismes aux hydrocarbures (Vandecasteele, 2005) ... 41
Figure 10: Voie métabolique de dégradation des n-alcanes (van Beilen et al., 2003) ................................... 50
Figure 11: Système de l’alcane hydroxylase à fer non hémique chez Pseudomonas putida Gpo1 (chaîne de
transfert d’électrons) Van Beilen et al., 2001 ....................................................................................... 50
Figure 12: Voie de dégradation des alcanes chez Pseudomonas putida Gpo1, rôle et localisation cellulaire
des protéines Alk et de leur système de régulation (Van Beilen et al., 2001) ....................................... 52
Figure 13: Voies métaboliques de dégradation du Pristane (2,6,10,14-tétraméthylpentadécane) Fall et al.
(1979) .................................................................................................................................................... 54
Figure 14: Réaction d’oxydation initiale du naphtalène par la naphtalène dioxygénase (NahAc) chez
Pseudomonas NCIB 9816 (Habe et Omori, 2003). ................................................................................ 56
Figure 15: Dégradation du naphtalène en salicylate par voie intradiol par des bactéries aérobies du genre
Pseudomonas (Vandecasteele, 2005) ..................................................................................................... 57
Figure 16: Arbre phylogénétique des principales lignées (phylums ou divisions) du domaine « Bacteria »
Woese (1987) ......................................................................................................................................... 66
Figure 17: Carte de l'Algérie, région d’échantillonnage de sols contaminés par les hydrocarbures
pétroliers - raffinerie d'Arzew-Oran (Smail et Khalef., 2007) ............................................................. 84
Figure 18: Courbe de croissance (DO) de bactéries en présence du pétrole (P) pendant 15 jours
d'incubation. ......................................................................................................................................... 85
Figure 19: Courbe de croissance (DO) de bactéries en présence du rejet industriel (RI) pendant 15 jours
d'incubation .......................................................................................................................................... 85
Figure 20: Amplification PCR de l’ADNr 16S des bactéries du consortium sélectionné. ............................ 86
Figure 21: Arbre phylogénétique par la méthode Neighbor-joining basée sur les séquences d’ADNr 16S
des souches du consortium bactérien. .................................................................................................. 87
Figure 22: Gel d’électrophorèse de la PCR alkB des souches sélectionnées ................................................ 88
Figure 23: Chromatogrammes de la TLC/FID par (Iatroscan). .................................................................. 89
Figure 24: Structure des substrats en hydrocarbures ayant fait l’objet dans cette étude. ........................ 100
Figure 25: Carte d’Algérie, région d’échantillonnage de sol contaminé par les hydrocarbures – Raffinerie
d’Arzew- ORAN (Ladji et al., 2010). .................................................................................................. 116
Figure 26: Gel d’électrophorèse des produits PCR d’ADNr16S des souches sélectionnées. ..................... 116
Figure 27: Arbre phylogénétique par la méthode Neighbor-joining basée sur les séquences d’ADNr16S
repésentés par des OTUs affiliées aux Protéobactéries, Firmicutes et Actinobactéries isolées du sol
contaminé par les hydrocarbures et des espèces apparentées du BLASTn database. ....................... 117
Figure 28: Arbre phylogénétique par la méthode Neighbor-joining basée sur les séquences d’ADNr 16S
des souches LGM affiliées aux Protéobactéries et Firmicutes isolées du sol contaminé par les
hydrocarbures et des espèces apparentées du BLASTn database. .................................................... 118
Figure 29: Gel d’électrophorèse des produits PCR d’AlkB des souches sélectionnées. ............................. 119
Figure 30: Gel d’électrophorèse des produits PCR de NahAc des souches sélectionnées. ......................... 119
Figure 31: Gel d’électrophorèse des produits PCR de NidA des souches sélectionnées. ........................... 120
LISTE DES TABLEAUX

Tableau 1 : Propriétés physico-chimiques des 16 HAPs prioritaires de la liste EPA d’apères Vandecasteele,
2005 modifié .......................................................................................................................................... 13
Tableau 2: Valeurs guides québécoises et francaises pour différents HAPs [Ministère de l'Enivironnement
du Québec, 1988] .................................................................................................................................. 16
Tableau 3: Normes de rejets en mer méditerranée (Naftec Spa, 2010a). ..................................................... 23
Tableau 4: Exemples de durée de demi-vie des HAPs dans le sol (LCPE, 1994). ........................................ 26
Tableau 5: Méthodes disponibles pour le traitement des eaux contaminées par des produits pétroliers
(Farhadian et al., 2008). ........................................................................................................................ 27
Tableau 6: Différentes techniques de traitement biologique des sols pollués (Scriban,1999). ..................... 31
Tableau 7: Principales souches bactériennes aérobies qui participent à la dégradation des HAPs et des
Alcanes .................................................................................................................................................. 36
Tableau 8: Proportions des différents familles de composés dans divers bruts pétroliers (Bertrand et Mille,
1989)...................................................................................................................................................... 48
Tableau 9: Qualité moyenne du brut Algérien (Naftec Spa, 2007) .............................................................. 49
Tableau 10: Enzymes capables d’oxyder les alcanes (Van Beilen et Funhoff, 2005) ................................... 55
Tableau 11: Diversité des gènes de dégradation des HAPs décrits dans la littérature (Louvel, 2010) ....... 60
Tableau 12: Cultivabilité des bactéries (Amann et al., 1995) ....................................................................... 62
Tableau 13: Composition (%) des fractions pétrolières dans les controles biotiques (P+c et RI+c) et
abiotiques pendant 28 jours d'incubation. ........................................................................................... 90
Tableau 14: Caractéristiques des différents couples d’amorces utilisées lors des PCRs de notre étude. .... 98
Tableau 15: Conditions chromatographiques pour l’analyse des hydrocarbures résiduels par CPG/FID
(Brito et al., 2006) ............................................................................................................................... 101
Tableau 16: Différents phénotypes des bactéries isolées ............................................................................ 111
Tableau 17: Numéro d’accession EMBL-GenBank et l’affiliation des séquences aux OTUs (unité
taxonomique opérationnelle) disponibles sur NCBI (http://www.ncbi.nlm.nih.gov/) ....................... 112
Tableau 18: Résiduels hydrocarbures aromatiques polycycliques (mg/L) et % de biodégradation par les
souches sélectionnées. HAPs à haut poids moléculaire (50 mg/L) et HAPs à bas poids moléculaire
(100 mg/L) après 30 jours de culture. ................................................................................................ 121
Tableau 19: Résiduels alcanes (mg/L) et % de biodégradation par les souches sélectionnées. (250mg/L)
après 21 jours de culture. ................................................................................................................... 122
ABREVIATIONS

% : pourcentage HAPs : Hydrocarbure aromatique polycyclique


GC : Teneur en Guanine et Cytosine HMW: Hight molecular weight
A : Adenine, T : Thymine LMW: low molecular weight

ADN : Acide désoxyribonucléique HPLC: Chromatographie Liquide Haute Performance

ADNr 16 S : ADN codant la sous-unité INT: Iodo-Nitro-Tétrazolium


16S de l’ARN ribosomal LB : Luria-Bertani
ADNc : ADN complémentaire LGM : laboratoire de génetique microbienne
ADNr : ADN ribosomique m/z : ratio masse sur charge d’une molécule
AlkB : Alcane hydroxylase membranaire M : Marqueur de taille
de type AlkBs
MED POL/MED PAS : Programme des Nations Unies
ARN : Acide ribonucléique pour l’environnement. Plan d’action pour la
Méditerranée.http://www.unepmap.org/index.php?module
ARNr : Acide ribonucléique ribosomique =content2&catid=001017003

ARNr 16S : Sous-unité 16S de l’ARN ribosomal MEGA 0.5: Molecular Evolutionary Genetics
Analysis
B[a]P: Benzo[a]Pyrène
MSM: Mineral salt medium
BET: Bromure d’éthidium NAD/NADH : Nicotinamide Adénine
BLAST: Basic Local Alignment Search Tool Dinucléotide (oxydé/réduit)
bp / pb, kbp : base pair / paire de base, kilo
NahAc : Naphtalène dioxygénase
base pairs
ND : Non Déterminé
BSASOL:Base de données Basol sur les sols
pollués:http://basol.developpementdurable.gouv.fr/ NidA : Série de dioxygénase Gram-positif

OTU : Operational Taxonomic Unit


CPG-FID : Chromatographie en phase gazeuse
à détection par ionisation de flamme OMS : Organisation mondiale de la santé

GC: Gas chromatography PCR : Polymerase Chain Reaction

P : Pétrole
GC-MS: Gas Chromatography-Mass Spectrometry
pH : Potentiel Hydrogène
dNTP : Désoxyribonucléotides triphosphates
Phe : Phénanthrène
DO : Densité optique
ppm : partie par million
EDTA : Ethylène Diamine Tétra Acétique

EMBL : European Molecular Biology Laboratory

Pyr : Pyrène
qPCR : quantitative Polymerase Chain Reaction Unités de mesure :
qsp : quantité suffisante pour h, min, s : Heure, minute, seconde
RDP : Ribosomal Database Project l, ml, µl : Litre, milli-litre, microlitre
RT-PCR : Transcription inverse suivie d’une mM : Milli-molaire
réaction d’amplification génique
rpm : Rotation par minute
RI : Rejet Industriel
U : Unité
S (16S) : Svedberg
p/v : masse à volume
SARA : Saturés, Aromatiques, Résines et
Asphaltènes v/v : volume à volume
SDS : Sodium Dodécyl Sulfate C° : Celsius
sp. : Espèce non précise km, cm, mm, nm, µm : kilomètre, centimètre,
millimètre, nanomètre, micromètre
Std : Standard
TBE : Tris-Borate-EDTA g, mg, µg : Gramme, milligramme,
TE: Tris base, EDTA microgramme

Tris: trishydroxyméthylaminométhane
TLC/FID: Thin layer chromatography/ flame
ionization detection
Tm: Temperature of melting
UFC: Unité Formant Colonie
UV: Ultra Violet
INTRODUCTION
Introduction

INTRODUCTION

La pollution par les hydrocarbures en milieu marin et terrestre, qu’elle soit chronique
ou accidentelle, pose d’importants problèmes d’élimination. Les voies d’élimination chimique
et physique ont leurs limites du fait de leur coût ou de leur impact secondaire sur
l’environnement. La voie biologique est actuellement en plein essor et suscite de très
nombreux travaux par le monde. A l’heure où se développe une large «sensibilité écologique»
dans notre société, la connaissance des propriétés de biodégradabilité des produits pétroliers
apparaît comme un enjeu essentiel pour légitimer l’utilisation de ces produits. Les activités
industrielles dans les raffineries génèrent une multitude de composés plus ou moins toxiques
pour les organismes vivants. Par exemple, l’extraction, la transformation et l’utilisation des
produits pétroliers produisent des composés organiques tels les hydrocarbures que l’on
retrouve dans le pétrole brut, les fiouls, les essences, les lubrifiants, rejets industriels
principalement les rejets liquides et des composés inorganiques tels que les métaux lourds.
Ces polluants contaminent tous les compartiments de l’environnement : le sol, l’eau, l’air et la
biosphère.
Selon la base de données BASOL (http://basol.ecologie.gouv.fr/), les hydrocarbures,
les solvants halogénés et les métaux lourds sont les composés le plus souvent rencontrés, seuls
ou en mélanges, sur les sites pollués. Les composés les plus récalcitrants sont les
hydrocarbures saturés principalement, les alcanes lourds ramifiés tel le Pristane (C19), les
hydrocarbures aromatiques polycycliques (HAPs) à haut poids moléculaires tel le Pyrène
(C16) et Benzo[a] Pyrène (C20). Ces polluants sont présents au niveau de sites industriels en
activité, proche des voies de communication routière, au niveau des sols agricoles notamment
et autres écosystèmes aquatiques. Ces substances plus ou moins mobiles se déplacent soit
sous forme particulaire dans l’atmosphère, soit en solution dans les eaux de surface ou
souterraines. Elles peuvent alors atteindre différents écosystèmes naturels. De part leurs
caractéristiques physico-chimiques, ces composés présentent des dangers pour
l’environnement et les organismes vivants. Ils entrent dans la chaine alimentaire, et finissent,
à terme par menacer la santé humaine en raison de leurs des propriétés mutagènes et
cancérigènes (Yakimov et al., 2007).
Malgré leur transformation au cours de l’accumulation, les hydrocarbures enfouis dans
les sols et les nappes aquifères peuvent persister longuement. La formulation des
hydrocarbures d’origine pétrolière doivent prendre en compte des critères de biodégradabilité
afin de limiter autant qu’il est possible les risques environnementaux liés à leur utilisation. De
surcroît, dans l’hypothèse de déversements accidentels, l’autorité publique algérienne se doit
d’être en mesure de prévoir l’impact de toute pollution par ces hydrocarbures. Elle doit
également être à même de prédire si les chances d’atténuation naturelle du site pollué sont
réelles ou si, à l’inverse, il conviendrait d’entreprendre un traitement de dépollution. Il est
donc primordial de mettre en œuvre des moyens de dépollution des sites contaminés. Leur
réhabilitation peut être réalisée par traitement physico-chimique sur site ou après excavation
des sols. Les produits pétroliers sont aussi introduits dans l’environnement marin sous forme
de produits raffinés: carburants et huiles, leurs compositions dépendent de l’origine du pétrole
et des opérations subies au cours du raffinage.

1
Introduction

Ces techniques sont coûteuses et non respectueuses des écosystèmes. Cependant, pour
certains polluants organiques (les hydrocarbures saturés, les HAPs à hauts poids
moléculaires), une approche par bioremédiation peut être envisagée. Elle utilise le pouvoir
épurateur des microorganismes de l’environnement, et présente l’avantage d’être peu invasive
et moins onéreuse. Les groupes de composés pétroliers polluants pour lesquelles la
biodépollution est possible sont : Les hydrocarbures pétroliers (gasoils, fuels, kérosène, huiles
minérales) et Les déchets d’exploitation et de transformation du pétrole (boues et résidus
d’huiles de forages et principalement les rejets ou effluents liquides) (Bertrand et al., 1972).

La grande diversité bactérienne et la versatilité métabolique liée aux gènes de


dégradation a permis à des microorganismes de coloniser l’ensemble des niches écologiques
de la planète en s’adaptant aux changements environnementaux. Ces microorganismes
ubiquistes sont ainsi retrouvés de la stratosphère aux sous-sols profonds. Certaines bactéries
possèdent par ailleurs la capacité d’adopter des formes de vie (spores, symbiose) tel Bacillus
sp. (Dandie et al., 2004) et des structures (biofilms, tapis microbiens) particulières leur
permettant d’appréhender des contraintes environnementales plus ou moins extrêmes tel
Pseudomonas sp. (Johnsen et al., 2007). Ces microorganismes montrent par ailleurs un
potentiel élevé d’adaptation aux pollutions aux hydrocarbures dans les stations de traitement
des sites pollués (Molina et al., 2009). Ainsi, malgré les nombreuses techniques physico-
chimiques et mécaniques développées pour éliminer les hydrocarbures d’environnements
contaminés, la bio-réhabilitation impliquant les populations bactériennes du milieu reste
l’alternative la plus efficace.

La question du devenir des hydrocarbures dans les sites pollués a conduit dans un
premier temps à l’isolement et l’étude physiologique de nombreuses bactéries à partir du sol.
Ces études ont permis de montrer que certaines bactéries hydrocarbonoclastes principalement
les Pseudomonas sont capables de baser leur métabolisme exclusivement sur la dégradation
des hydrocarbures bien que de nombreuses sources de carbone plus facilement métabolisables
soient disponibles dans l’environnement (Juhasz et al., 2000). Cependant, les conditions de
culture limitent l’extrapolation du comportement de la souche isolée dans la communauté
exposée (seul 1% des souches d’une communauté est cultivable en condition de laboratoire).
Avec l’essor des outils moléculaires, de nouvelles approches sur l’écologie des communautés
bactériennes soumises à une contamination pétrolière ont pu être envisagées. Il a été démontré
que les consortia possèdent une efficacité de dégradation des hydrocarbures supérieure à des
souches isolées, grâce à la dégradation séquentielle de ces molécules ou encore à la mise en
place de coopérations métaboliques. Aussi, les métabolismes aérobies permettent une
dégradation plus rapide et plus efficace.

Ce travail a pour but d’étudier la capacité de dégradation des bactéries isolées du sol
contaminé par les hydrocarbures pétroliers de la raffinerie d’Arzew –Oran- afin de mettre au
point des procédés fiables de biodégradation accélérée. En cas de pollution, la connaissance
de la microflore locale du sol contaminé et de ses capacités intrinsèques de biodégradation est
essentielle pour pronostiquer les chances d'atténuation naturelle du site pollué.

2
Introduction

C'est en effet la microflore native qui détermine les capacités d'auto-épuration du site en
l'absence de toute limitation d'ordre physico-chimique. C'est pour cela qu'il est important de
connaître les compositions et performances des bactéries capables de dégrader les polluants.
Dans un premier temps, la problématique des effluents industriels, du rejet des
substances toxiques dans l’environnement et des traitements envisagés sera posée. Puis, les
résultats présentés sur les bactéries sélectionnées capables de dégrader les hydrocarbures
pétroliers principalement le rejet industriel liquide et le pétrole brut ainsi que les polluants
ciblés en HAPs et alcanes s’articuleront autour de quatre points principaux :

Le premier concerne la mise au point méthodologique sur l’enrichissement,


l’isolement et sélection des souches bactériennes aptes à vivre en présence de ces polluants
en s’appuyant sur la démarche adoptée pour l’étude de la biodégradabilité du pétrole brut
(Solano-Serena et al., 1999). Dans la partie expérimentale, la répartition des capacités de
dégradation vis-à-vis de différents substrats des bactéries sélectionnées a été réalisée par le
test de respiration pertinent avec les sels de Tétrazolium (INT) pour la détermination des
capacités intrinsèques des bactéries isolées ayant la capacité de croitre en présence du pétrole
et ses dérivés. Il convenait alors de prendre en considération non seulement l’origine des
microflores mais aussi la variation possible de la formulation du substrat en hydrocarbures
pétroliers. La persistance des HAPs augmente avec le nombre de cycles de la molécule, les
composés de poids moléculaires élevés sont très persistants et par conséquent
bioaccumulables, de ce fait nous nous sommes intéressés à une large gamme de HAPs tels :
phénanthrène, pyrène et le Benzo[a]Pyrène. Autres substrats d’adaptation représentatifs des
familles chimiques du pétrole dans la gamme des alcanes ont été choisis : l’octadecane
(alcane linèaire), le pristane et squalène pour les alcanes ramifiés afin d’évaluer la capacité de
dégradation des isolats sélectionnés.

Le deuxième volet de l’étude est relatif à la caractérisation moléculaire des


microorganismes dégradatrices. Actuellement, la majorité des espèces microbiennes ne sont
connues qu’au travers de leurs biomarqueurs, essentiellement les gènes codants pour les
ARNr 16S, la méthodologie choisie est basée sur l'analyse phylogénétique de séquences
d’ADNr 16S obtenues par amplification génique après extraction de l’ADN génomique des
bactéries isolées. En utilisant une méthode de séquençage des gènes codant l’ARNr16S,
l’identification des bactéries a été déterminée et comparée avec celles présentes dans la
banque de données GenBank database du National Center for Biotechnology Information
(NCBI). Cette étape permet de déterminer une affiliation phylogénétique entre les séquences
analysées et des séquences connues. Les séquences obtenues dans cette étude seront déposées
dans les banques de données NCBI/DDBJ/EMBL/GenBank avec des numéros d’accession
définies.

Le troisième point de l’étude concerne les différentes techniques de dosage utilisées


afin de pouvoir suivre la biodégradation au cours du temps, la détermination des différentes
classes de pétrole par Iatroscan est une méthode basée sur le principe d’une analyse faite par
chromatographie sur couche mince (CCM) couplée à une détection par ionisation de flamme
(TLC-FID) (Cavalier et al., 2009), elle permet de séparer, identifier et quantifier la proportion
relative des fractions majeures du pétrole.

3
Introduction

Les constituants aromatiques et saturés ciblés ont été ensuite quantifiés individuellement par
la chromatographie en phase gazeuse (CPG), c’est une technique permettant de séparer les
composés d'un mélange. Elle s'applique principalement aux composés gazeux ou susceptibles
d'être vaporisés par chauffage sans décomposition. Dans notre étude, nous avons utilisé un
détecteur à ionisation de flamme (FID), afin de pouvoir caractériser les hydrocarbures
résiduels à la fin de la période d'incubation.

Dans la quatrième et dernière partie de cette étude, la relation entre la présence de


certains gènes de dégradation et les performances d’adaptation de différentes souches isolées
a pu être abordée. Les enzymes intervenant dans l’attaque initiale des hydrocarbures sont des
cibles intéressants pour la détection des gènes d’intérêt ciblant la dégradation des
hydrocarbures pétroliers et la détection de bactéries ayant un potentiel de bioremédiation vis-
à-vis de ces composés (Hamman et al., 1999). Nous avons plus particulièrement recherché
ceux de l’attaque initiale des alcanes, l’alcane hydroxylase (alkB) et ceux de l’attaque initiale
des hydrocarbures aromatiques, la dioxygènase (HAP-diox), la naphtalène dioxygénase
(nahAc) susceptible d’intervenir dans l’attaque initiale des HAPs chez les bactéries Gram-
négatif (HAP-diox GN) et (nidA) chez les Gram-positif (HAP-diox GP). Un séquençage des
amplifias a été réalisé afin de confirmer l’identité du gène par rapport à une banque de
données.

4
Chapitre 1
ÉTUDE BIBLIOGRAPHIQUE
Étude bibliographique

1. HYDROCARBURES PETROLIERS

1.1. Définition
Les hydrocarbures sont des composés organiques contenant exclusivement des atomes
de carbones (C) et d'hydrogène (H) (Heider et al., 1999). D'après Harayama et al., (1999), le
terme « hydrocarbure pétrolier » est un terme générique qui désigne les mélanges de
composés organiques présents dans des matières géologiques comme l’huile, le bitume et le
charbon ou dérivés de ces matières.

1.2. Classification
Les hydrocarbures constituent la fraction la plus importante d'un brut pétrolier, ils
représentent entre 65 et 95 % de la plupart des pétroles bruts. Ces hydrocarbures peuvent être
classés en quatre familles principales qui sont présentes en proportions variables selon leur
origine: les hydrocarbures saturés (30 à 70 %), les hydrocarbures aromatiques et
polyaromatiques (20 à 40 %), les composés polaires (5 à 25 %) et les asphaltènes (0 à 10 %)
(Figure 1). Selon Syakti (2004), les hydrocarbures pétroliers sont classés comme suit:

1.2.1. Hydrocarbures saturés


Parmi les hydrocarbures saturés on distingue:
. Alcanes linéaires
Les alcanes linéaires (n-alcanes, CnH2n+2), dont la longueur de leur chaîne varie de 7 à 40
atomes de carbone constituent une des classes les plus abondantes (10 à 40 % des
hydrocarbures totaux d'un brut pétrolier).
. Alcanes ramifiés
Les alcanes ramifiés les plus abondants sont les iso-alcanes (groupement méthyle en position
2). Les autres composés ramifiés antéiso (groupement méthyle en position 3) ou polyramifiés
tels que les isoprénoïdes (exemple: pristane, phytane) sont beaucoup moins nombreux. Ces
composés se trouvent dans le pétrole brut à des proportions sensiblement égales à celles des
n-alcanes.
. Cycloalcanes
Les cycloalcanes renferment des composés cycliques (à 5 ou 6 atomes de carbone) saturés et
le plus souvent substitués. Quelques dérivés polycycliques sont aussi présents et certains
d’entre eux tels que les stéranes et les triterpanes sont caractéristiques d’un pétrole brut. Cette
famille peut représenter entre 30 et 40 % des hydrocarbures totaux d’un pétrole brut.

1.2.2. Hydrocarbures aromatiques (HAPs)


Plusieurs familles d'hydrocarbures aromatiques et polyaromatiques dont le nombre de
noyaux varie de 2 à 6 sont présentes dans les pétroles bruts. Ces composés sont dominés pa
des composés mono-, di- et tri-aromatiques, les cycles aromatiques peuvent être agencés de
manière linéaire (anthracène), angulaire (phénanthrène) ou groupé (pyrène). Au sens strict, ils
ne contiennent donc que des atomes de carbone et d’hydrogène (Vandecasteele, 2005; Seo et
al., 2009). Les HAPs se subdivisent en deux groupes : les légers, dont la masse molaire est
comprise entre 150 et 180 g.mol-1 (HAP de moins de quatre cycles) et les lourds (au moins
quatre cycles) ; dont les masses molaires varient de 200 à 280 g.mol-1.

6
Étude bibliographique

Les HAPs présentant un caractère génotoxique élevé, seize d’entre eux ont été classés par
l’American Environmental Protection Agency (EPA) comme polluants fortement toxiques
dont l’étude est prioritaire (Samanta et al., 2002) sont présentés dans la (Tableau 1). Depuis
quelques années, certains de ces 16 HAPs font également partie des listes de l’OMS
(Organisation Mondiale de la Santé) et de la Communauté Européenne. Ces HAPs sont
constitués de cycles aromatiques accolés en nombre croissant, allant de deux cycles (comme
le naphtalène) et n’ayant pas de limite supérieure encore démontrée. Cependant, certains
composés aromatiques contenant du soufre (comme par exemple le phénanthrothiophène :
C14H8S), de l’azote (comme la quinoline : C9H7N) ou de l’oxygène (comme le
dibenzofurane : C12H8O) sont parfois associés, et ces composés peuvent alors être aussi
considérés comme des HAPs. Les HAPs sont très stables, peu volatils et hydrophobes. Les
caractéristiques physico- chimiques de certains HAPs sont détaillées dans le (Tableau 1).
En général, les hydrocarbures aromatiques sont moins abondants que les alcanes, et ne
représentent que 10 à 30 % des hydrocarbures totaux d'un brut pétrolier.
1.2.3. Composés polaires
Les composés polaires correspondent à des molécules hétérocycliques, telles que:
- des composés oxygénés: phénols, acides carboxyliques, alcools, aldéhydes,…
- des composés soufrés: mercaptans, sulfures, disulfures,
- des composés azotés: pyridines, quinoléines,
Les dérivés soufrés sont dans la plupart des cas plus abondants que les composés oxygénés ou
azotés.

I.2.4. Résines et asphaltènes


Les résines sont des composés très polaires ayant un caractère aromatique très marqué
solubles dans les solvants organiques tels que l’n-heptane. Les asphaltènes correspondent à
une classe de composés de hauts poids moléculaires, insolubles dans le pentane ou l’hexane.
Les composés appartenant à la fraction des résines et asphaltènes peuvent être complexés à
des éléments autres que l’hydrogène et le carbone tels que l’azote, l’oxygène et le soufre pour
former des hétéroéléments. Ces éléments peuvent également être complexés à des métaux
lourds, tels que le nickel et le vanadium, généralement présents à l’état de trace dans les
pétroles (Tissot et Welte, 1984).

7
Étude bibliographique

Alcanes
Hydrocarbures aromatiques n-alcanes et alcanes ramifiés
(monoaromatiques et HAP)

Hexadécane Pristane

Benzène Octadécane
Phénanthrène 10 - 30% 10 - 40% Cycloalcanes

30 - 40%
Toluène
Cyclohexane
Naphtalène
5 - 20%
Métaux Composés
Porphyrines oxygénés Cyclopentane
Composés Composés
Asphaltènes azotés soufrés

Figure 1: Représentation schématique des principales familles d’hydrocarbures et


autres composés d’un pétrole avec quelques exemples de molécules. Modifié d’après
Syakti (2004).

1.3. Les type de pétroles


Le terme de pétrole recouvre un ensemble de produits dont les compositions peuvent
être très différentes. La diversité de composition des bruts repose principalement sur leur
provenance. En effet, les conditions de formation d’un brut vont influencer l’importance
relative de chacune des familles de constituants citées précédemment. Cependant, des bruts
issus d’une région donnée peuvent présenter des différences importantes liées aux conditions
de formation et d’évolution différentes. Les bruts lourds (Boscan, Sofania) contiennent des
proportions importantes de résines et d’alphaltènes par rapport aux hydrocarbures saturés. Au
contraire, les bruts légers sont très riches en hydrocarbures saturés et très pauvres en
asphaltènes (Arabian Light) (Syakti, 2004). Cette diversité dans la composition des bruts est
un aspect très important dans l’industrie du raffinage.

2. POLLUTION DE L’ENVIRONNEMENT PAR LES HYDROCARBURES ET


LEUR IMPACT
La notion de la pollution est toute relative. On peut considérer qu’il y a pollution par
les hydrocarbures lorsque l’action de ceux-ci peut être considérée comme néfaste aux
conditions de vie de l’homme directement, ou indirectement, si elle affecte les populations
animales et végétales qui lui sont utiles (Bertrand et Mille, 1989). La pollution est une
modification défavorable du milieu naturel (dégradation, altération) qui apparaît en totalité ou
en partie comme le sous-produit de l'action humaine (Vogel et Ballerini, 2001).
Les hydrocarbures sont des contaminants environnementaux omniprésents. Ils constituent une
classe des produits chimiques organiques dangereux dont certains de leurs effets toxiques sont
reconnus comme fortement cancérogènes, génotoxiques, immunotoxique, mutagénique ou
tératogénique. Ils représentent une menace pour la santé publique (Eriksson et al., 2003).

8
Étude bibliographique

Les sols contaminés par les hydrocarbures présentent un danger lors d'un contact direct avec
l'homme ou l'animal ou lors de leur transfert dans les chaines alimentaires. C'est le
phénomène de bioaccumulation avec le piégeage par les végétaux et les animaux des
polluants ou de leurs produits de dégradation jusqu'à des teneurs atteignant les seuils de
toxicité (Gabet., 2004). Aux polluants transitant par les cours d’eau s’ajoutent ceux provenant
des territoires proches de la mer. Ils peuvent avoir une origine diffuse (principalement
agricole) ou ponctuelle (stations d’épuration industrielles ou urbaines).
Les impacts de la pollution par les hydrocarbures sont multiples. Les aspects les plus
évidents sont les grandes catastrophes très médiatisés (Soltani, 2004). La plus grande
catastrophe pétrolière fut celle du sous marin d’Ixtoc one, dans le golfe du Mexique où
350 000 tonnes de pétrole brut se sont déversées dans l’océan entre juin 1979 et février 1980.
D’autres sources viennent alourdir le bilan, citons l’exemple de la première guerre du Golfe,
où la fin du conflit en 1991 à révélé la catastrophe des champs de puits de pétrole en flamme
et le naufrage de pétroliers bombardés, déversant des quantités importantes de brut. Le bilan
total a été estimé à 800 000 tonnes déversées, 40 millions de tonnes de sols saturés de pétrole
et 700 km de côtes polluées (Kennish, 2001). En 1980, l’Algérie non plus n’a pas été
épargnée, à ce titre, l’accident du pétrolier Juan Lavalleja a déversé plus de 40 000
tonnes de pétrole dans les eaux territoriales algériennes. Un plan d’action Algérien
national pour la réduction de la pollution marine due à des activités industrielles menées à
terre a été élaboré sous l’égide du Ministère de l'Aménagement du Territoire et de
l'Environnement: MED POL/MED PAS (2005)
(http://www.themedpartnership.org/med/documents/library/backgrounddocuments/naps/en/att
achments%7Cattachments%3A001%7Cfile).
L’essor de l’industrie a entraîné le rejet massif de résidus toxiques dans
l’environnement. Le pétrole constituant la première source mondiale d’énergie, la pollution
par les hydrocarbures est la plus répandue et affecte le milieu marin, les environnements
côtiers et tout particulièrement le sol et les eaux souterraines.

2.1. Impact éco-toxicologique


Dans l’environnement, les contaminants peuvent être présents sous différentes formes
augmentant ainsi les risques d’exposition. En effet, à température ambiante, les hydrocarbures
aliphatiques sont gazeux jusqu'à C4, puis liquides et enfin solides à partir de C16 (excepté
pour les alcynes qui se solidifient à partir de C15). Ces formes induisent des modes de
contamination différents. Par ordre d’importance, on notera l’inhalation, la pénétration à
travers la peau puis l’ingestion (Baudouin et al., 2002). Une fois dans l’organisme, ces
composés hautement liposolubles rejoignent la circulation sanguine puis sont répartis vers un
spectre très large de tissus avec une localisation préférentielle au niveau des tissus adipeux.
Du fait de leur caractère lipophile, ces polluants ont une tendance à la bioaccumulation via les
réseaux trophiques (Fent, 2004). De nombreux hydrocarbures aliphatiques présentent des
risques toxicologiques, mutagènes voire même cancérigènes pour de nombreux organismes
dont l’homme (Spencer et al., 2002). Il est cependant difficile de dissocier leurs effets propres
car ils sont souvent présents en mélange avec d’autres hydrocarbures, tels les HAPs, qui sont
largement plus étudiés.

9
Étude bibliographique

Les hydrocarbures aromatiques sont des composés toxiques, de par leur caractère
mutagène, carcinogène et récalcitrant (Phale et al., 2007). Ils constituent une classe de
composés hydrophobes, donnant une stabilité thermodynamique non négligeable. Les HAPs
se trouvent dans l’environnement à des doses relativement faibles, mais leur caractère
hydrophobe entraîne leur bioconcentration dans la chaîne alimentaire. Certains ont été
reconnus comme cancérigènes (benzo(a)pyrène, benzo(a)anthracène, chrysène, benzo (b)
fluoranthène…). Chez l’homme, les HAPs deviennent toxiques après oxydation enzymatique,
provoquant la formation de métabolites électrophiles solubles.
Ces métabolites peuvent alors former des adduits sur les acides nucléiques ainsi que sur les
protéines, amenant à un dérèglement du processus de division cellulaire et à la formation de
tumeurs (Kallimanis et al., 2007). Le Benzo(a)pyrène (BaP) est certainement le plus connu et
le plus étudié des HAPs quant à sa cancérogenicité. Certains de ses dérivés seraient impliqués
dans le développement de cancers du poumon chez l’homme par la formation d’adduits avec
l’ADN, notamment au niveau du gène p53 (Coppotelli et al., 2008). Des études font état
d’une plus grande mutagénicité de mélanges de HAPs lorsque la proportion en BaP est plus
importante (Phale et al., 2007).
L'homme est exposé aux HAPs par l'ingestion de denrées alimentaires (légumes,
viandes grillées), Phillips (1999) indique que l'alimentation est la source majoritaire
d'exposition aux HAPs pour les non fumeurs (70 % de l'exposition). Des études menées dans
différents pays ont montré que la quantité de HAP ingérée variait de 1,2 à 5 μg par jour.
Par comparaison, la fumée de cigarette ajoute 2 à 5 μg par jour pour une consommation d'un
paquet par jour. Les hydrocarbures aliphatiques chlorés (méthanes, éthanes et éthènes chlorés)
sont les plus étudiés car ce sont des composés chimiques qui sont largement utilisés pour leurs
propriétés de solvants et dont la toxicité est avérée (Ruder, 2006). En effet, le contact avec ces
contaminants peut entraîner des dommages, pouvant aller jusqu’au développement de cancers,
au niveau de nombreux organes (foie, reins, système cardio-vasculaire, système reproductif,
système nerveux) (Ruder, 2006 ; Spencer et al., 2002). Le caractère toxique du pétrole ne
s’applique pas qu’aux organismes supérieurs. En effet, de nombreuses études ont permis de
mettre en évidence le caractère toxique de certains hydrocarbures chez les bactéries (Shirai,
1987). Ces molécules agissent principalement en s’accumulant au niveau de la bicouche
lipidique de la membrane plasmique bactérienne. Elles affectent ainsi la cellule bactérienne en
modifiant la structure et l’intégrité membranaire.
Outre ces effets, certains composés volatils aromatiques contribuent, au travers de réactions
faisant intervenir les oxydes d'azote et le rayonnement solaire, à la formation de polluants
photochimiques, tels que l'ozone, nocifs pour la santé et l’environnement.

10
Étude bibliographique

2.2. Toxicité et propriétes physico-chimiques des HAPs


Les hydrocarbures aromatiques sont des composés que l’on retrouve de manière
naturelle au sein des environnements (produits pétrolifères, dégradation de la matière
organique comme la lignine, feux de forêts, activités volcaniques) (Vandecasteele, 2005).
Cependant, de nombreuses activités anthropiques (comme le raffinage du pétrole brut ou
l’expansion des industries chimiques) entraînent une forte production de ces molécules, qui
malheureusement dans certains cas, vont s’accumuler au sein des sols et donc générer des
pollutions, ces composés organiques ainsi que certains de leurs métabolites de dégradation
peuvent en fonction du degré de contamination, du mode et du temps d’exposition et de
l’organisme considéré, être retrouvés dans une grande variété de tissus affectant ainsi les
capacités fonctionnelles des organismes (augmentation des attaques parasitaires, atteintes des
fonctions de reproduction, modification d’activités cérébrales) (Meador et al., 1995 ; Mearns
et al., 2008).
Dans le cas particulier des marées noires ont pu être constatés des dégâts importants sur les
populations d’oiseaux, de poissons et de mollusques plusieurs années après la catastrophe
(Gentile, 2006).
Les molécules aromatiques ont également la particularité d’être présentes dans les effluents
d’industries chimiques, pétrochimiques et pétrolières tels Benzène, Toluène, Ethylbenzène,
Xylène (BTEX), certains dérivés du phénol et les Hydrocarbures Aromatiques Polycycliques
(HAPs). Cette liste est composée des polluants aux effets sur la santé parfois très différents
(nuisances olfactives, altération de la fonction respiratoire, troubles nerveux (Germain, 1995).
Le devenir et la mobilité des polluants dans l’environnement sont principalement
contrôlés par leurs propriétés chimiques. Ces propriétés les rendent relativement résistants à
la biodégradation. De fait, ils persistent dans l’environnement, faisant courir un risque
sanitaire. En effet, des études ont montré que certains HAPs sont génotoxiques, mutagènes et
cancérigènes (Phale et al., 2007).
La stabilité des HAPs est grandement fonction de l’arrangement des cycles, les HAPs
angulaires étant les plus stables, et les linéaires les moins stables (Vandecasteele, 2005; Seo et
al., 2009). Leur solubilité en milieu aqueux est notable pour le naphtalène (32 mg/L avec
deux cycles aromatiques), mais décroît rapidement avec le nombre de cycles aromatiques
(4 μg/L pour le Benzo[a]Pyrène qui se compose de cinq cycles). Il en va de même pour leur
volatilité, leur faible solubilité et volatilité font que ces hydrocarbures aromatiques sont
persistants dans l’environnement et entraînent des pollutions des écosystèmes (Haritash et
Kaushik, 2009).
A l'état pur, les HAPs sont des solides souvent colorés et cristallins à température ambiante.
Leurs propriétés physico-chimiques varient avec leur masse molaire et leur structure. Le
(Tableau 1) regroupe principales propriétés physico-chimiques des 16 HAPs prioritaires
classés par l'Agence de Protection de l'Environnement américaine (USEPA). Les HAPs ont un
point de fusion supérieur à 100°C et un point d’ébullition élevé (supérieur à 300°C). Ce sont
des composés neutres et non polaires.

11
Étude bibliographique

Les HAPs sont classifiés selon les propriétés qui indiquent leur propension à transferer
vers les differentes phases. Le coefficient de partage octanol/eau (Kow), (Daugulis and
Janikowski, 2002) permet de qualifier l’hydrophobicité d’une molécule. Plus il est important,
plus la molécule aura tendance à s’adsorber sur une surface solide. La solubilité d’un
composé en phase aqueuse, reflétant le degré d’attraction pour ce solvant, est aussi un bon
indicateur de sa capacité d’adsorption. Dans la mesure où elle définit l’affinité du soluté pour
le solvant (Demaneche et al., 2004), plus la solubilité sera élevée, plus les forces reliant le
soluté au solvant seront fortes et plus l’adsorption sera faible. D’autre part, la température
d’ébullition permet d’évaluer la volatilité d’un composé. Plus la température d’ébullition est
faible, plus le composé aura tendance à transferer facilement vers la phase gazeuse.
Dans l’eau, les HAPs sont généralement présents en faible concentration du fait de
leur faible solubilité. Le caractère lipophile (Log Kow >3,2), des HAPs se traduit par une
tendance à se fixer sur les fractions organiques des matières en suspension (MES) et
sédiments (sols). Cela explique que la présence des HAPs est très marquée sur les matières en
suspension alors qu’elle est peu visible dans la phase aqueuse (Feix and Wiart, 1995).

12
Tableau 1 : Propriétés physico-chimiques des 16 HAPs prioritaires de la liste EPA d’apères Vandecasteele, 2005 modifié

Coefficient de partage Cancérogène ou


Formule semi- Formule Masse molaire Pression de Point de Point d’ébull- Solubilité Toxicité Commentaires
HAPs octanol /eau log Pow mutagène
développée brute (g/mol) vapeur (Pa) fusion(C°) ition(C°) (mg/L)

Non confirmé Cancérigène chez les


Naphthalène C8H10 128.2 36.8 80 218 31 3.35 Modérée
animaux

Acénaphthylène C12H8 152.2 4.14 82 270 16.1 4 Modérée Constaté

Acénaphthène C12H10 154.2 1.52 93 279 3.8 3.92 Modérée Constaté

Mutagène pour l’homme


Fluorène C13H10 166.2 0.715 116 294 1.9 4.18 Faible Constaté
Photo-
Phénanthrène C14H10 178.2 0.113 100 338 1.10 4.52 Modérée Constaté sensibilisateur de peau

Anthracène C14H10 178.2 0.0778 216 340 0.045 5.54 Modérée Constaté Cancérigène chez les
animaux. Cancérigène/
Retenu par la norme
européenne relative à l’eau
Fluoranthène C16H10 202 8.72 10-3 107 383 0.26 5.22 Modérée Constaté
potable

Dommage sur ADN.


Pyrène C16H10 202 0.0119 150 393 0.132 5.18 Modérée Constaté Mutagène pour l’homme

Benzo[a] Confirmé Cancérigène.


C18H12 228.3 6.06 10-4 167 435 0.011 5.91 Elevé
anthracène Mutagène pour l’homme
Cancérigène chez les
Confirmé
Chrysène C18H12 228.3 8.4 10-7 254 441 0.002 5.79 Elevé animaux.
Mutagène pour l’Homme
Benzo[b] Confirmé
C20H12 252.3 6.7 10-5 169 443 0.015 5.8 Elevé Cancérigène chez les
fluoranthène
animaux

Benzo[k] Confirmé
C20H12 252.3 4.12 10-6 169.4 443 0.0008 6 Elevé Cancérigène chez les
fluoranthène
animaux
Cancérigène de l’humain.
Confirmé
Benzo[a]pyrène C20H12 252.3 2.13 10-5 179 496 0.0038 6.04 Elevé Mutagène pour l’Homme

Dibenzo Constaté
C22H14 278.3 9.16 10-8 267 524 0.0006 6.75 Elevé
[a,h]anthracène

Cancérigène chez les


Dibenzo[g,h,i] Confirmé
C21H16 268.4 2.25 10-5 280 501 0.00026 6.5 Elevé animaux.
pérylène
Mutagène pour l’Homme
Indéno[1,2,3- Confirmé Cancérigène chez les
c,d]pyrène C18H12 276.03 1.3 10-8 163 536 0.062 6.6 Elevé
animaux

La solubilité est déterminée dans l’eau à 25°C. Le Log P0/W est défini comme le logarithme décimal du coefficient de partition K0W d’un composé donné dans un système de standard diphasique octanol/ eau.
Étude bibliographique

2.3. Effluents industriels -problématique et enjeux sur la santé et l’environnement


La pollution engendrée par les raffineries est caractérisée par trois types de rejets:
solides, gazeux et principalement des rejets liquides. Le traitement des eaux résiduaires
produites par l’activité industrielle est une préoccupation importante des exploitants d’usines
et notamment, de ceux des raffineries et des ensembles pétrochimiques. Si la pollution
domestique des ressources en eaux est relativement maîtrisée et définie, les rejets industriels
sont, au contraire, caractérisés par une très grande diversité suivant l'utilisation qui est faite de
l'eau au cours du processus industriel. La lutte contre la pollution et le durcissement des
réglementations incitent en effet les industriels à optimiser les installations de traitement des
eaux de leurs sites.
Les raffineries, de par leur activité de conversion du pétrole brut et des procédés
appliqués, sont particulièrement concernées, différentes étapes du procédé de traitement des
bruts (fractionnement, craquage thermique, dessalage) conduisent à la production d’eaux
résiduaires qui se distinguent des eaux résiduaires urbaines par leur charge organique et
certains composants spécifiques tels que des hydrocarbures (saturés ou cycliques), les huiles ,
les composés phénoliques, des sulfures, de l’ammoniaque, des composés naphténiques, des
solvants et des chlorures. Le risque majeur que présentent certains de ces composés est leur
capacité à induire le développement de cancer chez les organismes exposés. Par exemple le
Benzo[a]Pyrène, un HAPs à 5 cycles dont les propriétés cancérigènes sont reconnues
représente 3 % des HAPs émis par les alumineries (Germain, 1995). Plusieurs métabolites du
B[a]P sont suspectés d’interférer avec les processus biochimiques cellulaires. Ces
interférences pourraient conduire à des anomalies dans le développement ou à l'induction de
cancers par altération du processus génétique et du processus de division cellulaire lors de la
combinaison avec l'ADN. Il existe beaucoup d'autres sources de contamination des eaux dans
une raffinerie de pétrole mais elles sont de moindre importance. Mentionnons les eaux
pluviales qui ruissellent sur les terrains de la raffinerie, les eaux usées domestiques, les eaux
de service (chaudières, eaux brutes, eaux de refroidissement); en outre, les nombreux produits
chimiques utilisés dans les procédés telle la soude caustique et les acides, les solvants, les
inhibiteurs de corrosion, les détergents, etc. peuvent contribuer à contaminer l'effluent à la
suite d'un déversement, lors des purges ou des nettoyages d'équipements.
2.4. Mesure de protection contre la pollution
2.4.1. Evaluation des sites pollués
L’évaluation de la contamination des sites suspects et l’estimation du danger qui
l’associe est un grand problème. L’évaluation simplifiée des risques (ESR) concerne leur
impact potentiel sur les cibles définies. Le risque est défini par la combinaison de trois
facteurs : Le danger de la source polluante lié à la nature des substances polluantes présentes
sur le site et à leur quantité, le transfert des substances de la source vers les milieux naturels et
la cible qui est l’homme, ou l’environnement (Bertrand et al., 1972). Ainsi, les paramètres les
plus représentatifs pour assurer une surveillance adéquate d'un effluent d'une raffinerie de
pétrole sont les MES (Matières En Suspension), dans une eau, par opposition aux matières
dissoutes mesurées par DCO (Demande Chimique en Oxygène) et DBO5 (est la quantité de
dioxygène nécessaire aux micro-organismes aérobies pour oxyder en 5 jours les matières
organiques dissoutes ou en suspension), les hydrocarbures (huiles et graisses), les phénols, les
sulfures, le NH3 . Le pH doit aussi être mesuré en continu.

14
Étude bibliographique

2.4.2. Réglementation au niveau national


Le littoral algérien n’est pas totalement dépourvu de réglementation. Il est couvert
directement ou indirectement par une pluralité de textes dont certains sont très anciens et
d’autres plus récents et qui touchent à des domaines très variés. L’Algérie a élaboré une loi-
cadre pour l’environnement en 1983, établissant des principes généraux de gestion et de
protection de l’environnement. Des mesures réglementaires ont vu le jour (Loi des finances
1992, Art 117) portant sur l’institution de taxes sur les activités polluantes et dangereuses.
Ces taxes servent à alimenter le Fonds National de l’Environnement (FNE). Ce fonds vise la
promotion d’actions de sensibilisation dans le champ environnemental et de soutien financier
concret à toute activité et mesure de protection de l’environnement.
Bien que la réglementation instaurée en matière de protection de l’environnement soit
complète et détaillée, elle reste, cependant, inefficace sur le terrain pour plusieurs raisons:
Manque de procédures spécifiques d’application, Manque de moyens d’intervention au niveau
des inspections de l’environnement, Contraintes d’ordre social liées à la prise de mesures
environnementales, Manque de sensibilisation des décideurs et des acteurs sociaux. Les
dispositions juridiques ne permettent pas le contrôle intégré des pollutions et la gestion
adéquate des déchets. Elles sont insuffisantes pour protéger le littoral et assurer l’exercice
effectif de la puissance publique.
Le Code des Eaux, réaménagé en 1996, constitue une base suffisante pour une gestion
rationnelle et intégrée des ressources en eaux, mais il est encore peu appliqué. L’Algérie a
continué à chercher d’autres instruments législatifs à fin de mieux protéger son
environnement, alors elle a adopté en 2002 une nouvelle loi relative à la protection et la
valorisation de l’environnement qui incite à préserver les espaces terrestres et marins
remarquables ou nécessaires au maintien des équilibres naturels et à l’interdiction de toute
implantation d’activité industrielles nouvelles sur le littoral. C’est en 2003, que l’état a conçu
la loi n°03-10 relative à la protection de l’environnement dans le cadre du développement
durable [102], où elle interdit toute déversement, immersion et incinération dans les eaux
maritimes sous juridiction algérienne, de substances et matières susceptibles de nuire
l’environnement. Concernant les normes algériennes sur les hydrocarbures, il existe le décret
exécutif n° 93-160 du juillet 1993 (J.O n°46 du 14 juillet 1993) qui fixe la valeur limite
maximale des hydrocarbures rejetés des installations de déversements industriels à 20 mg/l. Il
y a aussi le décret exécutif n° 06-141 du 19 avril 2006 qui définit les valeurs limites des rejets
d'effluents liquides industriels au niveau des anciennes installations pétrolières par 15 mg/L
des hydrocarbures totaux en attendant la mise à niveau des installations dans un délai de sept
(7) ans (conformément aux dispositions législatives en vigueur, et notamment celles de la loi
n°05-07 du 28 avril 2005). Après ce délai la valeur limite des hydrocarbures totaux devient
10 mg/L (Sakker, 2007).

15
Étude bibliographique

2.4.3. Le Règlement et normes de rejets internationales sur les effluents liquides


des raffineries de pétrole

Du fait du caractère toxique des HAPs, il est important de légiférer sur les teneurs
maximales admissibles pour éviter tout risque environnemental ou humain. Au Québec et en
France, ce qui concerne les eaux, le décret n° 2001-1220 du 20 décembre 2001 relatif aux
eaux destinées à la consommation humaine (à l'exception des eaux minérales naturelles)
indique que la somme des concentrations en benzo(b)fluoranthène, benzo(k)fluoranthène,
benzo(a)pyrène, benzo (g,h,i) pérylène et indéno (1,2,3-cd) pyrène ne doit pas excéder 0,1
μg.L-1. Il est à noter que la concentration en benzo[a]pyrène ne doit pas dépasser la valeur de
0,01 μg.L-1.
Dans le domaine de la pollution des sols, les seules données disponibles sont les VCI
(Valeur de Constat d'Impact), au-delà desquelles une étude de la nature de la pollution et de
ses impacts est nécessaire.
Des valeurs dites guides, servant de référence, sont utilisées au Québec [Ministère de
l'Environnement du Québec, 1988] où un seuil de concentration est défini, correspondant à la
valeur d'intervention au-dessus de laquelle le site doit être dépollué. Le (Tableau 2) récapitule
les valeurs retenues par ces gouvernements :

Tableau 2: Valeurs guides québécoises et francaises pour différents HAPs [Ministère de


l'Enivironnement du Québec, 1988]

Critères québécois pour les sols VCI françaises (mg/Kg de


(mg/Kg de matière sèche) matière sèche)
Niveau A Niveau B Niveau C Usage Usage non
sensible sensible
Naphtalène 5 50 46 pvl
Fluorène 10 100
Phénanthrène 5 50
Anthracène 10 100 pvl pvl
Fluoranthène 10 100 6100 pvl
Pyrène 0.1 10 100
Benzo(a)anthracène 1 10 13.9 252
Chrysène 10350 25200
Benzo (a)pyrère 7 25
Benzo(g,h,i)pérylène 1 10
Benzo (k)fluoranthène 900 2520
Indéno (1,2,3- 16.1 252
cd)pyrène
Pvl : pas de valeur limite.
Le niveau A représente le bruit de fond ou la limite de détection du contaminant. Le niveau B
constitue le seuil de contamination pour lequel des analyses approfondies sont nécessaires, et à partir
du niveau C, des techniques de dépollution doivent être mises en œuvre.

16
Étude bibliographique

Le Marpol (pollution marine) (http://marpol.com/) est une convention internationale


concernant la pollution de la mer, fondée en 1978, élaborée dans le cadre de l'Organisation
Maritime Internationale (OMI). Parmi ses principales dispositions :
A une distance de 1 Km de la côte et dans d'autres zones spéciales désignées, les pétroliers
sont autorisés à rejeter de l'eau contenant jusqu'à 15 ppm d'hydrocarbure. Au-delà de cette
concentration une pellicule brillante serait visible à la surface de l'eau, constituant une preuve
de non-conformité. Au-delà d'une limite de 1 Km de la côte et hors des zones spéciales, les
pétroliers sont autorisés à déverser jusqu'à 60 litres par la distance parcourue, jusqu'à un rejet
total maximum représentant 1/15.000 de leur cargaison totale pour les navires-citernes
existants ou 1/30.000 pour les navires-citernes neufs.
Les normes MARPOL 15 ppm et 60 litres au Km peuvent servir de limites plancher aux rejets
des navires-citernes par km pour prévoir les incidences sur l'environnement d'un
accroissement du transport des hydrocarbures.

3. HYDROCARBURES EN ALGERIE
3.1. Historique et situation géographique de la raffinerie d’Arzew
La raffinerie d’Arzew est l’une des cinq raffineries de pétrole d’Algérie, considérée
parmi les complexes les plus importants dans le Nord d’Afrique (Figure 2), troisième
raffinerie du pays après celles d’Alger et de Hassi-Messaoud. Elle est située dans la zone
industrielle sur le plateau d’el Mahgoune à 2 kilomètre de la ville d’Arzew et environ 40
kilomètres de la ville d’Oran. Elle se situe au voisinage du port d’Arzew qui lui permettant les
enlèvements par bateau des produits finis et semi-finis (Bouharis, 2005). Les enlèvements se
font aussi par : camions, pipes et par wagons. Elle est gérée par la société publique Naftec Spa
-SONATRACH.
Les hydrocarbures Algériens ont été nationalises juste après l’indépendance (24 février 1971),
ils occupent une place importante par rapport l’économie nationale. L’Algérie dispose de
potentialités importantes en pétrole et gaz naturel lesquels ne sont pas exploités sous forme de
matières premières mais transformés en partie sur place, selon une stratégie et une
planification rigoureuses. Le transport, la transformation et la commercialisation des
hydrocarbures ont été confiés à la société nationale SONATRACH dont les principaux sièges
se trouvent à: Hassi Messaoud, Alger, Arzew et Skikda.
Arzew, wilaya d’Oran représente un pôle important de transformation et transport des
hydrocarbures. Elle renferme un grand complexe d’industrie pétrochimique en Afrique.
Néanmoins, le développement d’une telle industrie s’est fait au détriment de l’environnement
de cette belle ville qu’on voit se dégrader d’année en année.

3.1.1. Présentation du complexe


La raffinerie d’Arzew occupe 170 hectares, elle a été construite dans le cadre du
premier plan 1970-1974 par la société Japonaise (Japon Gazoline Corporation). Le complexe
traite 2.5 millions Tonnes/an de pétrole brut acheminé du Sahara par pipeline, et plus de
280.000 Tonnes/an de brut réduit importé. D’une manière générale, la raffinerie d’Arzew est
divisée en trois grandes unités, de production, de stockage et zone administrative (Figure 2).

17
Étude bibliographique

Elle répond aux exigences suivantes : Traitement de pétrole brut de Hassi Messaoud,
satisfaction des besoins de consommation du marché national, en carburant, lubrifiants et
bitumes, et l’exploitation de produits excédentaires (naphta kérosène, fuel, gas-oil et huile,
GPL (Gaz de Petrole Liquéfié), essences, lubrifiants et bitumes (Figure 3).
Plus que la moitié de la production est destiné au marché local et le reste à l’exploitation
(Europe, USA) qui sont de grands consommateurs de fuel léger a basse teneur en soufre et de
naphta utilisé comme charge pour les unités pétrochimiques produisant des gaz, essences et
gas-oils (Bouharis, 2005). La raffinerie approvisionne la région Ouest et Sud-Ouest du pays
par 62% de sa production. Les fuels (Basse Teneur en Soufre (BTS) et Haute Teneur en
Soufre (HTS) et la naphta pétrochimique sont exportés à partir du port d’Arzew.

Figure 2: Vue aérienne de la raffinerie d’Arzew

18
Étude bibliographique

Figure 3: Schéma général de la raffinerie d’Arzew- (Boudjillouli, 2001)

3.2. Problématique liée aux hydrocarbures pétroliers en Algérie


Le littoral de l’Ouest d’Algérie recèle un potentiel biologique important, une flore et
une faune riches et variés, des sites naturels exceptionnels, un tel littoral devrait faire l’objet
d’un soin minutieux. Les hydrocarbures représentent la plus importante source de pollution
des eaux de mers et d’océans. Cette pollution résulte de plusieurs activités liées surtout à
l’extraction du pétrole, à son transport et en aval à l’utilisation des produits finis dans les
raffineries.
En effet, de nombreuses études ont permis d’observer l’apparition de problèmes de santé lors
de la baignade ou de pratique de sports aquatiques en eau contaminées. Les plus fréquents
sont des troubles digestifs et des infections cutanées. Cette pollution à retenue l’attention de
l’opinion mondiale et a suscité de nombreuses conventions nationales et internationales tel
que la convention internationale de Londres du 12 mai 1954 la prévention de la pollution des
eaux de la mer par les hydrocarbures » et la convention internationale de Bruxelles de 1971
relative à la création d’un fonds international d’indemnisation pour les dommages dus à la
pollution par les hydrocarbures. En mai 1974, l’Algérie porta ratification de la convention de
Bruxelles, puis, elle adopta le décret n°94-279 du 17 septembre 1994, portant organisation de
lutte contre les pollutions marines et institutions de plans d’urgence. Enfin, le 05 février 2002
la loi algérienne n°02-02 relative à la protection et à la valorisation du littoral est promulguée.

19
Étude bibliographique

Théoriquement la législation protège la baie algérienne, cependant la réalité est toute autre.
Les textes de la loi restent inappliqués, puisque sur le terrain rien n’est respecté. Les rejets des
déchets riches en hydrocarbures émanant des zones industrielles se déversent directement
dans la grande bleue et sans parler de ceux émanant des bateaux poubelles et les navires de
ballastage qui traversent quotidiennement la côte, comme ce fut le cas en 1989 par le pétrolier
‘Maas Luis’ et en 2003 par le navire italien ‘Valbruna’ (Saker, 2007). En attendant
l’application de ces textes et la concrétisation de ces projets, seule l’état de la faune et la flore
pourra témoigner de la triste vérité.
En effet, la pollution par les hydrocarbures en Algérie a fait l’objet de plusieurs études,
parmi lesquelles on cite les travaux de Talbi (2009) et Ghouas en 2005 qui touchent aux
techniques physico-chimiques de traitement des effluents de la raffinerie d’Arzew- Oran, ils
montrent la composition des produits pétroliers tels que Naphta léger et le Naphta lourd, le
kérosène et gasoil. Le gasoil est le produit le plus chargé en alcane (62.36%), ces composés
varient entre (C1 à C30), et en aromatique (17.36%) et il regroupe le benzène et des
hydrocarbures aromatiques non identifiés. Yassa (2005) cible la pollution atmosphérique, ces
travaux traitent la composition en particules organiques de la torche (combustion du pétrole
brut) émis par la raffinerie à Hassi-Messaoud et la comparer avec la pollution présente en
ville. La compostion en particules chimiques atmosphériques en n-alcanes est de 33% pour
(C16 et C34) tel Octadecane (0.012 ppm), et de 47% pour les n-alcanoique acides (A10 à
A30) tel acide pamitique (0.061 ppm). En HAPs 20% tels Phénanthrène (0.011 ppm) et
pyrène (0.003 ppm). Ladji (2010) étudie la composition organique du sable du Sahara pollué
par les hydrocarbures des différentes régions d’Algérie, Hassi-Messaoud, Hassi-Bahbah,
Laghouat, Tougguort et Ghardaia, la plus grande pollution est détectée en n-alcanes à Hassi-
Bahbah avec 66% entre (C16 à C35), le % de chaque n-alcanes est défini dans le sable pollué
et pour chaque ville. En HAPs la ville la plus polluée est Laghouat avec 21.8% entre les
aromatiques légers tels phénanthrènes, anthracène et les aromatiques lourds tels pyrènes et
benzo[a]pyrène, le % de chaque composé aromatique est défini dans le sable pollué et pour
chaque ville. Boutenfnouchet en (2005) a permis d’établir une cartographie de la pollution et
à évaluer la pollution industrielle par les hydrocarbures totaux au niveau de la plateforme
industrielle de Skikda.
Cependant, il serait intéressant de connaître l’identité de ces hydrocarbures directement dans
l’effluent industriel et même dans le pétrole brut avant et après le traitement en raffinerie, qui
est un élément important pour définir le degré du danger qu’ils constituent. C’est pourquoi,
dans notre travail nous nous sommes intéressés à la détermination de la teneur et la nature des
hydrocarbures présents dans le site de traitement de la raffinerie d’Arzew- Oran afin de
prévenir les risques courus dans l’avenir.

3.3. Description des unités de traitement des rejets de la raffinerie d'Arzew


3.3.1. Nature et composition des effluents avant épuration
La pollution engendrée par la raffinerie est caractérisée par trois types de rejets: solides,
gazeux et principalement les rejets liquides (Naftec Spa, 2010a).
La raffinerie d’Arzew rejette des quantités importantes d’eau vers le milieu marin qui sont :
Eaux huileuses ou chargées, eaux de procédés, eaux à forte salinité et eaux chimiques. Eaux
de pluie et de lavage, eaux sanitaires.

20
Étude bibliographique

Types du réseau d’assainissement : Aérien et souterrain. Sites récepteurs des effluents : Oued
Tasmanite, mer. Ces rejets ou effluents liquides canalisés dans des systèmes de réseaux semi-
aériens ou souterrains sont récupérés dans des stations appropriées où ils seront traités.
Pour le traitement des effluents des unités de production 1. La méthode la plus simple et la
plus classique de traitement eaux-huile consiste à utiliser la séparation par gravité. Celle-ci
s’effectue dans des bassins rectangulaires (bassin PPI/API). L’huile écumée est renvoyée dans
des réservoirs pour être retraitée, l’eau prétraitée est évacuée vers la mer.

3.3.2. Station de traitement PPI/API (zone 28)


Le premier bassin PPI (Plaques Parallèles Intercepteurs) contient neuf cellules
parallèles et identiques et chaque cellule traite un débit de 50 m 3/h, où on retrouve dans chaque
cellule un crémaillère de déchet ( ensemble de grilles à l’amont inclinées à 45° dans le sens de
l’écoulement) pour éliminer les déchets solides volumineux entraînés par l’eau, ensuite l’eau
huileuse passe dans un tuyau d’admission en tourbillon qui contient un cône et 12 plaques
parallèles de chaque coté, incliné avec une angle de 80° et orientées dans le sens d’écoulement, le
cône joue un rôle de tranquillisant et augmente le rendement de déshuilage, ensuite l’eau passe à
travers les plaques parallèles et par différence de densité les globules d’huiles montent avec une
vitesse ascensionnelle qui doit être supérieur à la vitesse d’écoulement, ensuite l’huile s’accumule
à l’intérieur du capuchon de submersion puis se déversent dans un écumoire et se dirige vers la
fosse d’huile (les huile sont envoyées vers le bac de slop pour être retraitées avec le pétrole brut
dans la charge…). L’eau partiellement déshuilée traverse le long des plaques, en passant aux
dessous du vase, et passe dans un canal commun qui relie les neuf cellules le conduisant vers la
fosse à eau.
Au cours du passage de l’eau huileuse dans les tuyaux d’admission, il se passe une décantation
(sable et déchet) formant une couche qu’il faut éliminer, cette élimination se passe à travers un
tube d’admission, par un tuyau flexible d’aspiration qui est relié à une pompe, il est tiré par un
câble relié à un treuil dans la direction de l’écoulement de l’eau jusqu’au fond de la fosse.
Le seconde bassin API (Antiparallèle Plaques Intercepteurs) est un séparateur par
gravité qui occupe un volume de 4000 m3 se trouve en aval du PPI, par gravité, on enlève les
composés libres des huiles et autres solides venant du bassin PPI, il est constitué de quatre zones :
Zone 1 : C’est une zone de dispersion des filets liquide. L’eau venant du PPI rencontre des
chicanes qui ont un rôle de repartir uniformément l’eau et abaisser le nombre de Reynolds de son
écoulement.
Zone 2 : Correspond à une zone de collecte et de tassement des matières sédimentées. On a des
globules d’huiles montant avec une vitesse ascensionnelle par différence de densité.
Zone 3 : C’est la zone de mise en vitesse avant le déversoir terminal.
Zone 4 : Dans cette zone on récupère l’huile dans une fosse, et on la refoule par pompage vers le
bac de slop. L’eau déshuilée sera évacuée vers la mer.

3.3.3. Station de traitement des effluents huileux U1800 (STEP)


Pour le traitement des effluents de la production 2 (Figure 4). L’unité dispose de
modes de traitements conjugués : traitement physique suivi d’un traitement biologique puis
tertiaire pour l’amélioration de la qualité de l’eau à recycler. Les eaux à forte salinité sont
traitées dans un circuit autonome.
L’unité dispose également d’un système de dégazage des eaux chimiques avant qu’elles ne
soient déversées dans le bassin de réception de tous les effluents liquides.

21
Étude bibliographique

Cette installation a pour objet :


Le traitement des effluents provenant de la raffinerie, c’est-à-dire les effluents des unités de
production, des zones de stockage et des bâtiments. Les effluents traités répondent aux
normes de rejet vers mer et traitement des effluents pour recyclage d’eau vers circuit
refroidissement.

Débit de traitement maximal de l’installation U1800 est de : 83 m3/h

Figure 4: Schéma représentatif de l’unité de traitement des éffluents de la


raffinerie d’Arzew U1800- (Naftec Spa, 2010b).

22
Étude bibliographique

3.3.4. Caractéristiques des effluents


Effluents bruts : Ils proviennent des égouts suivants :
Egout des eaux claires : ce sont les eaux de pluie provenant des toitures, des routes et
également de la vidange des eaux de pluie des cuves de rétention des réservoirs ainsi les aires
de stockage. Toutefois, cette dernière opération ne sera effectuée en dehors des périodes
pluvieuses.
Egout des eaux huileuses ou chargées : ce sont des eaux huileuses, provenant des aires pavées
des unités de production, stations de pompage, pluie chargée en huiles et réseau de
canalisation. Ce sont également les eaux provenant de vidange des équipements, cuves ou
réservoirs, à l’exception toutefois des vidanges qui pourraient contenir une très petite quantité
d’huile, mais ayant une teneur importante en sels minéraux,
Egout des eaux de procédés : ce sont les eaux condensées polluées provenant : du strippage
des condensats acides, du strippage furfural, du strippage Méthyl- éthyl-cétone et Toluène.
Elles ont une faible minéralisation mais une haute teneur en pollution organique.
Egout des eaux à forte salinité : ce sont les eaux provenant : des purges de déconcentration du
circuit de refroidissement, des purges de déconcentration des chaudières et des effluents de
régénération de l’unité de déminéralisation.

Effluents traités
Le Tableau 3 ci-dessous illustre les normes de rejets en mer méditerranée.

Tableau 3: Normes de rejets en mer méditerranée (Naftec Spa, 2010a).

Paramètres Normes
pH 6.5 à 8,5
DBO5 mg/l 35
DCO mg/l 120
MES mg/l 35
PHENOL mg/l 1
AZOTE TOTAL mg/l 10
PLOMB mg/l 0,1
CHROME EN Cr6+ mg/l 0,05
HYDROCARBURES mg/l 10

3.3.5. Principe de traitements des effluents pour rejet


Pour obtenir des effluents traités répandant aux normes de rejet, il est effectué sur les
effluents bruts les traitements suivants :
Sur Egouts : dessablage et dégraissage, dégazage, prédéshuilage, coagulation–floculation,
flottation, épuration biologique, clarification, filtration à sable et à charbon actif
Sur boues d’épuration biologique de décarbonatation : épaississement. Sur mélange boues de
flottation, boues épaissies et déshydratation sur lit de séchage.

23
Étude bibliographique

4. DEVENIR DES HYDROCARBURES DANS L’ENVIRONNEMENT


C'est par des processus physiques, chimiques et biologiques qu'un hydrocarbure va
pouvoir être déplacer, transformer ou éliminé, après avoir été diffusé dans l'environnement.
Parmi les différentes altérations que peut subir un hydrocarbure, on citera les facteurs
environnementaux qui sont :

4.1. Transformations abiotiques


Les pertes abiotiques des hydrocarbures sont uniquement dues à des phénomènes
d’ordre physique et chimique. Aucune action d’organismes vivant n’intervient. Elles serait
responsables de la perte de à 20% des hydrocarbures aromatiques à 2 et 3 cycles dans les sol
(Park et al., 2001). Les phénomènes de transformation abiotique des hydrocarbures peuvent
se traduire principalement par :
4.1.1. Evaporation
L'évaporation est un phénomène qui touche les fractions de faible poids moléculaire et
dépend des conditions atmosphériques (vent, vagues, température,…). Les hydrocarbures les
plus légers, ayant de 4 à 12 atomes de carbone (T° ébullition < 270 °C), qui représentent
généralement prés de 50 % des hydrocarbures totaux d’un brut moyen, sont éliminés
rapidement dès les premiers jours, pouvant conduire à une pollution de l’atmosphère (Soltani,
2004).
4.1.2. Solubilisation
La solubilité des hydrocarbures dans l’eau est très faible. Un hydrocarbure est d’autant
plus soluble que sa masse moléculaire est faible et que sa polarité est élevée. Il est important
de noter que ces hydrocarbures solubles sont parmi les plus dangereux pour l’environnement.
Ils sont difficiles à éliminer et sont adsorbés par la faune et la flore (Bouchez et al., 1995).
4.1.3. Emulsification
Deux types d’émulsions peuvent se former : eau dans l'huile appelée "mousse
chocolat" et huile dans l'eau. Les émulsions eau dans l'huile sont constituées par des
hydrocarbures de haut poids moléculaires. Ces émulsions difficilement dégradables sont
lesprécurseurs des résidus goudronneux retrouvés sur les plages, alors que les émulsions «
huile dans l'eau » facilitent l’élimination des hydrocarbures (Soltani, 2004).
4.1.4. Sédimentation
La sédimentation est le passage du pétrole de la surface vers le fond (Figure 5). Ce
phénomène concerne les résidus goudronneux constitués de la fraction pétrolière la plus
lourde et dont la densité est supérieure à celle de l’eau de mer. La sédimentation conduit à la
constitution d’agrégats de haute densité difficilement dégradable par voie naturelle (Morgan
et Watkinson, 1989).
4.1.5. Photo-oxydation
La photo- oxydation est observée au niveau de la surface de l’eau où l’air (oxygène) et
la lumière (radiations solaires) sont présents pour la transformation des hydrocarbures.
L’efficacité de ce phénomène dépend de la nature des hydrocarbures et de la présence de
composés non hydrocarbonés. Ainsi, la photooxydation touche plus particulièrement les
composés aromatiques qui sont plus photosensibles que les composés aliphatiques. Parmi ces
derniers, les composés ramifiés sont plus facilement photo-oxydés que les n-alcanes (Wilcke
et al., 2000).

24
Étude bibliographique

Pétrole

Evaporation

Ecoulement latéral

Sol et sous-sol
Formation
d’une langue

Zone capillaire
Nappe phréatique Pétrole dans la
Phase aqueuse

Figure 5: Représentation schématique du devenir d’une pollution pétrolière à la surface


du sol (Morgan et Watkinson, 1989).
La photolyse correspond à la transformation des hydrocarbures sous l'effet d'un rayonnement
lumineux. Après absorption de l'énergie lumineuse, la molécule est déstabilisée et peut
réagir (généralement avec de l'oxygène) pour former une molécule oxydée, plus polaire
et généralement plus toxique (Lampi, 2005). Dans le cas des sols, ce phénomène n'a lieu que
dans les premiers centimètres de la surface (Park et al., 2001). La photolyse est un processus
extrêmement rapide (temps de demi-vie de l'ordre de la minute, Lehto et al., 2000) qui peut
poser des problèmes expérimentaux. Matsuzawa et al. (2001) ont testé différentes modalités
pour tenter d’évaluer la photodégradation de certains HAPs.
Les demi-vie de certains d’entre eux sous éclairage UV constant et selon les conditions sont
données dans le (Tableau 1). La photodegradation parait donc atténuée par la présence de sol.
4.1.6. L'hydrolyse
Processus de dégradation des molécules organiques sous l'action de l'eau, fortement
influencé par le pH et la température du sol.

4.2. Transformation biotique


4.2.1. Biodégradation par les micro-organismes
La biodégradation est le processus naturel le plus important dans la dépollution de
l’environnement. Les microorganismes en sont responsables, en particulier les bactéries
(Vogel et al., 2001). L’importance de la biodégradation dans l’élimination du pétrole, les
voies métaboliques d’oxydation des hydrocarbures par les bactéries et les paramètres qui
peuvent influencer la biodégradation seront traitées plus loin.

25
Étude bibliographique

Particulièrement intéressantes dans le cadre de dépollution de sites contaminés en


hydrocarbures pétroliers, la bioremédiation est considéré comme une façon écologique de
diminuer la teneur de ces polluants récalcitrants notamment les HAPs. C’est en vue
d’exploiter la faculté de certains organismes à dégrader les hydrocarbures que des études
s’attachent à caractériser, quantifier et comprendre ces mécanismes de dégradation. Il est
important de souligner que la durée de demi-vie des hydrocarbures aromatiques dans les sols
est régie par différents mécanismes, dont les biodégradations. Elle consiste en une attaque des
molécules organiques par les micro-organismes du sol, les bactéries, champignons et algues
peuvent en effet cataboliser les hydrocarbures d’origine pétrolière. Le (Tableau 4) illustre les
fortes différences de durée de demi-vie dans un sol.

Tableau 4: Exemples de durée de demi-vie des HAPs dans le sol (LCPE, 1994).
HAPs Demi-vie
Fluorène 32 à 60 jours
Phénanthrène 2.5 à 210 jours
Anthracène 170 jours à 8 ans
Fluoranthène 268 jours à 377 jours
Pyrène 2010 jours à 5.5 ans
Benzo[a]pyrène 0.3 à 58 ans
Le temps de demie vie correspond au temps nécessaire pour que la moitié d'une quantité ou d'une concentration
d'un polluant disparaisse du milieu ou de l'organisme qu'il contamine (Ballerini et al., 1998)

Les micro-organismes produisent des enzymes qui vont réagir avec les molécules
d’hydrocarbures pour les transformer en molécules généralement plus simples. Si la
biodégradation est complète, les polluants sont entièrement décomposés en CO2, c'est la
minéralisation.

4.3. Traitement et méthodes de remédiation des sites pollués par les


hydrocarbures

4.3.1. Traitements des effluents contaminés par des hydrocarbures


Plusieurs techniques de traitement ont vu le jour afin de tenter de restaurer les sites
pollués classés dangereux pour les écosystèmes et la santé humaine. L’intérêt d’une méthode
se mesure à son efficacité, à son coût, à la facilité de sa mise en oeuvre, à la qualité des
effluents obtenu après traitement ainsi qu’à la facilité de retraitement des sous- produits
générés (Vogel et Ballerini, 2001). Pour réaliser une action curative sur un site reconnu
contaminer par les hydrocarbures, plusieurs filières sont envisageables : traitements
physiques, chimiques ou biologiques. Le choix de la filière obéit à des impératifs
technologiques (moyens disponibles, volume à traiter, nature des effluents et objectifs à
atteindre) et économiques (Bernheim, 1999).

26
Étude bibliographique

Les hydrocarbures provenant des industries chimiques et de transformation constituent


les principaux composés de déchets organiques qui contaminent l’environnement. La
présence de ces composés semble être largement attribuable aux techniques inadéquates
d’élimination. Ce type de déchets peut causer de sérieux problèmes de pollution
environnementale tels que la contamination des eaux souterraines (Holliger et al., 1997).
La réglementation nationale et internationale de plus en plus sévère vis-à-vis l’environnement
a permis le développement et l’optimisation de technologies visant la réduction de la pollution
de l’air, de l’eau et du sol. Beaucoup d’efforts ont été directement déployés pour le traitement
des solvants aromatiques dans les effluents gazeux et plusieurs méthodes ont été rapportées
(Tiburtius et al., 2005; Wallace and Kadlec, 2005).

L’évaluation des performances de traitement des stations d’épuration vis-à-vis de ces


substances reste insuffisante. Le bilan complet du devenir des micropolluants dans les stations
est par ailleurs rarement effectué notamment en raison des difficultés analytiques rencontrées
pour la mesure de ces composés dans les matrices solides (comme les boues : fraction
adsorbée) et dans la phase gazeuse. Les industriels doivent aujourd’hui traiter leurs eaux
résiduaires avant de les rejeter dans le milieu extérieur. Le Tableau 5 résume les techniques
d’élimination les plus employées pour le traitement des eaux contaminées par des produits
pétroliers. Les techniques de traitement employées peuvent être basées sur des principes
physiques, chimiques ou biologiques.

Tableau 5: Méthodes disponibles pour le traitement des eaux contaminées par des
produits pétroliers (Farhadian et al., 2008).

Technologies in-situ Technologies ex-situ


Physique Electro-rémédiation Electro-remédiation (électrodialyse)
Barrière Extraction d’Air
Injection d’Air Ajout de surfactant
Confinement hydraulique Adsorption sur charbon actif
Filtration membranaire
Chimique Coagulation, flocculation et précipitation
Oxydation Remediation photocatalytique
(O3, O2, H2O2, Cl2) Oxydation (O3, O2, H2O2, Cl2)

Biologique Bioremédiation In-situ Bioremédiation Ex-situ (aérobie et anaérobie)

A titre d’exemple, les differentes étapes du traitement d’un effluent de raffinerie sont
illustrées sur la (Figure 6). Des procédés d’épuration physicochimiques qui permettent
l’élimination de la pollution colloidale précèdent le traitement biologique qui a pour objectif
l’élimination de la pollution dissoute et biodégradable.

27
Étude bibliographique

Figure 6: Schéma d’une filière de traitement des eaux de raffinerie


(Royal Haskoning, 2003).

D’après le Royal Haskoning (2003), les meilleures techniques pour éliminer les HAPs des
eaux usées sont les suivantes:
1. séparation de l’huile et de l’eau avec un cyclone, par micro-filtration ou separateur API
(American Petroleum Institute),
2. micro filtration, media filtration granulaire ou flottaison des gaz,
3. traitement biologique.

Généralement, une raffinerie de pétrole traite les eaux usées de procédé de façon
semblable avec une chaine de traitement : l'épuisement des eaux acides sert principalement à
réduire la concentration des sulfures et de l'ammoniac et, à un moindre degré, les phénols
dans les eaux usées en provenance des unités d'hydrotraitement et de craquage, l'eau acide est
chauffée pour en récupérer les gaz. Les eaux acides épuisées sont utilisées de nouveau à
l'unité de dessalage en présence du pétrole brut où les phénols encore présents dans ces eaux
ont une plus forte tendance à migrer dans le pétrole brut en fonction du coefficient de partition
eau-huile. Les eaux usées sont ensuite traitées pour enlever les matières en suspension et les
huiles et graisses. Les eaux circulent d'abord dans des séparateurs où sédimentent les
particules et où flottent les huiles (hydrocarbures) libres qui sont récupérées dans le procédé
de raffinage. Par la suite, un flottateur à air dissous ou induit permet d'éliminer pratiquement
toutes les huiles libres en atteignant des concentrations de l'ordre de 10 mg/l. Un bassin
d'égalisation permet ensuite de régulariser le débit et sert également à équilibrer le pH avant le
traitement secondaire.
Sur ce dernier point, les raffineries se distinguent par leur traitement biologique. Ainsi, il
exixiste les réacteurs à lits bactériens, des systèmes à boues activées ou encore traitement des
eaux dans un étang d'aération. Ces trois systèmes sont suivis d'un décanteur secondaire. Les
eaux usées ainsi traitées sont mesurées et échantillonnées avant d'être rejetées au milieu
récepteur (génralement en mer).

28
Étude bibliographique

Les effluents ayant subi un traitement physico-chimique préalable, sont peu chargés en
MES, leur DBO5 est donc essentiellement soluble (la DBO5 exprime le niveau de
biodégradabilité de l’effluent) ; leur composition en nutriments nécessaires à la vie
bactérienne (carbone, azote et phosphore) est rarement équilibrée, un complément est souvent
nécessaire ; les fortes concentrations en sels minéraux sont fréquentes et leurs variations
rapides nuisent au développement de l’épuration biologique, il faut donc les prévenir ; les
valeurs de pH et de température sont souvent variables ; elles doivent être surveillées avec
beaucoup d’attention et rectifiées pour être maintenues dans des zones optimales au
développement de l’activité biologique. Les paramètres de dimensionnement, charge
massique, charge volumique, temps de séjour, âge des boues sont éminemment variables
suivant les procédés utilisés et les secteurs industriels considérés (Gilbert et al., 2005).

Généralités sur les procédés biologiques


La biodegradation aérobie est la plus utilisée dans le traitement d’effluents pétrochimiques
(Figure 7), et qui est considérée comme la technique actuellement disponible la plus éfficace
pour traiter les polluants aromatiques polycycliques récalcitrants de Nardi, 2006;
Kermanshahi et al., 2006, Guieysse et al., 2000).

Figure 7: Schéma de principe du traitement biologique des eaux et mécanismes


principaux d’élimination des substances prioritaires dans un réacteur biologique
conventionnel (Lesage, 2009)
L’épuration biologique aérobie est basée sur la mise en oeuvre de bactéries hétérotrophes qui
éliminent les polluants principalement par les processus suivant : I) par conversion en matière
cellulaire (anabolisme), II) par oxydation en CO2 et H2O qui produit l'énergie nécessaire au
fonctionnement et à la production du matériau cellulaire (catabolisme).

29
Étude bibliographique

Bien que le traitement biologique aérobie soit le traitement le plus courant pour traiter les
effluents industriels, l’application d’un tel procédé à l’élimination de certaines substances
prioritaires est difficile du fait I) de leur vitesse de dégradation parfois lente (nécessitant des
populations bactériennes adaptées), II) des faibles concentrations rencontrées pour certains
micropolluants (qui limitent les cinétiques), III) de la variabilité de l’effluent (Alinsafi et al.,
2006), IV) des propriétés inhibitrices ou toxiques de certaines molécules sur les
microorganismes et enfin V) des processus de transfert par volatilisation et adsorption qui
peuvent nuire à la biodisponibilité et qui sont rarement maîtrisés (Daifullah et al., 2003; Ania
et al., 2007).

4.3.2. Traitements biologiques des sols


Les différents procédés mis en oeuvre sont classés en grandes familles principalement
les traitements aérobies qui utilisent l’oxygène pour transformer les polluants (substrat) en
matériel biologique et participent à la formation de biomasse telles les cultures libres appelée
boues activées c’est l’aération de surface (Actirotor), aération profonde par air surpressé
(Dipair) aération à l’O2 pur et les cultures fixées : lits bactériens à matériau plastique c’est des
filtres biologiques à matériau granulaire (Biofor) et les cultures mixtes ce sont des boues
actives avec support (Meteor).
Les procédés biologiques permettent de dégrader les polluants par l'action de
microorganismes (bactéries, champignons). Ils peuvent être utilisés seuls ou en complément
d'une autre technique. La décontamination par voie biologique consiste donc à stimuler un
phénomène naturel pour en augmenter le rendement afin de détruire le polluant organique qui
sera utilisé comme source de carbone. La décontamination se fait in situ en introduisant dans
le site de traitement les éléments nécessaires au développement de la biomasse ou bien ex situ
dans le cas le sol excavé traité (Colin, 2000). Si la flore locale est inadaptée à la dégradation
des polluants ou est peu abondante, des souches bactériennes performantes allochtones
peuvent être ajoutées au sol (Scow, 2003). Les procédés de traitements biologiques sont : le
bioventing, le biosparging, le pompage et traitement, le traitement bioréacteur (bioslurry) et le
traitement en tas (biotertre et landfarming) représentés dans le Tableau 6.

4.4.3. Les principales technologies utilisées dans la bioremédiation sont les


suivantes
La bioaugmentation : cette technologie consiste à introduire des cultures de
microrganismes à la surface du milieu contaminé dans l’objectif d’augmenter la
biodégradation des contaminants organiques. Généralement les microorganismes sont
sélectionnés sur la base de leur aptitude à dégrader les composés organiques présents dans le
site à dépolluer. La culture peut comprendre une ou plusieurs espèces de microorganimes.
Des éléments nutritifs sont généralement apportés dans la solution contenant les
microorganismes. Cette suspension de microorganisme est apportée à la surface du sol dans
les conditions naturelles ou injecte dans le site contaminé sous pression. Cette technologie est
largement utilisée pour décontaminer les sites contenant des hydrocarbures : Les
microrganismes choisis sont des bactéries dotées d’une grande capacité de digestion de ces
hydrocarbures (Viñas et al., 2002).

30
Étude bibliographique

La biostimulation : cette technologie consiste à stimuler l’activité des populations


microbiennes indigènes (présentes dans le sol ou dans les eaux souterraines) par apport de
nutriments et par ajustement des conditions du milieu (potentiel d’oxydo-réduction, humidité)
(Abdelly, 2007).
Tableau 6: Différentes techniques de traitement biologique des sols pollués
(Scriban,1999).
Type de Avantages et
traitement Principe du Traitement Type de pollution Inconvénients

Aération de la zone Composés organiques - procédé lent.


" Bioventing"

insaturée semi-volatils (gazole) - rendement limité.


(au dessus du niveau - utilisé sur les
de la nappe phréatique) hydrocarbures
aliphatiques.
- plus limité pour les
hydrocarbures
polycycliques et chlorés.
Traitement in-situ.

"Biosparging

Injection d'air dans Composés volatils tel que Le rendement du procédé


la nappe phréatique solvants chlorés et peut eut atteindre 99%.
"

(au niveau de la zone saturée) hydrocarbures pétroliers


volatils (essences,
kérosène
Pompage et traitement

Traitement des pollutions des Composés organiques. Procédé lent.


zones saturées ou insaturées du
sol. L'eau pompée est traitée à la
surface et enrichie en nutriments
minéraux, oxygène et parfois en
microflore adaptée au
polluant, avant d'être
réinjectée dans les
poches contaminées du sol.
farming"
"Land-

Traitement extensif, Hydrocarbures (fuel) - durée importante.


oxygénation naturelle en - coût peu élevé.
couches peu épaisses - nécessité de l'espace
Traitement en tas

(biostimulation-bioaugmentation)
Pour améliorer la dégradation
Tertre biologique

Consommation accélérée par Hydrocarbures - coût modéré.


Traitement ex-situ

(biotertre)

l'ajout de nutriments (fuel, solvants Nécessité de l'espace.


(biostimulation) et micro- Chlorés, kérosène)
organismes
(bioaugmentation) aux polluants.
Possibilité de traitement des
effluents gazeux.
Traitement du sol pollué dans - bon rendement.
Bioslurry un ou plusieurs réacteurs sous Composés organiques - contrôle précis des
(traitement en forme de boue avec ajout hydrocarbonés semi- ou paramètres
bioréacteur) d'ingrédients nécessaires à la non volatils (gasoil, fuel, physicochimiques.
biodégradation ; Contrôle des HAP)
paramètres physicochimiques tel
que le pH.

31
Étude bibliographique

La biofiltration consiste à l’utilisation d’un biolfiltre pour traiter les émissions gazeuses : Le
principe consiste à utiliser des microorganismes pour dégrader les polluants contenus dans
l’air à traiter : la phase aqueuse (l’air contaminé) est mise en contact avec une phase aqueuse
dans laquelle se développe la population microbienne, connue aussi sous le nom de la
biomasse. Dans une unité de biofiltration, l’air à épurer (à dépolluer) traverse d’abord un filtre
et un humidificateur afin de supprimer les particules (poussières, graisses) présentes dans le
gaz et d’amener le niveau d’humidité à 100%. L’air est ensuite introduit dans un réacteur (une
cuve) contenant un garnissage formé de matériaux très poreux (très avide pour l’humidité). A
la surface des particules qui constituent le garnissage se trouve un biofilm qui correspond à
une pellicule d’eau contenant des microorganismes (bactéries et champignons) dont la
fonction est de dégrader les polluants présents dans l’air à traiter. Cette technologie est par
exemple utilisée pour traiter l’air pollué par le xylène ou par des composés azotés (Abdelly,
2007).

5. BIODEGRADATION AEROBIE DES HYDROCARBURES PETROLIERS PAR LES


BACTERIES
L’utilisation de méthodes biologiques dans la dépollution des zones contaminées par
les hydrocarbures se basant sur le phénomène de la biodégradation par les microorganismes
appelés hydrocarbonoclastes a été mise en évidence dès 1946 par ZoBell. Depuis cette date le
nombre d’espèces bactériennes identifiées possédant cette propriété n’a cessé d’augmenter
(Soltani, 2004). La biodégradation est l’ensemble des mécanismes de transformation d’un
contaminant en différents sous produits par l’action des microorganismes. Ce phénomène peut
s’effectuer à n’importe quel milieu (sol, eau) ainsi que dans différentes phases du polluant
(liquide, solide, gazeuse) (Lecomte, 1995).
Certains microorganismes du sol, en particulier des bactéries, sont capables d’obtenir
de l’énergie via le métabolisme des polluants du sol tels que les HAPs (Diaz, 2004). Ils ont
développé des stratégies pour utiliser ces molécules comme sources de carbone et d’énergie,
assurant la détoxification de l’environnement, ou pour les transformer en substrats
métabolisables par d’autres microorganismes (Johnsen et al., 2005). La réduction de la
pollution qui en résulte, est exploitée dans des procédés de bioremédiation visant à
décontaminer les sites pollués tout en conservant l’intégrité de l’écosystème. L’importance de
la biodégradation dans l’élimination du pétrole, les voies métaboliques d’oxydation des
hydrocarbures par les bactéries et les paramètres qui peuvent influencer la biodégradation
seront traitées plus loin.

5.1. Processus généraux de biodégradation des composés organiques


La biodégradation est un phénomène naturel. Elle est le résultat de la dégradation de
molécules organiques par les microorganismes (bactéries, champignons…) dont la croissance
s’effectue par l’oxydation du carbone qui est utilisé comme source d’énergie. Cette réaction
met en jeu deux autres éléments, l’azote et le phosphore, qui participent à la synthèse
protéique ; lorsque l’oxydant est représenté par l’oxygène, on parle de condition d’aérobiose.
Dans le cas d’anaérobiose, l’oxygène est remplacé par les nitrates, sulfates ou méthane (Jose,
1999).

32
Étude bibliographique

La littérature concernant l’oxydation des hydrocarbures par les microorganismes indique que
la croissance cellulaire dépend des processus de transport des hydrocarbures à la surface
cellulaire et de passage à travers l’enveloppe cellulaire jusqu’au cytoplasme (Soltani, 2004).
Dans les conditions naturelles, la biodégradation des hydrocarbures est un processus lent et
complexe, son mécanisme simplifié est décrit dans la Figure 8. Elle se déroule selon une
réaction d’oxydation en chaine, les hydrocarbures sont transformés par cassures successives
en molécules de moins en moins complexe jusqu’à l’obtention de sous-produits simples qui
sont représentés par l’H2O et le CO2 avec renouvellement de la biomasse (Lecomte, 1995).
Deux processus sont communément impliqués dans la biodégradation des composés
organiques (INERIS, 2004) :

I) l’utilisation du xénobiotique comme source d’énergie pour la croissance bactérienne


(oxydation, réduction, fermentation) ;
II) le co-métabolisme, au cours duquel le composé chimique n’est pas utilisé pour la
croissance bactérienne mais est dégradé du fait de l’activité métabolique.

R-CH2- CH2- CH3 Chaine hydrocarbonée

O2 Oxydation de la longue chaine hydrocarbonée en acide.

O
||
R-CH2- CH2- C-OH

β-oxydation sous l’action enzymatique des microorganismes


O2 et de l’oxygène, la chaine hydrocarbonée est dégradée en
acide acétique.

O
||
CH3-C-OH

Dégradation de l’acide acétique en CO2 et H2O dans le cycle


de Krebs.

CO2 + H2O

Figure 8: Principe simplifié de la biodégradation aérobie des hydrocarbures


(Lecomte, 1995).

33
Étude bibliographique

5.1.1. La dégradation primaire (Minéralisation)


La minéralisation de la molécule organique par les micro-organismes est une forme de
biodégradation complète, elle est couplée à une production d’énergie et de carbone au travers
d’une série de réactions complexes d’oxydoréduction. Dans ce cas, les substances impliquées
sont considérées comme des sources de croissances primaires, puisqu’elles sont directement
impliquées dans la croissance bactérienne. Au cours de ce procédé biologique, les électrons
subissent des transferts par addition ou retrait au niveau d’intermédiaires tout au long de la
chaîne de réactions.
La biodégradation se traduit par une simplification progressive de la structure chimique d'un
composé organique de formule Cx Hy Oz Nt Pu avec la minéralisation du carbone
(aboutissant à la formation du dioxyde de carbone CO2) et l'obtention de métabolites de faible
poids moléculaire, disponibles alors pour la synthèse de constituants cellulaires.

5.1.2. Le co-métabolisme des substrats


Horvath (1972) a été un des premiers à faire une synthèse des connaissances autour du
principe de co-métabolisme. Le co-métabolisme correspond à la dégradation biologique d'un
composé, par une enzyme produite de manière fortuite. Cette enzyme catalyse normalement
un autre substrat, mais elle peut présenter une certaine non-spécificité de substrat. Par
principe, le phénomène de co-métabolisme ne bénéficie pas aux microorganismes produisant
l'enzyme. Le polluant ne sert pas de source principale de carbone ou d'énergie, le micro-
organisme à besoin d'une source primaire de substrat, et le polluant est considéré comme un
substrat secondaire. Ainsi, les produits de dégradation liés au co-métabolisme ne stimulent
pas la croissance bactérienne des populations concernées. En culture bactérienne pure, le
produit du co-métabolisme est généralement stocké et n'est pas entièrement minéralisé. Tant
que le métabolite n'est pas toxique, la transformation du substrat peut continuer. Dans le cas
d'un consortium microbien, il peut exister une forme de commensalisme, où une première
espèce dégrade un substrat. Le métabolite produit n'étant pas utilisé par la bactérie, cette
source d'énergie peut servir à une seconde espèce comme un champignon (Bouchez et al.,
1999). Un exemple d’alcane cométabolisé est le cyclohexane dégradé par Mycobacterium
austroafricanum en présence d’isooctane (Marchal et al., 2003).
Le co-métabolisme est reconnu pour permettre la dégradation des HAPs de haut poids
moléculaires dont le benzo(a)pyrène (Juhasz et Naidu, 2000; Kanaly et Harayama, 2000). En
dépit de nombreux essais, seul un nombre très limité de bactéries pouvant croître en cultures
pures à partir de HAP de 5 cycles aromatiques et plus comme substrats, ont été isolées
(Johnsen et al., 2005). Ces HAPs peuvent par contre être dégradés par co-métabolisme.
Le cométabolisme demeure toutefois un phénomène complexe. En effet, cette complexité a
été soulignée par Ye et al., (1996), ils ont trouvé que différents co-substrats (glucose, xylose,
glycérol, acétate) avaient des effets différents sur la transformation du xylène par
Pseudomonas aeruginosa.
Plusieurs microorganismes sont capables de minéraliser les hydrocarbures. Par contre
la présence d’un consortium bactérien peut être requise pour la dégradation complète de
HAPs, particulièrement les HAPs à haut poids moléculaire. Vu la nature complexe et la
diversité de ces composés, la dégradation effectuée par un consortium est souvent plus
efficace (Vinas et al., 2002).

34
Étude bibliographique

En effet, lorsqu’il ya plusieurs bactéries impliquées, chaque microorganisme peut fournir les
enzymes impliquées dans une certaine étape de la dégradation. Les métabolites intermédiaires
de la dégradation des composés peuvent alors être utilisés comme source de carbone par les
autres bactéries (Marcoux, 1998). De plus, certains métabolites intermédiaires peuvent être
toxiques pour quelques bactéries tandis que d’autres peuvent les utiliser comme source de
carbone. Plusieurs études ont d’ailleurs montré la dégradation des HAPs par différents
consortium bactériens (Mueller et al., 1989; Yu et al., 2005)

5.2. Microorganismes aptes à biodégrader les hydrocarbures


Ils proviennent de milieux très variés et peuvent vivre dans des conditions extrêmes :
des températures en dessous de 0°C ou au contraire, très élevées, dans des milieux inondés ou
en plein désert, en présence d’un excès d’oxygène ou milieu anaérobie.
En raison de leur pouvoir d’adaptation, ces microoganismes sont utilisés pour éliminer les
composés xénobiotiques. L’existence d’organismes susceptibles de métaboliser les
hydrocarbures a été signalée dès le début du 20ème siècle par Sohgen (Gatellier, 1970). Les
bactéries sont des acteurs essentiels dans le recyclage des composés organiques de toutes
natures, contribuant ainsi à la biodégradation d’une foule de substances utilisées comme
source d’énergie ou comme source de carbone directement assimilable par les cellules
(Pelmont, 1995).
La dégradation des hydrocarbures dans les milieux marin et terrestre est réalisée par les
bactéries suivantes : Achromobacter, Acinétobacter, Alcaligens, Arthrobacter, Bacillus,
Flavobacterium, Nocardia, Pseudomonas, Micrococcus, Actinomycétes, Rhodococcus,
Corynebacterium et Mycobacterium (Champagnat et Adrian, 1974).
Selon Pelmont, (1995), Les caractéristiques des bactéries aptes à biodégrader les
hydrocarbures sont les suivantes : Génétiquement stable, apte à se reproduire rapidement suite
à un entreposage de longue durée, apte à biodégrader une vaste étendue de polluants
pétroliers, activité enzymatique et croissance des bactéries dans des conditions
environnementales optimum , aucun effet secondaire néfaste et produits finaux non toxiques,
63% pigmentés (orange, jaune et rouge), la majorité des souches bâtonnées Gram négatives,
2% des bactéries motiles ou mobiles, 20% des bactéries à Gram positives, filamenteuses.
Parmi les microorganismes aptes à se développer sur les hydrocarbures (Tableau 7),
les bactéries restent qualitativement et quantitativement prépondérantes pour métaboliser ces
substrats. On peut y retrouver tous les types de bactéries, des autochtones, des hétérotrophes,
des aérobies ; des anaérobies ; des mésophiles ; des psychrophiles et des thermophiles (Gabet
et al., 2004). L’étude de la littérature nous a permis de synthétiser le tableau suivant.

35
Étude bibliographique

Tableau 7: Principales souches bactériennes aérobies qui participent à la dégradation


des HAPs et des Alcanes
Composés Microorganismes Références
Naphtalène Pseudomonas Sp. Eaton et Chapman.,1992
Rhodococcus sp. Grund et al,, 1983
Mycobacterium sp. Daane et al. 2001
Fluorène Pseudomonas sp. Genney et al., 2004
Rodococcus sp. Boldrin et al., 1993
Anthracène Pseudomonas sp. Juhasz et al., 2009
Phénanthrène Pseudomonas sp. Kang et al., 2005
Fluoranthène Pseudomonas sp. Lopez et al., 2005
Paucimobilis sp.
Pyrène Mycobacterium sp. Boldrin et al.,1993
Benzo[a]pyrène Beijerinckia sp. Jerina et al., 1976
Pseudomonas sp. Kanaly et al., 2000
N-alcanes : C5-C10 Pseudomonas aeruginosa Zhang et al.,2010
C10-C20 Corynebacterium sp. Zuber et al.,2008
Mycobacterium sp. Snapper et al., 1990
Rhodococcus sp. Sokplovska et al.,2003
C20-C32 Rhodococcus sp. Whyte et al.,1998

Isoalcane Mycobacterium fortuitum Solano-Serena et al., 2000


Cycloalcanes Nocardia sp. Bouchez-Naitali et al.,1999
Pseudomonas sp. Smith et al., 2004

Plusieurs microorganismes peuvent dégrader partiellement ou complètement les


hydrocarbures. Ce sont principalement des bactéries qui participent à cette dégradation, par
contre certains champignons et algues ont aussi démontré qu’ils pouvaient dégrader ces
composés. Les champignons peuvent transformer les hydrocarbures de façon cométabolique
en métabolites moins toxique par l’action de peroxydase et de monooxygénase. Un des
champignons les plus étudiés pour ses capacités de dégradation est Phanerochaete
chrysosporium (Boonchan et al., 2000) qui à la capacité de dégrader une grande variété de
polluants persistants dans l’environnement comme les HAPs, les biphéniles polychlorés ou les
pesticides. Cette capacité de dégradation serait reliée au système d’enzymes ligninolytiques
extracellulaire sécrétées dans l’environnement (Kanaly et Hur, 2006). Les champignons
dégradant les HAPs qui sont les plus fréquemment retrouvés dans la littérature appartiennent
aux genres Aspergillus, Cunninghamella, Penicillium, Trametes, Fusarium, Sacharomyces et
Bjerkandera.
Quelques recherches ont aussi démontré la dégradation de certains HAPs pas des
algues. En effet, Selenastrum capricoruntum, une algue verte, peut dégrader le fluoranthène,
le pyrène (Lei et al., 2007) et le Benzo[a]Pyène (Cerniglia, 1992, Juhasz et Naidu, 2000).
D’autres espèces comme Chlorella vulgaris, Scenedesmus platydiscus et Scenedesmus
quadricauda ont aussi montré une certaine capacité de dégradation des HAPs (Lei et al.,
2007).
Il est reconnu que les hydrocarbures sont souvent dégradés en aérobie. Par contre, la
biodégradation des HAPs a aussi été rapportée sous différentes conditions anaérobies :
conditions dénitrifinates, sulfato-réductrices ou méthanogène (Chang et al., 2005). En fait le
Naphtalène (Rockne et al., 2000), le phénanthrène, le pyrène et l’anthracène on été
complètement oxydé en C02 sous conditions dénitrifiantes (McNally et al., 1998).

36
Étude bibliographique

De plus, la dégradation de Naphtalène et Phénanthrène a été obtenue sous conditions sulfato-


réductrices (Meckenstock et al., 2000).

5.2.1. Rôle des Protéobactéries dans la dégradation des hydrocarbures


L’identification de bactéries possédant des capacités épuratrices peut aussi être réaliser
au cours de la bioremédiation des sols pollués. Ainsi, une étude sur l’évolution de la diversité
d’un sol pollué aux alcanes et aux aromatiques pendant un processus de bioremédiation a
permis de mettre en évidence que le sol pollué est toujours dominé par des microorganismes
de type Gamma-Proteobacteria (Juhasz et al., 2000). Les bactéries appartenant aux sous-
divisions Gamma-Proteobacteria et Beta-Proteobacteria sont toutefois importantes tout au
long de la décontamination. Par ailleurs, la plupart des souches bactériennes, caractérisées au
cours de ce travail, avaient déjà été identifiées au niveau de sols contaminés par des
hydrocarbures (Eriksson et al., 2003). Les Pseudomonales, et surtout le genre Pseudomonas,
sont très souvent dominants dans les sites contaminés aux hydrocarbures (Evans et al., 2004).
Ils semblent, en effet, être impliqués dans les premières phases des procédés de
bioremédiation lorsque les polluants sont biodisponibles (Kaplan et Kitt, 2004).
Des bactéries du genre Pseudomonas, appartenant à la classe des
Gammaprotéobactéries, ont servi de modèles pour étudier le métabolisme du naphtalène et du
phénanthrène. Les opérons cataboliques de P. putida G7 et P. stutzeri AN10 ont a été
caractérisés après isolement sur naphtalène (Bosch et al., 1999). De même, Pseudomonas
aeruginosa a été isolée pour ses capacités à dégrader le phénanthrène (Romero et al., 1998).
Pseudomonas putida, et Pseudomonas aeruginosa sont aussi connues pour leur faculté de
chimiotactisme vis à vis des HAPs (Grimm and Harwood, 1999). D’autres Pseudomonas ont
été détectées dans des sols contaminés par une pollution diffuse (Johnsen et al., 2002). Une
autre Gammaprotéobactérie, Stenotrophomonas, est capable de dégrader le phénanthrène ainsi
que des HAP de haut poids moléculaire comme le benz[a]anthracène, le benzo[a]pyrène, le
fluoranthène et le pyrène (Juhasz et al., 2000).

5.2.2. Exemples de biodégradation


Biofiltration des effluents
La dégradation des composés organiques volatils (COV) par les microorganismes
capables de les utiliser comme source d’énergie ou de carbone, abrités dans un bioréacteur
filtrant les effluants gazeux, représente une solution moins onéreuse que les méthodes
physicochimiques, qui peuvent dégager des composés toxiques comme les oxydes d’azote.
Déjà largement utilisé pour le traitement de l’eau et de certains rejets liquides industriels, le
traitement biologique s’étend depuis quelques années aux effluents gazeux, en particulier en
hollande, en Allemagne et plus récemment aux USA.
Selon la nature des polluants à éliminer, la transformation biologique implique des bactéries,
des algues ou des champignons. De manière générale, de nombreuses souches microbiennes
métabolisent les alcools, les acides, les esters et les cétones. Les hydrocarbures aromatiques
nécessitent une assez longue adaptation de la population microbienne dans le réacteur. Il faut
considérer éventuellement la toxicité de certains composés présents dans les gaz à traiter
comme le dioxyde de soufre.

37
Étude bibliographique

Il est cependant plus simple d’ensemencer le réacteur avec de la boue active provenant d’une
station d’épuration d’eau, dont la population microbienne s’adaptera d’elle-même. Quelque
soit l’origine de la souche dégradant le polluant, une population microbienne extrêmement
variée se développera dans le bioréacteur.
Il arrive souvent que les bactéries ne dégradent pas complètement les composés organiques
mais les transforment en métabolites secondaires, eux-mêmes utilisés comme substrats
nutritifs par d’autres espèces. Ainsi de proche en proche, les microorganismes finissent par
dégrader totalement lescomposés organiques en eau, sels et gaz carboniques (CO2). Les
cellules mortes servent à leur tour de substrat à des espèces saprophytes, si bien que le
réacteur peut être considéré comme un système fermé (Abedelly, 2007).

Dépollution des eaux usées et des effluents industriels


Dans les stations d’épuration, ce sont des microorganismes qui retirent des eaux
usées les polluants les plus courants, avant qu’elles ne rejoignent la rivière, le lac ou la mer.
Les pollutions croissantes (dues à l’industrie et à l’agriculture) nécessitent le développement
de procédés capables d’éliminer des polluants spécifiques comme l’azote, le phosphore, les
métaux lourds et les composés chlorés.
Selon la vieille méthode des boues activées, les eaux usées passent dans un premier bassin dit
biologique, où un agitateur mécanique brasse les boues (mélange de biomasse, de polluants et
de débris) pour les maintenir en suspension et stimuler la biodégradation du substrat. Les
bactéries se développent librement dans ce bassin où les effluents sont fournis de manière
continue et les boues se décantent. L’eau est alors libérée dans la nature (et utilisée) alors que
les boues sont maintenues dans ce bassin biologique.
Plusieurs dizaines d’espèces bactériennes, en particulier du genre Pseudomonas, peuvent
dégrader les polluants organiques. Ces organismes hétéroptrophes se reproduisent très vite et
les boues sont renouvelées au bout de 2 à 10 jours. En revanche les Nitrosomas, qui
transforment en nitrite les fortes concentrations d’ammoniac des eaux résiduaires et les
Nitrobacters qui convertissent ces nitrites en nitrates ont un faible taux de croissance. Pour
laisser à ces bactéries le temps d’opérer, on ne peut renouveler les boues qu’en 20 jours
environ (Kermanshahi et al., 2006).
A la place des cultures libres, les professionnels développement depuis quelques années des
cultures de bactéries sur des supports minéraux fixes ou sur des supports mobiles constitués
de billes de polystyrène en suspension. Le recyclage des déchets en produits utiles peut
réduire les coûts du traitement des eaux usées. Par exemple, grâce à des bactéries utilisant le
soufre dans leur métabolisme, les métaux lourds et les composés soufrés, présents dans les
eaux usées peuvent être retirés puis réutilisés. La production d’aliments pour les animaux à
partir la biomasse de champignons qui demeure après l’extraction de la pénicilline en est un
autre exemple. Enfin la plupart des systèmes de traitement des eaux usées produisent un gaz
utilisable (biogaz) (Alemzadeh and Vossoughi, 2001).

38
Étude bibliographique

Dépollution du milieu marin


Pour lutter contre les marées noires (arrivée de nappes de pétrole provenant d’un
navire qui a été accidenté ou qui a purgé ses réservoirs ou de l’éruption accidentelle d’une tête
de puits sous marine), l’expérience a prouvé que la plupart des produits commercialisés à base
de microorganismes exogènes ne sont pas plus efficaces que les organismes oléophiles
(microorganismes qui dégradent les produits pétroliers) indigènes, dont la profilération est
stimulée par la marée noire.
Le mouvement des marées apporte l’oxygène nécessaire, ainsi un simple ajout de fertilisants
azotés dans les zones contaminées suffit pour éliminer la pollution 3 à 5 fois plus vite que
dans les zones non traitées. Malheureusement un tel succès dans le nettoyage d’une marée
noire reste rare. La bioremédiation ne devient efficace que lorsque la couche de pétrole n’est
pas épaisse, c'est-à-dire après plusieurs nettoyages mécaniques.
Lorsque la couche est épaisse, l’absence d’oxygène à l’intérieur de la couche d’hydrocarbures
diminue l’action des microorganismes.
Un autre problème auquel est confrontée la dépollution est la contamination des sédiments
des océans et des estuaires. Au cours du temps, un grand nombre de polluants comme les
polychlorobiphényles, les hydrocarbures aromatiques polycycliques, les pesticides
s’accumulent. Leur attaque par les bactéries est parfois difficile en raison de leur adsorption
sur les particules sédimentaires. Des détergents (produits permettant d’éliminer d’un milieu
solide les particules étrangères qui y adhèrent par leur mise en suspension ou en solution)
d’origine microbienne, les bio surfactants peuvent permettre leur désorption et faciliter leur
attaque par les bactéries. Les chercheurs travaillant sur les microorganismes qui utilisent des
hydrocarbures comme seule source de carbone pour leur croissance, ont observé que ces
microorganismes libèrent leurs propres agents surfactants dans le milieu. En facilitant la
désorption des nutriments dans la matrice du sol ou leur dispersion dans l’eau, ces
biosurfactants rendent les souches microbiennes qui les sécrètent plus compétitives.
Au cours de ces dernières années, la recherche sur les biosurfactants a fortement
augmenté sous l’effet des progrès de la biotechnologie. Aussi efficaces que leurs homologues
chimiques, les biosurfactants présentent l’avantage d’être biodégradables et non toxiques. De
plus certains qui sont sécrétés par des organismes extrêmophiles (et sont donc très efficaces),
restent fonctionnel malgré les conditions sévères de température, de salinité et de pH. De
nombreux microorganismes producteurs de biosurfactants ont été déjà isolés et il est devenu
maintenant possible de produire par voie biologique une grande variété de biosurfactants dont
la nature chimique et les propriétés dépendent des paramètres physiques de l’environnement
(pH, température, salinité) et de la composition du milieu nutritif (N, P, K, Fe et Mn). Les
conditions qui existent dans le futur milieu d’utilisation du biosurfactant déterminent
d’ailleurs en grande partie le choix d’une souche pour une application donnée. Etant donné
leur diversité chimique et fonctionnelle, les biosurfactants trouveront probablement des
applications aussi variées que leurs homologues de synthèse (Zimmerman et al., 2004).

39
Étude bibliographique

5.3. Mécanisme d’accession des microorganismes aux composés organiques


hydrophobes
Certains microorganismes utilisent les hydrocarbures comme source de carbone pour
leur croissance. De ce fait, ils se sont adaptés en termes de résistance et d’équipement
enzymatique pour utiliser ce type de substrat. Les hydrocarbures sont des composés
hydrophobes dont la solubilité diminue à mesure que la masse moléculaire des composés
augmente. Pour les hydrocarbures dont la solubilité est faible (< 0,1 g/l), les microorganismes
ont développé des stratégies pour venir au contact du substrat. Quatre modes d'accession,
illustrés dans la (Figure 9) ont été avancés pour expliquer l'assimilation des hydrocarbures
par les microorganismes (Bouchez-Naitali et al., 1999).
L’assimilation des hydrocarbures solubles, l’assimilation en phase aqueuse a surtout été
rapportée pour les hydrocarbures aromatiques suffisamment solubles et les alcanes légers
(Bouchez et al., 1995; Goswami et Singh, 1991). C'est sous forme solubilisée que le substrat
pénètre dans la cellule.
L'accession interfaciale, les micro-organismes utilisant les alcanes peu solubles possèdent
fréquemment une membrane externe hydrophobe (Rosenberg, 1986).
L'hydrophobicité élevée de cette enveloppe permet l'adhésion du microorganisme aux
gouttelettes de substrat présentes dans le milieu aqueux, souvent de taille très supérieure à
celle des bactéries. Le substrat pénètre directement dans la cellule par diffusion ou transport
actif sans dissolution préalable dans la phase aqueuse. L'hydrophobicité des microorganismes
concernés entraîne souvent une forte tendance à l'agrégation.
L'accession interfaciale facilitée (émulsification), dans ce cas, l'intervention de
biosurfactants produits par les microorganismes accélère le transfert des hydrocarbures en
augmentant l'aire interfaciale entre les phases hydrophobe et hydrophile. On parle de transfert
interfacial assisté. L'action des biosurfactants est souvent complexe.
Ils participent à la pseudo solubilisation des alcanes nécessaires à la croissance tout en restant
associés aux cellules bactériennes pendant la croissance, puis sont libérés massivement
lorsque le microorganisme a cessé toute croissance (Singer et Finnerty, 1984).
Le transfert micellaire, différents auteurs ont montré que la solubilité apparente des n-
alcanes était très largement supérieure à celle mesurée dans l'eau dans les cultures de levures
sur n-alcanes (Roy et al., 2003) ou sur HAP (Kim et al., 2001).
Cette augmentation de la solubilité apparente est liée à la formation d'une microémulsion
résultant de la pseudo solubilisation des hydrocarbures par des biosurfactants produits par le
microorganisme. Les micelles ainsi formées, de taille très inférieure aux bactéries, entrent en
contact avec la cellule. Le mécanisme de transfert à travers l'enveloppe cellulaire n'est en
réalité pas connu. Une protéine de transport membranaire AlkL a été cependant mise en
évidence (van Beilen et al., 1992b). Hommel, 1994 a formulé une hypothèse sur l'existence
des pores hydrophobes au niveau de l'enveloppe bactérienne. Il faut noter que la surface
externe d'une micelle est majoritairement hydrophile et le transfert micellaire apparaît
privilégié chez les microorganismes dont l'hydrophobicité de l'enveloppe micellaire est faible
(Bouchez-Naitali et al., 1999). Les interactions hydrophobes entre substrat et cellule
microbienne sont d'ailleurs complexes car les biosurfactants produits sont susceptibles
d'affecter l'hydrophobicité cellulaire. En effet, le rôle physiologique des biosurfactants est
multiple.

40
Étude bibliographique

Ils interviennent dans la formation de microcolonies, ils facilitent l’association en surface des
bactéries et de part ce fait la formation d’agrégats, ils assurent la formation d’une structure de
type filamenteuse et jouent un rôle dans la dispersion des biofilms (Pamp et Tolker-Nielsen,
2007).

Bactéries

Solubilisation de Transfert interfacial Transfert interfacial Transfert micellaire


l’hydrocarbure dans direct Facilité (Hydrocarbure (micelles < 50 nm)
la phase aqueuse émulsionné)

Figure 9: Les mécanismes d’accession des microorganismes aux hydrocarbures


(Vandecasteele, 2005)
4.6. Acquisition des HAPs par les bactéries
Les HAPs à l’état solide, sous forme de cristaux, ne semblent pas disponibles pour
être utilisés comme source de carbone et d’énergie par les bactéries (Volkering et al., 1992).
Seuls les HAPs dissous dans la phase aqueuse sont capables de pénétrer à l’intérieur de la
cellule pour être catalysés par des enzymes intracellulaires. Ainsi la croissance des bactéries
dégradantes ne dépend pas de la quantité de naphtalène ou de phénanthrène solide présent
dans le milieu de culture mais de la quantité dissoute dans la solution aqueuse (Wodzinski et
Coyle, 1974). Néanmoins, la surface spécifique des composés aromatiques joue un rôle
important dans la dissolution spontanée, ce qui favorise à terme la minéralisation des HAPs
par les bactéries (Thomas et al., 1986). L’utilisation d’un microscope électronique à
balayage montre de petits cratères laissés par les bactéries à la surface des cristaux
d’anthracène (Wick et al., 2002).
Lorsque la quantité d’anthracène solide dans le milieu de culture est faible, Mycobacterium
sp. est capable de développer un biofilm à la surface, ce qui optimise sa dissolution. La
distance entre les bactéries et les cristaux est inférieure à 1 µm. Une fine couche d‘eau reste
dans l’espace intermédiaire dans laquelle la concentration d’équilibre de l’anthracène est
atteinte (45-62 µg.L-1). La surface de la bactérie présente une forte affinité pour le composé
organique, ce qui diminue localement la concentration du polluant par rapport à la
concentration dans le milieu, et favorise le taux de transfert de l’anthracène vers la bactérie
pour entraîner à nouveau la dissolution de l’anthracène (Wick et al., 2002). Le mécanisme de
prélèvement des HAPs par les bactéries semble un processus de diffusion passif lié à la nature
lipidique de la membrane cytoplasmique (Hori et al., 2009).

41
Étude bibliographique

L’inhibition des protéines membranaires ne modifie pas le prélèvement de phénanthrène par


Pseudomonas fluorescens (Bugg et al., 2000). Les protéines de transport de la membrane
externe et les protéines plasmiques ne semblent pas avoir de rôle dans le prélèvement des
HAPs. À l'inverse, il semble qu'elles permettent l’efflux actif en dehors de la cellule des
polluants dont le phénanthrène et le fluoranthène (Bugg et al., 2000). Les propriétés de
surface de l’enveloppe bactérienne, dont le caractère hydrophobe, sont affectées par plusieurs
paramètres liés à l’environnement de la cellule.

L’augmentation de la température de 28°C à 37°C de Pseudomonas sp. TIS1-127 entraîne une


variation de l’hydrophobicité, ce qui implique une diminution de l’acquisition du toluène
(Hori et al., 2009). La nature du substrat de croissance peut aussi affecter les propriétés de
surface de Mycobacterium sp. (Wick et al., 2002). Lorsque le substrat est le glucose, la
surface des cellules est plus hydrophile et moins électronégativement chargée que dans le cas
où les bactéries ont poussé sur l’anthracène, lesquelles adhèrent mieux sur les surfaces
hydrophobes.

5.4. Adaptation des micro-organismes aux sites pollués


Dans les sites pollués aux hydrocarbures depuis longtemps, il a été mis en évidence
que les micro-organismes présentent la capacité de s'adapter à la présence des polluants, leur
sensibilité vis à vis des composés organiques peut ainsi être diminuée de plusieurs ordres de
grandeur (Klimkowicz et Maliszewska, 2003). De même la dégradation des hydrocarbures
pétroliers dans un sol ayant déjà été exposé à ces molécules est plus rapide que dans un sol
non précédemment exposé (Barriuso et al., 1996 ; Barriuso et al., 2000). Ainsi dans un sol
n'ayant jamais contenu de HAPs par exemple, leur minéralisation est inférieure à 5% alors
qu'elle atteint 60% de la quantité de HAPs ajoutée au bout de 9 semaines dans un sol pré-
exposé (Carmichael et al., 1997). Il semble également que la quantité de HAPs qui doit être
présent dans le sol pour maintenir ou activer une capacité de biodégradation n'a pas besoin
d'être très importante. Johnsen et Karlson (2005) ont en effet montré que " le bruit de fond "
de la contamination en HAPs des sols danois (0,1 mg kg-1) était suffisant pour observer la
minéralisation du pyrène alors que celle-ci reste inexistante dans des sols de forêts. Ainsi
l'historique de pollution d'un sol est un paramètre à prendre en compte lors de l'étude de la
capacité de biodégradation de sa microflore.

5.5. Adaptation génétique des bactéries


Les microorganismes d’un sol non exposé à des composés contaminants ne possèdent
pas forcément la capacité de les métaboliser. Cependant, lorsqu’ils sont exposés à de tels
composés, ils sont souvent capables de s’adapter, c'est-à-dire d’acquérir le potentiel
métabolique de dégradation de ces polluants par recrutement vertical ou horizontal de gènes
spécifiques (George et Hay, 2011).
Le recrutement des voies métaboliques, présentes dans le génome mais non exprimées, peut
se faire par des évènements de mutation ponctuelle, de réarrangement génétique ou de
transposition (recrutement vertical) (Habe et Omori, 2003). Les microorganismes peuvent
aussi acquérir des clusters de gènes cataboliques via des éléments mobiles transférés d’un
hôte donneur à un hôte receveur (transfert horizontal).

42
Étude bibliographique

Chez les bactéries, les phénomènes de transferts les plus connus sont la conjugaison via des
plasmides, la transformation ou la transduction (Juhas et al., 2009). Ces phénomènes de
transferts horizontaux augmentent les capacités métaboliques des bactéries, notamment en
élargissant leur gamme de substrats, et permettent l’adaptation des populations microbiennes
à de nouveaux contaminants (van der Meer et al., 1992; van der Meer et Sentchilo, 2003).

5.6. Biodétection de la pollution par les hydrocarbures


Il paraît nécessaire de donner quelques définitions concernant la notion de
bioindication qui, avec l’avancement des travaux de recherche, se diversifie et recouvre en
réalité plusieurs concepts.
Rhee et ses collaborateurs (2002) considèrent le terme de bio-indicateur comme « un simple
relais ne faisant référence qu’à des effets observables au niveau de l’individu se traduisant par
des altérations morphologiques, tissulaires ou physiologiques (croissance et reproduction) ».
Les auteurs prennent ainsi la réaction au niveau individuel. Lorsque la réaction se situe au
niveau populationnel et/ou communautaire (disparition ou apparition d’espèces, variation
densitaire), on utilisera le terme de bio-intégrateur.
Un troisième concept relève également des processus biologiques mais se situe au niveau
infra-individuel : altérations moléculaires, biochimiques, cellulaires ou physiologiques non
visibles à l’oeil. Il s’agit de la notion de bio-marqueur dont on peut donner la définition de
Mendum et al (1998): « Un bio-marqueur est un changement observable et/ou mesurable au
niveau moléculaire, biochimique, cellulaire, physiologique, qui révèle l’exposition présente
ou passée d’un individu à au moins une substance chimique à caractère polluant». Plusieurs
auteurs ont étudié la répartition des dégradeurs des HAPs dans l'environnement (Kastner et
al.1998 ; Bakker et al., 2000; Besombes et al., 2001) . La plupart de ces études ont trait aux
bactéries des sols.
La diversité microbienne contribue au fonctionnement des sols et peut être utilisée comme un
indicateur biologique de la qualité des sols et de leur fertilité. Les bactéries hétérotrophes
participent directement ou indirectement à l’altération des matières organiques dans le sol
(Kastner et al., 1994).
La capacité de dégrader les hydrocarbures est distribuée parmi de nombreux genres
bactériens appartenant aux Protéobacteries et aux bactéries Gram positives. Les souches
isolées sont généralement mésophiles et sont le plus souvent isolées à partir du sol. La gamme
de substrats utilisée par une souche peut être restreinte à un ou deux hydrocarbures ou
s'étendre à cinq et plus. Elle peut être liée à la présence chez la même souche d'une ou de
plusieurs voies cataboliques mais ne peut pas être clairement assignée à des genres bactériens
particuliers (Vandecasteele, 2005).
Les études de la microflore des sols pollués par les hydrocarbures ont mis en évidence
plusieurs points relatifs à l'activité des bactéries aérobie. Ces études ont notamment souligné
l'intérêt physiologique et écologique de la croissance microbienne, la grande diversité de la
microflore et leur adaptation aux conditions du milieu. La prédominance des souches à
croissance rapide du genre telles Pseudomonas et Bacillus a fréquemment été observée
(Daane et al., 2001). Andreoni et Gianfreda (2007) ont étudié la distribution des
microorganismes dégradeurs d'hydrocarbures dans différents habitats.

43
Étude bibliographique

Des microorganismes ont été isolés dans des sédiments marins, des océans, des eaux côtières,
des étangs arctiques, des lacs et des estuaires. Cependant, ces microorganismes se retrouvent
en proportions variables dans la communauté microbienne totale. Smit et al. (2001) ont
montré que la composition de la microflore des sols est modifiée par la venue d'une pollution
par des carburants, avec un enrichissement en Beta-Protéobactéries et/ou Gama-
Protéobactéries.
Les résultats de Kiyohara et al. (1978) montrent que la plupart des bactéries utilisant les
HAPs ont été trouvées dans des environnements où une activité humaine non négligeable à
amené des contaminations par HAPs. Les auteurs, notent également la rareté des souches
dégradant l'anthracène et le kérosène ainsi que l'ubiquite remarquable des souches dégradant
le phénanthrène. Il n'est pas exclu que cette études complaise aussi certains cas de dégradation
des HAPs par cométabolisme. Si les bactéries capables de dégrader le naphtalène sont
observées dans tous les sols en quantité non négligeables, c'est –à- dire supérieures à 104
UFC/g, les bactéries dégradant les HAPs à trois ou quatre cycles ne sont au contraire
présentes en quantités importantes (de 103à 106 UFC g-1 de sol) que dans les sols contaminés
par les HAPs.

5.7. Facteurs affectant la biodégradation des hydrocarbures dans l’environnment


Les travaux de recherche sur l’oxydation des hydrocarbures par les
microorganismes ont montré que ce processus dépend de la structure chimique des
hydrocarbures et des conditions environnementales (Leahy et Colwelli, 1990). Les facteurs
physico-chimiques influant sur la vitesse de biodégradation microbienne sont :
a- Structure et nature du milieu récepteur
Les bioprocédés s’appliquent à une grande variété de sol. Pour cela, il est
important de connaitre la structure et la nature du sol à traiter (Lecomte, 1995). La taille des
pores et les propriétés de l’eau et de l’air dans ces pores sont des facteurs spécifiques de
chaque sol (Girard et al., 2005). Les particules élémentaires du sol sont généralement liées
entre elles par les forces électrostatiques formant des agrégats plus au moins volumineuses
groupés en unités structurales du sol. En effet, les agrégats tendent à diminuer l’activité
microbienne dans le sol de manière indirect. Par un ralentissement de la diffusion de
l’oxygène et l’apport des nutriments à l’intérieur de l’unité structurale et par la protection
mécanique des substrats qu’elle renferme (Girard et al., 2005).
b- Nature du polluant - Composition chimique des hydrocarbures
Les composés pétroliers différents par leur susceptibilité à l’attaque microbienne.
Ainsi, la vitesse de biodégradation est plus élevée pour les hydrocarbures saturés, viennent
ensuite les hydrocarbures aromatiques légers, les hydrocarbures aromatiques à haut poids
moléculaire et les composés polaires ayant la vitesse de dégradation la plus faible (Soltani,
2004).
La biodégradabilité des pétroles bruts est très fortement dépendante de leur composition ; à
une température déterminée, un pétrole léger est plus susceptible d’être biodégradé qu’un
pétrole lourd (Soltani, 2004). En général, ils sont classées selon leur sensibilité aux attaques
microbiennes de la manière suivante : n-alcanes > alcanes ramifiés > aromatiques à faible
poids moléculaire > alcanes cycliques > aromatiques à haut poids moléculaire > stéranes-
hopanes (Van Hamme et al., 2003).

44
Étude bibliographique

c- Facteurs microbiologiques
Les hydrocarbures à faible poids moléculaire sont considérés comme des composés
toxiques pour les microorganismes à cause de leur grande solubilité et par conséquent leur
concentration très élevée dans les phases aqueuses (Zhang et al., 2009). L’action toxique du
polluant peut provoquer un ralentissement de l’activité de la microflore du sol (Vogel et
Ballerni, 2001).
Dans un habitat bien défini, il est reconnu que les différentes communautés microbiennes
autochtones ont eu la possibilité de développer des interactions :
· Positives : le concept de commensalisme implique l’action normale d’une population qui
modifie l’environnement de telle façon que ces modifications permettent le développement
d’une espèce.
· Négatives : parmi ces interactions, le phénomène dénommé amensalisme ou «antagonisme»
qui implique la production par une espèce donnée de métabolites inhibiteurs pour d’autre
population qui ne pourront ainsi venir coloniser l’habitat (Vogel et Ballerni, 2001).
d- Facteurs environnementaux
1. Influence de la température
La température est un paramètre pouvant influencer la biodégradation du pétrole en
modifiant son état physique, sa composition chimique, l’activité physiologique des
microorganismes et par conséquent la vitesse de dégradation des hydrocarbures, ainsi que la
nature et la concentration des espèces microbiennes présentes (Leahy et Colwell, 1990). Une
diminution de la température est généralement accompagnée par une diminution de la vitesse
de biodégradation qui peut être expliquée par une décroissance de l’activité enzymatique. Des
températures plus élevées ont pour effet d’augmenter la vitesse de biodégradation (Sikkema et
al., 1995 ). Le maximum de l’activité métabolique des microorganismes est généralement
observé à une température comprise entre 30 et 40 °C. Au delà de la température optimale de
croissance et de biodégradation on assiste à une augmentation de la toxicité des hydrocarbures
et une diminution de l’activité métabolique. Roling et al., (2004) mentionnent une inhibition
totale de la biodégradation au-delà de 80-90°C après l’isolement des bactéries thermophiles.
2. Influence de l’oxygène
L’étape initiale du catabolisme des hydrocarbures par les bactéries et les champignons
inclus l’oxydation de ces substrats par l’intermédiaire d’hydroxylases et d’oxygénases, pour
lesquelles l’oxygène moléculaire est indispensable. Les conditions aérobies sont, nécessaires
pour cette voie d’oxydation microbienne des hydrocarbures dans l’environnement (Leahy et
Colwell, 1990).
La concentration en oxygène a été identifiée comme une variable limitante de la vitesse de la
biodégradation du pétrole dans les sols, Marin et al. (2001), ont constaté une augmentation de
la dégradation des hydrocarbures totaux de 10 % par la bactérie Acinetobactercalcoaceticus,
après un apport supplémentaire d’oxygène par agitation. Théoriquement, 3,5 g d’oxygène sont
nécessaires pour l’oxydation complète de 1 g de pétrole (Soltani, 2004).
3. Influence des éléments nutritifs
Le rejet des hydrocarbures dans les environnements qui contiennent des éléments
nutritifs inorganiques en faibles concentrations, conduit généralement à des rapports
carbone/azote et carbone/phosphore très élevés, défavorables pour la croissance microbienne
(Leahy et Colwell, 1990).

45
Étude bibliographique

Le pétrole lui-même contient de tels nutriments en petites quantités, mais ils sont toujours
présents sous forme de composés hétérocycliques (exemple: dérivés de la pyridine et du
pyrrole pour l’azote) ou organométalliques complexes; ils ne sont donc pas utilisables par les
microorganismes. L’azote et le phosphore sont donc des facteurs limitant la biodégradation
des hydrocarbures dans les sols (Bertrand et Mille, 1989).
4. Effet de la salinité
Les fortes salinités constituent une barrière naturelle pour la biodégradation des
hydrocarbures. Des chercheurs ont trouvé que la biodégradation des hydrocarbures est
maximale pour une concentration en sel de 0,4 M et diminue lentement pour des valeurs
supérieures et inférieures à celle-ci (Soltani, 2004).
Thiele-Bruhn et Brummer, 2004 ont montré que la vitesse de la biodégradation des
hydrocarbures décroit lorsque la salinité passe de 3,3 à 28,4%, et ils ont attribué ces résultats à
une réduction générale des vitesses métaboliques des microorganismes.
5. Effet du pH
Les biotopes naturels peuvent avoir des valeurs de pH très variables, allant de 2,5 à
11,0. Des valeurs extrêmes de pH pourraient avoir une influence négative sur la capacité des
microorganismes à dégrader les hydrocarbures. La croissance des bactéries hétérotrophes et
des champignons étant favorisée par un pH proche de la neutralité (Leahy et Colwell, 1990).
Liebeg et Cutright, 1999 et Straube et al., 2003 ont trouvé que la dégradation des
hydrocarbures est plus élevée dans des conditions légèrement basiques.
6. Effet de l’humidité
L’humidité est un paramètre important dans le processus de la biodégradation car l’eau
est un élément indispensable au développement des bactéries. Les bactéries sont influencées
par la concentration osmotique et la disponibilité en eau dans le sol, pour cella, Gabet (2004)
a signalé que pour une meilleure activité de biodégradation, l’humidité doit être de 25 à 90%.

5.8. Facteurs biologiques favorisant l’accessibilité et la dégradation des


hydrocarbures
De nombreux mécanismes ont été développés par les microorganismes pour détecter,
importer et dégrader les hydrocarbures. Dans la plupart des cas, les enzymes de dégradation
des hydrocarbures sont localisées à l’intérieur de la cellule et par conséquent les
hydrocarbures doivent être importés dans la cellule pour être dégradés. Plusieurs modes de
transport des hydrocarbures ont pu être identifiés chez les bactéries : la diffusion passive au
travers de la bicouche lipidique de la membrane ou au travers de pores non spécifiques
(Pinkart et White, 1997 ; Sikkema et al;, 1995 ; Tsitko et al., 1999) ; le transport actif par
système de pompe à efflux permettant la concentration du composé dans la cellule
(Kallimanis et al., 2007). C’est le cas de certains composés aromatiques comme le
naphthalène chez Pseudomonas fluorescens (Rojas et al., 2001). D’autres systèmes actifs de
pompe à efflux permettent la résistance aux composés par leur élimination de la cellule
(Duque et al., 2001).
D’autres comportements favorisant l’incorporation des hydrocarbures ont pu être observés
chez les bactéries :

46
Étude bibliographique

- Certains microorganismes sont capables de détecter la présence des hydrocarbures par


chimiotactisme et de se diriger dans un gradient de concentration (Pandey et Jain, 2002), ces
mécanismes interviennent via des chimiorécepteurs et des voies de signalisation, et
provoquent un déplacement des bactéries selon le gradient de concentration du polluant. Les
bactéries s’accumulent alors à l’interface entre le polluant hydrophobe et le milieu hydrophile,
provoquant une augmentation du taux de dégradation des composés et souvent une
augmentation de leur désorption (Law et Aitken, 2003).
- Certains microorganismes sont capables de s’adsorber aux particules riches en polluants
grâce à leur paroi hydrophobe (Miyata et al., 2004) et de former des biofilms (Johnsen et al.,
2005). D’autres microorganismes produisent des surfactants. Ces molécules ont la propriété
d’augmenter la solubilité des composés hydrophobes et d’en améliorer l’accessibilité (Zheng
et Obbard, 2002).
- Aussi, l’excrétion d’enzymes à la surface de l’organisme a pu être observée afin de favoriser
le transport des hydrocarbures (Walzer et al., 2008).
- Dans le cas des HAPs très récalcitrants à la biodégradation comme le benzo[a]pyrène, des
processus coopératifs peuvent se mettre en place : les champignons, connus pour leur capacité
à dégrader les HAPs de haut poids moléculaire (Cerniglia, 1992), amorcent la dégradation.
Les bactéries utilisent ensuite les produits de dégradation plus hydrophiles et plus réactifs
comme sources de carbone (Boonchan et al., 2000).

6. BIODEGRADATION DU PETROLE BRUT


La spécificité des substrats à l’attque microbienne a été largement étudiée. Atlas 1981
et Leahy et Colwell (1990), ont classé les composés du pétrole en quatre familles. Ces
composés différents par leur susceptiblité à l’attaque microbienne. Ainsi la vitesse de
biodégradation est plus élevée pour les saturés, viennet ensuite les aromatiques légers, les
aromaiques à haut poids moléculaire, les composés polaires ayant la vitesse de dégradation la
plus faible.
Les hydrocarbures saturés incluent les n-alcanes, les alcanes ramifiés et les
cycloalcanes. Les alcanes à chaines linéaires sont les plus abondants des hydocarbures totaux
dans le cas du pétrole leger et peuvent atteindre dans certains cas 60%, les plus rapidement
dégradable tels les n-alcanes à nombre de carbone supérieur à 44 peuvent etre métabolisés par
les microorganismes et ceux ayant de 10 à 24 atomes de carone (C10-C24) sont généralement
les plus facilement dégradables. Les alcanes ramifiés sont plus récalcitrants à la
biodégradation que les n-alcanes et plus le nombre de ramification augmente, moins ces
composés sont susceptibles à la biodégradation microbienne. Les hydrocarbures cycliques
constituent une fraction importante des hydrocarbures dans la plupart des bruts pétroliers, ils
sont difficilement dégradables que les deux séries précédentes à cause de leur toxicité suite à
l’intéraction avec la membrane cellulaire des microorganismes (Sikkema et al., 1995).
Les expériences montrent de façon équivoque que la biodégradation des cycloalcanes
est très limitée (atlas 1981). La non accumulation des hydrocarbures cycliques dans
l’environnement implique des phénomènes non conventionnels de dégradation tel que
l’intervention des phénomènes de co-oxydation impliquant plusieurs souches microbiennes
dont l’équipement enzymatique est complémentaire (Bertrand et al., 1989, Rotani et al.,
1992).

47
Étude bibliographique

Des études sur la transformation des HAPs par les microrganismes ont montrés leur
toxicité cellulaire (Sikkema et al., 1995). Les HAPs de faible poids moléculaires constituent
généralement 2 à 20% des hydrocarbures des pétroles légers et moins de 2% des
hydrocarbures des pétroles lourds tels les alkyl-benzènes légers qui sont les plus toxiques à
cause de leur solubilité dans l’eau, mais peuvent cependant être métabolisés par les
microorganismes quand ils sont présents en faibles concentrations.
La structure moléculaire des HAPs détermine la vitesse de leur dégradation, un grand
nombre de méthyle empêche l’oxydation initiale, les polyaromatiques sont moins toxiques
pour les microoorganismes, mais ils sont rarement métabolisés et quand ils le sont leur
biodégradation est lente, c’est ce qui explique leur accumulation dans l’environnement. Ces
hydrocarbures aromatiques lourds constituent 2 à 10% des hydrocarbures des pétroles léger et
plus de 35% des hydrocarbures des pétroles lourds.
Les asphaltènes et les résines constituent une fraction faible du pétrole brut, 1 à 5 % du
pétrole légers alors qu’un pétrole lourd peut contenir plus de 25% d’asphaltènes et 20 % de
résines. Cette dernière classe de composés pétroliers n’est pas biodégradable ou très
lentement dégradable.
La biodégradabilité des pétroles bruts est très fortement dépendante de leur
composition (Atlas, 1981), à une température déterminée, un pétrole léger est plus susceptible
d’étre biodégradé qu’un pétrole lourd. Par exemple, un brut à très faible teneur en soufre et
très riche en composész saturés (exemple : Louisiane du Sud) (Tableau 8) sera facilement
biodégradé, contrairement à un fuel de type Bunker C à très haute teneur en soufre et
composés aromatiques. Les n-alcanes contenus dans un pétrole provenant du Vénézuéla sont
moins bien dégradés que ceux présents dans un pétrole de type Léger d’Arabie (Bertrand et
Mille, 1989). Les caractéristiques du brut algérien sont representés dans le Tableau 9.

Tableau 8: Proportions des différents familles de composés dans divers bruts pétroliers
(Bertrand et Mille, 1989)
Bruts pétroliers Saturés Aromatiques Polaires (Résines) Asphaltènes
Louisiane du Sud 69 20 10.3 0.3
Koweit 44 28.3 23.2 4.5
Buncker C 21.1 34.2 30.3 14.4
Léger d’Arabie 48 35 9 7.5
Tunisien (Asthar) 48 32 12 8
Vénézulien 46 21.6 19.3 9
Prudho Bay 55 25 10 10

48
Étude bibliographique

Tableau 9: Qualité moyenne du brut Algérien (Naftec Spa, 2007)


Caractéristiques du pétrole
Densité 0.8025
TVR (bar) 0.650
Soufre (ppm) 850
TVR : Tension de vapeur

Bertrand 1989, a rassemblé des règles qui ont des applications générales à l’ensemble des
micoorganismes :
1- Les hydrocarbures aliphatiques sont assimilés par une grande variété de microorganismes,
les composés aromatiques peuvent être oxydé mais sont assimilés par quelque bactéries
seulement.
2- Les n-alcanes à chaines courtes tels que n-nonane ne sont pas toujours assimilés mais
peuvent être oxydé, seuls quelques bactéries ont la capacité de croitre sur des alcanes plus
court que le n-octane. Quand la longueur des chaines augmente au delà de C9, le facteur de
production augmente, mais la vitesse d’oxydation décroit.
3- Les composés saturés sont plus rapidement dégradés que les insaturés.
4- Les composés ramifiés sont moins rapidement degradés que les composés non substitués.

7. BIODEGRADATION PAR TYPE D’HYDROCARBURE


En aérobiose, de nombreuses bactéries ont développé des stratégies enzymatiques qui
leur permettent d’incorporer un ou deux atomes d’oxygène à la molécule cible. Cette réaction
d’oxydation rend l’hydrocarbure plus hydrophile et par conséquent plus facilement
dégradable par le métabolisme bactérien. Les réactions impliquées dans ces processus font le
plus souvent appel à l’action d’oxygénases (mono- ou dioxygénase). L’acquisition par les
organismes des gènes de dégradation des hydrocarbures se fait le plus souvent par transfert
horizontal via des plasmides, des transposons (Phale et al., 2007).

7.1. Biodégradation des hydrocarbures saturés


7.1.1. Voies de dégradation des alcanes linéaires
La dégradation aérobie des alcanes est amorcée par l’introduction d’un atome
d’oxygène sur la chaîne aliphatique via l’action d’une monooxygénase pour former un alcool
linéaire (Figure 10). Cette réaction peut être réalisée par des cytochromes P450 (Sariaslani et
Omer, 1992), des méthanes monooxygénases et des systèmes d’hydroxylases à fer non
hémique appelés « alcane hydroxylase » qui semblent être les plus répandus dans la
dégradation des alcanes (Van Beilen et al., 2001).

49
Étude bibliographique

Oxydation terminale Oxydation subterminale

Oxydation diterminale

Figure 10: Voie métabolique de dégradation des n-alcanes (van Beilen et al., 2003)
L’étude du système d’alcane hydroxylase de Pseudomonas putida a permis de mettre en
évidence une large spécificité de l’enzyme, celle-ci permettant l’oxydation d’n-alcanes,
d’alkylbenzènes et de cycloalcanes (Van Ravenswaay et van Linden, 1971).
Cette oxydation peut être monoterminale, biterminale ou subterminale, et nécessite de
l’énergie qui est le plus souvent fourni par l’oxydation d’un composé intermédiaire réduit tel
NADH (Figure 11). L’alcool obtenu est ensuite converti après plusieurs réactions en un acide
gras qui pourra être introduit dans les cycles de la β -oxydation et/ou des acides
tricarboxyliques. Les intermédiaires produits servent à d’autres réactions métaboliques, à la
constitution de biomasse cellulaire, de réserves lipidiques (inclusions) et peuvent également
être totalement minéralisés en CO2.

R-CH3 : alcane ; R-CH2OH : alcool primaire.


Figure 11: Système de l’alcane hydroxylase à fer non hémique chez Pseudomonas putida
Gpo1 (chaîne de transfert d’électrons) Van Beilen et al., 2001

50
Étude bibliographique

La dégradation des alcanes a été mise en évidence chez de nombreux micro-


organismes (Singer et Finnerty, 1984; Watkinson et Morgan, 1990). Une spécialisation des
micro-organismes en fonction de la longueur de la chaîne a pu ainsi être mise en évidence. La
biodégradation des alcanes à chaîne moyenne (nC5-nC10) est de loin la plus étudiée. Ceux-ci
peuvent être dégradés par des bactéries du genre Pseudomonas (Whyte et al., 1997). Les
alcanes à longues chaînes (nC10- nC20) sont également dégradés par différents genres
bactériens tels qu’Acinetobacter (Lai et Khanna, 1996) ou encore Rhodococcus (Whyte et al.,
1998). La biodégradation des alcanes à très longues chaînes (> nC20) est plus difficile.
Cependant, une souche psychrotrophe, Rhodococcus sp. Q15, capable de minéraliser
l’octacosane (nC28) et le dotriacontane (nC32) a pu être isolée (Whyte et al., 1998).
Le système d’oxydation des alcanes de Pseudomonas putida Gpo1 est codé par
l’opéron alkBFGHJKL et le locus alkST situés sur deux régions du grand plasmide OCT (Van
Beilen et al., 2001) (Figure 12). L’opéron alkBFGHJKL code pour l’alcane hydroxylase
(AlkB), deux rubrédoxines (AlkF et AlkG), une aldéhyde déshydrogénase (AlkH), une alcool
déshydrogénase (AlkJ), une acétyl-CoA synthase (AlkK) et une protéine de la membrane
externe qui jouerait un rôle dans le transport du substrat (AlkL). Le locus alkST code pour une
protéine de régulation (AlkS) qui active l’expression des deux opérons, et une rubrédoxine
réductase (AlkT). AlkN interviendrait dans le chimiotactisme pour atteindre le substrat. Chez
le genre Acinetobater, les gènes ne sont pas regroupés en opéron et ne sont pas portés par un
plasmide. Aussi, la protéine AlkR (homologue de AlkS) est nécessaire pour activer AlkM
(homologue de AlkB).

Récemment, des enzymes apparentées aux système alcane hydroxylase de Pseudomonas


putida ont été clonées à partir de différentes souches appartenant à des genres différents
(Smits et al., 1999). Le système enzymatique chez P. putida semble dégrader les n-alcanes C5
à C12 (van Beilen et al., 1994) alors que la plupart des autres systèmes homologues isolés
dégradent généralement les alcanes ayant plus de 10 atomes de carbone (Smits et al., 2002).
Les bactéries capables de dégrader les alcanes sont largement répandus dans l’environnement,
mais leur étude reste difficile car les gènes responsables de la dégradation sont très
diversifiés. Les différents gènes du système alkB isolés aujourd’hui sont notamment très peu
conservés, ce qui rend leur étude plus difficile (van Beilen et al., 2003).

51
Étude bibliographique

FAD : flavo adénine dinucléotide ; NADH : nicotinamide adénine dinucléotide ; ATP : adénine tri-phosphate ;
CoA : coenzymeA ; Cycle TCA : cycle des acides tri-carboxyliques

Figure 12: Voie de dégradation des alcanes chez Pseudomonas putida Gpo1, rôle et
localisation cellulaire des protéines Alk et de leur système de régulation
(Van Beilen et al., 2001)
7.1.2. Voies de dégradation des alcanes branchés
Les alcanes branchés contenant un ou deux groupements méthyles sur leurs chaînes
principales sont complètement métabolisés en CO2. Leurs voies de dégradation semblent
similaires à celles intervenant lors de la dégradation des alcanes linéaires (Thijsse et Van der
Linden, 1961). En général, plus les groupements méthyles sont éloignés sur la chaîne, plus la
biodégradation est facile (Pirnik, 1977). Les molécules présentant des carbones tertiaires sont
dégradées plus lentement. Les composés les plus récalcitrants sont ceux qui comportent un
carbone quaternaire. Plus la chaîne carbonée est grande et/ou plus le carbone substitué est près
du centre de la chaîne principale et/ou plus le degré de substitution est élevé, plus la molécule
est difficilement biodégradable (Mc Kenna, 1972).
Les composés branchés sont en général plus résistants à la dégradation que leurs homologues
linéaires. D'autres raisons pour lesquelles le mécanisme d'oxydation peut contribuer à cette
résistance, sont : I) les cellules sont incapables de transférer les molécules branchées au travers
des membranes, II) le système enzymatique n'est pas capable d'oxyder ce type de molécule,
III) les alcanes branchés ne parviennent pas à induire le système enzymatique d'oxydation ou
enfin, IV) le substrat est toxique pour les cellules.

52
Étude bibliographique

Le cas du pristane (2,6,10,14-tétraméthylpentadecane) est présenté sur la Figure 13. Des


produits d’oxydation monoterminale (Nakamiya et al., 1985), diterminale et subterminale
(Alvarez et al., 2001) de la dégradation du pristane ont été identifiés. La structure
régulièrement ramifiée du pristane a été considérée comme réfractaire pendant longtemps.
L’acide ou le diacide, après activation en acyl-CoA, est dégradé par Bêta-oxydation (Rontani
et al., 1986).

Les autres systèmes d’oxydation


Plusieurs systèmes enzymatiques peuvent être impliqués dans l’étape initiale d’oxydation des
alcanes. Les différentes classes d’enzymes impliquées dans la dégradation des n-alcanes sont
présentées dans le Tableau 10 (van Beilen et al., 2003).
Les alcanes à chaînes courtes sont la plupart du temps oxydés par des alcanes hydroxylases
solubles ou liées à la membrane et similaires aux méthane monooxygénases, comme c’est le
cas chez P. butanovora. Un système d’oxydation différent de l’alcane hydroxylase a
également été mis en évidence chez Acinetobacter sp. M1. L’enzyme impliquée est ici une
flavoprotéine nécessitant la présence de cuivre pour son activité. Elle est capable d’oxyder les
n-alcanes ayant de 10 à 30 atomes de carbone et les alkylbenzènes à longues chaînes latérales
(Maeng et al., 1996).

53
Étude bibliographique

Oxydation subterminale

Oxydation terminale

Oxydation diterminale

Figure 13: Voies métaboliques de dégradation du Pristane (2,6,10,14-


tétraméthylpentadécane) Fall et al. (1979)

54
Étude bibliographique

Tableau 10: Enzymes capables d’oxyder les alcanes (Van Beilen et Funhoff, 2005)

Classe d’enzyme Composition et cofacteurs Présents chez Substrats


P450 oxygénase : P450 Sphingomonas sp.HXN-200
Classe I Ferredoxine :[2Fe-2S] Mycobacterium sp.HXN-1500 C4-C16
P450 (CYP153) Ferredoxine reductase :FAD, NADH Acinetobacter sp.EB104

oxygénase: P450 Candida maltose, Candida tropicalis,


Classe II Reductase: FAD, FMN, NADPH Yarrowia lipolytica C10-C16
P450 (CYP52)
oxygénase: P450
Classe II P450 Réductase: FAD, FMN, NADPH Les humains et les lapins C6-C16
(CYP2E,CYP4B)
Membrane hydroxylase: à fer non Acinetobacter, Alcanivorax,
membrane hémique Burkholderia, Mycobacterium, C5-C16
alkane hydroxylase Rubredoxine: iron Pseudomonas, Rhodococcus
Rubredoxin reductase: FAD, NADH

Soluble méthane hydroxylase : à fer non hémique Methylisinus trichosporium OB3B C1-C16
monooxygenase Reductase: [2Fe-2S], FAD, NADH Methylococcus capsulatus (Bath)
Sous uité de régulation

méthane hydroxylase : à fer non hémique Tous les méthanotrophes connus C1-C5
monooxygenase

Propane monooxygénase Reductase: NADH Gordonia sp. TY-5 C3 and C13-C22


Regulatory subunit

Butane monooxygénase hydroxylase : à fer non hémique Pseudomonas butanovora C2-C8


Réductase: [2Fe-2S], FAD, NADH ATCC43655
Sous uité de régulation

P450cam P450 oxygenase: P450 Pseudomonas putida ATCC 29607 C3-C10


Putidaredoxine : [2Fe-2S]
Putidaredoxine réductase :FAD, NADH

P450BM-3 polypeptide: FAD, FMN, NADPH Bacillus megaterium ATCC 14581 C3-C8

Quelques bactéries dégradant les n-alcanes et les cyclo-alcanes disposent d’un système
nécessitant la présence d’un cytochrome P450. Ainsi, une souche d’Acinetobacter
calcoaceticus, dégradant les alcanes à chaînes longues, dispose d’un système enzymatique
comprenant un cytochrome P450 inductible (Kleber et al., 1985). La spécificité de substrat du
cytochrome semble variable selon les micro-organismes (Sariaslani, 1991; Sariaslani & Omer,
1992). Ainsi, le cytochrome P450 identifié chez Xanthomonas sp. est inductible par le
cyclohexane et catalyse l’oxydation de nombreux hydrocarbures (alkylcyclohexane, terpènes
cycliques). Le système enzymatique identifié chez Streptomyces griseus est quant à lui
capable de réaliser l’hydroxylation de composés aromatiques et alicycliques (Sariaslani &
Omer, 1992). Récemment, Maier et al. (2001) ont cloné et étudié le cytochrome P450
d’Acinetobacter sp. EB104, impliqué dans l’oxydation des n-alcanes.

55
Étude bibliographique

7.2. Biodegradation oxydative des HAPs par les bactéries


Une grande variété de bactéries à Gram-positif et Gram-négatif ont été isolées et
caractérisées pour leur capacité à métaboliser les HAPs. Si la dégradation bactérienne des
HAPs à faible poids moléculaire tels que le naphtalène, le phénanthrène, ou encore
l’anthracène est clairement mise en évidence et présente des similarités importantes
(Cerniglia, 1992), les mécanismes intervenants dans celle des HAPs à cinq cycles aromatiques
ou plus tels que le Benzo[a]Pyrène restent encore à explorer.
Les HAPs peuvent être dégradés et minéralisés par un seul organisme ou par cométabolisme.
Les bactéries oxydent initialement les HAPs par l’incorporation de deux atomes d’oxygène
via l’action d’une dioxygénase entraînant ainsi l’oxydation d’un cycle aromatique
(Figure 14).

Entre parenthèses sont annotés les gènes codant pour les enzymes nécessaires à cette réaction d’oxydation.
Figure 14: Réaction d’oxydation initiale du naphtalène par la naphtalène dioxygénase
(NahAc) chez Pseudomonas NCIB 9816 (Habe et Omori, 2003).

L’étape initiale d’attaque des HAPs peut être réalisée via une monooxygénase, une
dioxygénase, ou par oxydation du groupement substitué par l’action de monooxygénase
(Gibson et Parales, 2000 ; Khan et al., 2001 ; Williams et Sayers, 1994). A l’issu de plusieurs
réactions biochimiques, l’attaque par une dioxygénase conduit à un cis-dihydrodiol
caractéristique de la dégradation bactérienne. Les produits sont par la suite minéralisés ou
incorporés en biomasse cellulaire (dépendant du nombre de cycles et de substitutions).

La dégradation du naphtalène par clivage intradiol est la mieux connue et constitue la


référence pour la dégradation des HAPs (Figure 15). L’étape initiale de la dégradation du
naphtalène, catalysée par la naphtalène dioxygénase (NahAc) implique l’incorporation de
deux atomes d’oxygène pour former le cis-1,2-naphtalène dihydrodiol. Les étapes
enzymatiques suivantes aboutissent à la formation de salicylate et sont spécifiques des
composés polyaromatiques (Eaton, 1994). Le salicylate évolue ensuite en catéchol ou en
gentisate, intermédiaires classiques de la dégradation des composés monoaromatiques.

56
Étude bibliographique

Figure 15: Dégradation du naphtalène en salicylate par voie intradiol par des bactéries
aérobies du genre Pseudomonas (Vandecasteele, 2005)

Composés : naphtalène (1); cis-1,2-naphtalène dihydrodiol (2); 1,2-dihydroxynaphtalène (3);2-hydroxy-4-(2’-


oxo-3,5-cyclohexadiényl)-buta-2,4-diénoate (4) ; cis-o-hydroxybenzylidène pyruvate (5); 2-hydroxychromène-2-
carboxylate (6) ; trans-o-hydroxybenzylidène pyruvate (7) ; pyruvate (8) ; salicylaldéhyde (9) ; salycilate (10) ;
gentisate (11) et catéchol (12). Enzymes: naphtalène-1,2- dioxygénase (a); cis-1,2-naphtalène dihydrodiol
déshydrogénase NAD-dépendante (b);1,2- dihydroxynaphtalène dioxygénase (c) ; 2-hydroxy-4-(2’-oxo-3,5-
cyclohexadiényl)-buta-2,4-diénoate isomérase (d); spontané (e);2-hydroxychromène-2-carboxylate isomérase (f);
trans-ohydroxybenzylidène pyruvate hydratase-aldolase (g); salicylaldéhyde déshydrogénase NADdépendante
(h) ; voies métaboliques du gentisate (i) et du catéchol (j).

Le naphtalène est dégradé par de nombreux micro-organismes tels qu’Acinetobacter,


Alcaligenes, Mycobacterium, Pseudomonas, Corynebacterium, Comamonas (Cerniglia,
1992). Chez Pseudomonas, les gènes de dégradation sont souvent plasmidiques. Chez
Pseudomonas putida PpG7 et NCIB 9816, les gènes de dégradation du naphtalène sont sur le
plasmide NAH7 (Yen et Gunsalus, 1982).
De nombreuses études ont montré que les gènes de dégradation sont localisés sur deux
opérons : nah et sal. Le premier code pour les gènes dégradant le naphthalène en acide
salicylique et le deuxième code pour les gènes impliqués dans la conversion de l’acide
salicylique en pyruvate et acétyl-CoA. La régulation de ces deux opérons se fait grâce au
salicylate (inducteur) et à la protéine NahR qui agit en tant que régulateur positif pour les
deux promoteurs (Schell et Wender, 1986).
De manière générale, les dioxygénases responsables de l’attaque des hydrocarbures
aromatiques sont des cibles intéressantes pour la détection des gènes de dégradation des
hydrocarbures aromatiques et la détection de bactéries ayant un potentiel de dégradation vis à
vis de ces composés (Wilson et al., 1999). La naphtalène dioxygénase est une enzyme
multimérique qui comprend une réductase (NahAa), une ferredoxine (NahAb) et deux sous-
unités protéiques contenant des domaines Fer/Soufre (NahAc et NahAd) (Eaton et Chapman,
1992; Habe et Omori, 2003; Harayama et al., 1999; Williams et Sayers, 1994).

57
Étude bibliographique

C’est généralement le gène codant la grande sous-unité α de la dioxygénase qui est utilisée
dans les études visant à détecter les gènes de dégradation des composés aromatiques. Cette
sous-unité est par exemple très conservée chez les bactéries du genre Pseudomonas (gène
nahAc chez Pseudomonas putida NAH7). Les différentes études effectuées montrent que cette
sous-unité est conservée au sein des différents genres étudiés : Pseudomonas, Comamonas,
Rhodococcus, mais semble très divergente entre les différents genres (Moser et Stahl, 2001).

7.2.1. Biodégradation des HAPs à 2 ou 3 noyaux aromatiques


Les voies de dégradation des HAPs, comme le naphtalène et le phénanthrène, ont été
largement étudiées depuis de nombreuses années (Stolz, 2009). Plusieurs voies de dégradation
bactériennes aérobies du phénanthrène ont été mises en évidence (Moody et al., 2001;
Krivobok et al., 2003; Seo et al., 2007; au sein d’une grande variété de souches appartenant à
de nombreux genres bactériens.
La dégradation du phénanthrène par les bactéries se déroule de manière analogue à celle du
naphtalène, à savoir la formation d’un dihydrodiol, puis de différents intermédiaires avant le
clivage du cycle (Cerniglia, 1992; Saito et al., 2000).
Il arrive fréquemment qu’un produit de dégradation d’un HAP à grand nombre de cycles
passe par la voie de dégradation d’un HAP à plus petit nombre de cycles (ainsi, certains
produits de dégradation du phénanthrène vont pouvoir être dégradés via les enzymes de
dégradation du naphtalène, et donc la voie du naphtalène). De plus, pour une grande majorité
de bactéries, la dégradation du phénanthrène nécessite les mêmes étapes biochimiques (et
souvent les mêmes enzymes) que la dégradation du naphtalène (Mallick et al., 2007; Seo et
al., 2009).
De nombreuses espèces Gram-négatives et Gram-positives ont été décrites pour leur aptitude
à croître sur phénanthrène (Kang et al., 2003, Moody et al., 2001). Beaucoup de bactéries
capables de dégrader le naphtalène sont également capables de dégrader le phénanthrène, et
dans ce cas les mêmes enzymes catalysent l’oxydation des deux substrats (Parales, 2003).

7.2.2. Dégradation des HAPs à 4 noyaux aromatiques ou plus


Malgré le grand intérêt apporté à la biodégradation des HAPs légers, la présence de
HAPs à haut poids moléculaire continue de poser problème du fait de la persistence et de la
toxicité de ces composés. Alors que les HAPs de 2 à 3 noyaux aromatiques sont relativement
facilement dégradés par des bactéries, les HAPs de haut poids moléculaire sont beaucoup plus
récalcitrants à la biodégradation.
La biodégradation de molécules de poids moléculaires supérieurs (nombre de cycles
aromatiques supérieur à 3) est encore mal connue (Cerniglia, 1984b; Smith, 1990). Les
composés les plus étudiés sont le fluoranthène, le pyrène, le chrysène et le le benzo[a]pyrène.
Heitkamp et Cerniglia (1988a) furent les premiers à isoler de l’environnement une bactérie
capable de dégrader les composés aromatiques contenant quatre cycles. Mueller et al. (1989)
démontrèrent pour la première fois l’utilisation de composés aromatiques à quatre cycles et
plus comme seule source de carbone.

58
Étude bibliographique

Le fluoranthène, souvent utilisé comme composé modèle, a été largement étudié : sa


biodégradation a été démontrée à de nombreuses reprises, par exemple, par une souche pure
de Pseudomonas paucimobilis isolée d’un consortium (Mueller et al., 1990) ou encore par
Alcalinogenes dentrificans WW1 (Weissenfels et al., 1990) isolée d’un sol. Kim et al. (2007)
ont pu identifier que 27 enzymes étaient nécessaires à la dégradation complète du pyrène.
Cependant, concernant les HAPs à 5 cycles aromatiques et plus, tels que le benzo[a]pyrene ou
encore le benz[a]anthracene, peu d’information sont disponibles sur les capacités des
bactéries à métaboliser ces composés. Aussi, les mécanismes impliqués dans la dégradation
de ces molécules restent inconnus (Fernández-Luqueño et al., 2010).
La plupart des bactéries identifiées pour leur capacité de dégradation du pyrène sont des
actinomycètes du genre Mycobacterium (Schneider et al., 1996), Rhodococcus (Bouchez et
al., 1995), Gordonia (Kastner et al., 1994) ou Bacillus cereus (Seo et al., 2009). Des espèces
Gram-négatives ont également été identifiées, comme Pseudomonas fluorescens (Boonchan et
al., 1998), Sphingomonas paucimobilis (Kastner et al., 1998), Burkholderia cepacia (Juhasz
et al., 1997), Xanthamonas sp. ou Stenotrophomonas maltophilia (Seo et al., 2009).
Les études les plus complètes ont été réalisées sur le genre Mycobacterium, de par ses
capacités à dégrader les HAPs avec un grand nombre de cycles, et donc les plus récalcitrants
(comme le Benzo[a]Pyrène) (Kim et al., 2006; Kweon et al., 2007). Elles montrent que la
dégradation du pyrène nécessite les mêmes étapes biochimiques que la dégradation du
naphtalène et du phénanthrène. Cependant, beaucoup de métabolites intermédiaires ont pu
être détectés, constituant parfois des impasses métaboliques. La dégradation bactérienne
principale du pyrène chez les espèces du genre Mycobacterium est réalisée par une
dioxygénase initiale formant des produits du métabolisme du pyrène,
Certaines souches sont capables de cométaboliser des HAP à 5 cycles aromatiques,
comme le benzo[a]pyrène. C’est le cas de Sphingomonas yanoikuyae B1 (Gibson et al., 1975)
et de Mycobacterium sp. RJGII-135 (Schneider et al., 1996) qui sont capables de
cométaboliser le benz[a]anthracène et le benzo[a]pyrène. Chez cette dernière bactérie, 3 voies
de dégradation du benzo[a]pyrène ont été mises en évidence (Lee et al., 2007).
Certains de ces microorganismes épurateurs ont de plus la capacité d’améliorer la
solubilisation des HAPs, molécules fortement hydrophobes, par la production de
biosurfactants (formation de micelles), ou par la production de biofilms (matrices
extracellulaires adhésives et protectrices) (Leglize et al., 2008). C’est par exemple le cas de la
souche bactérienne Pseudomonas aeruginosa P-CG3, capable de produire un biosurfactant
améliorant fortement la solubilisation du phénanthrène et du pyrène au sein de sols
contaminés (Cheng et al., 2004). La formation de biofilms est également une des stratégies
mises en place dans l’amélioration de la dégradation des HAPs (Andreoni et al., 2004;
Johnsen et Karlson, 2004). Cette formation de biofilms permet à la fois aux microorganismes
de se protéger des effets toxiques inhérents aux HAPs, mais aussi d’améliorer leur
biodisponibilité. Ces microorganismes ont donc développé diverses capacités leur permettant
de métaboliser les HAPs.

59
Étude bibliographique

7.2.3. Diversité des genres bactériens dégradant les HAPs et des gènes codant une
HAP-dioxygènase
De nombreuses bactéries distinctes sont capables d'amorcer la dégradation des HAPs
(Mueller et al., 1997). Il est intéressant de constater que les capacités métaboliques des genres
bactériens semblent liées à la morphologie. Les bactéries capables de dégrader le
phénanthrène et le fluoranthène appartiennent plutôt à des genres à Gram négatif comme
Achromobacter, Burkholderia, Pseudomonas et Sphingomonas (Rockne et al., 2000; Ho et
al., 2000). Des bactéries du genre Pseudomonas, appartenant à la classe des Gamma-
Protéobactéries, ont servi de modèles pour étudier le métabolisme du naphtalène et du
phénanthrène. De même, Pseudomonas aeruginosa a été isolée pour ses capacités à dégrader
le phénanthrène (Romero et al., 1998). L'étude de Juhasz et al. (1997) est l'une des premières
à montrer que Burkhoderia cepacia a été capable de croître sur du pyrène. Les bactéries
capables de dégrader le pyrène sont plus généralement des genres à Gram positif comme
Mycobacterium, Nocardia, Peanibacillus, et Rhodococcus. Les études montrant des genres
bactériens à Gram positif capable de croître sur le fluoranthène sont plus rares (Lopez et al.,
2005). La diversité des bactéries dégradantes peut être définie par une diversité génétique des
gènes codant les arènes dioxygènases, plus particulièrement les gènes codant la sous-unité ɑ
des HAP-dioxygènases. Le gène nah est un des premiers à avoir été étudié (Yen et Gunsalus,
1982), d'autres gènes ont été découverts par la suite (Tableau 11).

Tableau 11: Diversité des gènes de dégradation des HAPs décrits dans la littérature
(Louvel, 2010)

Gène Localisation Genres N° accession Références


bphA1 pNL1 Sphingomonas aromaticivorans F199 Romine et al., 1999

dntAc Plasmide Burkholderia sp. DNT AF169302 Suen et al., 1996

nagAC pWWF6 Ralstonia sp. U2 AF036940 Fuenmayor et al., 1998

doxB Plasmide Pseudomonas sp.C18 M83949 Denome et al., 1993

nahAc Plasmide Pseudomonas sp. U49496 Yen et Gunsalus, 1982


NAP7
Pseudomonas stutzeri AF039533 Bosch et al., 1999

nbzAc Comamonas sp. JS765 AF379638 Lessner et al., 2002

narAa Chromosome Rhodococcus sp. NCIMB 12038 AF082663 Larkin et al., 1999

ndoB Plasmide Pseudomonas putida NCIB9816 M23914 Kurkela et al., 1988

ntdAc PDTG800 Pseudomonas sp.JS42 U49505 Parales et al., 1996

pahAc Chromosome Comamonas testosteroni AF252550 Moser et Stahl, 2001

Pseudomonas aeruginosa AF252550 Takizawa et al., 1999

Pseudomonas putida OUS82 AB004059 Takizawa et al., 1999

pdoA1 Chromosome Mycobacterium sp. 6PY1 Krivobok et al., 2003

phnAc Burkholderia sp. RP007 AADO9872 Laurie et lloyd-Jones, 1999


60
Étude bibliographique

Chez les Gamma-Protéobactéries, les dioxygénases de Pseudomonas sp.ont


essentiellement été étudiées à partir d’espèces capables d’utiliser le naphtalène, Nah chez
Psudomonas putida G7, Ndo chez Pseudomonas putida NCIB 9816-4 (Takizawa et al.,
1994).
Chez les Alpha-Protéobactéries, les Sphingomonades sont des microorganismes capables de
dégrader un large spectre de composés aromatiques (Leys et al., 2004). Ils ont été isolés ou
détectés dans des sols fortement contaminés aux hydrocarbures.
Chez Les Beta-Protéobactéries, Les dioxygénases des betaprotéobactéries ont été nettement
moins étudiées notamment pour ce qui est de leur spécificité du substrat. Les souches dont
elles sont issues ont été caractérisées pour leur capacité à minéraliser certains HAPs.
Dans la litérature, parmi ceux-ci citons ceux regroupant les gènes nah de dégradation du
naphtalène chez Pseudomonas (Simon et al., 1999; Simon et al., 1993), les gènes ndo, dox et
nag codant pour des dioxygenases impliquées dans la dégradation du naphtalène chez
Pseudomonas (Denome et al., 1993), les gènes phn et pah de dégradation du phénathrène
chez Burkholderia et Pseudomonas respectivement (Laurie et Lloyd-Jones, 1999),
Les bactéries Gram-positives, et plus particulièrement celles appartenant au phylum
des Actinobactéries, sont aussi impliquées dans la dégradation des HAPs. Les mycobactéries,
genre le plus étudié, sont capables de se développer en utilisant le phénanthrène, l’anthracène
ou le pyrène comme uniques sources de carbone et sont aussi impliquées dans la dégradation
d’HAPs de haut poids moléculaire, comme le fluoranthène et le benzo[a]pyrène. Ces
microorganismes ont été détectés dans des environnements à pollution diffuse, avec une faible
concentration et une faible biodisponibilité en HAPs. Ils produisent dans leur paroi externe
des acides mycoliques, acides gras alkylés et hydroxylés, qui forment une couche quasi
cristalline protégeant la cellule de la toxicité des polluants.
La présence de cette barrière de protection associée à la fluidité de leur bicouche lipidique
sert aussi à l’internalisation des HAPs (Jouanneau et al., 2011; Leys et al., 2005).
Les bactéries Gram-positives possèdent, quant à elles, plusieurs copies de gènes cataboliques
leur conférant une large gamme de spécificité. Ainsi le système décrit chez Mycobacterium
PYR-1 comporte NidBA, dont le substrat préféré est le pyrène, et NidA3B3 qui oxyde
préférentiellement le fluoranthène, mais qui oxyde aussi le naphtalène, le phénanthrène,
l’anthracène et le pyrène (Khan et al., 2001; Kim et al., 2006).
Les gènes phd et nid chez les souches à gram positif Nocardioides et Rhodococcus sont
impliqués dans la dégradation de l’anthracène, fluorenthène et pyrène chez Mycobacterium et
Sphingomonas respectivement (Story et al., 2000).

61
Étude bibliographique

8. DIVERSITE BACTERIENNE ET CLASSIFICATION DES


MICROORGANISMES (taxonomie)

L’étude de la diversité microbienne a longtemps été limitée aux techniques de


microbiologie classique. La structure des communautés bactériennes reposait donc sur
l’isolement et la culture des micro-organismes. Ces techniques ont conduit à une sous
estimation de leur nombre réel car il est impossible de mettre au point des milieux de culture
adaptés à toutes les espèces présentes.
D’après Amann et al. (1995) ou encore (Pace, 1997), un faible pourcentage de bactéries
d’écosystèmes complexes et plus particulièrement du sol seraient donc cultivables
(Tableau 12). Plusieurs raisons peuvent être la cause de cette «incultivabilité» comme i)
l’absence de milieu de culture adapté, ii) les interactions entre différentes espèces rendant
impossible leur isolement (phénomènes de coopération), iii) les temps de générations très
variables d’une espèce à l’autre, iv) la quantité d’inoculum, et donc iv) l’abondance relative
de chaque espèce au sein de la population considérée (une population moins abondante peut
prendre la place d’une population majoritaire mais moins adaptée au milieu de culture choisi)
(Amann et al., 1995; Ward et al., 1997).

Tableau 12: Cultivabilité des bactéries (Amann et al., 1995)


Habitats Cultivabilité (%)
Eau de mer 0.001 - 0.1
Eau douce 0.25
Lac mésotrophique 0.1 - 1
Eaux d’estuaires non polluées 0.1 - 3
Boues activées 1 -15
Sédiments 0.25
Sols 0.3
Pourcentage des bactéries cultivalbles par rapport aux cellules totales déterminées par comptage direct; bactéries
cultivablles mesurées en tant qu’unités formant colonies (UFC).

8.1. Microbiologie « classique »


La microbiologie, selon la technique utilisée, permet de définir les trais
morphologiques, physiologiques et/ou métaboliques des microorganismes d’un écosystème
donné (Heitkamp et al., 1988b). La majeure partie des connaissances concernant la
biodégradation des hydrocarbures dans l’environnement a été acquise à partir d’études basées
sur l’isolement de microorganismes hydrocarbonoclastes (Watanabe et Hamamura, 2003).
L’isolement présente comme avantage essentiel de pouvoir travailler sur des souches pures et
ainsi d’étudier précisément un microorganisme et certaines de ses fonctions.
Il est par exemple possible de caractériser in vitro les mécanismes biochimiques et
moléculaires impliqués dans la dégradation d’un hydrocarbure. Cependant, les souches
hydrocarbonoclastes isolées ne sont pas forcément représentatives des capacités métaboliques
de la communauté naturellement présente (Thompson et al., 2005).

62
Étude bibliographique

En effet, seul 1% des bactéries d’une communauté serait cultivable en condition de


laboratoire (Amann et al., 1995), le principal biais de ces techniques étant une sous-estimation
importante de la diversité soit une sous-estimation des capacités métaboliques de la
communauté étudiée. Aussi, les cinétiques de biodégradation d’un polluant in vitro sont très
différentes de celles observées dans l’environnement (Watanabe et Baker, 2000).
Toutes ces méthodes, à l’exception des comptages directs, sont dépendantes de la culture des
microorganismes. Afin de s’affranchir de tels biais, des approches biochimiques et
moléculaires ont été développées au cours de ces vingt dernières années. La simple utilisation
de techniques de microbiologie classique ne permet pas la caractérisation de communautés
complexes. Elles sont aujourd’hui généralement utilisées en complément d’approches
moléculaires afin d’apporter des informations complémentaires sur la communauté
bactérienne étudiée.
Au début du XXème siècle, la classification des microorganismes reposait sur des critères
morphologiques observés par microscopie ou cultures pures sur boites de Petri. A cette
époque, les microbiologistes étaient conscients que ces méthodes étaient restrictives et
insuffisantes pour distinguer les espèces les unes des autres (Janssen, 2006). Les méthodes
d’identification à base d’ADN restent discirminantes et plus résolutives (Devriesse et al.,
1995).
8.2. Apport de la biologie moléculaire
Le développement des méthodes moléculaires, dans les années 1990, a permis de
décrire plus précisément les microorganismes et d’établir un nouveau système de
classification fondé sur une comparaison de la séquence du gène codant la sous-unité 16S de
l’ARN ribosomal (ARNr16S). En 1992, Carl Woese et ses collègues présentent la première
librairie de séquences de gènes d’ARNr16S (Woese et al., 1990).

8.2.1. Le choix de l’ADNr 16S


L’émergence des techniques moléculaires est liée au développement de la phylogénie
moléculaire et du concept d’horloge moléculaire (Zwirglmaier et al., 2004) et au choix de
l’ADNr 16S comme marqueur évolutif universel (Woese et Fox, 1977). Le concept d’horloge
moléculaire est basé sur la théorie neutraliste de l’évolution (Kimura, 1968). Les mutations
s’accumulent au cours du temps dans le génome. Le taux d’accumulation est alors dicté par
l’intensité de la pression de sélection. Il est du même ordre de grandeur dans les régions
soumises à la même pression de sélection. Les évènements évolutifs récents sont alors reflétés
par les gènes à mutations rapides, alors que les gènes très conservés sont considérés comme
les témoins d’un passé très éloigné. Cette théorie a été largement contestée (Li, 1993). La
différence de taux d’évolution serait alors attribuée aux différences de temps de génération ou
aux différences d’activité du métabolisme.
L’ADNr 16S, codant l’ARNr 16S, se prête bien aux analyses phylogénétiques pour plusieurs
raisons (Amann et Ludwig, 2000) : i) élément clé dans la synthèse des protéines, il est
abondamment présent dans tous les organismes vivants, où il accomplit le même rôle, ii) il a
évolué lentement iii) sa séquence (1 500 pb environ) est suffisamment longue pour réaliser
des comparaisons statistiquement significatives, et iv) elle possède des régions dites
conservées (comparaison d’espèces éloignées) et d’autres variables ou hyper variables
(comparaison d’espèces proches),

63
Étude bibliographique

v) elle est facilement obtenue par des méthodes standard d’extraction et de séquençage ; et
enfin, vi) les bases de données pour l’analyse comparative des séquences sont bien fournies et
régulièrement mises à jour (par exemple, Ribosomal Database Project (RDP)
(http://rdp.cme.msu.edu/html/), European Molecular Biology Laboratory (EMBL)
(http://www.ebi.ac.uk/embl/).
Le choix de l’ADNr 16S est parfois contesté. Il serait en effet préférable de pouvoir
établir les phylogénies sur plusieurs gènes afin de ne conserver que l’arbre consensus à toutes
ces phylogénies (Gupta, 1998). Les techniques fondées sur l’étude comparative des séquences
d’ADNr 16S contribuent à améliorer les connaissances concernant la diversité phylogénétique
microbienne associée à un milieu. Le séquençage et l’analyse des séquences obtenues, par
comparaison aux séquences présentes dans les banques de données, permettent d’accéder à la
diversité phylogénétique de l’échantillon (Amann et al., 1995). Même si l’ARNr 16S (~1.500
nucléotides) ne contient environ que deux fois moins d’informations que l’ARNr 23S (~3.000
nucléotides), il est actuellement le biomarqueur phylogénétique bactérien de référence. D’une
part, il est plus facile à cloner et à séquencer et d’autre part, les bases de données sur les
ARNr 16S sont les plus denses et ne cessent d’augmenter. Ainsi, certains serveurs, comme la
base de données RDP (Ribosomal Database Project) proposent des plateformes de traitement
en ligne et sont mis à jours régulièrement, c’est un outil très performant pour positionner
finement une séquence d’ADN 16S et savoir à quoi elle correspond.
Ce marqueur biologique de l’identité est présent chez tous les procaryotes. Il a servi de
pilier à la classification taxonomique des microorganismes jusqu’à ce jour, et par conséquent
à la description des communautés bactériennes de l’environnement. Sur cette base, le Bergey's
Manual of Systematic Bacteriology (Ludwig et Klenk, 2001) définit les groupes
taxonomiques selon 7 niveaux principaux – Domaine, Phylum, Classe, Ordre, Famille, Genre,
Espèce – certains de ces niveaux pouvant être déclinés en sous-divisions. L’affiliation de
séquences au niveau du phylum est considérée comme fiable et aisée. Actuellement, 52
phylums bactériens majeurs ont été identifiés tous environnements confondus (Rappe et
Giovannoni, 2003).
En définitive, les séquences d’ARNr 16S constituent une bonne base d’affiliation
taxonomique mais la discrimination en genres et espèces doit s’appuyer sur un séquençage
plus systématique d’un panel de « gènes de référence » ou de génomes entiers. De plus, la
classification actuelle ne tient compte ni de la nature des écosystèmes d’où proviennent les
bactéries, ni des fonctions qu’elles y assurent.
La compréhension de la distribution et de l’organisation des groupes taxonomiques dans
différents biotopes reste un challenge pour la microbiologie environnementale.
Les approches moléculaires, indépendantes de la culture des micoorganismes, utilisées
pour déterminer la diversité et la structure des communautés bactériennes dans les
environnements naturels sont variées et se basent essentiellement sur la diversité des
séquences d’ADNr 16S (Theron et Cloete, 2000). Ces techniques reposent sur la variation de
la séquence et la structure secondaire de fragments d’ADNr 16S.
Ces techniques basées sur l’amplification par PCR d’un gène d’intérêt permettent soit
d’étudier des organismes en particulier, soit des groupes d’organismes (populations) ou
encore l’ensemble de la communauté.

64
Étude bibliographique

Bien que révolutionnaire dans l’étude des communautés bactériennes d’environnements


complexes, ces techniques ne permettent pas une analyse quantitative absolue du fait des biais
dues à l’extraction des acides nucléiques, à l’amplification par PCR (utilisation
d’oligonucléotides, présences d’inhibiteurs, séquence préférentiellement amplifiées due à leur
composition) et aux propres biais de chacune des techniques (seuil de détection, bruit de
fond). Cependant, ces approches moléculaires couplées à des outils statistiques sont très
adaptées en écologie microbienne pour suivre l’évolution d’une communauté bactérienne
soumise à une pollution ou pour la comparaison de communautés bactériennes
d’environnements différents (pollué/sain, traité/non traité, etc). L’étude du suivi des
communautés est généralement basée sur l’étude du gène codant pour l’ARN ribosomique
16S (ARNr 16S) et ses transcrits qui sont utilisés comme marqueurs phylogénétiques.
8.3. La diversité du domaine « Bacteria »
Un arbre basé sur l’analyse phylogénétique de l’ARNr 16S du domaine «Bacteria»
est présenté sur la (Figure 16). Les 11 divisions définies par Woese (1987) sont symbolisées
par les 12 branches blanches. En effet, les bactéries à Gram positif sont maintenant reconnues
comme formant deux divisions distinctes : les Firmicutes (bactéries à faible pourcentage en
GC) et les Actinobactéries (bactéries à fort pourcentage en GC). Parmi ces divisions
initialement décrites, la mieux connue est celle des Protéobactéries, largement représentée sur
l’ensemble de la planète. Cette division regroupe cinq classes (α-, β-, γ-, δ- et ε-
Protéobactéries). Depuis 1987, 14 divisions supplémentaires (branches blanches) ont été
identifiées (Hugenholtz, 2002). Un certain nombre de ces divisions regroupent des
organismes thermophiles, comme les Aquificae, Thermodesulfobacteria, Dictyoglomi,
Coprothermobacter et Desulfobacteria. Beaucoup de ces divisions semblent émerger tôt de
l’arbre phylogénétique bactérien. La physiologie divergente de micro-organismes regroupés
dans une même division peut rendre difficile les descriptions relatives à ces divisions, comme
c’est le cas pour la division des Acidobactéries (Barns et al., 1999).
En phylogenie, certains phylums bactériens sont dominants et leur abondance relative
varie selon les caractéristiques environnementales et les méthodes d’analyse (Janssen, 2006).
En comparant 32 librairies de gènes d’ARNr 16S, Janssen, 2006 montre qu’en moyenne, 40%
des séquences identifiées dans des échantillons de sol appartiennent aux Protéobactéries, 20%
aux Acidobactéries et 13% aux Actinobactéries. En revanche, l’affiliation de séquences aux
niveaux taxonomiques les plus détaillés (genre, espèce) est plus complexe car un grand
nombre de genres bactériens n’a pas été caractérisé. Malgré ce défaut de connaissance, les
séquences des gènes d’ADNr 16S constituent une base robuste et fiable pour évaluer les
relations pylogénétiques jusqu’au niveau du genre (Cole et al., 2010). En revanche, la
classification au niveau de l’espèce basée sur la seule comparaison des gènes d’ADNr 16S
n’est souvent pas pertinente. Ainsi, certaines espèces de Bacillus, distinguées sur la base de
leur phénotype, présentent des séquences d’ARNr 16S identiques (Maughan et Van der
Auwera, 2011).

65
Étude bibliographique

Figure 16: Arbre phylogénétique des principales lignées (phylums ou divisions) du


domaine « Bacteria » Woese (1987)
Les branches en noir correspondent aux 12 divisions originales décrites par Woese (1987) ; les branches
blanches correspondent aux 14 divisions ayant des représentants cultivables reconnues depuis 1987, et en gris
sont représentées les 26 divisions candidates n’ayant pas de représentant cultivable. Cet arbre a été construit
selon la méthode de matrices des distances après analyse de plus de 600 séquences d’ADNr 16S pratiquement
complètes en utilisant la base de données ARB (Rappe et Giovanonni, 2003).

66
Étude bibliographique

Dans la classification bactérienne reposant sur le seul critère ARNr 16S, on considère
que deux gènes d’ARNr 16S montrant plus de 96% de similarités de séquence appartiennent à
des microorganismes de même genre, et que deux gènes ayant plus de 98% de similarité
appartiennent à la même espèce. Cependant, en se basant sur d’autres critères comme le taux
d’hybridation ADN : ADN, il s’avère que des espèces différentes peuvent avoir des gènes
d’ARNr 16S similaires à 99% (Torsvik et al., 1996). La notion d’espèce étant difficile à
définir sur des bases moléculaires, la plupart des auteurs préfèrent donc classer les gènes
d’ARNr 16S en unités taxonomiques opérationnelles (OTUs), définies par un seuil de
similarité, plutôt que de les affilier à des espèces ou des genres (Schloss et Handelsman,
2005).

9. ETUDE DE LA REPONSE DES COMMUNAUTES BACTERIENNES


SOUMISES A UNE CONTAMINATION PETROLIERE
Une contamination par des hydrocarbures peut induire de nombreux effets sur la
biomasse, les métabolismes, la structure et la diversité taxonomique et/ou fonctionnelle d’une
communauté microbienne. Cependant, les connaissances sur la dynamique adaptative des
communautés bactériennes en réponse à cette contamination restent encore limitées et
exposées à de nombreuses controverses. Suite à une contamination pétrolière, de nombreuses
études ont démontré la mise en place rapide au sein de la communauté de certains
microorganismes hydrocarbonoclastes jouant un rôle majeur dans les processus de
dégradation.
De nombreux auteurs ont isolé des bactéries sur des substrats très différents, comme
des alcanes à longues chaînes, cycliques, branchés et des iso-alcanes. La dégradation
d’hydrocarbures pris individuellement est largement étudiée depuis de nombreuses années.
Mais rares sont ceux qui se sont intéressés à l’évaluation des possibilités de biodégradation
sur un ensemble de composés aussi variés et complexes que le pétrole brut. Il existe
cependant un intérêt général pour l’étude de la diversité des microflores capables de dégrader
les polluants tels que les huiles (Abed et al., 2007), les composés aromatiques (Kanaly et al.,
2000) ou encore les composés chlorés (Dojka et al., 1998).
La biodégradation d’un mélange de composés n’est pas la somme de la biodégradation
de chaque composé pris individuellement. Olson et al. (1999) ont travaillé sur la dégradation
des principales familles chimiques du pétrole (n-alcanes, iso- et cyclo-alcanes, aromatiques),
comparée à la dégradation d’une fraction composite de ces trois familles. La susceptibilité à la
biodégradation semble se présenter dans l’ordre suivant : n-alcanes > aromatiques > iso- et
cyclo-alcanes. Sur la fraction composée de l’ensemble des familles, la fraction aliphatique se
dégrade plus rapidement que la fraction aromatique. Cependant, la biodégradation est moins
rapide en mélange que sur les composés pris individuellement.
Les données concernant la biodégradation du pétrole sont souvent issues
d’observations effectuées sur des sites pollués, c’est-à-dire des écosystèmes ouverts dans
lesquels les bilans complets ne sont pas réalisables. Plusieurs études concernant la
biodégradation du pétrole, sur site ou en laboratoire, ont été effectuées (Salanitro, 2001). Des
études en laboratoire sur des sols sableux ou argileux ont ainsi montré que le pétrole est
biodégradable à hauteur de 40 à 65 % (Margesin et Schinner, 2001).

67
Étude bibliographique

Certaines de ces études ont prouvé que les taux de dégradation étaient souvent surestimés,
soulignant ainsi l’importance de travailler en milieu fermé afin de pouvoir effectuer des bilans
carbone sur les tests de dégradation effectués. En effet, d’après les travaux de Margesin et al.,
2003), 20 à 25 % de ces taux seraient dus à des pertes abiotiques par volatilisation ou
adsorption au cours des expériences, ce qui ramène le taux de dégradation réel à une valeur
comprise entre 15 et 40 %. Les données obtenues lors d’expérimentations sur site (Margesin
et Schinner, 2001 ; Stefanoff et Garcia, 1995) ont montré que 50 à 95 % du pétrole brut
pouvait disparaître en 3 à 24 mois.
Des études ont été effectuées sur la capacité de consortiums bactériens à dégrader les
produits pétroliers (Richard et Vogel, 1999). Ainsi, Marquez-Rocha et al. (2001) ont utilisé
un consortium contenant des bactéries du genre Pseudomonas, Serratia, Acinetobacter et
Flavobacterium et dégradant le pétrole brut à 85 % en 6 semaines.
Richard et Vogel (1999) ont isolé un consortium du sol contenant sept bactéries différentes
(cinq Pseudomonas, un Achromobacter et une non-identifiée) dont trois seulement sont
capables d’utiliser les hydrocarbures comme substrat de croissance. Il semblerait que les
autres bactéries présentes dans le consortium utilisent les intermédiaires métaboliques comme
substrat de croissance. Après 50 jours d’incubation, 90 % du pétrole initial était dégradé. La
dégradation d’un mélange aussi complexe que le pétrole dépend de différents types de
bactéries dont les capacités cataboliques sont complémentaires et qui peuvent ainsi coopérer
dans la biodégradation. Chaque biotope a un potentiel de dégradation, et donc une microflore
indigène qui lui est propre. Une contamination similaire ne provoque pas le développement de
communautés microbiennes similaires (Bundy et al., 2002). De plus, il apparaît que
l’exposition d’un sol à une pollution de type carbonée altère la composition de la microflore
considérée. Ainsi une forte pollution diminue la densité de la population microbienne alors
qu’une teneur plus faible enrichit la microflore en micro-organismes capables de dégrader les
hydrocarbures considérés (Long et al., 1995).
L’évolution de la diversité bactérienne ainsi que la capacité métabolique de la
communauté à faire face à la contamination semble être influencée par l’historique de
contamination de l’environnement étudié (Evans et al., 2004 ; Röling et al., 2004 ). En effet,
les communautés bactériennes présentant ou non un antécédent de contamination, ou encore
soumises à des contaminations chroniques ou accidentelles, ne présentent pas les mêmes
réponses adaptatives. Aussi, la durée d’exposition, la complexité et le niveau de
contamination en hydrocarbures influencent la réponse de la communauté (Yakimov et al.,
2005).
Des successions particulières de groupes bactériens au cours du processus de
remédiation des systèmes étudiés ont pu être mentionnées. Plusieurs études soulignent le lien
existant entre la contamination et la dynamique des communautés bactériennes comme la
dominance de Gamma-Proteobactéries lors de la contamination ou encore l’enrichissement
en Alpha-proteobactéries lors de l’appauvrissement en hydrocarbures (Röling et al., 2002).
Selon Head et al. (2006), la dynamique de la communauté est fonction de l’évolution
qualitative et quantitative des hydrocarbures présents et inversement. Dans le cas d’un pétrole
par exemple, au fur et à mesure que les bactéries dégradent les substrats pour lesquels elles
ont la meilleure affinité, les autres composés du pétrole deviennent prédominants dans le
mélange.

68
Étude bibliographique

Il s’en suit ainsi une modification de la communauté avec la sélection d’autres organismes
présentant une meilleure affinité pour les composés restants.
Les capacités des bactéries à biodégrader des hydrocarbures ont ainsi déjà fait l’objet
de plusieurs publications (Abed et al., 2006; Chaillan et al., 2006. Même si leur rôle dans ces
processus reste discutable (De Oteyza et al., 2006), il apparaît que ces structures bactériennes
se développent parfaitement dans des environnements contaminés en produits pétroliers
(Abed et al., 2007 ; Hernandez-Raquet et al., 2006 ; Kasai et al., 2005). Par ailleurs,
l’identification et l’isolement de nombreuses espèces bactériennes hydrocarbonoclastes à
partir de ces écosystèmes soulignent leur potentiel de biodégradation (Chaillan et al., 2004 ;
Goréguès et al., 2004). Les bactéries de par leur richesse spécifique et métabolique
constituent des systèmes de choix pour étudier les processus métaboliques et de modification
de structure de communautés en réponse à une contamination pétrolière. L’étude de la
réponse des communautés microbienne à une contamination pétrolière apparaît d’un grand
intérêt en termes d’écologie microbienne afin de mieux comprendre la capacité d’adaptation
de ces structures face à des changements environnementaux importants.

10. DETECTION ET ANALYSE DES HYDROCARBURES PETROLIERS

10.1. Techniques basées sur la biologie moléculaire


La compréhension des écosystèmes et l’identification des micro-organismes jouant un
rôle clé dans les processus de biodégradation restent un enjeu de taille pour le développement
optimal de stratégies de bioremédiation. Les techniques moléculaires permettent d’accéder à
la diversité microbienne d’un écosystème (Theron et Cloete, 2000). Elles peuvent également
servir à surveiller et évaluer la bioremédiation des biotopes pollués (Widada et al., 2002).
L’évaluation de la bioremédiation peut être étudiée par les techniques d’empreintes
génétiques appliquées aux gènes de dégradation. Le polymorphisme des gènes considérés
est alors détecté par restriction enzymatique et examen des profils de restriction après
amplification génique. Watanabe et al. (1998) ont ainsi utilisé une analyse du gène codant une
phénol hydroxylase (LmPH) et du gène codant l’ARNr 16S afin de détecter et de caractériser
les bactéries dégradant le phénol prédominantes dans des boues activées d’une station
d’épuration. Ils ont montré que seulement deux bactéries dominantes étaient
vraisemblablement impliquées dans la dégradation du phénol et qu’elles dominaient au bout
de 20 jours de culture sur phénol. Cavalca et al. (2004) ont également analysé la biodiversité
phylogénétique et fonctionnelle de microflores d’eaux souterraines polluées avec des
hydrocarbures aromatiques. Dans leur étude, ils ont montré que peu de changements étaient
globalement observés dans la population bactérienne recensée pendant cinq mois d’injection
d’air dans les eaux polluées. L’étude leur permet également de conclure à la persistance du
groupe Pseudomonas au cours de l’étude. L’emploi combiné de plusieurs méthodes offre des
informations intéressantes quant à la diversité microbienne des écosystèmes étudiés.
Il est également intéressant de pouvoir coupler l’analyse de la diversité microbienne à
une activité de dégradation. Kanaly et al. (2000) ont ainsi étudié l’évolution d’un consortium
bactérien au cours de la dégradation du Benzo[a]Pyrène.

69
Étude bibliographique

Ils ont confirmé la présence, dans leur consortium, de micro-organismes connus pour
dégrader les composés aromatiques, tels que Sphingomonas paucimobilis EPA505 (Ye et al.,
1996), Mycobacterium str.PYR-1 (Cerniglia, 1992) ou Alcaligenes denitrificans WW1
(Stapleton et al., 2000).
Dans une optique de bioremédiation, il semble intéressant de détecter spécifiquement
les gènes impliqués dans la biodégradation. L’expression de ces gènes peut être détectée avec
des méthodes adaptées utilisant les ARNm (Van Hamme et al., 2003). Ces méthodes offrent
une alternative intéressante dans la mesure où la majorité des microorganismes présents dans
les sols par exemple demeurent à ce jour non cultivés. Les études concernant la détection de
certains gènes de dégradation et leur diversité se multiplient donc depuis quelques années.
Beaucoup d’auteurs ont travaillé à l’aide d’amorces dégénérées, en séparant les produits
d’amplification par clonage ou électrophorèse (Watanabe et al., 1998). Certaines voies de
dégradation sont bien caractérisées et quelques gènes de dégradation sont connus à l’heure
actuelle. Ceci a permis le développement d’une grande variété d’amorces.
La détection du gène alkB, impliqué dans le métabolisme des alcanes (Smits et al., 1999) ou
encore des gènes impliqués dans le métabolisme des hydrocarbures aromatiques (Widada et
al., 2002) est actuellement bien documentée. Langworthy et al. (1998) ont par exemple
montré que les gènes nahA et alkB sont plus fréquemment détectés dans les sols pollués que
dans les sols non pollués. Margesin et al. (2003) se sont, eux, intéressés à la caractérisation de
sols alpins pollués. Ils ont montrés que les génotypes des gènes de dégradation de bactéries à
Gram négatif, comme le gène alkB de Pseudomonas putida, se retrouvent plus fréquemment
dans les sols pollués que dans les sols non pollués. Les méthodes basées sur les ARNm
permettent d’évaluer l’expression des gènes de dégradation connus. Wilson et al. (1999) ont
ainsi développé une méthode pour isoler et caractériser les ARNm de micro-organismes
dégradant le naphtalène dans un aquifère contaminé. L’extraction d’ARNm suivie d’une
transcription inverse en ADNc et d’une amplification génique (RT-PCR) et couplée à une
analyse des ADNr 16S permet d’avoir une idée des micro-organismes actifs dans une
microflore (Nogales et al., 2001).
L’amélioration de notre compréhension de la composition des microflores et de
l’activité des micro-organismes impliqués dans la biodégradation permet de mieux envisager
les stratégies de bioremédiation acceptables pour un site pollué. Il est donc important de
développer une approche pluridisciplinaire permettant d’englober l’ensemble des paramètres
intervenant dans l’atténuation naturelle en utilisant toutes les méthodes mises à disposition,
quelles soit basées sur une approche moléculaire, culturale ou physiologique.

10.2. Techniques analytiques basées sur la chromatographie


L'analyse des dérivés pétroliers se fait généralement par classes de composés
chimiques (hydrocarbures saturés, aromatiques, polaires. Elle comprend la séparation et la
quantification des familles d’hydrocarbures d’un échantillon, pour lesquelles on emploie
généralement les techniques chromatographiques. Les critères de sélection d'une technique
particulière sont basés sur les points d'ébullition et/ou la polarité des composés à séparer et à
quantifier (ito et al., 2008) .

70
Étude bibliographique

la chromatographie liquide haute performance (CLHP) en phase normale, couplée à un


détecteur ultraviolet (UV) ou à indice de réfraction (RI), c'est la technique la plus
fréquemment utilisée pour la détermination de la composition de distillats moyens (gasoil) et
lourds (fuel) du pétrole, en familles d’hydrocarbures (saturés, aromatiques et polaires). Elle
permet aussi la séparation et l’analyse des hydrocarbures en fonction du nombre de cycles.
Cependant, lorsque le point d'ébullition des produits à analyser est élevé, les composés lourds
et/ou polaires peuvent être adsorbés irréversiblement sur les colonnes, les déteriorant et
donnant lieu à une élution incomplète (Goto et al., 1994).

10.2.1. Chromatographie sur couche mince avec détection à ionisation de flamme


La TLC-FID plus communément appelée IATROSCAN, est devenue une technique
complémentaire de la Chromatographie Liquide Haute Performance, permettant la séparation
et la quantification d’échantillons à teneur élevés en composés lourds et/ou polaire, elle
combine l’efficacité de la séparation sur couche mince de silice avec la très grande sensibilité,
la rapidité de réponse et les capacités de quantification d'un détecteur FID (Maki et al., 2001).
L’analyse chromatographique est une technique de séparation des différentes familles du
pétrole par gravimétrie (SARA : Saturés, Aromatiques, Resines et Asphaltènes) (Woods et al.,
2008), elle a été mise au point au Japon par les laboratoires Iatron, elle conduit à des
chromatogrammes, cependant, chaque pic étant représentatif de centaines de composés qui
peuvent varier d'un échantillon à l’autre, les facteurs de réponse obtenus par FID sont
différents.
L’étalonnage du détecteur est généralement réalisé à l’aide d'étalons externes, étant donné que
la relation entre la masse d'échantillon et la réponse fournie dépend de la nature de cet
échantillon. Ce type d'étalonnage est généralement aisé pour des composés purs connus et
disponibles. Il est généralement nécessaire de réaliser une séparation préalable des
échantillons pour obtenir des fractions séparés et pures.
Les composés du mélange sont séparés par élution dans une cuve de développement en verre
saturée par un mélange de solvants propres à séparer la classe des composés organiques
donnés suivant le modèle de la CCM classique.
Les composés du mélange d’hydrocarbures sont identifiés par analogie entre leur temps de
rétention et celui de composés contenus dans un mélange standard déposé sur le premier rod.
La quantification se fait par intégration des pics des chromatogrammes. L’analyseur MK4 est
couplé en sortie au logiciel d’exploitation développé par l’entreprise JMBS.
Une des originalités de la méthode IATROSCAN est la possibilité de ne brûler qu’une partie
du rod à la suite d’une élution. Ceci permet de garder intact, près du point de dépôt, les
composés n’ayant pas ou peu migré lors de l’élution. La séquence d'élution choisie pour
analyser les échantillons permet de séparer et quantifier les composés majeurs d'un extrait
complexe (Woods et al., 2008).
La CCM présente certains avantages tels la possibilité de traiter plusieurs échantillons
simultanément, analyse d'échantillons sans fractionnement initial ni élimination préalable des
asphaltènes et la possibilité de stocker les plaques développées.

71
Étude bibliographique

10.2.2. Quantification des hydrocarbures résiduels par chromatographie en phase


gazeuse CPG/FID
Les hydrocarbures résiduels sont dosés par CPG/FID en fin de test de dégradation. Au
préalable, une extraction avec un solvant est effectuée. Le standard interne utilisé à une
concentration déterminée et doit être dans la même gamme des hydrocarbures recherchés,
après extraction des hydrocarbures, la phase organique recueillie est analysée en CPG/FID,
sur un appareil de type Varian 3 400 équipé d’un passeur d’échantillon automatique Varian 8
200. Le débit du gaz vecteur (Hélium) est régulé par la pression d’entrée dans la colonne (180
ou 190 kPa). Ce gaz est préalablement épuré de toute trace d’O2 et d’H2O. L’air et
l’hydrogène sont filtrés pour éliminer toute trace d’hydrocarbures. L’acquisition des données
se fait par le logiciel informatique Borwin. C’est l’analyse fine du chromatogramme qui nous
permet de quantifier les hydrocarbures résiduels. La réponse spécifique est considérée comme
identique quel que soit le composé considéré. Les pics sont intégrés par rapport à la ligne de
base du chromatogramme. C’est la différence d’aire entre les chromatogrammes en début et
en fin de test qui nous permet d’accéder aux taux de dégradation (Brito et al., 2006).

72
Chapitre II

PROCÉDURES ÉXPÉRIMENTALES
Procédures expérimentales – Partie I

Partie 1

Ce travail a été publié en 2013 dans le journal International Journal of Biotechnology


Applications (5) 1: (147-154) sous le titre :

Application des méthodes moléculaires comme biomarqueurs en


bioremédiation

74
Procédures expérimentales – Partie I

AVANT-PROPOS

L'Algérie est un pays producteur de pétrole et son économie est étroitement liée aux
hydrocarbures. La production, l’industrie du raffinage, le transport et l'utilisation du pétrole
contribuent à la pollution de l'environnement et produisent des problèmes écologiques
conséquents. La contamination des sols par des hydrocarbures pétroliers entraîne une baisse
significative de sa qualité et deviennent inutilisables. (Gojgic-Cvijovic et al., 2011). Les
rejets industriels dans les eaux entrainent un déséquilibre des écosystèmes aquatiques.
Le pétrole contient des hydrocarbures simples et des composés complexes, leurs principaux
composants sont les saturés, les composés aromatiques polycycliques (HAPs), les résines et
les asphaltènes (hydrocarbures hétérocycliques ou oxygénés) (Viñas et al., 2002).
L’élimination des hydrocarbures dans le milieu marin et le traitement biologique dans les
stations d'épuration des déchets industriels à partir des raffineries nécessite l'intervention de
différents facteurs biotiques et abiotiques dont la biodégradation par les micro-organismes
particulièrement les bactéries. Les hydrocarbures, y compris les HAPs, ont été classés comme
polluants prioritaires par l’Agence de protection environnementale des États-Unis et par
d’autres organisations de l’environnement et de la santé dans le monde (Yerushalmi et al.,
2003). Afin d'optimiser le processus de bioremediation, deux approches principales ont été
explorées, la biostimulation, où les nutriments sont ajoutés pour stimuler les bactéries, et la
bioaugmentation, dans laquelle les souches microbiennes avec des capacités de dégradation
spécifiques sont ajoutées à des micro-organismes indigènes isolés à partir du sol contaminé
(Viñas et al., 2002).
De nombreux micro-organismes capables de dégrader les hydrocarbures d’origine pétrolière
ont été isolés par les chercheurs. Selon la complexité des produits pétroliers, une combinaison
de souches bactériennes telles un consortium seront nécessaires pour atteindre une
dégradation extensive.
Cependant, la plupart des études rapportées dans la littérature sur la biodégradation du pétrole
brut ont été réalisées avec des cultures de bactéries simples ou mixtes. Il est généralement
admis qu'un seul micro-organisme n'est pas capable de dégrader tous les composés de ce
mélange complexe et les cultures mixtes ont non seulement un large choix de substrat, mais
aussi la dégradation a pu être réalisé dans un système de cooxydation et commensalisme
(Chikere et al., 2011). De nombreux scientifiques ont reporté que les populations mixtes avec
leurs vastes capacités enzymatiques sont nécessaires pour dégrader les mélanges complexes
d'hydrocarbures tels que le pétrole dans les milieux marins, l'eau douce, et le sol.
Les bactéries sont les organismes les plus actifs dans la dégradation du pétrole, elles agissent
comme agents dépolluants primaire sur le pétrole déversé dans l'environnement (Brooijmans
et al., 2009). Le séquençage de l'ADNr 16S a révélé que ces bactéries dépolluantes sont en
majorité affiliées au groupe de Gamma-Proteobacteria et Actinobacteria. Christopher et
Christopher, (2004) ont démontré l'importance des espèces de Pseudomonas dans le stade
précoce de dégradation du pétrole et dans le traitement des sols contaminés. D’autres
bactéries Gram-négatif telles Shewanella et Pseudomonas isolées de boues huileuses se sont
avérées tolérantes aux hydrocarbures saturés, mono-aromatique, et polyaromatiques. Ces
bactéries sont moins sensibles aux composés toxiques que les bactéries Gram-positif (Stancu
et Grifoll, 2011).

75
Procédures expérimentales – Partie I

Certains Enterobacteriacaea notamment Enterobacter sp. et Serratia sp. isolées du sol


contaminé par les hydrocarbures ont également été caractérisées par leur potentiel de
dégradation d’hydrocarbures d’origine pétrolière (Zhang et al., 2010).
Par l’application des techniques à base d’ADN, il est possible d'évaluer le potentiel de
biodégradation en détectant les gènes cataboliques chez les microorganismes indigènes. De
nombreuses bactéries à Gram-négatif, impliquées dans la dégradation des alcanes disposent
de systèmes enzymatiques similaires au système alcane hydroxylase de Pseudomonas putida
Gpo1. L’alcane hydoxylase système (alkB) est constitué de trois protéines : une hydroxylase à
fer non hémique, une rubrédoxine (flavoprotéine) contenant deux atomes de fer et une
rubrédoxine réductase (van Beilen et al., 1994).

La chromatographie sur couche mince couplée à un détecteur à flamme d’ionisation


(TLC/FID) a été utilisé pour évaluer la biodégradabilité de pétrole brut et du rejet industriel, y
compris la fraction non volatile du pétrole brut (Maki et al., 2001). Les produits de
biodégradation du pétrole ont été séparés par analyse gravimétrique avec un modèle de
système SARA (Saturés, aromatiques, résines, asphaltènes) de séparation en plusieurs
fractions qui sont facilement séparés sur la base des différences de polarité fournissant ainsi
des informations plus détaillées sur la répartition des classes de composants au cours du temps
(Woods et al., 2008).
L'objectif principal de ce travail est d'isoler et d'identifier des bactéries capables de dégrader
les hydrocarbures pétroliers en utilisant l’analyse phylogénétique basée sur les séquençages
du gène ADNr 16S et d'optimiser le processus de dégradation avec un consortium bactérien
sélectionné. En outre, l'objectif est aussi de déterminer l'ampleur de la dégradation en
comparant les fractions spécifiques d'hydrocarbures résiduelles par la méthode de TLC/FID.
La recherche du gène alkB par réaction d’amplification génique est réalisée afin de
caractériser les bactéries sélectionnées.

1. MATERIELS ET METHODES

1.1. Site de prélèvement des échantillons


Les échantillons de sol contaminés par les hydrocarbures pétroliers ont été prélevés
depuis la raffinerie d'Arzew (Sonatrach, compagnie Algérienne de pétrole) (Figure 17). Au
total, cinq échantillons ont été utilisés à partir de deux sites contaminés par les hydrocarbures.
Pétrole brut (P) et rejets industriels (RI) ont été utilisés séparément comme seule source de
carbone en milieu minimum (MSM) pour des croissances bactériennes.

1.2. Enrichissement et isolement des bactéries aérobies dégradant les


hydrocarbures
Les bactéries sont isolées sur milieu minimum à base de sels minéraux (MSM),
contenant par litre: 1,2g NH4C; 1,6g K2HPO4; 0,4g KH2PO4; 0,1g NaCl, 1g KNO3, 20g
MgSO4.7H2O; 10g CaCl2.2H2O; 0,05g FeCl3, pH 7,1, une solution d'oligo-éléments (1 ml) et
une solution de vitamine (1 ml) décrite par Pfennig et Trüper (1992) ont été ajoutés
séparément en conditions stériles.

76
Procédures expérimentales – Partie I

Pour l'enrichissement, 20g de sol contaminé sont ajoutés à 200 ml de MSM contenant les
polluants filtrés (P ou RI) à 0,025% (v/v) de chaque source de carbone séparément (Brito et
al., 2006). Les cultures ont été maintenues en agitation (200 rpm) pendant 2 heures à
température ambiante (±28°C). Les bactéries capables d'utiliser les polluants ont été isolées
sur MSM. 20 ml de la culture précédente ont été repris en MSM frais dans des conditions
similaires, ainsi l’opération est répétée quatre fois. Après les quatre transferts consécutifs à de
courts intervalles (4 semaines), 1 ml de culture est dilué à 10-8 et 100µl ont été étalées sur
milieu Luria-Bertani (LB) agar et incubées à 30°C.

1.3. Le criblage et la conservation des souches isolées


La capacité de dégrader les hydrocarbures pétroliers est confirmée par inoculation du
milieu LB liquide avec des pures cultures (18h), transférées en milieu MSM frais contenant
des polluants comme seule source de carbone. Les colonies sont inoculées individuellement
sur le MSM contenant (P) ou (RI) à 1% (v/v), et incubées à 30°C en agitation (200rpm)
pendant 2 semaines. La consommation des hydrocarbures est indiquée par la variation de la
turbidité.
Les isolats ont été maintenus dans un milieu nutritif additionné de glycérol (1:1, v/v),
additionné de la source de carbone filtré (0,005%). Le mélange est agité au vortex et conservé
à -20°C (Obayori et al., 2009).

1.4. Détermination du potentiel de biodégradation bactérienne par turbidimétrie


La turbidimétrie est utilisé pour déterminer la croissance bactérienne en présence
hydrocarbures (P) ou (RI) utilisés comme sources de carbone à 1% (p/v) pour chaque
hydrocarbure dans le milieu MSM à température ambiante pendant 15 jours. La densité
optique (DO) à 600 nm est mesurée à des intervalles réguliers de 2 jours pendant la période
d’incubation.

1.5. Extraction de l'ADN génomique des souches bactériennes sélectionnées


L’extraction d'ADN est préparée selon la méthode modifiée de Gevers et al. (2001),
les colonies ont été repris dans 1 ml d'eau distillée stérile, centrifugées et congelées pendant 1
heure à -20°C. Le culot est lavé dans 1 ml de tampon TES (6,7% (p/v) de saccharose, 50 mM
Tris-Hcl (pH 8,0), EDTA 1 mM) et remis en suspension dans 300μl de tampon STET (8%
(p/v) de saccharose, 5% de Triton X-100, 50 mM Tris-Hcl (pH 8,0), 50 mM EDTA).
75μl de tampon de lyse (TES contenant 1330 U/ml mutanolysine et 40 mg/ml de lysozyme)
est ajouté, et la suspension est incubée à 37°C. Après addition de 40μl de solution de SDS
20% préchauffé (37°C) dans le tampon TE (10 mM Tris-Hcl, 1 mM EDTA, pH 8,0) et de
billes de verre, les cellules sont agitées au vortex pendant 60s et incubées à 37°C pendant 10
min, suivie d'une incubation à 65°C pendant 10 minutes. 100µl de tampon TE sont ajoutés et
le lysat est extrait avec 1 volume phénol/chloroforme/alcoolisoamylique.
Les phases sont séparées par centrifugation (12.000x g, 10 min). La phase aqueuse est
soigneusement mélangée avec 70 µl de NaCl 5M et 1 ml d'isopropanol, et l'ADN est précipité
dans la glace pendant au moins 15 min. Il est recueilli par centrifugation (12.000x g, 10 min)
et le culot est lavé à l'éthanol froid à 70%. Le culot d'ADN est finalement dissout dans 50µl
d'eau distillée et stocké à -20°C. L'ADN est vérifié par une électrophorèse sur gel d’agarose à
1% dans Tris-acétate-EDTA (TAE).

77
Procédures expérimentales – Partie I

1.6. Amplification de l’ADNr 16S, séquençage et analyse phylogénétique


Des amorces universelles suivants sont utilisées pour l'amplification par PCR de
l'ADN ribosomal 16S : 8UA: (5'-AGA GTT TGA TCC TGG CTC AG-3 '), 1492r (5'-TAC
TAC CTT GTT GGG ACG LOI T-3') (Sato et al., 2003).
Le mélange de PCR (50 µl) contient 100 ng d'ADN Taq polymerase selon les instructions du
fournisseur, 0,2 mM de dNTP, 1,0 µM de chaque amorce et 2,0 mM MgCl2 et le tampon
(10X). L'amplification a été effectuée à l'aide d'une PCR TECHNE TC-312 (Pierre ST 15
OSA, UK) programmé comme suit: 15 min à 95 °C, 35 cycles de 1 min à 94 °C pour la
dénaturation, 1 min à 60 °C pour l’hybridation et 1,5 min à 72°C pour l'élongation et 10min à
72 °C pour une extension finale. 5µl de l’ADN (produit PCR) est analysé par une
électrophorèse avec migration sur gel d’agarose 1% à 100V.
Les réactions de séquençage de gènes ADNr 16S sont effectués à l’aide du Kit « Big Dye
Terminator Cycle Sequencing » par l'analyseur d'ADN 370A (Applied Biosystem).
Les séquences ont été comparées à celles présentes dans une banque de données du National
Center for Biotechnology Information (NCBI) sur le site Infobiogen en utilisant l’outil
d’alignement Basic Local Alignment Search Tool (BLAST) et alignées sur le programme
ClustalW. Un arbre phylogénétique a été conçu en utilisant le logiciel MEGA 5.05 par la
méthode neighbor-joining (Tamura et al., 2011).

1.7. Détection de gène de dégradation alkB


Pour la détection de gène alkB responsable de l’enzyme clé de l’oxydation des alcanes,
(alcane oxygénase), une PCR spécifique a été réalisée avec un couple d’amorces dégénérées,
Monf (5'-TCAAYACMGSNCAYGARCT-3') et Monr (5'CCGTARTGYTCNAYRTARTT-
3'), conçus sur la base des motifs conservés de l’alkB dans la N-(NTXHELGHK) et C-
terminal (INYIEHYGLL) domaines (Wang et al., 2010). Ce couple d'amorces a été prévu
pour amplifier un produit PCR (fragment d’ADN) d'environ 420 pb. Le mélange final de
PCR réaction est de 50µl contient: qsp H2O, 2.0 mM de MgCl2 et du tampon 10X (fourni
avec la Taq polymérase), 0.2 mM de dNTP, 1µM de chaque amorces, et 2,5U Taq ADN
polymérase (HotStart Taq Master Mix Qiagen Gmbh, Gernany) et 10-15 ng d'ADN purifié à
partir de souches sélectionnées. La PCR a été effectuée avec une dénaturation initiale de 5
min à 94 °C suivi par 32 cycles de 30s à 94 °C, 30s à 50-55 °C, et de 45s à 72 °C et une étape
finale d'élongation de 5 min à 72 °C. Les produits de PCR ont été séparés avec une
électrophorèse sur un gel de 1,0% agarose. L’ADN Smart ladder 200pb (Eurogentec) a été
utilisé comme marqueur de taille moléculaire.

1.8. Analyse de la biodégradation des fractions pétrolières par TLC/FID


La biodégradation a été suivi dans des flacons de 1L en triplicata contenant 500 ml de
MSM additionné de (P ou RI) filtré à 1% (p/v) comme seule source de carbone et 5% (v/v)
d’inoculum de quatre souches sélectionnées (consortium). Les cultures pures de souches
sélectionnées sur (LB) ont été centrifugées afin de récupérer le culot bactérien, lavés deux fois
avec du MSM pour éliminer toute trace de source de carbone restante.

78
Procédures expérimentales – Partie I

Les cultures ont été incubées en agitation (180 rpm) à 30 °C pendant 4 semaines. Les témoins
(abiotiques) non inoculés pour chaque polluant ont été mis dans les mêmes conditions de
culture. Les interactions et les témoins non inoculés ont été soumis à l’extraction
d’hydrocarbures avec le dichlorométhane (DCM), puis passer à l’analyse de chromatographie
liquide sur colonnes de silice couplée à des mesures gravimétriques (méthode SARA)-
TLC/FID (type Iatroscan MK-5, Mitsubishi Kagaku Iatron, Tokyo, Japon) (Goto et al., 1994).
La solution du DCM (3 µl) été déposé sur l’extrémité d'une tige de gel de silice (Chromarods-
SIII; Iatron). Toutes les tiges sont repérés par les échantillons, le support est placé dans la
cuve de migration avec le premier éluant le n-hexane pendant 30 minutes pour séparer les
hydrocarbures saturés environ 10 cm à partit du dépôt, ensuite avec le toluène pour séparer les
hydrocarbures aromatiques (5cm), et enfin 2 min dans une solution de 95:5 DCM:méthanol
pour séparer les résines des asphaltènes. Après chaque migration, les colonnes ont été mises à
une température ambiante pendant 5-10 min afin de sécher le solvant et arrêter la
chromatographie. Dès que les colonnes sont séchées, elles sont placées dans le système
Iatroscan pour l’analyse (débit d'hydrogène 160 ml.min-1, le débit d'air 2 L. min-1 et 30 s
vitesse de numérisation scan-1), de manière efficace à analyser 10 échantillons en 5 minutes.
Les composants organiques séparés sur la colonne (chromarod) sont ionisés et chargés à la
fois positivement et négativement. Les données qui en résultent sont des pourcentages de
différentes fractions du mélange complexe représentés par des chromatographes; cette
méthode permet de séparer les hydrocarbures pétroliers en quatre pics appelés les fractions,
saturés, aromatiques, résines et asphaltènes (Maki et al., 1997). L’étalon interne (Std du
laboratoire, Newcastle, UK) a été utilisé pour évaluer la dégradation des hydrocarbures
analysés par TLC/FID, 3µl ont été déposé sur la colonne et analysé comme décrit ci-dessus.
Le processus nous a permis de suivre le contenu total des fractions d'hydrocarbures pétroliers
dans les échantillons contaminés.

2. RÉSULTATS

2.1. Isolement et criblage des souches isolées


Avec une étape d’enrichissement et de purification en utilisant (P) et (RI) comme
source de carbone et d'énergie, 15 colonies bactériennes au total ont été obtenues avec une
diversité morphologique différente à caractère macroscopique et microscopique, certaines
d’entre-elles ont été répertoriés comme suit : LGM106, les cellules sont Gram-négatif en
forme de bâtonnet, colonies beiges muqueuses en boite de Petri sur milieu LB, LGM101
étaient des coques à Gram-négatif, des colonies rondes et rose, à croissance rapide. LGM10
en forme de bâtonnet, à Gram-négatif, colonies blanches gluantes et LGM104 étaient en
forme de bâtonnet Gram-négatif, des colonies blanches, de forme arrondie. Les souches LGM
(101, 103, 104 et 106) ont démontré une turbidité importante dans les cultures d'interactions
en signe de croissance, elles ont été choisies pour la composition d’un consortium microbien.
Ces quatre souches ont été cultivées séparément et mélangés en proportions égales pour une
utilisation en culture dans les interactions avec les polluants hydrocarbures (P et RI).
.

79
Procédures expérimentales – Partie I

2.2. Évaluation de l'utilisation des hydrocarbures par turbidimétrie


La DO change avec le temps pour chaque isolat et pour la culture mixte en présence
des hydrocarbures (P- Figure 18), (RI- Figure 19). La turbidité mesurée à intervalle régulier
(tous les 2 jours) montre le potentiel de dégradation des hydrocarbures choisis par les
bactéries sélectionnées. Plus précisément, la croissance est linéaire entre le 4ème et 12ème jour
d’incubation, l’utilisation du xénobiotique comme source d’énergie pour la croissance
bactérienne (oxydation); la croissance est limitée apres 12 jours d’incubation, process au
cours duquel le composé chimique n’est pas utilisé pour la croissance bactérienne mais est
dégradé du fait de l’activité métabolique (le co-métabolisme). Les résultats montrent que
LGM 101 et LGM 106 ont plus de capacité à dégrader le pétrole (P), en plus la souche
LGM 106 utilisée seule montre un meilleur potentiel à dégrader le rejet industriel (RI).
Ces mesures de DO ont montré que les bactéries testées ont la capacité d’utiliser les substrats
hydrocarbonés (P et RI) comme seule source de carbone et d'énergie, le degrès de turbitidé
diffère d'une bactérie à une autre (probablement en raison de l’attaque initiale de la source de
carbone qui diffère d’une souche à l’autre et les caractéristiques individuels de la croissance).
La culture mixte composée de quatre souches a montré une plus forte densité de cellules. Ceci
peut être expliqué du fait que les micro-organismes en culture simple peuvent métaboliser une
gamme limitée de substrats, tandis qu’en culture mixte, les souches bactériennes ont un
cométabolisme plus large et attribue une plus grande capacité de dégradation des mélanges
complexes d’hydrocarbures (Mueller et al., 1997).

2.3. La caractérisation moléculaire des bactéries sélectionnées


Après amplification de l'ADNr 16S (Figure 20). Une étude basée sur le séquençage de
l'ADNr 16S a été réalisée. Avec une homologie de 95-100% comparée avec les séquences de
la banque de données dans Genbank-BLASTn, l'analyse d'affiliation génétique (Figure 21) a
révélé que la souche LGM106 forme un groupe avec Pseudomonas Cedrina subsp. fulgida
DSM 14938 (99% de similarité) et avec la souche Pseudomonas Cedrina (99%). Dans la
littérature, la souche Pseudomonas Cedrina fait partie du groupe Pseudomonas fluorescence
selon Anzai et al., (2000). (LGM106 est identifiée comme Pseudomonas sp.). En outre,
l'analyse phylogénétique a indiqué que LGM101 présente (98%) de similarité de séquence
avec la souche Shewanella hafniensis P010. Le séquençage du gène ADNr 16S a permis
d’identifier deux Enterobacteriales LGM103 présentant (98%) de similarité de séquence avec
Enterobacter hormaechei ATCC 49162 souche CIP 103441 et LGM104 à (99%) de similarité
avec la souche Serratia proteamaculans 4364. Ceci permet la classification de LGM103 et
LGM104 comme souche au genre Enterobacter sp.

2.4. La détection de gène de dégradation: alcanes oxygénase


L’ADN génomique extrait à partir des souches sélectionnées a été utilisé pour l'amplification
du gène alkB. En utilisant le couple d’amorces dégénérées Monf et Monr, le fragment de gène
alkB de (420 pb) a été amplifié chez Pseudomonas sp. (LGM106). Cependant, aucune
amplification n’a été observée chez les autres isolats Shewanella sp. (LGM101), Enterobacter
sp. (LGM103) et Serratia sp. (LGM104) qui présentaient une capacité de croissance en
présence des hydrocarbures pétroliers, le gène alkB est absent chez ces souches
(Figure 22).

80
Procédures expérimentales – Partie I

La capacité de croissance peut s’expliquer par la possibilité de présence d’autres groupes


d’alcanes monooxygénase et/ou présence d’autres gènes de dégradation responsables de
l’attaque initiale des autres groupes pétroliers.

2.5. La biodégradation des hydrocarbures pétroliers par un consortium


sélectionné
Les données à partir de l’analyse TLC/FID indiquent les concentrations de quatre
fractions majeures d'hydrocarbures pétroliers au cours du temps (Tableau 13).
La concentration de chaque composant a été calculée sur la base du rapport des aires des pics
pour chaque fraction par rapport au standard (Std). La chromatographie liquide sur colonne de
silice couplée à des mesures gravimétriques montre que le pétrole brut utilisé comme standard
(Std) contient 58,05% d'hydrocarbures saturés, 34,91% d'hydrocarbures aromatiques, 5,33%
des résines et 1,72% d'asphaltènes, ces résultats correspondent approximativement aux
composants des fractions de (P) et (RI) mesurée par TLC/FID (Figure 23-B et
Figure 23-D). Cependant, le pétrole brut algérien (P) contient plus de composés saturés, une
fraction de 66,19% (Tableau 13) par rapport au (Std) à savoir 58.05%.
L'analyse des produits de biodégradation dans les cultures d'interactions (P+c et RI+c) montre
que le pourcentage de biodégradation des composants saturés diminue avec l'augmentation
importante des fractions non biodégradables (asphaltènes). Cette biodégradation
(consommation ou disparition) importante de cette classe de composés est due à leur grande
sensibilité à l’attaque microbienne comme cela a été souligné dans la littérature (Ulrici, 2000).
Les résultats de la fraction aromatique en (P+c) ne montre aucune variation importante et peut
être expliqué que ces substrats (polluants) ne sont pas appropriés ni apprécier par le
consortium, alors que dans (RI+c), il y’a la possibilité que le RI a pu subir un traitement
chimique pendant le raffinage du pétrole et les composants générés sont moins complexes et
peuvent présenter une meilleure accessibilité pour le consortium bactérien sélectionné.
Cependant, les résultats montrent que le pourcentage de biodégradation de résines est stable
dans tous les échantillons et le pourcentage d’asphaltènes augmente et reste stable comme
observé dans (Figure 23-C) et (Figure 23-E), cela pourrait s’expliquer par le fait qu'ils ne
sont pas dégradés en raison de leurs structures complexes et ils sont difficiles à analyser, les
résines et asphalthènes sont généralement insolubles dans le solvant et résiste à la
biodégradation (Ito et al., 2008).

3. DISCUSSION
La biodégradation est l'un des principaux moyens par lesquels les polluants
d'hydrocarbures peuvent être retirés de l'environnement et de nombreuses espèces de bactéries
aérobies peuvent utiliser ces hydrocarbures et leurs dérivés dans l’environnement. L'efficacité
de biodégradation varie de 0,13% à 50% pour ces bactéries, d’autres organismes peuvent être
impliqués dans ce processus, agissant souvent sous forme de consortiums.
Il est souvent difficile de trouver des organismes qui dégradent individuellement toutes les
fractions de pétrole brut (aliphatiques et aromatiques) (Das et Chandran., 2011).

81
Procédures expérimentales – Partie I

Dans cette étude, quatre bactéries ont été caractérisées et identifiées, la phylogénie a permis
de les regrouper dans un groupe de Gamma-Protéobactéries et les affilier aux genres
Pseudomonas, Shewanella, Enterobacter et Serratia. Selon la littérature et leur affiliation, ces
souches ont été adaptées à un environnement complexe, et pourraient être d'une grande utilité
en bioremédiation, dans les zones contaminées par les hydrocarbures (Kim et Picardal, 2000).
Des consortiums microbiens ayant la capacité de dégrader le pétrole brut à basse température
ont été étudiée par Deppe et al., (2005), et Shewanella sp. et Pseudomonas sp. ont été les
phylotypes prédominants dans ce microcosme destinés à la biodégradation des hydrocarbures.
Les cultures mixtes montrent plus d’avantage de dégradation par rapport à la monoculture, y
compris la stabilité du consortium, avec une importante adaptation de ces bactéries dans des
combinaisons différentes, elles démontrent la capacité d'utiliser divers hydrocarbures, tels que
les alcanes à longue chaîne (n- C24 à n-C34), le pristane, (méthyl)-naphtalènes et des xylènes,
en tant que seule source de carbone et d’énergie. Katsivela et al., (2005) ont noté que le genre
Enterobacter en communauté microbienne à été détecté dans les boues résiduaires actives de
raffinerie et contribuent à l'épuisement des n-alcanes d'environ 75-100%. En outre, Chikere et
al. (2012) ont noté que la souche CEE_131 (T) a été isolée à partir des sédiments, cette
dernière à la capacité de dégrader les hydrocarbures aromatiques polycycliques à haut poids
moléculaire (quatre à cinq noyaux aromatiques, cette souche présente 91% de séquence
similaire avec Serratia proteomaculans DSM4597 (T).
Jin et al. (2012) ont démontré que Serratia sp. NB2 en culture mixte pourrait améliorer la
dégradation de nitrobenzène par rapport à sa croissance en culture simple.
Dans ce travail, la dégradation des hydrocarbures pétroliers par un consortium sélectionné à
montré que les fractions saturés et aromatiques ont subi une biodégradation. Les voies
métaboliques de dégradation majeures pour de nombreux composants pétroliers ont été
étudiées et documentées (Watkinson et Morgon, 1990) pour expliquer leur sensibilité et
accessibilité par les bactéries. Les n-alcanes sont les composés les plus facilement
biodégradés dans un mélange de pétrole, bien que les composés aromatiques sont
généralement les plus résistants à la biodégradation. Les hydrocarbures aromatiques de bas
poids moléculaire tels que le naphtalène peuvent être oxydés avant de nombreux composés
saturés (Zhu et al., 2001). Comme décrit par Maki et al., (2001), la diminution de la fraction
aromatique pourrait s'expliquer par l'hypothèse que les composés aromatiques ont été
transformés à une forme polaire (transformés à la fraction résine ou asphaltènes).
Différents facteurs influençant sur la dégradation des hydrocarbures ont été rapportés par
Cooney et al. (1985) et la plus importante est celle qui limite la biodégradation est leur
biodisponibilité aux micro-organismes. Les constituants d'hydrocarbures pétroliers se lient à
des composants du milieu, ils sont piégés et donc difficiles à être disponibles ou dégradés
(Barathi et Vasudevan, 2001).
Les hydrocarbures diffèrent par leur sensibilité et accessibilité aux attaques microbiennes, ils
peuvent généralement être classées comme suit: alcanes linéaires> alcanes ramifiés >
aromatiques légers > alcanes cycliques (Ulrici, 2000). Selon Warne Zouekia et al. (2010), une
biodégradation efficace dépend de divers paramètres, notamment sur la composition du
pétrole, sur la capacité des bactéries à adhérer et sur le potentiel de dégradation les
hydrocarbures.

82
Procédures expérimentales – Partie I

Beaucoup de recherches ont été effectuées pour comprendre les propriétés physico-chimiques
des différents constituants du pétrole brut, cependant la compréhension de la façon dont les
principales composantes du pétrole brut peuvent affecter l'adhésion bactérienne est encore très
limitée.
Le cométabolisme joue également un rôle important dans la biodégradation du pétrole.
Plusieurs hydrocarbures complexes, ramifiés, cycliques et aromatiques ne sont pas
biodégradables individuellement, ils ne peuvent être oxydés que par cométabolisme dans un
mélange d’hydrocarbures due à la présence d’autres substrats qui peuvent être métabolisés
facilement au sein d’un mélange complexe (Atlas, 1981).
Dans la présente étude, le système enzymatique d'alcane hydroxylase a été étudié, il s’agit du
gène alkB, codant une alcane hydroxylase intervenant dans l’attaque initiale des alcanes. Le
genre Pseudomonas a été différencié des autres genres par sa possession du gène alkB. La
première découverte dans la biodegradation de l’hexane concernant Pseudomonas fluorescens
(Smits et al., 2003). Les gènes codant pour l’alkB sont présents dans de nombreux groupes
bactériens ɑ -,ẞ- et ƴ -Proteobacteria, telles Rhodocuccus erythropolis, Pseudomonas
aeruginosa, plusieurs Acinetobacter sp. et Alcanivorax borkumensis (Van Beilen et al., 2005).
Les souches bactériennes peuvent contenir plusieurs alcanes hydroxylases membranaires de
types AlkBs, et il ya une explication possible à cette redondance apparente, les enzymes
peuvent avoir différentes gammes de substrat: certains enzymes oxydent les n-alcanes de C5 à
C12, tandis que d'autres oxydent de C10-C16 (Van Beilen et al., 2004). Différents AlkBs
pourraient également être actifs au cours des différentes phases de croissance, une autre
explication est que les AlkBs pourraient avoir des affinités constantes pour différents alcanes
ou quelques AlkBs pourraient préférentiellement oxyder les composés non-linéaires, ramifiés,
aliphatiques cycliques ou aromatiques.
La fraction organique des sols contaminés associée aux sables des localités du Sahara
Algérien a été caractérisé, elle contient une fraction de n-alcanes appartenant à C16-C35, des
hydrocarbures aromatiques polycycliques (HAPs) et des acides carboxyliques (Ladji et al.,
2010), ce qui peut expliquer l’adaptation des communautés bactériennes aux composés
organiques présents dans les sols contaminés.
Les résultats obtenus dans cette étude précisent que le consortium sélectionné, à été identifié
comme un consortium bactérien qui a le potentiel de dégrader les hydrocarbures pétroliers.
L'analyse phylogénétique a révélé que les souches appartiennent à des genres de
Pseudomonas, Enterobacter, Serratia et Shewanella. La culture bactérienne mixte
sélectionnée pourrait être utilisée en bioremédiation.
Récemment, des souches à Gram-négatif appartenant à Shewanella et Pseudomonas isolées de
boues actives sont révélées être tolérantes aux composés saturés (n-hexane, n-heptane,
n-décane, n-pentadécane, n-hexadécane, cyclohexane), aux mono-aromatiques (benzène,
toluène, styrène, isomères du xylène, éthylbenzène, propyl benzène) et aux aromatiques
polycycliques (Stancu et Grifoll, 2011). Dans le domaine de la bioremédiation, le choix d'une
méthode de biodégradation dépend en grande partie sur les capacités de dégradation naturelle
de la microflore locale. À cet égard, la TLC/FID est une technique prometteuse pour évaluer
en détail les capacités de bioremédiation de la microflore bactérienne.

83
Procédures expérimentales – Partie I

Cette méthode présente des avantages dans la mesure où on peut utiliser des hauts points
d'ébullition dans les mélanges des hydrocarbures tels que les saturés de poids moléculaire
élevé, les aromatiques, les résines et les asphaltènes, dont certains peuvent ne pas être
détectable par la GC ou la HPLC (Zhu et al., 2001). Dans une optique de bioremédiation,
l’analyse fonctionnelle des bactéries selectionnées, et donc des gènes intervenant dans les
processus de dégradation est un paramètre clé.
De ce qui précède, il est assez judicieux que cette culture bactérienne mixte présente des
candidats potentiels pour la bioremédiation des sites pollués par les hydrocarbures, cette étude
fournit un aperçu d'une meilleure compréhension de l'adaptation des bactéries vivant dans des
environnements pollués et d'élaborer une solution de mettre en œuvre des bio-stratégies
adéquates à l'avenir pour intervenir, contribuer et améliorer le bon fonctionnement au niveau
des sites de traitement biologique des raffineries.

Sites de prélèvement 1 et 2

Figure 17: Carte de l'Algérie, région d’échantillonnage de sols contaminés par les
hydrocarbures pétroliers - raffinerie d'Arzew-Oran (Smail et Khalef., 2007)

84
Procédures expérimentales – Partie I

0.8

LGM 106
0.6
LGM 101
DO

0.4 LGM 103


LGM 104
0.2 Culture mixte
Contrôle abiotique
0
0 2 4 6 8 10 12 14

Jours

Figure 18: Courbe de croissance (DO) de bactéries en présence du pétrole (P) pendant
15 jours d'incubation.

0.8
LGM 106
0.6
LGM 101
DO

0.4 LGM 103


LGM 104
0.2 Culture mixte
Contrôle abiotique
0
0 2 4 6 8 10 12 14

Jours

Figure 19: Courbe de croissance (DO) de bactéries en présence du rejet industriel (RI)
pendant 15 jours d'incubation

85
Procédures expérimentales – Partie I

M 1 2 3 4 5 6

1500 bp

1000 bp
800 bp
600 bp

400 bp

200 bp

Figure 20: Amplification PCR de l’ADNr 16S des bactéries du consortium sélectionné.
M: Marqueur de taille (ADN Smart Ladder 200 pb), 1 : Souche LGM 101, 2: LGM 103,
3: LGM 104, 4 : LGM 106, 5 : Contrôle positif (Pseudomonas aeruginosa ATCC 27853),
6: Contrôle négative sans ADN.

86
Procédures expérimentales – Partie I

Pseudomonas libanensis CIP 105460


35 Pseudomonas panacis CG20106
Pseudomonas gessardii CIP 105469
43
64 Pseudomonas brenneri CFML 97-391

32
Pseudomonas synxantha IAM12356
36 Pseudomonas mucidolens IAM12406
46 Pseudomonas azotoformans KS 0034
41 Pseudomonas fluorescens IAM 12022
100 Pseudomonas cedrina subsp. fulgida : DSM 14938 LMG 21467
75 Pseudomonas cedrina CFML 96-198
64
LGM 106 Gammaproteobacteria
Shewanella basaltis J83 (NR_044418)

Proteobacteria
Shewanella hafniensis P010 (NR_041296)
100
Shewanella oneidensis MR-1 (NR_074798)
97

80 LGM 101
62 Shewanella putrefaciens CN-32 (NR_074817)
87 Shewanella putrefaciens LMG 26268 (NR_044863)
87 LGM 103
61 Enterobacter hormaechei ATCC 49162 CIP 103441(NR_042154)
99
Enterobacter ludwigii EN-119 DSMZ 16688 CIP 108491(NR_042349)
Enterobacter asburiae JCM6051 (NR_024640)
45 Serratia plymuthica K-7 (NR_037111)
100
Serratia liquefaciens CIP 103238 (NR_042062)
LGM 104
99
Serratia proteamaculans 4364 (NR_037112)
Serratia proteamaculans 568 (NR_074820)
63
Serratia proteamaculans DSM 4543 (NR_025341)
Serratia grimesii DSM 30063 (NR_025340)
Sphingobium scionense (T) WP01 Alphaproteobacteria

0.02

Les arbres ont été générés avec 1000 répétition et le pourcentage (%) au niveau des nœuds représente les valeurs
de probabilités de la robustesse de la similitude. Bar = 0,02 substitution de nucléotides par site.
Figure 21: Arbre phylogénétique par la méthode Neighbor-joining basée sur les
séquences d’ADNr 16S des souches du consortium bactérien (LGM 106, LGM 101, LGM 103,
LGM 104) et des espèces apparentées du BLASTn database.

87
Procédures expérimentales – Partie I

1 2 3 4 5 M

1500 bp

1000 bp
800 bp
600 bp

400 bp

200 bp

Figure 22: Gel d’électrophorèse de la PCR alkB des souches sélectionnées.


1, 2 et 3 : amplification PCR des souches LGM (101, 103, 104) respectivement, 4 : Présence
de gène AlkB chez LGM 106, 5: Contrôle négatif sans ADN, M: Marqueur de taille (ADN
Smart Ladder 200pb)

88
Procédures expérimentales – Partie I

A Std (Standard)
Standard (rod 2) (2,1) Atlas,nrg_ch14.CeG_Iatroscan 03-18 1004,2,1,1
Acquired 18 March 2009 10:22:35
Response

64
Saturates
0.11
62

60
Aromatics 0.26
58

56 Resins
0.33

54

52 Asphaltenes
0.46

50
0.0 0.1 0.2 0.3 0.4 0.5
Retention time

B P (Pétrole brut) C P+c (Consortium)


Sample 1 (rod 4) (4,1) Atlas,nrg_ch14.CeG_Iatroscan 03-18 1004,4,1,1
Acquired 18 March 2009 10:24:09 Sample 2 (rod 5) (5,1) Atlas,nrg_ch14.CeG_Iatroscan 03-18 1004,5,1,1
Acquired 18 March 2009 10:24:55
Response

64

Response
64

62
62

60 0.12
60
0.11
58
58

56 0.47
56 0.28

54
0.23 54
0.35
52
0.33 52
0.46 0.42
50 0.32

0.0 0.1 0.2 0.3 0.4 0.5 50


Retention time 0.0 0.1 0.2 0.3 0.4 0.5
Retention time

D RI (Rejet industriel) E RI+c (Consortium)


Standard (rod 2) (2,1) Atlas,nrg_ch14.CeG_Iatroscan 03-18 1004,2,1,1 Sample 4 (rod 9) (9,1) Atlas,nrg_ch14.CeG_Iatroscan 03-18 1004,9,1,1
Acquired 18 March 2009 10:22:35 Acquired 18 March 2009 10:28:02
Response
Response

64 64

0.11
62 62

60 60 0.47
0.26 0.12

58 58

56 56
0.33

54 54 0.27
0.35

52 0.46 52
0.42

50 50

0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5
Retention time Retention time

(A) Standard (Std), (B) Pétrole brut (P), (C) P avec Consortium, (D) le rejet industriel
(RI) et (E) RI avec consortium après 4 semaines d’incubation.
Figure 23: Chromatogrammes de la TLC/FID par (Iatroscan).

89
Procédures expérimentales – Partie I

Tableau 13: Composition (%) des fractions pétrolières dans les contrôles biotiques (P+c
et RI+c) et abiotiques pendant 28 jours d'incubation.

Echantillons Saturés Aromatiques Résines Ashphaltènes


Std 58.05 34.91 5.33 1.72
P 66.19 29.78 3.03 1.00
P+c 50.40 30.42 3.65 15.53
RI 56.44 34.72 5.15 3.68
RI+c 51.77 27.77 5.07 15.39

P: Pétrole brut, (P+c): Pétrole avec consortium, RI: Rejet industriel, (RI+c): Rejet industriel
avec consortium.
Std : Standard

90
Procédures expérimentales – Partie II

Partie 2

Ce travail est en phase rédactionnelle en vue d’une publication de renommée internationale

Caractérisation moléculaire des bactéries aérobies capables de dégrader des


polluants aliphatiques et aromatiques de différentes fractions des
hydrocarbures pétroliers

91
Procédures expérimentales – Partie II

AVANT-PROPOS
La production pétrolière, le raffinage et le transport des hydrocarbures contribuent fortement à
la pollution de l'environnement. L'industrie pétrochimique génère des rejets d'effluents
liquides vers un site de traitement. Les boues et les rejets industriels qui résultent de ce
procédé de traitement ont une teneur élevée en hydrocarbures dérivés du pétrole,
principalement des alcanes et des composés aromatiques (Overcash et Pal., 1979), ce qui les
rend des produits de déchet potentiellement dangereux. La dépollution, l’incinération des
déchets d’origine pétrolière des sites contaminés est une préoccupation majeure, en raison
d’une part, de l’impact de cette pollution sur l’environnement et la santé, liée notamment à la
propagation des molécules dangereuses dans le milieu et leur transfert dans les nappes
phréatiques et dans la chaîne alimentaire, et d’autre part des coûts exorbitants engendrés par
les projets de réhabilitation qui exigent souvent l’excavation des sols et le transport onéreux
des terres vers les installations de dépollution (Baheri et Meysami., 2001).
Les traitements mis en œuvre pour dépolluer les sites contaminés sont nombreux et depuis des
années déjà, de nouvelles technologies sont en développement. Sur le terrain, les techniques
de traitement thermiques et physico-chimiques sont les plus répandues, Le traitement
biologique, qui repose sur le pouvoir d’autoépuration naturel des micro-organismes
(bactéries, champignons), suscite actuellement un grand intérêt. L’étape ultime est
l’élimination complète (minéralisation) des polluants. Le traitement biologique peut se faire
enfin sur site. Deux types de traitements sont fréquemment utilisés : le traitement en tertre
dynamique (landfarming) ou en tertre statique (biotertre). L’intérêt de ces techniques réside
essentiellement dans le fait qu’elles ne nécessitent ni excavation, ni transport, ce qui rend leur
mise en œuvre bien moins coûteuse (Persson et Welander 1994). L’atténuation naturelle des
hydrocarbures pétroliers dans les sites pollués est dépendante à la fois des caractéristiques
physico-chimiques des polluants et des sols considérés. Cette situation justifie l’utilité des
études sur la biodégradabilité des produits pétroliers pour évaluer les possibilités d'atténuation
naturelle dans les sols afin de définir des stratégies de bioremédiation.
L’atténuation naturelle d’une pollution désigne l’ensemble des processus qui concourent à la
réduction de la pollution sur le site considéré. Il s’agit essentiellement de la migration des
polluants sous toutes leurs formes, mais aussi de la biodégradation. L’évaluation de
l’atténuation naturelle dans un site pollué défini est un objectif essentiel. En effet, elle vise à
prévoir le devenir de cette pollution pour en tirer les conclusions relatives aux actions à
entreprendre (Leahy et al., 1990).
D’autre part si une action de réhabilitation doit voir le jour, elle permet de proposer un type de
traitement et ses modalités principales (Atlas et al., 1991; Babla et al, 1998). Il semble donc
essentiel de travailler à la caractérisation de communautés bactériennes, telles que celles
dégradant les hydrocarbures pétroliers, car les relations entre les micro-organismes, entre eux
et vis-à-vis de leur environnement est un élément essentiel pour comprendre un écosystème,
et donc envisager une stratégie de bioremédiation.
Le pétrole brut est essentiellement composé d’hydrocarbures, parmi lesquels les
hydrocarbures saturés, les hydrocarbures aromatiques, les résines, et les asphaltènes. Ces
composés sont fortement nocifs, particulièrement les aromatiques puisqu’ils montrent des
propriétés toxiques, mutagènes et carcinogènes (Sudip et al., 2002).

92
Procédures expérimentales – Partie II

La biodégradation d’un mélange de composés n’est pas la somme de la biodégradation de


chaque composé pris individuellement. Kanaly et Hareyama., 2000 et Lal et Khanna., 1996
ont travaillé sur la dégradation des principales familles chimiques du pétrole brut (n-alcanes,
iso- et cyclo-alcanes, aromatiques), comparée à la dégradation d’une fraction composite de
ces trois familles. La susceptibilité à la biodégradation semble se présenter dans l’ordre
suivant : n-alcanes > aromatiques > iso- et cyclo-alcanes (Amund et al ., 1987).
Les n-alcanes sont les composés les plus facilement biodégradables lors d’une éventuelle
pollution. Leur dégradation aérobie a largement été étudiée, et a première étape d’oxydation
est catalysée par une oxygénase. La présence d’oxygène est donc une condition nécessaire à la
dégradation de ces molécules. Les composés branchés sont en général plus résistants à la
dégradation que leurs homologues linéaires (Singer et al., 1984, Kaczorek et Olszanowski.,
2011). La biodégradabilité des hydrocarbures aromatiques de faible poids moléculaire (2 et 3
noyaux aromatiques) sont davantage soumis à la biodégradation que les hydrocarbures
aromatiques de poids moléculaire plus élevé (4 et 5-6 noyaux aromatiques) (Juhasz et Naidu,
2000).
L’étude de gènes fonctionnels impliqués dans la dégradation des hydrocarbures permettrait de
mieux définir la réponse mise en place par la communauté bactérienne. De nombreuses études
se sont intéressées aux capacités de dégradation et à la diversité de gènes impliqués présents
au sein de souches ou de communautés bactériennes (Nam et Alexander, 2001 ; Watanabe et
Hamamura, 2003 ; Zhou et al., 2006). Cependant, Il existe à ce jour peu d’informations sur
l’expression de ces gènes dans les heures et les jours suivant la contamination (Margesin et
al., 2003). La relation entre la présence ou l’absence de gènes de dégradation et les
performances de dégradation des souches isolées n’est pas toujours directe.
Beaucoup de voies de dégradation sont encore inconnues à ce jour (Marquez-Rocha et al.,
2005, Zhang et al., 2010). L’écologie microbienne cherche également à mieux appréhender et
comprendre le rôle exact des micro-organismes dans le fonctionnement des écosystèmes
complexes et également à préciser l’impact des différents facteurs du milieu, tant abiotiques
que biotiques, intervenant sur les micro-organismes (Bouaid et al., 2010).

L’amélioration de notre compréhension de la composition des microflores et de l’activité des


micro-organismes impliqués dans la biodégradation permet de mieux envisager les stratégies
de bioremédiation acceptables pour un site pollué. Il est donc important de développer une
approche pluridisciplinaire permettant d’englober l’ensemble des paramètres intervenant dans
l’atténuation naturelle en utilisant toutes les méthodes mises à disposition, quelles soit basées
sur une approche moléculaire, culturale ou physiologique. Dans ce contexte, la
chromatographie en phase gazeuse (GC) est une technique prometteuse pour évaluer les
capacités de biodégradation de la microflore bactérienne locale (Brito et al., 2006).

L’intérêt de ce travail est d’isoler à partir du sol contaminé par les hydrocarbures d’origine
pétrolière de la raffinerie d'Arzew des souches bactériennes aptes à vivre en présence des
composés ciblés, et d’évaluer la capacité de dégradation des souches sélectionnées par le
dosage des hydrocarbures résiduels par la GC/FID. Les isolats bactériens seront identifiés par
l’analyse des séquences d'ADNr 16S en utilisant les amorces universelles.

93
Procédures expérimentales – Partie II

Par ailleurs, des amorces spécifiques (biomarqueurs) seront utilisées afin d’amplifier les gènes
de dégradation (AlkB, NahAc et NidA). Dans cette étude, nous rapportons les isolats
capables de dégrader les hydrocarbures aromatiques et aliphatiques présents dans le pétrole
brut.

1. MATERIELS ET METHODES
1.1. Site de prélèvement
La collecte des échantillons s’est réalisée en Juin 2009 à partir des différents sites
(sols) contaminés par les hydrocarbures au niveau de la zone d’Arzew (Naftec-Sonatrach)
(Figure 25) et aussi à partir de bourbier stocké sur le site. Sur terrain, les échantillons du sol
contaminé sont prélevés à partir de 2 à 5 cm de la surface du sol pour des analyses
microbiologiques. Quinze échantillonnages au total ont été utilisés à partir de trois sites
contaminés par les hydrocarbures. Le pétrole brut (P) et le rejet industriel (RI) utilisé dans
cette étude sont fournis par la même compagnie, utilisé comme seule source de carbone et
d’énergie en culture d’enrichissement. Le pétrole utilisé en tant que source de carbone a été
filtré et conservé à 4°C.

1.2. Enrichissement, Isolement des bactéries aérobies


Les méthodes d’analyses microbiologiques ont été réalisées à partir d’une solution
mère d’enrichissement des pré-cultures (180rpm, 27 ± 2°C ) présentant 20g se sol contaminé
mélangé à 200 ml du milieu minimum minéral (MSM), contient par litre: 1.2g NH4C; 1.6g
K2HPO4; 0.4g KH2PO4; 0.1g NaCl, 1g KNO3; 20g MgSO4.7H2O; 10g CaCl2.2H2O; 0.05g
FeCl3; pH 7.1; 1 ml de solution de traces d’éléments minéraux et 1 ml de solution de
vitamines (Pfennig et Trüper, 1992), pH 7. Ces dernières sont ajoutées stérilement par
filtration (0,22 μm) de la solution mère de vitamines. Une semaine après, 20 ml de la pré-
culture sont transférés dans 200 ml de MSM, ces cultures de bactéries capables de dégrader
les hydrocarbures pétroliers ont été réalisées dans le milieu minimum minéral (MSM) en
présence de polluants (pétrole brut) à 50 ppm, utilisés comme seule source de carbone. Ce
procédé est répété trois fois avec une augmentation de la concentration de pétrole, 66, 85, et
100 ppm respectivement à des intervalles d’une semaine à chaque fois (Langlois; 1998). Une
numération microbienne a été effectuée sur MSM agar avec 1% (p/v) de pétrole brut comme
source de carbone à partir des dilutions décimales de 10-4. Apres 2 jours d’incubations à 30°C,
plusieurs colonies apparaissent sur milieu Luria Bertani (LB) Agar. La conservation et le
stockage des souches sont réaisés à -20°C en présence de 20% glycérol.

1.3. Criblage des souches isolées et caractérisation phénotypique


Les bactéries oxydent initialement les hydrocarbures par l’incorporation de deux
atomes d’oxygènes moléculaires dans le substrat pour former des dihydrodiols de
configuration cis. Cette réaction est catalysée par une enzyme, la déshydrogénase. La mise au
point de ce test de respiration est estimée par les sels de Tétrazolium, appelé test INT [2-(p-
Iodophenyl)-3(p-Nitrophenyl)-5-phenyl Tetrazolium chloride (Johnsen et al., 2002) afin
d’évaluer le potentiel de dégradation des isolats. Pour déterminer l’activité déshydrogénase
(Johnsen et al., 2005), les isolats ont été incubés à 30 °C pendant 3 à 4 semaines d'incubation
selon la source de carbone sélectionnées. Les réactions positives sont marquées par une
coloration pourpre due à la réduction de l'INT à (0,75 g/L).

94
Procédures expérimentales – Partie II

La précision de cette méthode a été évaluée en comparant la différence de coloration entre les
cultures en présence d’un témoin sans source de carbone pour chaque polluant.

1.4. Test INT en présence de différentes sources de carbones, pétrole et (HAPs)


séparément
Plusieurs interactions ont été utilisées afin de déterminer le potentiel de dégradation
des souches sélectionnées, Les cultures ont été réalisées dans le milieu (MSM) en présence de
polluant sélectionné et de la souche purifiée.
Une suspension de cellules lavées (1 ml) d’une pré-culture de (A600nm =0.9) sur milieu Luria-
Bertany (LB) est utilisée pour inoculer 20 ml de MSM additionné de la source de carbone
(Vila et al., 2001), contenant 1% (v/v) de pétrole brut filtré ou des hydrocarbures aromatiques
sélectionnés avec un nombre croissant d'atomes de carbone (cycles aromatiques). le
phénanthrène (Phe) comme aromatique léger à faible poids moléculaire (LMW) est ajouté à
une concentration finale de 100 mg/L, le pyrène (Pyr) et le Benzo[a]Pyrène (BaP) comme
composés aromatiques lourds à haut poids moléculaire (HMW) à 50 mg/L (Brito et al., 2006).
Tous les hydrocarbures ont été fournis par Sigma Aldrich. Ils ont été préparé en solutions
mères dans de l'acétone ou le dichlorométhane, un volume de 80 µl est mis dans des flacons
de cultures. Les échantillons préparés ont été incubés à 30°C pendant 3 à 4 semaines en
aérobie (agitation à 200 rpm). Deux témoins ont été utilisés, le premier positif avec une
interaction de cellules et une solution de Glucose à (25mg/ml), et un autre négatif contient
des cellules sans hydrocarbures (source de carbone).
Aux jours 14, 21 et 28, 200µl de chaque interaction en présence de pétrole brut ou des HAPs
sont soumis au test INT. Cette méthode colorimétrique basée sur la réduction de l’INT,
fournit une analyse précise sur la présence de l’activité déshydrogénase dans des conditions
aérobies (Bhupathiraju et al., 1999; Von Mersi et Schinner, 1991).

1.5. Extraction de l'ADN génomique


Les ADNs génomiques on été extraits à partir des différentes souches à l’aide du kit
commercial Ultraclean Microbial DNA Isolation (MoBio Laboratories) selon les
recommandations du fournisseur. Ce kit combine deux types de lyse cellulaire, une lyse
mécanique par broyage et une lyse chimique. L’ADN génomique d’un large spectre de
bactéries a pu ainsi être extrait.
En outre la rapidité d’exécution qu’offre l’utilisation du kit, il permet également des
extractions homogènes et facilement reproductibles limitant ainsi les biais inhérents à
l’extraction d’ADN (important lors de l’analyse de la diversité microbienne). Une fois
extraits, les ADNs génomiques sont conservés à –20°C dans 50 μl d’eau milliQ.

1.6. Electrophorèse sur gel d’agarose


Contrôle de la qualité et de la taille des ADNs
Après extraction, la qualité et la taille des ADNs extraits ont été vérifiées par électrophorèse
sur gel d’agarose (Eurobio). Les gels contenaient 1% (m/v) d’agarose dans un tampon TBE
1X (Acide borique 90 mM, Tris-base 90 mM, EDTA 2,5 mM pH 8.3). La migration des
différents échantillons a été réalisée sous une tension de 100 V pendant 30 minutes environ,
en parallèle de la migration d’un marqueur de poids moléculaire (Smart Ladder, échelle de
200 à 10 000 pb, Eurogentec).

95
Procédures expérimentales – Partie II

Après 15 à 20 min dans un bain de bromure d’éthidium à une concentration de 0,5 μg.ml-1
(BET : agent intercalant de l’ADN), les gels d’agarose ont été placés sous lumière UV afin de
visualiser par fluorescence la qualité et la quantité des ADNs génomiques extraits.

1.7. Amplification des gènes d’ADNr 16S par réaction de polymérisation en


chaîne (PCR)
Les gènes d’ARNr 16S sont amplifiés à partir de l’ADN génomique extrait des
bactéries isolées avec des amorces universelles (Youssef et al., 2009). Un thermocycleur
automatisé répète 35 cycles de trois étapes : la dénaturation de l’ADN (20s à 95°C),
l’hybridation des amorces (55s) à la température d’hybridation (voir Tableau 14) et la
synthèse du brin complémentaire grâce à une ADN polymérase thermostable (105s à 72°C).
L’ensemble des cycles de PCR est précédé par une étape de dénaturation de l’ADN (10 min à
95°C) et suivi d’une élongation finale (105s à 72°C). La réaction de PCR est préparée dans un
volume réactionnel final de 50 μl contenant l’ADN matriciel, 0,2 μM de chacune des deux
amorces utilisées (Tableau 14), 0,2 mM de dNTPs, 1,5 mM de MgCl2, 0,5 à 1 U de Taq
polymerase (Eurobio) en fonction du gène à amplifier avec son tampon réactionnel 1X final.

1.8. Purification des produits PCR


Les produits PCR en solution ont été purifiés à l’aide du kit commercial Kit PCR-
Clean-up (Promega, Madison, USA). Cette purification a pour but de séparer les fragments
d’ADN amplifiés du milieu réactionnel de PCR (protéines, sels) ainsi que des autres acides
nucléiques (amorces non utilisées, amplification des séquences non désirées inférieures à 100
paires de bases). La qualité et la taille des produits de PCR purifiés ont été vérifiées par
électrophorèse en suivant les mêmes conditions décrites ci-dessus.

1.9. Séquençage des fragments amplifiés


Une librairie d’ADNr 16S est ensuite constituée et les gènes sont séquencés par la
méthode de Sanger (Sanger et al., 1992). La séparation des fragments de séquençage a été
réalisée par La société GATC BIOTECH, prestataire Européen leader de séquençage d’ADN
et de bioinformatique pour l’industrie et la recherche académique. Les fragments de
séquençage sont alors séparés dans un séquenceur capillaire qui permettra de déterminer les
séquences des fragments analysés. Le traitement des séquences brutes a été réalisé à l’aide du
logiciel Blast. Chaque séquence est alors affiliée à un taxon par comparaison avec les
séquences de référence contenues dans les bases de données. Un alignement multiple conduit
à la création d’un arbre phylogénétique qui ordonne les séquences expérimentales et calcule
des distances relatives par rapport à des séquences de référence.

1.10. Détection et amplification des gènes de dégradation en utilisant des amorces


spécifiques par PCR
Dans une optique de bioremédiation, l’analyse fonctionnelle des microflores, et donc
des gènes intervenant dans les processus de dégradation est un paramètre clé. L’étude de
fonctions métaboliques chez les bactéries est souvent appréhendée par la recherche de gènes
connus impliqués ou associés à des mécanismes de dégradation. Ces techniques de screening
impliquent l’utilisation d’amorces pour l’utilisation en PCR ou de sondes pour les
hydridations qui sont dessinées à partir d’éléments génétiques de souches isolées.

96
Procédures expérimentales – Partie II

Ainsi, les amorces ou les sondes utilisées sont plus ou moins dégénérées de manière à cibler
une diversité plus ou moins importante.
Dans cette étude, grâce à la réaction de polymérisation en chaîne (PCR), des gènes d’intérêts
(également appelés biomarqueurs) ont été spécifiquement amplifiés (Tableau 14), à partir
de l’ADN génomique des souches bactérienne étudiées, trois gènes fonctionnels modèles ont
été choisis pour amplification, Il s’agit :
- Le gène alkB, codant une alcane hydroxylase intervenant dans l’attaque initiale des alcanes,
des amorces dégénérées ont été dessinés spécialement dans le but d'amplifier la séquence du
gène par PCR (Paisse et al. 2011). Un premier alignement de 42 séquences ont été utilisées à
partir d’une banque de données. Les séquences de l’alkB ont été utilisées pour l'alignement
des séquences de quatre groupes d'alcane hydroxylase décrits par Heiss-Blanquet et al,
(2005): le groupe de Rhodococcus, Pseudomonas groupe1, Pseudomonas groupe 2 et le
groupe d’Acinetobacter. Un second alignement de nucléotides de la même séquence a été
réalisé pour définir le niveau de la dégénérescence des amorces conçues (Paisse et al. 2011).
- Le gène nahAc codant la grande sous-unité de naphtalène dioxygénase chez les bactéries à
Gram-négatif, responsable de la première étape de dégradation des HAPs, intervenant dans le
métabolisme de composés aromatiques (tels : naphtalène, phénantrène ou encore
benzo[a]pyrene). Les amorces utilisées pour amplifier la grande sous-unité de la naphtalène
dioxygénase ont été développées suite à l’alignement sur ClustalW des séquences de
Burkholderia sp. U62430, Pseudomonas aeruginosa D84146, Pseudomonas fluorescens
AF00483 selon Bordenave et al. (2007)
- Les bactéries Gram-positif possèdent, quant à elles, plusieurs copies de gènes cataboliques
(nidA) leur conférant une large gamme de spécificité. Ainsi le système décrit chez
Mycobacterium PYR-1 comporte NidBA, dont le substrat préféré est le pyrène, et NidA3B3
qui oxyde préférentiellement le fluoranthène, mais qui oxyde aussi le naphtalène, le
phénanthrène, l’anthracène et le pyrène (Khan et al., 2001; Kim et al., 2006). Mycobacterium
6PY1 possède Pdo1 qui oxyde préférentiellement le pyrène, ainsi que le phénanthrène, et
Pdo2 qui oxyde les HAPs de 2 à 3 cycles avec une préférence pour le phénanthrène (Krivobok
et al., 2003).
Ces trois gènes cataboliques participent à la dégradation des hydrocarbures en condition
oxique, la dégradation d’hydrocarbures en condition d’aérobiose étant plus rapide qu’en
anaérobiose.

97
Procédures expérimentales – Partie II

Tableau 14: Caractéristiques des différents couples d’amorces utilisées lors des PCRs de
notre étude.
La température d’hybridation est évaluée à partir du Tm de chaque amorce calculé selon la formule Tm = 2nA/T
+ 4nG/C (avec nA/T le nombre de bases A et T dans l’amorce et nG/C le nombre de bases G et C). Y=C/T ;
R=A/G ; S= C/G ; W=A/T ; M=A/C ; K=G/T ; H=A/C/T ; N=A/C/T/G.

Séquence cible Amorces Séquences (5’….3’) Taille Température


du produit d’hybridation
attendue (pb) utilisée (C°)

Fragments de gènes codant pour les 8F AGAGTTTGATCCTGGCTCAG 1500 55°


ADNr16S des Eubactéries 1492R GGTTACCTTGTTACGACTT-3'. (Youssef et al, 2009),
(Desai et Madamwar,
2006)

alkB AlkB1F CAYGARYTGGGYCAYAAR 414 55°C


AlkB1R AACTAYNTYGARCAYTACGG (Paisse et al., 2011)

Fragments de gènes codant pour des


Dioxygénases
nahAc FRT5A TYR ARG CYA ACT GGA A 437 50°
FRT3B CAT GTC TTT TTC KAC VAT GGC (Bordenave et al., 2007)

nidA GP F GGG GAA CAC GGT GCC RTG DAT RAA 292 52°C
GP R GGG GAA CAC GGT GCC RTG DAT RAA (Cébron et al.,2008)

Les souches utilisées comme contrôle positif (test de biodégradation des substrats
sélectionnés et amplifications PCR) sont des souches de références du laboratoire d’accueil
EEM (Equipe Environnement et Microbiologie de Pau).
Contrôle positif pour l’amplification de l’ADNr 16S : ADN génomique total de la souche
EEM 50 Pseudomonas aeruginosa.
Contrôle positif pour l’amplification de alkB : souche EEM 48 Marinobacter
hydrocarbonoclastticus ATTC 27132.
Contrôle positif pour l’amplification de nahAc : souche EEM 25 Alcaniorax venusti IS 04.
Contrôle positif pour l’amplification de nidA : souche Cd1 Rhodococcus rubberrzofil.
La vérification des amplifications PCR par comparaison avec un contrôle (ADN) positif est
réalisée par une électrophorèse sur gel d’agarose de 1 à 2 % en fonction de la taille du
fragment attendu (conditions de migration identiques à celle décrites précédemment).

1.11. Analyse phylogénétique des séquences


Les séquences ont dans un premier temps été comparées avec celles présentes dans la
banque de données GenBank database du National Center for Biotechnology Information
(NCBI) (http://www.ncbi.nlm.nih.gov/) grâce à l’outil d’alignement Basic Local Alignment
Search Tool (BLAST). Cette étape permet l’identification de la séquence par homologie avec
des séquences connues.

98
Procédures expérimentales – Partie II

Les séquences codant pour l’ARN ribosomique 16S ont en parallèle été vérifiées avec le
programme CHECK_CHIMERA du Ribosomal Database Project II (RDP)
(http://35.8.164.52/cgis/chimera.cgi?su=SSU) pour déterminer d’éventuelles séquences
hybrides générées par PCR. Les séquences ont ensuite été alignées à l’aide du logiciel
ClustalW, puis ajustées à la taille de la séquence nucléotidique la plus courte
(http://helios.bto.ed.ac.uk/evolgen/filatov/proseq.html). Une analyse par le logiciel
MEGA5.05 (www.megasoftware.net) a permis de générer une matrice de distance élaborée
par comparaison des séquences d’ADN selon la méthode de neighbor joining. Cette matrice
est ensuite représentée sous forme d’un arbre phylogénétique. Des analyses de bootstrap
avec 1000 itérations ont été effectuées pour vérifier la robustesse des arbres. Par ailleurs, les
séquences obtenues dans cette étude ont été déposées dans les banques de données
DDBJ/EMBL/GenBank (voir numéros d’accession dans chapitre des résultats).

1.12. Tests de biodégradation des souches sélectionnées


Les essais sont réalisés dans des fioles de pénicilline de 120 mL avec un volume de milieu de
culture de 20 mL en triplicata. Le substrat est introduit à l’aide d’une seringue Hamilton, juste
avant la fermeture des fioles. Ces dernières sont fermées par des bouchons butyle téflonnés et
scellées par des capsules d’aluminium. Le choix de ce type de bouchon résulte d’essais
effectués lors d’études antérieures ayant mis en évidence l’importance du type de fermeture
des fioles pour minimiser les pertes d’hydrocarbures par évaporation mesurée dans les
témoins abiotiques. Ces derniers sont réalisés pour chacun des tests de biodégradation dans
les mêmes conditions. Des essais sans substrat sont également réalisés dans les mêmes
conditions que les essais biotiques, afin d’estimer le niveau de respiration endogène de
l’échantillon utilisé. Les fioles sont ensuite incubées pendant 21 à 30 jours à 30 °C sous
agitation à 200 rpm (Brito et al.,2006).

Les substrats (SIGMA-ALDRICH) de croissance choisis lors des tests de dégradation sont :

- Pristane (C19H40 : 2,6,10,14-tétraméthylpentadécane) représentatif des alcanes ramifiés


- Octadecane (C18H38) représentatif des alcanes linéaires
- Squalène C30H50 représentatif des alcanes ramifiés
- Phénanthrène C14H10 représentatif des tri-aromatiques
- Pyrène C16H10 à quatre cycles aromatiques
- Benzo[a]Pyrène C20H12 à cinq cycles aromatiques

99
Procédures expérimentales – Partie II

Phénanthrène C14H10 Pyrène C16H10 Benzo[a]Pyrène C20H12

Pristane C19H40 Octadécane C18H38

Squalène C30H50

Figure 24: Structure des substrats en hydrocarbures ayant fait l’objet dans cette étude.
La concentration en hydrocarbures est de 50 mg/L pour les aromatiques lourds et 100 mg/L
pour les aromatiques légers, et 250 mg/L pour les alcanes (Brito et al., 2006).

1.13. Dosage des hydrocarbures résiduels par CPG/FID


Les hydrocarbures résiduels sont dosés en chromatographie en phase gazeuse couplée
à un détecteur à flame d’ionisation. Au préalable, une extraction avec 10 mL de
dichlorométhane ou Hexane est effectuée. Le standard interne utilisé est le Triphenylmethane
(C19H16) à une concentration de 100 mg/L dans le dichlorométhane. Après agitation pendant
30 min à 250 rpm, la phase organique est récupérée et analysée en CPG/FID, sur un appareil
de type (GC 8000 Serie, Fisons instruments, Italy) équipé d’un passeur d’échantillons
automatique. Le débit du gaz vecteur (Hélium) est régulé par la pression d’entrée dans la
colonne (180 ou 190 kPa). Ce gaz est préalablement épuré de toute trace d’O2 et d’H2O. L’air
et l’hydrogène sont filtrés pour éliminer toute trace d’hydrocarbures. La méthode est définie
dans l’appareil comme l’indique le Tableau 15:

100
Procédures expérimentales – Partie II

Tableau 15: Conditions chromatographiques pour l’analyse des hydrocarbures résiduels


par CPG/FID (Brito et al., 2006)
Paramètres du chromatographe Valeur
Colonne HP
Longueur 30 m
Diamètre intérieur 0,32 mm
Phase méthyl-phényl-silicone
Epaisseur de la phase 0,1 μm
Méthode colonne
Isotherme initiale 60 °C
Durée de l’isotherme 1 min
Température finale 300 °C
Pente 40 °C.min-1
Durée de palier finale 5 min
Détecteur
Température 300 °C
Injecteur
Température initiale 60 °C
Pente 180 °C.min-1
Température finale 280 °C
Méthode d’injection
Volume 1 μL
Vitesse 5 μL.s-1
Temps de séjour de l’aiguille 0 sec
Débit de fuite 0 μL.min-1
Gaz vecteur Hélium
Pression d’entrée 190 kPa (27 psi)
Débit 1 mL.min-1
Autres gaz
Make Up (N2) 20 mL.min-1
Air 320 mL.min-1
Hydrogène 30 mL.min-1

L’acquisition des données se fait par le logiciel informatique Borwin software (Borwin ver. 1.22, JMBS Developments,
Grenoble, France)

101
Procédures expérimentales – Partie II

1.14. Performances finales des bactéries testées en pourcentage (%) de


biodégradation
Le % de biodégradation des souches testées est calculé en incluant les valeurs
résiduelles en GC/FID de T0 et le témoin abiotique AB. Cela correspond au rapport entre la
quantité de substrat dosée par CPG/FID dans les essais et le substrat présent dans les témoins
abiotiques à la fin de la période d’incubation et la quantité de substrat initialement introduite
afin de valider l’expérience. Il indique notamment si l’étanchéité des fioles utilisées est
correcte. Il permet également de valider les résultats obtenus pour le calcul du taux de
dégradation et du rendement de minéralisation qui prennent en compte les valeurs des
concentrations en hydrocarbures résiduels.
Les valeurs en (mg/l) sont encadrées par des écarts types et suivis par un test statistique pour
souligner la différence entre les valeurs des souches et des contrôles.

2. RESULTATS ET DISCUSSIONS

2.1. Caractérisation phénotypique


150 bactéries au total ont été isolées du sol contaminé après plusieurs étapes de
purification successives, le pétrole brut a éré utilisé comme seule source de carbone et
d’énergie.

Mise au point d’un test de potentiel de dégradation


Afin de mesurer les capacités de dégradation des bactéries sélectionnées, il fallait mettre au
point un test à la fois simple, fiable et utilisable pour l’ensemble des échantillons et des
substrats à tester. Il repose sur la détermination directe de la présence de l’activité
enzymatique, la deshydrogénase en présence d’O2 au bout d’une période d’incubation
suffisamment prolongée, généralement fixée entre 14 et 30 jours. L’utilisation d’une source
de carbone comme le Glucose était utilisé comme témoin positif.

Détermination de l’activité déshydrogénase par test INT:


L’Oxydation initiale des hydrocarbures a été déterminée par le test de respiration INT (2-(p-
Iodophenyl)-3(p-Nitrophenyl)-5-phenyl tetrazolium chloride, les cultures sont cultivées sur
milieu MSM additionné de pétrole ou des HAPs comme source de carbone: le phénanthrène,
le pyrène et le benzo [a] pyrène.
La précision du criblage de ces 150 souches a été évaluée en comparant la densité
colorimétrique observée en cultures pures des bactéries dégradant les hydrocarbures choisis
après une incubation de 3-4 semaines, en présence des sels de Tétrazolium, avec ou sans
source de carbone.
Le composé organique est utilisé en tant que donneur d’électrons et en tant que source de
carbone (croissance). Les électrons générés par l’oxydation du composé sont transférés vers
l’accepteur d’électrons qui est l’oxygène et donc il est dégradé en CO2 et H2O et participe à la
formation de biomasse.
Par conséquent, c’est un système enzymatique qui fait intervenir un transfert d’électrons en
présence d’oxygène. L’oxydation du substrat est rendu possible grâce à l’activation de
l’oxygène.

102
Procédures expérimentales – Partie II

A la base, la solution de sels de Tétrazolium est incolore tandis que son produit «Formazan »
donne une solution fortement colorée (pourpre). Les sels sont réduits en présence d’un agent
réducteur (NADH) qui est responsable de la couleur pourpre.
L’activité totale (intensité de la couleur) de cette déshydrogénase dans l’échantillon augmente
avec l’augmentation des cellules viables et liée directement avec le nombre de cellules
métaboliquement actives dans le milieu.

Le (Tableau 16) résume les différents phénotypes, 5 groupes ont été obtenus avec le test INT,
ils ont été caractérisés : pétrole brut +, phénanthrène +, pyrène +, le benzo[a]pyrène+, et
(pétrole brut, benzo [a] pyrène) +.

La réduction des sels de tétrazolium a été utilisée comme un indicateur de l'activité de


déshydrogénase de 150 bactéries isolées; après incubation, 96 souches ont été caractérisées
positives par la réduction de l’Iodonitrotetrazolium
L’étude de la contribution des différents groupes bactériens d’une microflore à la dégradation
d’un mélange de substrats tels que le pétrole est réalisée par enrichissement de la microflore
d’étude sur chacun des constituants du mélange. Les micro-organismes ne participant pas à la
dégradation de tel ou tel substrat sont éliminés par les lessivages occasionnés par les transferts
successifs. Par conséquent, seules les espèces bactériennes pouvant se développer sur le
substrat concerné vont persister dans les microflores « adaptées ».
L’analyse de la composition des microflores adaptées permet alors d'appréhender la
participation directe ou indirecte des espèces bactériennes constitutives à la dégradation de
chaque substrat individuel.
Une telle approche expérimentale ne pouvait être adoptée directement dans le cas de la
dégradation du pétrole brut puisque celui-ci est constitué de plusieurs milliers
d’hydrocarbures (Anthony, 2006). Par ailleurs, même si le pétrole n’est constitué que de
quatre grandes classes structurales d’hydrocarbures (alcanes, iso-alcanes, cyclo-alcanes et
aromatiques), la séparation des ces classes structurales, semblait délicate, c’est la raison pour
laquelle nous avons utilisé le pétrole brut comme source d’adaptation.
La biodégradation d’un mélange de composés n’est pas la somme de la biodégradation de
chaque composé pris individuellement. Olson et al. (1999) ont travaillé sur la dégradation des
principales familles chimiques du gazole (n-alcanes, iso- et cyclo-alcanes, aromatiques),
comparée à la dégradation d’une fraction composite de ces trois familles. La susceptibilité à la
biodégradation semble se présenter dans l’ordre suivant : n-alcanes > aromatiques > iso- et
cyclo-alcanes.
Sur la fraction composée de l’ensemble des familles, la fraction aliphatique se dégrade plus
rapidement que la fraction aromatique. Cependant, la biodégradation est moins rapide en
mélange que sur les composés pris individuellement. La récalcitrance relative des différents
hydrocarbures présents dans le pétrole est illustrée par les différents tests de dégradation
effectués au cours de cette étude.
Pour chaque type de substrat testé, les alcanes linéaires sont dégradés en quelques jours. Les
hydrocarbures récalcitrants sont principalement les alcanes branchés et les aromatiques.

103
Procédures expérimentales – Partie II

Les hydrocarbures aliphatiques et aromatiques polycycliques majoritaires du pétrole brut ont


été biodégradés dès la première semaine d’incubation. Apres 12 jours d’incubation une
proportion importante d’organismes impliqués spécifiquement dans la dégradation des
hydrocarbures (tel que les souches LGM 20, LGM 22 et LGM30) qui présentent une réaction
positive nettement prononcée par rapport aux autres souches bactériennes.

2.2. Identification des souches par amplification et séquençage d’ADNr 16S


L’ADN génomique a directement été extrait des souches. L’ADN 16S a ensuite été
amplifié par PCR grâce aux amorces universelles du domaine Bacteria (8F) et (1492R)
(Figure 26). Les produits PCR ont ensuite été purifiés et séquencés par la méthode de Sanger
(Sanger et al., 1992), les séquences obtenues ont été soumises à une analyse de type BLAST
via la base de données NCBI.
Lorsque le pourcentage d’homologie des séquences obtenues est supérieur ou égal à 97 %
entre elles, ces séquences sont regroupées en OTU (Unité Taxonomique Opérationnelle)
alignées avec le logiciel Mothur project level 0.03 en utilisant la banque de données
Ribosomal Database Project (RDP) qui réalise une analyse fine de la diversité et la
construction d’arbre phylogénétique (Figure 27).
Numéros d’accession des séquences nucléotidiques
Les séquences déterminées dans cette étude (95 séquences) sont deposées à EMBL (European
Molecular Biology Laboratory) / GenBank database du National Center for Biotechnology
Information (NCBI) et désignées sous les numéros d’Accession de KF032720 à KF032814.
(Tableau 17) résume les numéros d’accession et les codes attribués aux souches au
laboratoire LGM (Université d’Oran).
Groupes phylogénétiques prédominants
L’arbre phylogénétique général des séquences obtenues pour l’analyse de la microflore
bactérienne est présenté en (Figure 27). L’arbre récapitule les séquences analysées en
fonction de leur appartenance aux différents groupes au sein du domaine « Bacteria ».
L’analyse de 95 séquences nous a permis de définir 17 OTUs différentes se répartissant sur 2
divisions, à savoir : les Gamma-Protéobactéries et les Firmicutes (bactéries à Gram-positif
regroupant les Actinobactéries)
Parmi ces groupes 65 souches sont regroupées dans le cluster des γ- Protéobactérie, et
appartiennent au genre Pseudomonas, Enterobacter et Acinetobacter. Les OTUs de ce
premier cluster represente 68.5% de l’echantillon de cette etude, il inclut (OTU1 (44%, OTU2
(10%) et OTU17 (1%)) representés par Pseudomonas sp. OTU9 represente (3%) representé
par Acinetobacter sp. OTUs12 avec (2% represneté par Serratia sp., OTU 15 avec 1%
representé par Enterobacter sp. et OTU4 avec 6% representé par Bervundimonas sp.
30 souches sont regroupées dans le deuxième cluster des Firmicutes, il represente 31.5% de la
totalité de l’echantillon analysé, representé par plusieurs d’OTUs, OTU3 (7%) representé par
le groupe des Enterococcacae, OTU5 (4%) et OTU8 (3%) representés par le groupe des
Bacillales, les souches appartiennent au genre Bacillus. Parmi les Firmicute, OTU6 (4%) et
OTU7 (3%) sont representés par Staphylococcus sp. Le groupe des Actinobacteriadae inclut
OTU14 et OTU16, les souches appartiennent au genre Kocuria sp. et OTU13 (2%), OUT11
(2%) representés par Corynecacterium sp. et Agrococcus sp. respectivement.

104
Procédures expérimentales – Partie II

La (Figure 28) illustre l’appartenance et la phylogenie des souches testées sur les
hydrocarbures aromatiques (Phe, Pyr et B[a]P) et les alcanes (Pristane, Octadécane et
Squalène). Ces souches appartiennet au groupe des Gamma-Protéobactéries et sont affiliées
aux genres de Pseudomonas sp. et Acineteobacter sp. Des isolats appartenant au groupe ƴ -
protéobactéries, étroitement liée à Acineteobacter sp. et Enterobacter sp. ont la capacité à
dégrader des hydrocarbures pétroliers (Wong et al, 2010 ; Thangaraj et al, 2008 ; Katsivela et
al, 2002).
Dans cette étude, le pourcentage élevé des isolats est représenté par le genre Pseudomonas sp.
ces bactéries sont faciles à cultiver dans les conditions utilisés et préférent le climat des
environnements méditerranéens (Fiorella et Spain, 1997); le genre Pseudomonas est parmi les
espèces qui montrent une grande efficacité à dégrader les hydrocarbures aromatiques
polycycliques et les alcanes (Zhang et al, 2011 ; Rocha et al, 2011).
Les isolats aappartenant au groupe Firmicutes incluant les bactéries du genre Bacillus et
Enterobacter (Figure 28) ont la capacité de minéraliser les hydrocarbures aromatiques
polycycliques lègers, Bacillus subtilis à la capacité d’assimiler le Pyrène (Das et Mukherjee.,
2007), et il a été démontré que la voie métabolique de dégradation du Benzo[a] Pyrène est
réalisée par B. Subtilis (BMT4i) (Lily et al.,2010).
Le pourcentage élevé des souches de Pseudomonas identifiées (~56%) dans ce travail pourrait
être liée à la propriété de ces microorganismes à coloniser les environnements contaminés par
des hydrocarbures (Karamalidis et al., 2010). Dans ce contexte, Pérez-Silva et al., (2006) ont
rapporté que l'espèce Pseudomonas était parmi les micro-organismes prédominants dans des
échantillons de sol hautement pollués par les hydrocarbures. Les espèces de ce genre ont une
large affinité pour les hydrocarbures et peuvent dégrader les alcanes tels, alycyclics,
thiophènes et aromatiques (Allen et al. 1997, Obayori et al., 2000). Les souches bactériennes
isolées sont adaptées à un environnement difficile, chose qui pourrait être d'une grande utilité
pour les inclure dans le domaine de décontamination et de bioremediation qui impliquent des
micro-organismes dans de telles circonstances.

2.3. Recherche des gènes d’intérêt (biomarqueurs) par PCR


Gène AlkB
Des amorces spécifiques du gène alkB ont été utilisées pour détecter sa présence dans les
souches isolées et sélectionnées.
D’après Kloos et al., (2006), des régions conservées ont été choisies pour la conception de ces
amorces pour chacun des quatres groupes cités en matériel et méthodes, les fragments
amplifiés ne représentent pas la totalité des gènes considérés. Pour tous les cas où aucune
amplification n’est observée, et au vu des performances de dégradation obtenues vis-à-vis des
hydrocarbure brut dans notre travail, il est probable qu’un gène codant l’alcane hydroxylase
alkB soit présent. Cependant, sa séquence divergerait suffisamment pour ne pas permettre
l’hybridation avec le couple d’amorces utilisé au cours de l’amplification (Paisse et al., 2011).
La (Figure 29) présente les résultats d’amplification obtenus pour les bactéries sélectionnées,
la souche Marinobacter hydrocarbonoclasticus (EEM48) est utilisée comme témoin positif
pour la détection du gène alkB. Nous observons une amplification à la taille attendue de 414
bp pour 16 espèces de Pseudomonas sp. sur la totalité (95) des souches sélectionnées
(Tableau 17).

105
Procédures expérimentales – Partie II

L’étude du gène alkB a permis de mettre en évidence la présence de ce gène chez les bactéries
du sol contaminé par les produits pétroliers de la raffinerie d’Arzew. Ainsi, malgré
l’optimisation des outils utilisés pour la détection de ce gène chez les bactéries, le gène alkB
ne permet pas de rendre compte de la réponse à une contamination pétrolière dans
l’environnement étudié. Plusieurs hypothèses peuvent expliquer ces observations. Tout
d’abord, la dégradation des alcanes au sein de communautés impliquerait plusieurs familles
d’enzymes, dont les cytochromes P450, aux spécificités de substrats différentes. Il serait donc
intéressant de suivre également la détection des gènes codant pour les cytochromes P450
durant 30 jours d’incubation. Par conséquent, la detection de ce gène n’étant pas spécifique à
la contamination, ce gène ne peut être utilisé comme gène modèle pour caractériser la réponse
de la communauté bactérienne à une contamination pétrolière spécifique aux alcanes.
Cependant, la recherche d’autres gènes de dégradation tels les gènes codant un cytochrome
(P450), susceptible d’intervenir dans la dégradation des iso-alcanes sont nécessaires afin de
mieux caractériser la microflore bactérienne, et sa capacité de dégradation vis-à-vis d’une
contamination par les alcanes.
Gène Nah Ac
La naphtalène dioxygénase (nahAc) susceptible d’intervenir dans l’attaque initiale des
hydrocarbures aromatique des bactéries Gram-négatif. La taille recherchée est de 437 bp.
La (Figure 30) représente un des gels des tests de mise au point de la méthode PCR, la taille
amplifiée est de 600 bp pour la plupart des souches testées. Le séquençage du produit PCR à
révélé que la partie amplifiée code pour une protéine (amino acid permease, APC family) et
non pas pour les dioxygenases responsables de l’attaque initiale des aromatiques (cela peut
s’expliquer par le problème d’alignement des amorces).

Gène NidA
La taille recherchée est de 292 bp. La (Figure 31) représente un des gels des amplifications.
Les amorces ont permis d’amplifier différentes tailles chez les souches potentiellement
impliquées dans la dégradation des aromatiques, chez les bactéries Gram-positif et les
bactéries Gram-négatif. La bande amplifiée entre 200 et 450 bp ne correspondait pas à la taille
recherchée sauf pour les souches LGM 10 et LGM 12 à environ 292 pb, ces souches sont
Gram-négatif appartenant au genre Pseudomonas sp. Résultats qui ne concordent pas avec la
littérature, les bactéries Gram positif possèdent plusieurs copies de gènes cataboliques leur
conférant une large gamme de spécificité. Le système décrit chez Mycobacterium PYR-1
comporte NidA, dont le substrat préféré est le pyrène, et NidA3B3 qui oxyde
préférentiellement le fluoranthène, mais qui oxyde aussi le naphtalène, le phénanthrène,
l’anthracène et le pyrène (Khan et al., 2001; Kim et al., 2006).
Un séquençage des produits amplifiés pour les Gram-positif et Gram-négatif est en cours afin
de confirmer la présence ou pas du gène nidA et l’appartenance de ce gène à la banque de
données des gènes responsables dans l’attaque initiale des hydrocarbures aromatique des
bactéries Gram-positif (Cébron et al., 2008).

106
Procédures expérimentales – Partie II

2.4. Biodégradation (%) des bactéries sélectionnées vis-à-vis des substrats choisis
Afin de caractériser au mieux les capacités de dégradation des bactéries identifiées vis-
à-vis des substrats sélectionnés, la quantité du substrat biodégradé a été mesurée en utilisant
l’analyse en chromatographie en phase gazeuse avec détection par ionisation de flamme
(CPG-FID). Ce type d’analyse nécessite, pour être répétable, une intégration très minutieuse
des chromatogrammes. Au niveau du test lui-même, il convenait également de ne pas négliger
la mise en œuvre de fioles dites « abiotiques », afin de quantifier les pertes liées notamment
aux fuites de substrats, des fioles dites « biotiques » pour s’assurer que la bactérie utilise la
source de carbone mise en culture et fioles dites « T0 » afin de vérifier la quantité
d’hydrocarbure mise au départ.
Quantification des hydrocarbures résiduels par CPG-FID
Les hydrocarbures résiduels sont donnés par CPG-FID en fin de test de dégradation. C’est
l’analyse fine du chromatogramme qui nous permet de quantifier ces hydrocarbures résiduels.
Les pics sont intégrés par rapport à la ligne de base du chromatogramme. C’est la différence
d’aire entre les chromatogrammes en début et en fin de test qui nous permet d’accéder aux
pourcentages de dégradation.
L’ensemble des résultats (%) de biodégradation des alcanes linéaires (C18) et branchés
utilisés (C19 et C30) et les aromatiques légers (Phe) et aromatiques lourds (Pyr er B[a]pyrene
par 23 espèces choisies sont présentés dans le (Figure 32 et 33 respectivement).
Biodégradation des n-alcanes
La dégradation des composés linéaires et ramifiés a été étudiée de façon indépendante pour
confirmer l'activité de dégradation des bactéries sélectionnées vis-à-vis des alcanes, à la fin de
la période d’incubation de 21 jours, les n-alcanes diminuent au cours du temps, mais reste
toujours présent à la fin du test de dégradation. Le genre Pseudomonas est un groupe de
bactéries qui présente une gamme variée d'activités métaboliques, y compris la dégradation de
divers hydrocarbures aliphatiques (n-alcanes) (Binazadeh et al, 2009) et ramifiés comme
source de carbone et d'énergie (Xie et al, 2011 ; Vomberg et Klinner, 2000).
Les alcanes avec une longueur de chaîne carbonée de C18, C19 et C30 ont été utilisés pour
tester la capacité de certaines bactéries qui ont répondu positivement au test de sélection
précédent (test INT). Les résultats indiquent que sur une période de 21 jours d'incubation à
30 °C dans le milieu MSM contenant 250 mg/L d’alcane que la dégradation de n-alcanes est
estimée à 13,29 % pour l’Octadecane par Pseudomonas sp. (LGM 27), 21.33% pour le
Squalène par Pseudomonas sp. (LGM 31) et 35.11% pour le Pristane (Tableau 18) par
Pseudomonas sp. (LGM 20), à signaler que ces souches possèdent le gène alkB.
La minéralisation du Pristane (C19) par les bactéries est plus rapide, alors qu’elle est plus
lente sur les n-alcanes tels Octadecane et Squalène (C18 et C30), la biodégradation de
l’Octadecane (C18) était beaucoup plus lente que c’elle du Pristane, cela est due au caractère
hydrophobe élevé de l’octadécane (Grötzschel et al, 2002 ; Hua et Wang, 2011).
La valeur résiduelle minimale des n-alcanes observée est pour 242.58 mg/L pour le Pristane
par Pseudomonas sp. (LGM 20), 304.17 mg/L pour l’Octadecane par Pseudomonas sp. (LGM
27) et 322.54 mg/L pour Squalène par Pseudomonas sp (LGM 31), cependant les pertes en
abiotique sont de 18.35% pour le Pristane 0.17% pour l’Octadécane.

107
Procédures expérimentales – Partie II

Biodégradation des HAPs


Les HAPs sont beaucoup plus résistants à la biodégradation. La dégradation des HAPs à trois,
quatre et cinq noyaux aromatiques ont été testés par les bactéries sélectionnées dans cette
étude pendant 30 jours à 30°C dans MSM contenant 100 mg/L de HAPs à bas poids
moléculaire et 50 mg/L pour HAPs à haut poids moléculaire.
La souche (LGM 10) appartenant au genre Pseudomonas sp. a la capacité de dégrader 11.51%
le Phénanthrène, environ 10.14% le Pyrène, pour le Benzo[a]Pyrene, le taux de dégradation le
plus elevé est de 33.93% pour LGM 11. Des études récentes montrent que plusieurs espèces
de bactéries capables de dégrader les HAPs à haut poids moléculaire ont été isolées (Rentza et
al, 2008; Juhasz et Naidu, 2000), de ces micro-organismes peu ont été montré capables
d’utiliser des HAPs à quatre ou cinq noyaux aromatiques pour la croissance en l'absence de
co-facteurs ou des agents tensio-actifs, leur métabolisme a lieu généralement sous des
conditions de co-metabolisme avec autres HAPs ou autres hydrocarbures (Boonchan et al.,
2000).
Dans ce travail, outre que Pseudomonas qui appartiennent à Gamma-Protéobactéries,
Enterobacter sp. LGM 60 minéralise 31.63% le B[a]P, Bacillus sp. à 31.49% et
Acinetobacter sp. LGM 7 environ 30.13% (Tableau 18), ce qui n'est pas commun avec la
littérature, les bactéries attaquent d'abord les composés à faible poids moléculaire (Mrozik et
al., 2003). Nous suggérons que ces isolats possèdent un système enzymatique spécifique pour
dégrader les aromatiques lourds à plus de quatre-benzène sans cofacteur ou des agents tensio-
actifs ajoutés au milieu minéral. Certaines bactéries ont la capacité de produire un agent
tensioactif comme Pseudomonas, Acinetobacter et Bacillus (Rocha et al., 2011; Thangaraj et
al., 2008 ; Das et Mukhrjee 2007, Salgado-Brito et al., 2007).
Cependant, les résultats montrent que Pseudomonas sp. a plus de capacité de dégradation que
Bacillus sp, Acinetobacter sp. et Enterobacter sp. avec un maximum de 33.93% pour le B[a]P
par Pseudomonas sp. LGM 11, un maximum de minéralisation de 10.14% pour Pyr et
11.51% pour Phe par LGM 10 illustré dans le (Tableau 18).
Hasanshahian et Giti (2008) ont montré que Bacillus subtilis produit 0,8 g/l de biosurfactant
comparée à Pseudomonas sp. qui produit 0,6 g/l. L'effet de l'agent tensio-actif produit par les
micro-organismes dans le milieu de culture en présence des hydrocarbures aromatiques,
solubilise le HAP et conduit à une augmentation de sa concentration dans le milieu et devient
plus accessible aux micro-organismes (Zhang et al., 1994, Toledo et al., 2006).
Quelques espèces de bactéries appartenant aux Micrococcus, Mycobacterium, Pseudomonas
et Bacillus, ont été caractérisées par leur aptitude à utiliser les HAPs lourds comme seule
source de carbone et d'énergie (Zhuang et al., 2002).
Les résultats de cette étude montrent que deux souches à Gram-positif appartenant au genre
Bacillus ont la capacité de dégrader les aromatiques récalcitrants lourds, LGM8 à 7.89% pour
Pyr et 28.74% pour B[a]P. LGM4 à 6.73% pour Pyr et 31.49 % pour B[a]P, montrant ainsi
la diversité des groupes de bactéries isolées à partir de sols contaminés et qui ont la capacité
de croître en présence des HAPs.

108
Procédures expérimentales – Partie II

Un isolat observé possédant le gène alkB à la capacité de dégrader à la fois les HAPs et les n-
alcanes, Pseudomoans sp. LGM 2 à la capacité de minéraliser l’alcane ramifié (Pristane) à
29.65% après 21 jours d’incubation, le Pyrène à 9.61%, et le Benzo[a]Pyrène à 15.37%
après 30 jours d’incubation, cette souche de Pseudomonas sp. possède à la fois les voies
cataboliques responsables de la dégradation des aromatiques et des aliphatiques. Il a été
rapporté que les deux composés HAP et alcanes peuvent être dégradés par une seule espèce
bactérienne (Sotsky et al, 1994; Whyte et al., 1997).
Le genre Pseudomonas à la capacité de croître sur les deux fractions aliphatiques et
aromatiques de pétrole, ce genre d’espèce présente un grand intérêt dans la bioremediation,
non seulement pour la dégradations des hydrocarbures pétroliers, mais aussi une gamme
variée de composés xénobiotiques (Parales et al., 2002). Cette capacité différencie
Pseudomonas sp. (LGM2) de toutes les bactéries isolées à partir du même site contaminé par
les hydrocarbures.
Dans notre étude, la prédominance de la minéralisation des hydrocarbures aliphatiques
estimée à 35.11% cas du Pristane (Tableau 19), elle est plus élevée que c’elle des
aromatiques estimée à 33.93% cas du B[a]P (Tableaux 18) ainsi que la dégradation des
aliphatiques est plus rapide, ces résultats ont été observés dans plusieurs études (Vinas et al.,
2002 ; Manee et al, 1998 ; Hasanshahian et Giti (2008).
L’accessibilité difficile des substrats complexes pour les microorganismes apparaît comme un
facteur limitant important à prendre en compte pour expliquer ce phénomène. En effet, ce sont
les hydrocarbures les plus lourds et complexes (cas du Squalène dans notre étude) qui
résistent le plus à la biodégradation.
Dans la présente étude, les résultats montrent les C18, C30 des n-alcanes sont faiblement
dégradés par les bactéries testées en comparant avec C19, les données fournies de l’étude par
Ladji et al, (2010) ont montré que les n-alcanes tels C18 et C30 ne sont pas des constituants
abondants dans le sable contaminé par les hydrocarbures de Hassi-Messaoud, donc moins
presents dans le pétrole brut, contrairement aux composés aromatiques qui sont plus présents
dans le sable contaminé. A ce stade, il est important de considérer l’adaptation et la
biodisponibilité des composés pour utilisation microbienne (Reid et al., 2000).
L'adaptation des bactéries aux contaminants a été largement mentionnée dans la
biodégradation du pétrole (Horowitz et Atlas., 1977 ; Solano et al., 2000). Penet et al., (2006)
ont montré une comparaison entre les échantillons de sol contaminé et non contaminé par une
adaptation à la pollution, les capacités de dégradation des bactéries du sol contaminé ont été
plus élevés que ceux des sols non contaminés.
Ce travail a montré que les souches sélectionnées identifiées comme Pseudomonas sp. ont le
potentiel d’utiliser efficacement les fractions de n-alcanes ramifiés (Pristane) comme source
de carbone et certains Pseudomonas sp., Bacillus sp. Enterobacter sp et Acinetebacter sp.
étaient capables de dégrader les hydrocarbures aromatiques récalcitrants comme le pyrène et
le Benzo[a]Pyrène. Par conséquent, nos résultats suggèrent que ces micro-organismes peuvent
être intéressants pour une application dans les techniques de la bioremédiation et utilisées
dans un site de traitement biologique des eaux usées des stations de raffinerie. Ils seraient
donc des candidates potentiellement importantes afin de sélectionner un consortium en
biotechnologie.

109
Procédures expérimentales – Partie II

Ainsi, ces souches peuvent être utilisées pour concevoir des cultures mixtes avec des
capacités de biodégradation spécifiques pour des fractions pétrolières déterminés. Néanmoins,
des études devraient être menées pour évaluer les interactions microbiennes au cours de la
biodégradation des hydrocarbures au fil du temps.
La valeur résiduelle minimale des HAPs observée est pour 109.94 mg/L pour Phénanthrène et
35.74 mg/L pour le Pyrène par Pseudomonas sp. LGM 10, et 114.67 mg/L pour B[a]P par
Pseudomonas sp. (LGM 11), cependant les pertes en abiotique sont de 38,75%, 63,01% et
10% respectivement (Tableau 18).
Les rendements de biodégradation dans les stations d’épuration dans les raffineries doivent
être étudiées par des expériences de bioaugmentation selon Andreoni et Gianfreda, 2007 qui
ereposait sur l’introduction dans ces sites des microorganismes présentant les capacités
métaboliques nécessaires à la dégradation des polluants présents. Cela consiste à ensemencer
le site avec des microorganismes adaptés à la dégradation du (ou des) xénobiotique(s)
présent(s), afin d’assurer ou d’accélérer le processus de dépollution. Cet ajout peut se faire
sous la forme d’une souche unique, ou d’un groupe de souches appelé consortia (Samanta et
al., 2002; Silva et al., 2009; Zanaroli et al., 2010). Ce qui conduirait à la mise au point de
nouvelles technologies de bioremédiation des sites de traitement biologiques contaminés par
les hydrocarbures pétroliers.
Certains microorganismes épurateurs ont de plus la capacité d’améliorer la solubilisation des
hydrocarbures particulièrement les HAPs, molécules fortement hydrophobes, par la
production de biosurfactants (formation de micelles), ou par la production de biofilms
(matrices extracellulaires adhésives et protectrices) (Johnsen et Karlson, 2004; Leglize et al.,
2008). C’est par exemple le cas de la souche bactérienne Pseudomonas aeruginosa P-CG3,
capable de produire un biosurfactant améliorant fortement la solubilisation du phénanthrène et
du pyrène au sein de sols contaminés (Cheng et al., 2004).
Dans notre travail des souches LGM 4 et LGM 8 sont des bactéries Gram-positif, appartenant
au genre Bacillus présentent des capacités de dégradation des composés aromatiques de
31.49% et 28.74% pour le B[a]P respectivement. Ces souches sont potentiellement
considérées comme positives pour le gène nidA, d’après la littérature c’est un gène spécifique
des Gram-positif (Andreoni et al., 2004), le genre Bacillus est capable de se protéger des
effets toxiques inhérents aux HAPs, et peut être susceptibles de produire des biosurfactants.
La formation également de biofilms est une des stratégies mises en place dans l’amélioration
de la dégradation des HAPs (Andreoni et al., 2004). Cette formation de biofilms permet à la
fois aux microorganismes de se protéger des effets toxiques des HAPs, mais aussi d’améliorer
leur biodisponibilité (Johnsen et Karlson, 2004).
Les bactéries sélectionnées ont montré des préférences spécifiques pour les différentes
sources de carbone testées, par conséquent leur capacité à utiliser les différents constituants
du pétrole, ces souches peuvent être utilisées pour concevoir des cultures mixtes (consortium)
avec des capacités de biodégradation spécifiques pour les différentes fractions pétrolières.

110
Procédures expérimentales – Partie II

Tableau 16: Différents phénotypes des bactéries isolées


Nombre de souches testées

Phénotypes Dehydrogenase positive alkB positive

C.Oil+ 9 (++) 22 (+) 15

Phe+ 7 (++) 19 (+)

Pyr+ 5 (++) 12 (+)

B[a]P+ 2 (++) 15 (+)

C.oil+, B[a]P+ 5 (++) 2 (+) 2

C.Oil: crude oil; Phe, phenanthrene; Pyr, pyrene; B[a]P: benzo[a]pyrene.


L’activité dehydrogenase déterminée par le test INT.
150 souches isolées du sol contaminé par les hydrocarbures, 96 souches testées par INT.
(++) Coloration forte. (+) coloration faible.

111
Procédures expérimentales – Partie II

Tableau 17: Numéro d’accession EMBL-GenBank et l’affiliation des séquences aux


OTUs (unité taxonomique opérationnelle) disponibles sur NCBI
(http://www.ncbi.nlm.nih.gov/)
Souches plus proche parent BLAST % d’identité Numéro Numéro Groupe amplification
déterminé (EMBL) d’OTUs d’accession Phénotypique alkB

LGM1 Pseudomonas libanensis 99.49% 1 KF032720 C.Oil+

LGM2 Pseudomonas brenneri 99.49% 1 KF032721 C.Oil+ , B[a]P+ +

LGM3 Pseudomonas libanensis 99,86% 1 KF032722 C.Oil+

LGM4 Bacillus amyloliquefaciens 99.76% 5 KF032723 C.Oil+ , B[a]P+

LGM5 Pseudomonas brenneri 99.08% 1 KF032724 C.Oil+ , B[a]P+ +

LGM6 Pseudomonas libanensis 99.617% 1 KF032725 C.Oil+

LGM7 Acinetobacter lwoffii 99.38% 9 KF032726 C.Oil+ , B[a]P+, Pyr+, Phe+

LGM8 Bacillus amyloliquefaciens 99.62% 5 KF032727 C.Oil+, B[a]P+, Pyr+, Phe+

LGM9 Bacillus amyloliquefaciens 99.74% 5 KF032728 C.Oil+

LGM10 Pseudomonas fragi 99.36% 2 KF032729 C.Oil+ , B[a]P+

LGM11 Pseudomonas libanensis 99.61% 1 KF032730 C.Oil+ , B[a]P+

LGM12 Pseudomonas psychrophila 98.97% 2 KF032731 C.Oil+ , B[a]P+

LGM13 Pseudomonas libanensis 99.68% 1 KF032732 C.Oil+

LGM14 Pseudomonas brenneri 99.51% 1 KF032733 C.Oil+ , B[a]P+ +

LGM16 Pseudomonas libanensis 99.73% 1 KF032734 C.Oil+

LGM17 Pseudomonas libanensis 99.72% 1 KF032735 C.Oil+

LGM18 Pseudomonas libanensis 99.83% 1 KF032736 C.Oil+

LGM19 Pseudomonas libanensis 99.73% 1 KF032737 C.Oil+

LGM20 Pseudomonas brenneri 99.49% 1 KF032738 C.Oil+ +

LGM21 Pseudomonas libanensis 99.74% 1 KF032739 C.Oil+

LGM22 Pseudomonas brenneri 99.49% 1 KF032740 C.Oil+ +

LGM23 Pseudomonas libanensis 99.49% 1 KF032741 C.Oil+

LGM24 Serratia proteamaculans 98.37% 12 KF032742 C.Oil+

LGM25 Pseudomonas extremorientalis 99.51% 2 KF032743 C.Oil+/- +

LGM26 Pseudomonas brenneri 99.47% 1 KF032744 C.Oil+/- +

112
Procédures expérimentales – Partie II

Souches plus proche parent BLAST % d’identité Numéro Numéro Groupe amplification
déterminé (EMBL) d’OTUs d’accession Phénotypique alkB

LGM27 Pseudomonas brenneri 99.22% 1 KF032745 C.Oil+/- +

LGM28 Pseudomonas libanensis 99.73% 1 KF032746 C.Oil+

LGM29 Pseudomonas veronii 100% 2 KF032747 C.Oil+/- +

LGM30 Pseudomonas brenneri 99.60% 1 KF032748 C.Oil+/- +

LGM31 Pseudomonas brenneri 99.32% 1 KF032749 C.Oil+/- +

LGM32 Enterococcus durans 99.52% 3 KF032750 C.Oil+

LGM33 Acinetobacter lwoffii 99.86% 9 KF032751 C.Oil+

LGM34 Pseudomonas libanensis 99.60% 1 KF032752 C.Oil+

LGM35 Pseudomonas veronii 99.20% 2 KF032753 C.Oil+/- +

LGM36 Pseudomonas extremorientalis 99.84% 2 KF032754 C.Oil+/- +

LGM37 Pseudomonas libanensis 99.83% 1 KF032755 C.Oil+

LGM38 Pseudomonas lurida 100 % 2 KF032756 C.Oil+/- +

LGM39 Kocuria rhizophila 99.36% 14 KF032757 C.Oil+

LGM40 Pseudomonas brenneri 99.22% 1 KF032758 C.Oil+/- +

LGM41 Pseudomonas libanensis 99.61% 1 KF032759 C.Oil+

LGM42 Pseudomonas libanensis 99.50% 1 KF032760 C.Oil+

LGM43 Pseudomonas libanensis 99.73% 1 KF032761 C.Oil+

LGM44 Pseudomonas brenneri 98.28% 1 KF032762 C.Oil+

LGM45 Pseudomonas libanensis 99.08% 1 KF032763 C.Oil+

LGM46 Pseudomonas libanensis 99.84% 1 KF032764 C.Oil+

LGM47 Acinetobacter lwoffii 99.60% 9 KF032765 C.Oil+

LGM48 Pseudomonas brenneri 99.18% 1 KF032766 C.Oil+/- +

LGM49 Pseudomonas libanensis 99.73% 1 KF032767 C.Oil+

LGM50 Bacillus anthracis 99.73% 8 KF032768 C.Oil+

LGM51 Pseudomonas libanensis 99.73% 1 KF032769 C.Oil+

LGM52 Enterococcus hirae 99.60% 3 KF032770 C.Oil+

113
Procédures expérimentales – Partie II

Souches plus proche parent BLAST % d’identité Numéro Numéro Groupe amplification
déterminé (EMBL) d’OTUs d’accession Phénotypique alkB

LGM53 Kocuria rhizophila 100% 14 KF032771 C.Oil+


LGM54 Pseudomonas libanensis 99.71% 1 KF032772 C.Oil+

LGM55 Pseudomonas libanensis 99.20% 1 KF032773 C.Oil+

LGM56 Agrococcus jenensis 99.01% 11 KF032774 C.Oil+

LGM57 Kocuria polaris 98.62% 16 KF032775 C.Oil+

LGM58 Brevundimonas diminuta 97.52% 4 KF032776 C.Oil+

LGM59 Pseudomonas xanthomarina 99.38% 17 KF032777 C.Oil+

LGM60 Enterococcus hirae 99.10% 3 KF032778 C.Oil+ , B[a]P+, Pyr+

LGM61 Carnobacterium inhibens 97.72% 10 KF032779 C.Oil+


LGM62 Pseudomonas cedrina 100% 1 KF032780 C.Oil+

LGM63 Enterococcus durans 99.88% 3 KF032781 C.Oil+

LGM64 Staphylococcus warneri 100% 7 KF032782 C.Oil+

LGM65 Pseudomonas libanensis 99.72% 1 KF032783 C.Oil+

LGM66 Pseudomonas libanensis 99.71% 1 KF032784 C.Oil+

LGM67 Brevundimonas diminuta 97.35% 4 KF032785 C.Oil+

LGM68 Corynebacterium xerosis 99.74% 13 KF032786 C.Oil+

LGM69 Staphylococcus succinus 99.87% 6 KF032787 C.Oil+

LGM70 Enterococcus hirae 99.61% 3 KF032788 C.Oil+

LGM71 Enterococcus hirae 99.16% 3 KF032789 C.Oil+

LGM72 Bacillus thuringiensis 99.32% 8 KF032790 C.Oil+

LGM73 Carnobacterium inhibens 98.55% 10 KF032791 C.Oil+

LGM74 Pseudomonas libanensis 99.61% 1 KF032792 C.Oil+

LGM75 Pseudomonas libanensis 99.73% 1 KF032793 C.Oil+

LGM76 Pseudomonas libanensis 99.61% 1 KF032794 C.Oil+

LGM77 Agrococcus jenensis 99.14% 11 KF032795 C.Oil+

LGM78 Brevundimonas diminuta 97.67% 4 KF032796 C.Oil+

114
Procédures expérimentales – Partie II

Souches plus proche parent BLAST % d’identité Numéro Numéro Groupe amplification
déterminé (EMBL) d’OTUs d’accession Phénotypique alkB

LGM79 Serratia proteamaculans 98.43% 12 KF032797 C.Oil+


LGM80 Enterobacter amnigenus 99.75% 15 KF032798 C.Oil+
LGM81 Brevundimonas diminuta 97.43% 4 KF032799 C.Oil+
LGM82 Pseudomonas psychrophila 98.95% 2 KF032800 C.Oil+
LGM83 Brevundimonas diminuta 97.42% 4 KF032801 C.Oil+
LGM84 Pseudomonas libanensis 99.74% 1 KF032802 C.Oil+
LGM85 Brevundimonas diminuta 97.57% 4 KF032803 C.Oil+
LGM86 Corynebacterium xerosis 99.75% 13 KF032804 C.Oil+
LGM87 Staphylococcus equorum 99.63% 6 KF032805 C.Oil+
LGM88 Staphylococcus equorum 100% 6 KF032806 C.Oil+
LGM89 Pseudomonas psychrophila 98.56% 2 KF032807 C.Oil+
LGM90 Bacillus thuringiensis 99.49% 8 KF032808 C.Oil+
LGM91 Staphylococcus succinus 99.87% 6 KF032809 C.Oil+
LGM92 Pseudomonas psychrophila 99.06% 2 KF032810 C.Oil+
LGM93 Enterococcus hirae 99.76% 3 KF032811 C.Oil+
LGM94 Staphylococcus warneri 99.87% 7 KF032812 C.Oil+
LGM95 Bacillus subtilis 100% 5 KF032813 C.Oil+
LGM96 Staphylococcus warneri 100% 7 KF032814 C.Oil+

115
Procédures expérimentales – Partie II

ARZEW  
ORAN 

Figure 25: Carte d’Algérie, région d’échantillonnage de sol contaminé par les
hydrocarbures – Raffinerie d’Arzew- ORAN (Ladji et al., 2010).

1 2 3 4 5 6 7 C- P M

1500 bp
1000 bp
800 bp
600 bp

400 bp

200 bp

Figure 26: Gel d’électrophorèse des produits PCR d’ADNr16S des souches
sélectionnées.
M: SmartLadder 10000 bp DNA, P: Contrôle positif Pseudomonas sp. EEM 50,
C- : Contrôle négatif (échantillon sans ADN), 1: souche LGM 52, 2: LGM 79, 3: LGM 92,
4: LGM 59, 5: LGM 84, 6 : LGM 1.

116
Procédures expérimentales – Partie II

Pseudomonas auricularis AB680413


Pseudomonas trivialis DQ536517
Pseudomonas poae HQ898902
Pseudomonas poae GU188952
Pseudomonas grimontii FJ005054
Pseudomonas brenneri HQ824860
Pseudomonas libanensis JQ014183
Pseudomonas lini EU169168
3643 Pseudomonas teessidea HQ003439
63 Pseudomonas fluorescens JQ336977
Pseudomonas veronii HQ824863
63 Pseudomonas veronii HQ824944
Pseudomonas corrugata HQ407237
42 Pseudomonas fluorescens AY267197
Pseudomonas fluorescens GU198115
Pseudomonas gessardii JF766369

Proteobacteria
36
OTU1 LGM76
Gammaproteobacteria
OTU2 LGM35
Pseudomonas syringae D84026
67 OTU17 LGM59
Pseudomonas sp. 122 EU003535
Pseudomonas fluorescens GU198121

99 Pseudomonas sp. A10.1(2011)HQ412501


63 Pseudomonas poae HQ898909
Nannospalax galili (Upper Galilee mountains blind mole rat)JO020273
98 Pseudomonas fluorescens JQ361752
Pseudomonas sp. SV3 AF251333
Acinetobacter lwoffii AM293675
Acinetobacter sp. TM6 6 DQ279315
99 Acinetobacter lwoffii DQ328322
99 OTU9 LGM33
Rahnella aquatilis DQ440548
99
Rahnella sp. D FJ386501
98 OTU12 LGM24
92 Enterobacter sp. 15 FJ587228
98 OTU15 LGM80
98
Proteus vulgaris FJ799903
99 Proteus mirabilis HQ398231
uncultured Hyphomicrobiaceae bacterium EF018179

67 Brevundimonas diminuta HE575935 Alphaproteobacteria


99 OTU4 LGM83
OTU3 LGM60
Enterococcus faecium HM638426
99 Enterococcacae
Enterococcus durans GQ421476
Enterococcus faecium FJ870986
Enterococcus sp. A1 DQ376914
OTU5 LGM4
62
65 Bacillus subtilis JN004058
Bacillus amyloliquefaciens HQ256522
99
Geobacillus sp. RSNPB7 HM588147
Firmicutes

Bacillus amyloliquefaciens JQ342907 Bacillales


59 43 Bacillus subtilis GQ872186
55
Bacillus sp. 4828 JN874809
Bacillus sp. SXMCr-4 JN606323
94
90 OTU8 LGM72
41 Bacillus sp. SAFN-018 AY167812
99 Carnobacterium sp. KOPRI80155 JN873179 Lactobacillales
99 OTU10 LGM61
67 Staphylococcus pasteuri EU379258
89 OTU7 LGM94
Staphylococcus pasteuri JQ085395

87 99 Staphylococcus sp. SX4 JN029836


OTU6 LGM87
44 Staphylococcus succinus JN411418
Actinobacteria

99 Kocuria sp. Z21zhy AM418389


86 Kocuria sp. B1 EU196518
Kocuria sp. SGb392 HQ224638
97
85 OTU14 LGM39

74
Kocuria sp. CCBAU 10913 JF772568 Actinobacteridae
93 OTU16 LGM57
uncultured Corynebacterium sp.GQ424180

99 99 OTU13 LGM68
Agrococcus sp. 8 1Kb EF540451

99 Agrococcus sp. m4-6 HM587914


78 OTU11 LGM56

0.02

Les arbres ont été générés avec 1000 répétitions et les pourcentages (%) au niveau des nœuds représentent les valeurs
de probabilité de la robustesse de la similitude. Bar = 0.02 substitution de nucléotides par site.
Figure 27: Arbre phylogénétique par la méthode Neighbor-joining basée sur les séquences 117
d’ADNr16S repésentés par des OTUs affiliées aux Protéobactéries, Firmicutes et Actinobactéries
isolées du sol contaminé par les hydrocarbures et des espèces apparentées du BLASTn database.
Procédures expérimentales – Partie II

LGM 35
Pseudomonas extremorientalis KMM 3447
LGM 36
Pseudomonas meridiana CMS 38
Pseudomonas antarctica CMS 35
LGM 29
Pseudomonas veronii CIP 104663
Pseudomonas trivialis P 513/19

Proteobacteria
Pseudomonas poae P 527/13
LGM 38
Pseudomonas lurida : DSM 15835
Pseudomonas costantinii CFBP 5705
Pseudomonas tolaasii LMG 2342
LGM 25
LGM 10
Pseudomonas fragi ATCC 4973
Pseudomonas psychrophila E-3
LGM 12

Proteobacteria
Pseudomonas lundensis ATCC 49968
Pseudomonas brenneri strain CFML 97-391
Pseudomonas proteolytica CMS 64
Pseudomonas panacis CG20106 Gammaproteobacteria
Pseudomonas migulae CIP 105470
LGM 30
LGM 2
LGM 5
LGM 14
LGM 27
LGM 26
LGM 20
LGM 40
LGM 48
LGM 31
LGM 22
Pseudomonas gessardii CIP 105469
Pseudomonas libanensis CIP 105460
LGM 11
Pseudomonas cedrina subsp. fulgida : DSM 14938 LMG 21467
Pseudomonas cedrina CFML 96-198
Acinetobacter radioresistens DSM 6976
Acinetobacter venetianus ATCC 31012
LGM 7
Acinetobacter lwoffii DSM 2403
LGM 24
Serratia fonticola DSM 4576
Serratia proteamaculans DSM 4543
Serratia grimesii DSM 30063
Bacillus subtilis subsp. subtilis DSM 10
Firmicutes
Firmicutes

Bacillus vallismortis DSM11031


Bacillus atrophaeus JCM9070 Bacillales
Bacillus amyloliquefaciens NBRC 15535
LGM 8
LGM 4

Les arbres ont été générés avec 1000 répétitions et les pourcentages (%) au niveau des nœuds représentent les valeurs de
probabilité de la robustesse de la similitude. Bar = 0.05 substitution de nucléotides par site. 118
Figure 28: Arbre phylogénétique par la méthode Neighbor-joining basée sur les séquences d’ADNr 16S
des souches LGM affiliées aux Protéobactéries et Firmicutes isolées du sol contaminé par les
hydrocarbures et des espèces apparentées du BLASTn database.
Procédures expérimentales – Partie II

1 2 3 4 5 6 7 P M

1000 bp
800 bp
600 bp

400 bp

Figure 29: Gel d’électrophorèse des produits PCR d’AlkB des souches sélectionnées.
M: SmartLadder 10000 bp DNA, P: Contrôle positif : Marinobacter carbonocalsticus
(EEM48), 1: souche LGM2, 2: LGM5, 3: LGM14, 4: LGM25, 5: LGM22, 6: LGM 27,
7: LGM26.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 P C- M

1500 bp
1000 bp
800 bp
600 bp
400 bp

200 bp

Figure 30: Gel d’électrophorèse des produits PCR de NahAc des souches sélectionnées.

M: SmartLadder 10000 bp DNA, P: Contrôle positif : Alcaniorax sp. EEM25, C- : Contrôle négatif, 1:
souche LGM 1, 2: LGM 52, 3: LGM 2, 4: LGM 3, 5: LGM 4, 6: LGM 7: LGM 53, 8: LGM 6, 9 :
LGM 54, 10 : LGM 55, 11 : LGM 7, 12 : LGM 8, 13 : LGM 10, 14 :LGM9.

119
Procédures expérimentales – Partie II

1 2 3 4 5 6 P 7 C- M

1500 bp
1000 bp
800 bp
600 bp

400 bp

200 bp

Figure 31: Gel d’électrophorèse des produits PCR de NidA des souches sélectionnées.

M: SmartLadder 10000 bp DNA, P: Contrôle positif Rhodococcus sp. (Cd1), C- : Contrôle négatif,
1: souche LGM 2, 2: LGM 4, 3: LGM 7, 4: LGM 8, 5: LGM 9, 6: LGM 10, 7: LGM 11, 7:LGM 12.

120
Procédures expérimentales – Partie II

Tableau 18: Résiduels hydrocarbures aromatiques polycycliques (mg/L) et % de


biodégradation par les souches sélectionnées. HAPs à haut poids moléculaire (50 mg/L)
et HAPs à bas poids moléculaire (100 mg/L) après 30 jours de culture.

Phénanthrène Pyrène Benzo [a] Pyrène

Contrôle moyenne concentration moyenne concentration moyenne concentration


s résiduelle (mg/l) / écart type % Biodégradation résiduelle (mg/l) / écart type % Biodégradation résiduelle (mg/l) / écart type % Biodégradation

T0 217,58 ± 0,2 230,58 ± 0,6 193,27 ± 0,04

AB 133,25 ± 0,8 48,29 ± 0,4 173,92 ± 1,2


Souches

LGM 2 116,63 ± 2,1 7,63 ± 0,9 35,74 ± 0,7 9,61 ± 0,5 146,45 ± 0,3 15,37 ± 0,1

LGM 10 109,94 ± 0,01 11,51 ± 0,007 35,38 ± 0,6 10,14 ± 0,4 150,3 ± 1,2 13,62 ± 0,6

LGM 12 111,58 ± 1,7 9,96 ± 0,8 36,62 ± 2,21 8,93 ± 1,6 146,28 ± 1,7 14,96 ± 1

LGM 8 122,31 ± 0,03 5,67 ± 001 38,72 ± 0,5 7,89 ± 1,02 120,76 ± 0,8 28,74 ± 0,4

LGM 4 131,35 ± 0,9 2,03 ± 1,7 39,95 ± 0,5 6,73 ± 0,7 114,67 ± 1,04 31,49 ± 0,5

LGM 60 132,31 ± 0,4 0±0 39,79 ± 0,9 6,78 ± 0,7 117,74 ± 3,7 31,63 ± 1,9

LGM 7 125,42 ± 1,3 3,59 ± 1,3 39,38 ± 0,7 7,42 ± 1,4 118,98 ± 3,7 30,13 ± 2,6

LGM 11 127,27 ± 0,7 2,75 ± 0,3 38,8 ± 0,2 7,83 ± 0,1 111,67 ± 3,2 33,93 ± 1,7

AB: contrôle abiotique

121
Procédures expérimentales – Partie II

Tableau 19: Résiduels alcanes (mg/L) et % de biodégradation par les souches


sélectionnées. (250mg/L) après 21 jours de culture.

Octadécane
Pristane Squalène

moyenne concentration moyenne concentration moyenne concentration


Contrôles résiduelle (mg/l) / écart type % Biodégradation résiduelle (mg/l) / écart type % Biodégradation résiduelle (mg/l) / écart type % Biodégradation

T0 533,54 ± 9,8 341,1 ± 1,06 368,88 ± 0,62

AB 435,6 ± 0,4 340,49 ± 0,91 380,94 ± 3,92


Souches
LGM 2 277,39 ± 0,9 29,65 ± 0,45 326,94 ± 0,31 4,47 ± 0,09 369,18 ± 1,49 1,44 ± 0,88

LGM 5 262,57 ± 3,7 32,42 ± 1,05 323,61 ± 0,36 4,95 ± 0,1 354,34 ± 6,62 3,94 ± 2,56

LGM 14 272,55 ± 2,5 30,56 ± 1,09 327,34 ± 0,52 4,68 ± 0,15 365,7 ± 1,83 3,18 ± 2,2

LGM 25 266,52 ± 1,5 31,68 ± 0,82 324,28 ± 0,5 5,25 ± 0,14 371,16 ± 2,77 0,69 ± 0,74
a
LGM 22 252,09 ± 2,4 35,11 ± 0,45 333,65 ± 1,93 ND 358,65 ± 6,08 4,46 ± 1,64

LGM 27 270,9 ± 0,9 31,53 ± 0,18 304,17 ± 2,65 13,29 ± 0,77 361,11 ± 1,18 2,1 ± 0,67
a
LGM 26 244,59 ± 0,01 33,25 ± 3,82 324,14 ± 1,93 5,51 ± 0,56 379,79 ± 6,97 ND
a
LGM 20 242,58 ± 0,4 34,41 ± 0,08 320,72 ± 1,28 7,11 ± 0,37 364,04 ± 0,8 1,5 ± 0,41

LGM 30 303,57 ± 2,9 23,47 ± 0,56 321,14 ± 1,03 6,15 ± 1,03 349,49 ± 5,32 8,22 ± 9,7

LGM 40 288,77 ± 10,8 27,51 ± 2,02 336,16 ± 3,76 ND 371,46 ± 4,78 ND

LGM 36 313,96 ± 1,6 22,8 ± 0,31 327,8 ± 1,72 4,18 ± 0,5 362,53 ± 1,81 ND

LGM 48 327,59 ± 1,6 20,24 ± 0,31 328,76 ± 2,42 6,84 ± 0,71 370,14 ± 1,32 ND

LGM 38 308,74 ± 1,1 23,77 ± 0,21 320,19 ± 1,08 6,16 ± 0,32 380,52 ± 0,45 ND

LGM 29 294,34 ± 0,5 26,47 ± 0,1 320,46 ± 1,08 5,87 ± 0,45 370,95 ± 3,85 ND

LGM 31 314,5 ± 0,5 22,69 ± 0,1 332,3 ± 1,68 2,84 ± 0,86 322,54 ± 28,54 21,33 ±,21,75

LGM 35 300,86 ± 5,9 25,25 ± 1,12 322,38 ± 4,2 6,56 ± 1,23 367,2 ± 4,07 1,24 ± 1,13

ND : non dégrader
AB: contrôle abiotique

122
Procédures expérimentales – Partie II

40
35
30
25
% Biodégradation du Benzo[a]Pyrène
20
15 % Biodégradation du Pyrène
10 % Biodégradation du Phénanthrene
5
0
LGM2 LGM10 LGM12 LGM8 LGM4 LGM60 LGM7 LGM11

Figure 32: Histogramme montrant la biodégradation (%) des aromatiques utilisés dans
cette étude par les souches les plus performantes.

40
35
30
25
20 % Biodegradation de l'Octadécane
15
% Biodegradation du Pristane
10
5 % Biodegradation du Squalène
0
LGM2
LGM5
LGM14
LGM25
LGM22
LGM27
LGM26
LGM20
LGM30
LGM40
LGM36
LGM48
LGM38
LGM29
LGM31
LGM35

Figure 33: Histogramme montrant la biodégradation (%) des alcanes utilisés dans cette
étude par les souches les plus performantes.

123
Chapitre III

CONCLUSIONS GÉNÉRALES & PERSPECTIVES


Conclusions et perspectives

L’objectif de notre travail était ambitieux puisqu’il visait à établir des relations entre la
composition (culture simple ou consortium) des bactéries sélectionnées, leur bagage
génétique permettant l’oxydation initiale des principaux types d’hydrocarbures et les
capacités de dégradation des hydrocarbures par ces bactéries hydrocarbonoclastes. Le
principal but était d’explorer la diversité des bactéries capables de dégrader les hydrocarbures
pétroliers à partir de la station de raffinerie d’Arzew afin de caractériser la réponse de
communautés bactériennes à une contamination pétrolière. Dans cette perspective, nous avons
abordé différents axes de recherche :

I) L’élaboration d’une collection de souches à partir de la flore tellurique autochtone.

II)L’identification par des méthodes ADN des bactéries hydrocarbonoclastes afin de mettre
en interactions les communautés associées à des concentrations élevées en hydrocarbures
pétroliers choisis.

III) Le suivi de la biodégradation par chromatographie en réponse à une contamination


pétrolière afin de mesurer la capacité de dégradation des bactéries sélectionnées en réponse à
l’effet polluant ou stimulant de l’hydrocarbure.

IV) L’étude et détection de gènes fonctionnels impliqués dans la dégradation des


hydrocarbures choisis chez les bactéries sélectionnées afin de mettre en évidence des
mécanismes adaptatifs mis en place par certaines bactéries en réponse à la contamination.

V) Dépôt des séquences de l’ADNr16S dans une banque universelle.

Cette étude a été menée sur les communautés bactériennes présentes dans les sols de la
raffinerie de la région d’Arzew en Algérie. Ces sols sont soumis depuis plusieurs décennies à
une contamination en hydrocarbures chronique et élevée. Ils constituent ainsi un modèle de
choix pour comprendre les mécanismes microbiens impliqués dans la réponse à la présence
d’hydrocarbures. En effet, ces populations bactériennes sont supposées posséder les systèmes
enzymatiques permettant de répondre à la contamination.
Afin de mettre en évidence la réponse adaptative précoce, un intérêt tout particulier a été
apporté aux composés récalcitrants (alcanes ramifiés et aromatiques lourds) et à l’étude des
mécanismes mis en place par la communauté bactérienne pendant quelques semaines (2 à 4)
selon la contamination.
Ces différentes études ont fait appel à l’utilisation de techniques de biologie moléculaire afin
d’accéder à l’identification précise des microorganismes dominants (extraction ADN, PCR,
séquençage, analyse par bioinformatique, élaboration d’arbres phylogénétiques et dépôt de
séquences dans la banque de données universelle ‘GenBank’) couplées à des méthodes
analytiques chimiques (CPG/FID et TLC/FID) permettant le dosage résiduel des
hydrocarbures.
L’atténuation naturelle d’une pollution désigne l’ensemble des processus qui concourent à la
réduction de la pollution sur le site considéré. Il s’agit essentiellement de la migration des
polluants sous toutes leurs formes, mais aussi de la biodégradation.

125
Conclusions et perspectives

L’évaluation de l’atténuation naturelle dans un site pollué défini est un objectif essentiel. En
effet, elle vise à prévoir le devenir de cette pollution pour en tirer les conclusions relatives aux
actions à entreprendre. D’autre part, si une action de réhabilitation doit voir le jour, elle
permet de proposer un type de traitement et ses modalités principales.

Plusieurs points de conclusion peuvent être tirés de ce travail :

Méthode d’étude de la diversité microbienne des microflores


Une méthode basée sur le séquençage des échantillons d’ADNr 16S de la population
bactérienne a été principalement utilisée pour étudier la biodiversité microbienne des
microflores dégradatrices. Cette méthode permet une analyse fine de la diversité des
environnements complexes, en multipliant le nombre de séquences analysées.
L’échantillonnage effectué doit en effet être suffisamment important pour donner une bonne
image de la diversité. Il convient également de porter un intérêt particulier à l’échantillonnage
à la méthode de conservation des échantillons, ainsi qu’aux protocoles adaptés pour
l’éxtraction de l’ADN.

Mesure des capacités de dégradation des microflores


Une approche méthodologique reprenant en partie celle qui avait été mise au point pour
mesurer les capacités de dégradation des microflores vis-à-vis de l'essence a été utilisée
(Solano-Serena et al., 1999). Le test de mesure des capacités de dégradation sur les
hydrocarbures est conduit en présence d’oxygène. Le pétrole et rejet industriel sont alors
l’unique source de carbone disponible pour la microflore bactérienne. La mise au point du test
a consisté à optimiser deux facteurs : la quantité initiale de substrat choisis et le mode
d’apport de la microflore bactérienne. La microflore bactérienne a été introduite sous forme
d’interaction simple d’une part et complexe (consortuim) d’autre part. Le paramètre suivi au
cours de l'incubation est la concentration des hydrocarbures résiduels. La méthodologie
utilisée s'est avérée tout à fait pertinente puisque le taux de recouvrement des hydrocarbures
mesuré sur les fioles abiotiques après incubation est généralement supérieur à 80 %.
L’utilisation d’un standard interne (nC19) pour le dosage des hydrocarbures résiduels par
CPG/FID permet une bonne estimation de ces derniers (Vinas et al., 2002).
La séparation des principales familles d'hydrocarbures obtenue par TLC/FID en
utilisant des microcolonnes de silice est convenable pour accéder aux informations concernant
la biodégradabilité intrinsèque des différentes familles chimiques du pétrole. Même s’il est
possible de déterminer une réponse spécifique moyenne pour des familles de composés tels
que les composés saturés (alcanes) et les hydrocarbures aromatiques, il existe à l'intérieur de
chaque famille une variation significative de l'indice de réfraction pour les hydrocarbures
considérés individuellement (Brito et al., 2006). En effet en l'état actuel, la technique de
TLC/FID ne peut donc fournir que des informations globales sur les classes structurales des
composés qui sont dégradés ou qui, à l'inverse, sont récalcitrants. Les progrès attendus de la
CPG/FID dans les années futures devrait permettre d’atteindre cet objectif, dès lors que la
détection par spectrophotométrie de masse sera utilisable GC/MS.

126
Conclusions et perspectives

Biodégradabilité intrinsèque du pétrole et ses dérivés


Plusieurs études avaient déjà été effectuées sur la biodégradabilité d'un produit pétrolier tel
que le pétrole et ses dérivés qui constituent des polluants potentiels des eaux et des sols. Les
performances de dégradation obtenues ici en utilisant des perélèvements de la flore téllurique
de sols contaminés corroborent avec les résultats précédemment publiés par Marquez-Rocha
et al. (2001), une biodégradabilité moindre s’explique par l’accessibilité restreinte des micro-
organismes pour les hydrocarbures les plus lourds. Nos résultats indiquent que le groupe
Gamma-Protéobactéries était le principal acteur de cette dégradation, Pseudomonas sp.
groupe bactérien majoritaire spécifique adapté à la pollution aux hydrocarbures pétroliers
(Rocha et al, 2011) a la capacité de métaboliser (en culture simple) certains hydrocarbures
récalcitrants (alcanes ramifiés tel le Pristane à 35.11% et les aromatiques lourds tel le
Benzo[a]Pyrène à 33.93%) et de cométaboliser (en consortium) les différentes fractions du
pétrole brut à 50.44% pour les saturés et à 30.42% pour les aromatiques polycycliques.
La récalcitrance relative des différents hydrocarbures présents dans le pétrole est illustrée par
les différents tests de dégradation effectués individuellement au cours de cette étude.
Les hydrocarbures récalcitrants sont principalement les alcanes branchés et les aromatiques
(Rontani et al., 1986). Ceci a été vérifié avec certains composés branchés repérables sur les
chromatogrammes CPG/FID tels que le Pristane. En effet, la dégradation de ceux-ci est
beaucoup plus lente que celle des n-alcanes.
Ces données ont également été confirmées par l’utilisation de la TLC/FID, la
détermination qualitative et quantitative des hydrocarbures selon leur nombre d’atomes de
carbone et leur famille chimique ainsi sur la comparaison des cartographies d’échantillons
restent des éléments importants pour juger de l’efficacité de dégradation d’un type de
microflore. Les composés les plus réfractaires à la biodégradation sont des composés saturés
(cyclo et iso-alcanes) contenant entre C16 et C23 atomes de carbone et les aromatiques lourds à
plus de quatre-benzène (Thangaraj et al., 2008).

Composition des microflores dégradatrices


La méthode basée sur le séquençage des gènes codant l’ARNr 16S a été utilisée pour étudier
la diversité de la microflore bactérienne du sol contaminé. La banque « Bacteria » a été
analysée pour la microflore sol et recense 17 OTUS. Le groupe prédominant dans la banque
de clones d’ADNr 16S est celui des Protéobactéries, constituant 67 % des séquences
obtenues. La classe des Gamma-Protéobactéries est la plus abondante. Des résultats
similaires ont été obtenus lors de l’étude de la diversité microbienne d’une boue de station
d’épuration où les Protéobactéries représentaient 60 % des OTUs retrouvées (Chouari, 2003).
Ce groupe phylogénétique est d’ailleurs reconnu comme un élément très important des
écosystèmes tels que les boues de stations d’épuration (Snaidr et al., 1997).
La prévalence des bactéries à Gram négatif, et en particulier des Protéobactéries, dans la
microflore de sol pollué, est en accord avec les résultats précédemment décrits dans la
littérature (Margesin et al., 2003). Ceci peut nous laisser supposer que les Protéobactéries
jouent un rôle important dans la dégradation des hydrocarbures. L’analyse phylogénétique a
également permis de mettre en évidence la présence de division ayant peu de représentants
cultivables, comme les Firmicutes (24.18%) et les Actinibactéries 7.3%).

127
Conclusions et perspectives

L’utilisation de différents substrats, représentatifs des grandes classes structurales intervenant


dans la composition du pétrole, a permis la sélection de micro-organismes particuliers à
chaque microflore adaptée. En effet, chaque genre bactérien sélectioné présente une
composition en OTUs qui lui est propre.

Détection de gènes de dégradation


Dans une optique de bioremédiation, l’analyse fonctionnelle des microflores, et donc des
gènes intervenant dans les processus de dégradation est un paramètre clé, Il existe à ce jour
peu d’informations sur la prévalence et la distribution géographique des populations
dégradant les hydrocarbures (Margesin et al., 2003; Sotsky et al., 1994).
Lors de cette étude, différents gènes intervenant dans l’attaque initiale des hydrocarbures ont
été choisis. Il s’agit des gènes alkB, nahAc et nid A. La grande diversité de ces gènes rend
difficile leur détection au sein de microflores complexes ou de souches isolées. En effet, il a
été montré que leur séquence nucléotidique est très peu conservée (Paisse et al., 2011).
Il est cependant intéressant de remarquer que le gène alkB était présent chez 16 espèces de
Pseudomonas sp. Pour les gènes nahAc et le nid A, on a rencontré des difficultés à les
détecter chez les souches sélectionnées. Ces observations confortent le manque certain de
connaissance dont nous disposons pour étudier les gènes de dégradation. Les gènes
recherchés peuvent alors : i) ne pas être détectés (manque de sensibilité de la méthode, trop de
divergence avec les amorces utilisées), ii) ne pas être présents au sein des microflores de
souches isolées.
Beaucoup de voies métaboliques de dégradation empruntées sont en effet encore inconnues.
Ce ne sont par ailleurs pas forcément les micro-organismes les plus représentés dans les
banques des souches bactériennes identifiées par l’ADNr 16S qui sont les plus actifs au sein
d’un écosystème. Les capacités de dégradation sont probablement dispersées au sein de ces
microflores. Beaucoup de gènes identifiés jusqu'à maintenant semblent par ailleurs situés sur
des plasmides. Il existe probablement de nombreux cas de transferts horizontaux entre
microorganismes qui favoriseraient le transfert des capacités de dégradation au sein d’une
microflore. Il est également évident, que
i) les couples d’amorces développés ici ne permettent pas forcément la détection des gènes
choisis pour l’étude,
ii) la séquence de nombreux gènes de dégradation est encore inconnue,
iii) les informations sur l’organisation des gènes de dégradation au sein de la cellule ne sont
pas forcément connues,
iv) l’impact réel des phénomènes d’interactions entre souches comme le cométabolisme reste
difficile à évaluer.
Tous ces éléments limitent encore la mise en évidence de relations entre gènes de
dégradation et performances des microflores et donc la compréhension du fonctionnement de
communautés bactériennes complexe dégradant les hydrocarbures. L’efficacité de la
biodégradation des microflores est liée à la présence de voies métaboliques particulières chez
certains micro-organismes et à la coopération entre les différents micro-organismes
composant ces microflores. Ainsi, la caractérisation de nouveaux gènes et donc la mise en
évidence de mécanismes adaptatifs nous permettrait de mieux appréhender la réponse des
communautés bactériennes à une contamination pétrolière.

128
Conclusions et perspectives

Les informations disponibles sur les enzymes impliquées dans les voies de dégradation
des HAPs sont assez fragmentaires, sauf pour les HAPs modèles comme le phénanthrène ou
le naphtalène (Seo et al., 2009). De plus, celles-ci ne sont disponibles que pour des
microorganismes généralement cultivables et isolés. Or les microorganismes épurateurs
agissent le plus souvent en consortia au sein des environnements pollués, et beaucoup d’entre
eux ne peuvent être isolés et étudiés facilement. De plus, ces consortia possèdent des
capacités de dégradation plus importantes que les microorganismes isolés (Molina et al.,
2009; Vila et al., 2010). Obtenir plus d’informations sur ces consortia permettrait de franchir
une nouvelle étape dans la compréhension des capacités de biodégradation des HAPs, et donc
d’améliorer les techniques de bioremédiation.
L’évaluation de la bioremédiation peut être étudiée par les techniques d’empreintes
génétiques appliquées aux gènes de dégradation. Le polymorphisme des gènes considérés est
alors détecté par restriction enzymatique et examen des profils de restriction après
amplification génique. Enfin, l’avènement des approches indépendantes de la culture
(métagénomique) pourrait donner un nouvel élan à des approches d’isolement des
microorganismes, qui représentent le moyen le plus direct et le plus opérationnel de tirer parti
sur le plan biotechnologique de la richesse microbiologique à partir d’échantillons
d’environnement pollué.
Chaque méthode apporte un éclairage partiel de la diversité des communautés bactériennes et
leur combinaison est susceptible de fournir une image plus réaliste de sa complexité
(Bombach et al., 2010; Hill et al., 2000).

D’un point de vue plus appliqué, les résultats obtenus pourraient permettre de développer des
outils de diagnostic et de suivi des sites contaminés par les hydrocarbures pétroliers ou rejet
industriel. Connaissant les séquences d’ADNr 16S des bactéries dégradant les HAPs et les
alcanes, on peut envisager de les détecter in situ par qPCR en fonction des conditions
environnementales.

Les études de biodégradabilité de produits tels que les produits pétroliers ont pour but de
répondre à une série de questions. Elles doivent notamment donner la possibilité de pouvoir
juger, en cas de déversements accidentels, si les chances d’atténuation naturelle de la
pollution sont réelles. La microflore indigène de sol et aquatique sur laquelle survient un
déversement constitue l’acteur principal du processus d’atténuation naturelle. C’est la raison
pour laquelle, il est important d’avoir une bonne vision des relations existant entre la
composition bactérienne d’une microflore et son aptitude à dégrader le polluant. Appliqué à la
gestion des bassins de traitement des eaux rejetées polluées, un tel suivi permettrait de mieux
comprendre le système de traitement des eaux contaminées par les hydrocarbures pétroliers et
d’améliorer l’efficacité du traitement par bioremédiation.

129
RÉFÉRENCES BIBLIOGRAPHIQUES
Références bibliographiques

Abed R.M.M., Al-Thukair A., De Beer D. (2006). Bacterial diversity of a cyanobacterial


mat degrading petroleum compounds at elevated salinities and temperatures. FEMS
Microbiology Ecology. 57: 290-301.
Abed R.M.M., Zein B., Al-Thukair A., De Beer D. (2007). Phylogenetic diversity and
activity of aerobic heterotrophic bacteria from a hypersaline oil-polluted microbial mat.
Systematic and Applied Microbiology. 30: 319-330.
Abedelly C. (2007). Bioremédiation/Phytoremédiaton. Thèse. Département des sciences
naturelles. Institute supérieur de l’éducation et de la formation continue. Université de Tunis.
Alemzadeh I., Vossoughi M. (2001). Biodegradation of toluene by an attached biofilm in a
rotating biological contactor. Process Biochemistry 36, 707-711.
Allen C.R., Boyd D.R., Larkin M.J., Reid K.A., Sharma N.D., Wilson K. (1997).
Metabolism of naphthalene, I-naphtol, idene and indole by Rhodococcus strain NCIMB
123038. App. Environ Microbiol. 63: 151-155.
Alvarez H. M., Souto M. F., Viale A., Pucci O. H. (2001). Biosynthesis of fatty acids and
triacylglycerols by 2,6,10,14-tetramethyl pentadecane-grown cells of Nocardia globerula 432.
FEMS Microbiol. Lett .200:195-200.
Amann R.I., Ludwig W., Schleifer K.H. (1995). Phylogenetic identification and in situ
detection of individual microbial cells without cultivation. Microbiological Reviews. 59: 143-
169.
Amann R., Ludwig W. (2000). Ribosomal RNA-targeted nucleic acid probes for studies in
microbial ecology. FEMS Microbiol. Rev. 24: 555- 565.
Amund O.O., Adewale A.A., Ugoji O.E. (1987). Occurrence and characterization of
hydrocarbon utilizing bacteria in Negerian soils contaminated with spent motor oil. Indian J.
of Microbiol. 27: 63-68.
Andreoni V., Gianfreda L. (2007). Bioremediation and monitoring of aromatic-polluted
habitats. Appl. Microbiol. Biot. 76: 287-308.
Andreoni V.L., Cavalca M.A., Rao G., Nocerino S., Bernasconi E., Dell'Amico M.,
Colombo., Gianfreda L. (2004). Bacterial communities and enzyme activities of PAHs
polluted soils. Chemosphere 57(5): 401-412.
Anzai Y., Kim H., Park J.Y., Wakabayashi H., Oyaizu H. (2000). Phylogenetic affiliation
of the Pseudomonads based on 16S rRNA sequence. Int. J. Syst. Evol. Microbiol. 50(4):1563–
1589.
Atlas R. M. (1981). Microbial degradation of petroleum hydrocarbons: an environmental
perspective. Microbiol Rev. 45: 180-209.
Atlas R.M., Atlas M.C (1991). Biodegradation of oil and bioremediation of oil spills. Curr.
Opin. Biotechnol. 2: 440-443.
Babla M.T., Al-Awadhi N., Al-Daher R. (1998). Bioremediation of oil-contaminated soil:
microbiological methods for feasibility assessment and field evaluation. J. Microbiol.
Methods 32:155-164.
Baheri H., Meysami P. (2001). Feasibility of fungi bioaugmentation in composting a flare pit
soil. J. Hazard Mater. 89: 279-286.
Bakker M.I., Casado B., Koerselman J.W., Tolls J., Kollöffel C. (2000). Polycylic
aromatic hydrocarbons in soil and plant samples from the vicinity of an oil refinery. The
Science of the Total Environment. 263: 91-100.

131
Références bibliographiques

Ballerini D., Gatellier C., Vogel T. (1998). Techniques de traitement par voie biologique des
sols pollués, ADEME Editions, 198 p.
Barathi S., Vasudevan N. (2001). Utilization of petroleum hydrocarbons by Pseudomonas
fluorescens isolated from a petroleum-contaminated soil. Environ. Int. 6:413–416.
Barns S. M., Takala S. L., Kuske C. R. (1999). Wide distribution and diversity of members
of the bacterial kingdom Acidobacterium in the environment. Appl. Environ. Microbiol. 65 :
1731-1737.
Barriuso E., Calvet R., Schiavon M., Soulas G. (1996). Les pesticides et les polluants
organiques dans les sols. Etude et Gestion des Sols, n° spécial : Forum "Le sol, un patrimoine
menace ?", 3 : p. 279-295.
Barriuso E., Soulas G., Schiavon M. (2000). Rétention et dégradation des pesticides dans
les sols. Hydrogeologie, 1: p. 49-56.
Baudouin C., Charveron M., Tarroux R., Gall Y. (2002). Environmental pollutants and
skin cancer. Cell. Biol. Toxicol. 18: 341-348.
Bernheim Y. (1999).Typologie des techniques de réhabilitation des sites pollués. Techniques
de l’ingénieur Environnement. ISSN 1282- 9080. Source, vol. G2, noG2600, pp. G2600.1-
G2600.4
Bertrand A.R., Briant J., Castela A., Degobert P., Gatellier C., Masson M., Oudin J.L.,
Poittier J. (1972). Prévention et lutte contre la pollution au cours des opérations de forage et
de production en mer. Oil and Gas Energy Booksellersince.
Bertrand J.C., Mille G. (1989). Devenir de la matière organique exogène. Un modèle: les
hydrocarbures. In Microorganismes dans les écosystèmes océaniques. Bianchi M. (ed). Paris:
Masson, pp. 343-385.
Besombes J.L., Maître A., Patissier O., Marchand N., Chevron N., Stoklov M., Masclet
P. (2001). Particulate PAHs observed in the surrounding of a municipal incinerator.
Atmospheric Environment, 35: 6093-6104.
Bhupathiraju V.K., Hernandez M., Landfear D., Alvarez-cohen L. (1999). Application of
a tetrazolium dye as an indicator of viability in anaerobic bacteria. J. Microbiol. Methods 37:
231-243.
Binazadeh M., Karimi I.A., Li Z. (2009). Fast biodegradation of long chain n-alkanes and
crude oil at high concentration with Rhodococcus sp. Moj-3449. Enzyme Microb. Tech. 45:
195-202.
Boldrin B., Tiehm A., Fritzsche C. (1993). Degradation of phenanthrene, fluorene,
fluoranthene, and pyrene by a Mycobacterium sp. Appl. Environ. Microbiol. 59 : 1927-1930.
Bordenave S., Goñi-Urriza M.S., Caumette P., Duran R. (2007). Effects of Heavy fuel oil
on the bacterial community structure of a pristine microbial mat. Appl. Environ. Microbiol.
73: 6089-6097.
Boonchan S., Britz M. L., Stanley G.A. (1998). Surfactant-enhanced biodegradation of high
molecular weight polycyclic aromatic hydrocarbons by Stenotrophomonas maltophilia.
Biotechnol. Bioeng. 59(4): 482-494.
Boonchan S., Britz ML., Stanley G.A. (2000). Degradation and mineralization of
highmolecular-weight polycyclic aromatic hydrocarbons by defined fungal-bacterial
cocultures. Appl. Environ. Microbiol. 66: 1007-1019.

132
Références bibliographiques

Bosch R., Garcia-Valdes E., Moore E.R. (1999). Genetic characterization and evolutionary
implications of a chromosomally encoded naphthalene-degradation upper pathway from
Pseudomonas stutzeri AN10. Gene 236: 149-57.
Bouaid A., Martínez M., Aracil J. (2010). Biorefinery approach for coconut oil valorisation:
A statistical study. Bioresour Technol 101: 4006–4012
Bouchez M., Blanchet D., Vandecasteele J. P. (1995). Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations: inhibition phenomena and
cometabolism. Appl. Microbiol. Biotechnol. 43: 156-164.
Bouchez-Naitali M., Rakatozafy H., Marchal R., Leveau J.Y., Vandecasteele J. P. (1999).
Diversity of bacterial strains degrading hexadecane in relation to the mode of substrate
uptake. J. Appl. Microbiol. 86 : 421-428.
Boudjillouli H. (2001). Programme de Réhabilitation des Raffineries Pour la production des
carburants propres en Algérie. Journées d’études les 16 et 17 Novembre 2001.
Bouharis A. (2005). Description de la raffinerie d’arzew, rapport de stage, Arzew.
Boutefnouchet N., Bouzerna N., Chettibi H. (2005). Assessment of the petrochemical
industry pollution on the skikda Bay Algeria. Int. J. Res. Public Health (2)3:463-468.
Brito E.M.S., Guyonraud Remy, Goni-Urriza M., Ranchou-Peyruse A., Verbaere A.,
Crapez M.A.C., Wasserman J.C.A., Duran R. (2006). Characterization of
hydrocarbonoclastic bacterial communities from mangrove sediments in Guanabara Bay,
Brazil. Research in Microbiol 157: 752-762.
Brooijmans R.J.W., Pastink M.I., Siezen R.J. (2009). Hydrocarbon-degrading bacteria: the
oil-spill clean-up crew. Microbial. Biotechnol. (2)6:587–594.
Bugg T.J.M., Foght M.A., Pickard Gray M.R. (2000). Uptake and Active Efflux of
Polycyclic Aromatic Hydrocarbons by Pseudomonas fluorescens LP6a. Appl. Environ.
Microbiol. 66(12): 5387-5392.
Bundy J. G., Paton G. I., Campbell C. D. (2002). Microbial communities in different soil
types do not converge after diesel contamination. J. Appl. Microbiol. 92: 276-288.
Carmichael L.M., Christman R.F., Pfaender F.K. (1997). Desorption and mineralization
kinetics of phenanthrene and chrysene in contaminated soils. Environmental Science and
Technology, 31, p. 126- 132.
Cavalca L., Dell'Amico E., Andreoni V. (2004). Intrinsic bioremediability of an aromatic
hydrocarbon-polluted groundwater: diversity of bacterial population and toluene
monooxygenase genes. Environ. Biotechnol. 64 :576-587.
Cavalier J.F., Lafont D., Boullanger P., Houisse D., Giallo J., Ballester J.M., Carriere F.
(2009). Validation of lipolysis product extraction from aqueous/biological samples, separation
and quantification by thin-layer chromatography with flame ionization detection analysis
using O-cholesteryl ethylene glycol as a new internal standard. J. Chromatogr. A.1216: 6543-
6548.
Cerniglia, C. E. (1984b). Microbial transformation of aromatic hydrocarbons. New York:
Atlas RM (Ed) Mc Millan Publishers.
Cerniglia C.E. (1992). Biodegradation of polycyclic aromatic hydrocarbons. Biodegradation.
3: 351-368.

133
Références bibliographiques

Cébron A., Norini M. P., Beguiristain T., Leyval C. (2008). Real-time PCR quantification
of PAH ring hydroxylating dioxygenase (PAH-RHD) genes from Gram positive and Gram
negative bacteria in soil and sediment samples. J. Microbiol. Meth. 73 : 148-159.
Chaillan F., Le Fléche A., Bury E., Phantavong Y.H., Grimont P., Saliot A., Oudot J.
(2004). Identification and biodegradation potential of tropical aerobic hydrocarbon-degrading
microorganisms. Research in Microbiology. 155: 587-595.
Chaillan F., Gugger M., Saliot A., Coute A., Oudot J. (2006). Role of cyanobacteria in the
biodegradation of crude oil by a tropical cyanobacterial mat. Chemosphere. 62: 1574-1582.
Chang W., Um Y., Hoffman B., Pulian Holoman T. R. (2005). Molecular characterization
of polycyclic aromatic hydrocarbon (PAH)-degrading methanogenic communities. Biotechnol
Prog 21(3):682-688.
Champagnat N., ADRIAN A., (1974). Pétrole et protéines. Doin. Paris.
Cheng K., Zhao Z., Wong J. (2004). Solubilization and desorption of PAHs in soilaqueous
system by biosurfactants produced from Pseudomonas aeruginosa P-CG3 under thermophilic
condition. Environmental Technology 25(10): 1159-1165.Chikere C.B., Okpokwasili G.H.,
Chikere B.O. (2011). Monitoring of microbial hydrocarbon remediation in the soil.
Biotechnol. 1:117–138.
Chikere C.B., Chikere B.O., Okpokwasili G.C. (2012). Bioreactor-based bioremediation of
hydrocarbon-polluted Niger Delta marine sediment, Nigeria. Biotechnol. 2(1):53-66.
Christopher W.K., Christopher L.K. (2004). Bacterial succession in a petroleum land
treatment unit. App. Environ Microbiol. 70: 1777-1786.
Cole J.R., Konstantinidis K., Farris R.J., Tiedje J.M. (2010). Microbial diversity and
phylogeny: extending from rRNAs to genomes. In: Liu WT and Jansson JK (eds).
Environmental Molecular Microbiology. Caister Academic Press. pp 1-19.
Cooney J.J., Silver S.A., Beck E.A. (1985). Factors influencing hydrocarbon degradation in
three freshwater lakes. Microbial Ecol. 11(2):127–137.
Coppotelli B., Ibarrolaza A., Del Panno M., Morelli I. (2008). Effects of the Inoculant
Strain Sphingomonas paucimobilis 20006FA on Soil Bacterial Community and
Biodegradation in Phenanthrene-contaminated Soil. Microbial Ecology. 55(2): 173-183.
Daane L.L., Harjono I., Zylstra G.J., Haggblom M.M. (2001). Isolation and
charcterization of polycyclic aromatic hydrocarbon-degrading bacteria associated with the
rhizosphere of salt marsh plants. Appl. Environ. Microbiol. 67: 2683-2691.
Dandie C.E., Thomas S.M., Bentham R.H., McClure N.C. (2004). Physiological
characterization of Mycobacterium sp. strain 1B isolated from a bacterial culture able to
degrade high-molecular-weight polycyclic aromatic hydrocarbons. J. Appl. Microbiol.97:246-
255.
Das N., Chandran P. (2011). Microbial Degradation of Petroleum Hydrocarbon
Contaminants: An Overview. Biotechnol. Res. Int. Article ID 941810, 13 pages.
Das K., Mukherjee A.K. (2007). Differential utilization of pyrene as the sole source of
carbon by Bacillus subtilis an Pseudomonas aeroginosa strains: role of biosurfactants in
enhancing bioavailability. J. Appl. Microbiol. 102: 195-203.
Daugulis A.J., Janikowski T.B., (2002). Scale-up performance of a partitioning bioreactor
for the degradation of polyaromatic hydrocarbons by Sphingomonas aromaticivorans.
Biotechnology Letters 24:591-594.

134
Références bibliographiques

De Nardi I.R., Zaiat M., Foresti E. (2006). Kinetics of BTEX degradation in a packed-bed
anaerobic reactor. Biodegradation 7:1-8.
De Oteyza T.G., Grimalt J.O., Llirós M., Esteve I. (2006). Microcosm experiments of oil
degradation by microbial mats. Science of the Total Environment. 357: 12-24.
Demaneche S., Meyer C., Micoud J., Louwagie M., Willison,J.C., Jouanneau Y. (2004).
Identification and functional analysis of two aromatic-ring-hydroxylating dioxygenases from
a Sphingomonas strain that degrades various polycyclic aromatic hydrocarbons. Applied And
Environmental Microbiology 70: 6714-6725.
Denome S., Stanley D., Olson E., Young K. (1993). Metabolism of dibenzothiophene and
naphthalene in Pseudomonas strains: complete DNA sequence of an upper naphthalene
catabolic pathway. Journal of Bacteriology 175:6890-6901.
Deppe U., Richnow H.H., Michaelis W., Antranikian G. (2005). Degradation of crude oil
by an arctic microbial consortium. Extremophiles 9(6):461-70.
Desai C., Madamwar D. (2006). Extraction of inhibitor-free metagenomic DNA from
polluted sediments, compatible with molecular diversity analysis using adsorption and ion-
exchange treatments. Bioresource Technol 98: 761-768.
Devriese L.A., Pot B., Van Damme L., Kersters K., Haesebrouk F. (1995). Identification
of enterococcus species isolated from foods of animal origin. Int. J. Food Microbiol 26:187-
197.
Diaz E. (2004). Bacterial degradation of aromatic pollutants: a paradigm of metabolic
versatility. Int. Microbiol. 7: 173-180.
Dojka M.A., Hugenholtz P., Haack S. K., Pace N. R. (1998). Microbial diversity in a
hydrocarbon- and chlorinated-solvent contaminated aquifer undergoing intrinsic
bioremediation. Appl. Environ. Microbiol. 64: 3869- 3877.
Duque E., Segura A., Mosqueda G., Ramos J. L. (2001). Global and cognate regulators
control the expression of the organic solvent efflux pumps TtgABC and TtgDEF of
Pseudomonas putida. Molecular Microbiology. 39: 1100-1106.
Eaton R. W., Chapman P. J. (1992). Bacterial metabolism of naphthalene: construction and
use of recombinant bacteria to study ring cleavage of 1, 2-dihydroxynaphthalene and
subsequent reactions. J. Bacteriol. 174: 7542-8554.
Eaton R.W. (1994). Organization and evolution of naphthalene catabolic pathways:
Sequence of the DNA encoding 2- hydroxychromene-2-carboxylate isomerase and trans-o-
hydroxybenzylidenepyruvate hydratase-aldolase from the NAH7 plasmid. Journal of
Bacteriology. 176: 7757-7762.
Erikson M., Sodersten E., Yu Z., Dalhammar G., Mohn W. W. (2003). Degradation of
Polycyclic Aromatic Hydrocarbons at Low Temperature under Aerobic and Nitrate-Reducing
Conditions in Enrichment Cultures from Northern Soils. Appl. Environ. Microbiol. 69(1) :
275-284.
Evans F.F., Rosado A.S., Sebastián G.V., Casella R., Machado P.L., Holmström C.,
Kjelleberg S., Elsas J.D., Seldin L. (2004). Impact of oil contamination and biostimulation
on the diversity of indigenous bacterial communities in soil microcosms. FEMS Microbiology
Ecology. 49: 295-305.

135
Références bibliographiques

Fall R. R., Brown J. L., Schaeffer T. L. (1979). Enzyme recruitment allows the
biodegradation of recalcitrant branched hydrocarbons by Pseudomonas citronellis. Appl.
Environ. Microbiol. 38, 715-722.
Farhadian M., Vachelard C., Duchez D., Larroche C. (2008). In situ bioremediation of
monoaromatic pollutants in groundwater: A review. Bioresource Technology 99 :5296-5308.
Feix I., Wiart J. (1995). Les micropolluants organiques dans les boues résiduaires de stations
d'épuration urbaines. ADEME, Angers, 191.
Fent K. (2004). Ecotoxicological effects at contaminated sites, Toxicology, 205: 223-240.
Ferrari B.C., Binnerup S.J., Gillings M. (2005). Microcolony cultivation on a soil substrate
membrane system selects for previously uncultured soil bacteria, Appl. Environ. Microbiol.
71: 8714-8720.
Fiorella P.D., Spain J.C. (1997). Transformation of 2, 4, 6-Trinitrotoluene by Pseudomonas
pseudoalcaligenes. Appl. Environ. Microbiol. 63:2007-2015.
Fuenmayor S.L., Wild M., Boyes A.L., Williams P.A. (1998). A gene cluster encoding
steps inconversion of naphthalene to gentisate in Pseudomonas sp. strain U2. J. Bacteriol.
180: 2522-2530.
Gabet S., (2004). Remobilisation d'Hydrocarbures Aromatiques Polycycliques (HAP)
présents dans les sols contaminés à l'aide d'un tensioactif d'origine biologique. Thèse de
doctorat de l’universite de Limoges, spécialité Chimie et Microbiologie de l'Eau, p. 177.
Gatellier C. (1970). La microbiologie du pétrole. Revue de l’institut français de pétrole. 25:
04.
Genney D. R., Alexander I. J., Killham K., Meharg A.A. (2004). Degradation of the
polycyclic aromatic hydrocarbon (PAH) fluorene is retarded in a Scots pine
ectomycorrhizosphere. New Phytol. 163: 641-649.
Gentile G., Giuliano L., D’Auria G., Smedile F., Azzaro M., De Domenico M., Yakimov
M.M. (2006). Study of bacterial communities in Antarctic coastal waters by a combination of
16S rRNA and 16S rDNA sequencing. Environ Microbiol. 8: 2150– 2161.
George K.W., Hay A.G. (2011). Bacterial Strategies for Growth on Aromatic Compounds.
Adv. Appl. Microbiol. 74: 1-33.
Germain A., Ringuette S., Tremblay J. (1995). Use of a phenanthrene to benzo(e)pyrene
ambient air ratio as an indicator for the source of polycyclic aromatic hydrocarbons. Comptes
rendus de 1994 U.S. EPA/A&W MA International Symposium: Measurement of toxic and
related air pollutants, 17 p.
Gevers D., Huys G., Swings J. (2001). Applicability of rep-PCR fingerprinting for
identification of Lactobacillus species. FEMS. Microbiol. Lett. 205:31-36.
Ghouas H., Haddou B., Bouabdesselam H., Bouberka Z., Derriche Z. (2010). Elimination
of fuel spills from effluent using cloud point extraction methods. Chemosphere 81:925-931.
Gibson D.T., Parales R.E. (2000). Aromatic hydrocarbon dioxygenases in environmental
biotechnology. Current Opinion in Biotechnology. 11: 236-243.
Gilbert T.T., Nirmalakhandan N., Jorge L.G.T. (2005). Kinetic evaluation of a field-scale
activated sludge system for removing petroleum hydrocarbons from oilfield-produced water.
Environmental Progress 24: 96-104.

136
Références bibliographiques

Girard M., Walter C., Remy C., Berthelin N., More L. (2005). Sol et environnement,
exercices et études de cas. Dunod. P. 799.
Goswami P., Singh H. D. (1991). Different modes of hydrocarbon uptake by two
Pseudomonas species. Biotechnology and Bioengineering 37: 1-11.
Gojgic-Cvijovic G.D., Milic J.S., Solevic T.M., Beskoski V.P., Ilic M.V., Djokic L.S.,
Narancic T.M., Vrvic M.M. (2011). Biodegradation of petroleum sludge and petroleum
polluted soil by a bacterial consortium: a laboratory study. Biodegradation. 23(1):1-14.
Goréguès C., Michotey V., Bonin P. (2004). Isolation of hydrocarbonoclastic denitrifying
bacteria from Berre microbial mats. Ophelia. 58: 263-270.
Goto M., Misako K., Massayoshi A., Katsuhisa S., Kasthuri V. (1994). TLC/FID Method
for evaluation of the crude-oil degrading capability o f marine microorganisms. J. of Marine
Biotechnol. (2):45-50.
Grimm A.C., Harwood C.S. (1999). NahY, a catabolic plasmid-encoded receptor required
for chemotaxis of Pseudomonas putida to the aromatic hydrocarbon naphthalene. J. Bacteriol.
181: 3310-3316.
Grötzschel S., Koster J., Abed R. M., Dirk de Beer (2002). Degradation of petroleum
model compounds immobilized on clay by hypersaline microbial mat. Biodegrad. 13: 273-
283.
Grund A.D., Gunsalus I.C. (1983). Cloning of genes for naphthalene metabolism in
Pseudomonas putida. J. Bacteriol. 156: 89-94.
Guieysse B., Bernhoft I., Andersson B.E., Henrysson T., Olsson S., Mattiasson
B.(2000). Degradation of acenaphthene, phenanthrene and pyrene in a packed-bed biofilm
reactor. Applied Microbiology And Biotechnology 54: 826-831.
Gupta R. (1998). Protein phylogenies and signature sequences: A reappraisal of evolutionary
relationships among archaebacteria, eubacteria and eukaryotes. Microbiol Mol Biol Rev
62:1435-1491.
Habe H., Omori T. (2003). Genetics of polycyclic aromatic hydrocarbon metabolism in
diverse aerobic bacteria. Biosci Biotech Biochem 67: 225-243.
Hamman C., Hegemann J., Hildebrandt A. (1999). Detection of polycyclic aromatic
hydrocarbon degradation genes in different soil bacteria by polymerase chain reaction and
DNA hybridization. FEMS. Microbiol. Lett. 173: 255-263.
Harayama S., Kishira H., Kasai Y., Shutsubo K. (1999). Petroleum biodegradation in
marine environments. Journal of Molecular Microbiology and Biotechnology. 1: 63-70.
Hasanshahian M., Giti E. (2008). Investigation of alkane biodegradation using the microtiter
plate method and correlation between biofilm formation, biosurfactant production and crude
oil biodegradation. Int. Biodeterior. Biodegrad. 62: 170-178.
Head I.M., Jones D.M., Röling W.F. (2006). Marine microorganisms make a meal of oil.
Nature reviews. Microbiology. 4: 173- 182.
Heider J., Spormann A.M., Beller H.R., Widdel F. (1999). Anaerobic bacterial metabolism
of hydrocarbons. FEMS. Microbiology. Reviews. 22: 459-473.
Heiss-Blanquet S., Benoit Y., Marechaux C., Monot F. (2005). Assessing the role of alkane
hydroxylase genotypes in environmental samples by competitive PCR. J. Appl. Microbiol. 99:
1392-1403.

137
Références bibliographiques

Heitkamp M. A., Franklin W., Cerniglia C.E. (1988a). Microbial metabolism of polycyclic
aromatic hydrocarbons: isolation and characterization of a pyrene-degrading bacterium. Appl.
Environ. Microbiol. 54:2549–2555.
Heitkamp M.A., Freeman J. P., Miller D. W., Cerniglia C. E. (1988b). Pyrene degradation
by a Mycobacterium sp.: identification of ring oxidation and ring fission products. Appl.
Environ. Microbiol. 54:2556–2565.
Hernandez-Raquet G., Budzinski H., Caumette P., Dabert P., Le Ménach K., Muyzer
G., Duran R. (2006). Molecular diversity studies of bacterial communities of oil polluted
microbial mats from the Etang de Berre (France). FEMS Microbiology Ecology. 58: 550-562.
Holliger C., Sarra G., Guy G., Cornelis H., Wolfram S., Rene P.S., Francisco V. (1997).
Contaminated environnements in the subsurface and bioremediation: organic contaminants.
FEMS Microbiology Reviews 20, 517-523.
Hommel R. K. (1994). Formation and function of biosurfactant for degradation of
waterinsoluble substrate. In. Biochemistry of microbial degradation, pp. 63-87. Edited by C.
Raledge. Dordrecht: Kluwer Academic Publishers.
Hori K., Hiramatsu N., Nannbu M., Kanie K., Okochi M., Honda H. Watanabe H.
(2009). Drastic change in cell surface hydrophobicity of a new bacterial strain, Pseudomonas
sp. TIS1-127, induced by growth temperature and its effects on the toluene-conversion rate. J.
Biosci. Bioeng.107: 250-255.
Horowitz A., Atlas R.M. (1977). Response of microorganisms to an accidental gasoline
spillage in an artic freshwater ecosystem. Appl. Environ. Microbiol.33: 1252-1258.
Horvath R. S. (1972). Microbial co-metabolism and the degradation of organic compounds
in nature. Bacteriological Reviews, 36:146-155.
Hua F., Wang H. (2011). Uptake modes of octadecane by Pseudomonas sp. DG17 and
synthesis of biosurfactant. J. Appl. Microbiol. 112:25-37.
Hugenholtz P. (2002). Exploring prokaryotic diversity in the genomic era. Genome Biol. 3.
INERIS (2004). Institut National de l’Environnement Industriel et des Risques de France
(données INERIS disponibles sur : www.ineris.fr
Ito H., Hosokawa R., Morikawa M., Okuyama H. (2008). A turbine oil-degrading bacterial
consortium from soils of oil fields and its characteristics. Int. Biodeter. Biodegr. 61(3): 223-
232.
Janssen P.H. (2006). Identifying the dominant soil bacterial taxa in libraries of 16S rRNA
and 16S rRNA genes. Appl. Environ. Microbiol. 72: 1719-1728.
Jerina D. M., Selander H., Yagi H., Wells M.C., Davey J. F., Mahadevan V., Gibson D.
T. (1976). Dihydrodiols from antracene and phenanthrene. J. Am. Chem. Soc, 98, 5988.
Jin D.F., Hu H., Liu D.F., Ding H.T., Jia X.M., Zhao Y.H. (2012). Optimization of a
bacterial consortium for nitrobenzene degradation. Water Sci. Technol. 65(5):795-801.
Johnsen A.R., Bendixen K., Karlson U. (2002). Detection of microbial growth on
polycyclic aromatic hydrocarbons in microtiter plates by using the respiration indicator WST-
Appl. Environ. Microbiol. 68: 2683-2689.
Johnsen A.R., Karlson U. (2004). Evaluation of bacterial strategies to promote the
bioavailability of polycyclic aromatic hydrocarbons. Applied Microbiology and
Biotechnology 63(4): 452-459.

138
Références bibliographiques

Johnsen A.R., Karlson U. (2005). PAH degradation capacity of soil microbial communities
does it depend on PAH exposure ? Microbial Ecology, 50, p. 488-495.
Johnsen A. R., Wick LY, Harms H (2005). Principles of microbial PAH-degradation in soil.
Environ. Pollut. 133: 71-84.
Jose F. (1999). Essai de biodégradabilité sur les sols contaminés par les hydrocarbures, 3ème
édition. Dunad. Paris. P.102-116.
Juhasz A.L., Britz M.L., Stanley G.A. (1997). Degradation of fluoranthene, pyrene,
benz[a]anthtacene and dibenz[a,h] anthracene by Burkholderia cepacia. J. Appl. Microbiol.
83: 189-198.
Juhasz A.L., Naidu R., (2000). Bioremediation of high molecular weight polycyclic
aromatic hydrocarbons: a review of the microbial of benzo[a]pyrene. International
Biodeterioration and Biodegradation. 45: 57-88.
Juhas M, van der Meer JR, Gaillard M, Harding RM, Hood DW, Crook DW (2009).
Genomic islands: tools of bacterial horizontal gene transfer and evolution. FEMS. Microbiol.
Rev. 33: 376-393.
Kaczorek E., Olszanowski A. (2001). Uptake of hydrocarbon by Pseudomonas fluorescens
(P1) and Pseudomonas putida (K1) strains in the presence of surfactants: a cell surface
modification. Water air Soil Pollut 214: 451-459.
Kaplan C.W., Kitts C.L. (2004). Bacterial succession in a petroleum land treatment unit,
Appl Environ Microbiol. 70:1777-1786.
Kallimanis A., Frillingos S., Drainas C., Koukkou A.I. (2007). Taxonomic identification,
phenanthrene uptake activity, and membrane lipid alterations of the PAH degrading
Arthrobacter sp. strain Sphe3 Applied Microbiology and Biotechnology. 76: 709-717.
Kanaly R.A., Harayama S. (2000). Biodegradation of high-molecular-weight polycyclic
aromatic hydrocarbons by bacteria. J. Bacteriol. 182(8): 2059-2067.
Kanaly R.A, Hur G., (2006). Growth of Phanerochaete chrysoporium on diesel fuel
hydrocarbon at neutral pH. Chemosphere 63(2): 202-211.
Kanaly R.A., Bartha R., Watanabe K., Harayama S. (2000). Rapid mineralization of
Benzo[a]pyrene by a microbial consortium growing on diesel fuel. Appl. Environ. Microbiol.
66: 4205-4211.
Kang H., Hwang S.Y., Kim y.M., Kim E., Kim Y.S., Kim S.K., Kim S.W., Cerniglia
C.E., Shuttleworth K.L, Zylstra G.J. (2003). Degradation of phenanthrene and naphthalene
by a Burkholderia species strain. Can. J. Microbiol. 49(2): 139-144.
Kang S., Xing B. (2005). Phenanthrene sorption to sequentially extracted soil humic acids
and humins. Environ. Sci. Technol. 39, 134-140.
Karamalidis A.K., Evangelou A.C., Karabika E., Koukkou A.I., Drainas C., Voudrias
E.A. (2010). Laboratory scale bioremediation of petroleum-contaminated soil by indigenous
microorganisms and added Pseudomonas aeroginosa strain Step. Bioresour. Technol. 101:
6545-6552.
Kasai Y., Takahata Y., Hoaki T., Watanabe K. (2005). Physiological andmolecular
characterization of a microbial community established in unsaturated, petroleum-
contaminated soil. Environmental Microbiology. 7: 806-818.

139
Références bibliographiques

Kastner M., Breuer-Jammali M., Mahro B. (1998). Impact of inoculation protocols,


salinity, and pH on the degradation of polycyclic aromatic hydrocarbons (PAHs) and survival
of PAH-degrading bacteria introduced into soil. Appl. Environ. Microbiol. 64(1): 359-362.
Katsivela E., Moore E.R.B., Kalogerakis N. (2002). Biodegradation of aliphatic and
aromatic hydrocarbons: specificity among bacteria isolated from refinery waste sludge.
Water, Air, soil pollut 3: 103-115.
Katsivela E., Moore E.R., Maroukli D., Strömpl C., Pieper D., Kalogerakis N. (2005).
Bacterial community dynamics during in-situ bioremediation of petroleum waste sludge in
landfarming sites. Biodegradation. 16(2):169-80.
Kennish M.J. (2001). Practical handbook of marine science, Third Edition. CRC Press.
Boca Raton, London NewYork Washington, D.C.
Kermanshahi A., Karamanev D., Margaritis A., (2006). Kinetic modeling of the
biodegradation of the aqueous p-xylene in the immobilized soil bioreactor. Biochemical
Engineering Journal 27:204.
Khan A.A., Wang R.F., Cao W.W., Doerge D.R., Wennerstrom D., Cerniglia C.E.
(2001). Molecular cloning, nucleotide sequence, and expression of genes encoding a
polycyclic aromatic ring dioxygenase from Mycobacterium sp. strain PYR-1. Appl. Environ.
Microbiol. 67(8): 3577-3585.
Kim S., Picardal F.W. (2000). A novel bacterium that utilizes monochlorobiphenyls and 4-
chlorobenzoate as growth substrates. FEMS Microbiol Lett. 185(2):225-9.
Kim I.S., Park J.S., Kim K.W. (2001). Enhanced biodegradation of polycyclic aromatic
hydrocarbons using nonionic surfactants in soil slurry Applied Geochemistry 16:1419-1425.
Kim S.J., Kweon O., Freeman J.P., Jones R.C., Adjei M.D., Jhoo J.W., Edmondson
R.D., Cerniglia C.E. (2006). Molecular Cloning and Expression of Genes Encoding a Novel
Dioxygenase Involved in Low- and High-Molecular-Weight Polycyclic Aromatic
Hydrocarbon Degradation in Mycobacterium vanbaalenii PYR- 1. Applied and
Environmental Microbiology 72(2): 1045-1054.
Kimura M. (1968). Evolutionary rate at the molecular level. Nature 217, 624-626.
Kiyohara H., Nagao K. (1978). The catabolism of phenanthrene and naphthalene by
bacteria. J. Gen. Microbiol. 105:69-75.
Kleber H.P., Mueller R., Asperger O. (1985). Cytochrome P450 in Acinetobacter.
Occurence, isolation and regulation. FEMS Symp. 23: 89-95.
Klimkowicz-Pawlas A., Maliszewska-Kordybach B. (2003). Effect of anthracene and
pyrene on dehydrogenases activity in soils exposed ad unexposed to PAHs. Water, Air, and
Soil Pollution, 145, p. 169-186.
Kloos K., Munch J.C., Schloter M. (2006). A new method for the detection of
alkanemonooxygenase homologous genes (alkB) in soils based on PCR-hybridization. J.
Microbiol.Methods 66: 486-496.
Krivobok S., Kuony S., Meyer C., Louwagie M., Willison J.C, Jouanneau Y. (2003).
Identification of pyrene-induced proteins in Mycobacterium sp. strain 6PY1: evidence for two
ring-hydroxylating dioxygenases. J. Bacteriol. 185(13): 3828-3841.
Kurkela S., Lehvaslaiho H., Palva E.T., Teeri T.H. (1988). Cloning, nucleotide sequence
and characterization of genes encoding naphthalene dioxygenase of Pseudomonas putida
strain NCIB9816. Gene 73: 355-62.

140
Références bibliographiques

Ladji R., Yassaa N., Balducci C., Cecinato A. (2010). Organic components of Algerian
desert dusts. Chemosphere 81:925–931.
Lampi M.A. (2005). Environmental photoinduced toxicity of Polycyclic Aromatic
Hydrocarbons: Occurence and toxicity of photomodified PAHs and predictive modeling of
photoinduced toxicity. PhD thesis, Waterloo, Ontario, Canada, 146 p.
Langlois Eric (1998). Theses. Biodegradation of nitroaromatics compounds. Laval
University- National library of Canada. January 1998.
Lal B., Khanna S. (1996) Degradation of crude oil by Acinetobacter calcoaceticus and
Alcaligenes odorans. Appl. Biotechnol. 81: 355-362.
Langworthy T.A., Stapleton R.D., Sayler G.S., Findlay R.H. (1998). Genotypic and
phenotypic responses of a riverine microbial communauty to polycyclic aromatic hydrocarbon
contamination. Appl. Environ. Microbiol. 64:3422-3428.
Larkin M.J., Allen C.C.R., Kulakov L.A., Lipscomb D.A. (1999). Purification and
characterisation of a novel naphthalene dioxygenase from Rhodococcus sp. Strain
NCIMB12038. J. Bacteriol. 181: 6200- 6204.
Laurie A.D., Lloyd-Jones G. (1999). The phn genes of Burkholderia sp. strain RP007
constitute a divergent gene cluster for polycyclic aromatic hydrocarbon catabolism. J.
Bacteriol. 181: 531-540.
Law A.M.J., Aitken M.D. (2003). Bacterial chemotaxis to naphthalene desorbing from a
nonaqueous liquid. Appl. Environ. Microbiol. 69: 5968-5973.
LCPE : Loi Canadienne sur la Protection de l'Environnement, Liste des substances d'intérêt
prioritaire-Rapport d'évaluation-Hydrocarbures Aromatiques Polycycliques, (1994), 69p.
Leahy J.G., Colwell R.R. (1990). Microbial Degradation of hydrocarbons in the
Environment. Microbiol. Rev. 54: 305-315.
Lee S.E., Seo J.S., Keum Y.S., Lee J. H., Li C.H. (2007). Fluoranthene metabolism and
associated proteins in Mycobacterium sp. JS14. Proteomics 7(12): 2059-2069.
Lecomte P. (1995). Les sites pollués, traitement des sols et des eaux souterraines. Édition
Lavoisier, TEC & DOC, p. 198.
Leglize P., Saada A., Berthelin J. Leyval, C. (2008). Adsorption of phenanthrene on
activated carbon increases mineralization rate by specific bacteria. J. Hazard. Mater. 151:
339-347.
Lehto K.M., Vuorimaa E., Lemmetyinen H., (2000). Photolysis of polycyclic aromatic
hydrocarbons (PAHs) in dilute aqueous solutions detected by fluorescence. Journal of
Photochemistry and Photobiology, A: Chemistry, 136, p. 53-60.
Lei A.P., Hu L.Z., Wong Y. S., Tam N. F. (2007). Removal of flouranthene and pyrene by
different microalgal spicies. Bioresour Technol 98(2): 273-280.
Lesage G. (2009). Etude de l’élimination de substances aromatiques dangereuses dans un
procédé couplant adsorption et biodégradation. Thèse de l’Institut National des Sciences
Appliquées de Toulouse. Génie des Procédés et de l’Environnement.
Lessner D.J., Johnson G. R., Parales R. E., Spain J. C., Gibson D.T. (2002). Molecular
characterization and substrat specificity of nitrobenzene dioxygenase from Comamonas sp.
Strain JS765. App.l Environ. Microbiol. 68, 634-641.
Li W. (1993). So, what about the molecular clock hypothesis? Curr. Opin. Gen. Dev. 3: 896-
901.

141
Références bibliographiques

Liebeg E. W., Cutright T. J. (1999). The investigation of enhanced bioremediation through


the addition of macro and micro nutrients in a PAH contaminated soil. Int. Biodeter. Biodegr.,
44, 55-64.
Lily M.K., Bahuguna A., Dangwal K., Garg V. (2010). Optimization of an inducible,
chromosomally encoded benzo[a]pyrene (BaP) degradation pathway in Bacillus subtilis
BMT4i (MTCC 9447). Ann Micrbiol 60: 51-58.
Liu S., Suflita J.M. (1993). Ecology and evolution of microbial populations for
bioremediation. Trends in Biotechnology 11: 344- 352.
Liu W.T., Marsh T.L., Cheng H., Forney L.G. (1997). Characterization of microbial
diversity by determining terminal restriction fragment length polymorphism of genes
encoding 16S rRNA. Appl. Environ. Microbiol. 63 : 4516- 4522.
Long S.C., Aelion C.M., Dobbins D.C., Pfaender F. K. (1995). A comparison of microbial
community characteristics among petroleum-contaminated and uncontaminated subsurface
soil samples. Microb. Ecol. 30:297-307.
Lopez Z., Vila J., Grifoll M. (2005). Metabolism of fluoranthene by mycobacterial strains
isolated by their ability to grow in fluoranthene or pyrene. J. Ind. Microbiol. Biot.32 : 455.
Louvel B. (2010). Thèse de Doctorat. Étude en microcosmes de l’effet du ray-grass et de ses
exsudats racinaires sur la dissipation des HAP et les communautés bactériennes dégradantes.
Sciences et Ingénierie des Ressources Procédés Produits Environnement. Université de
Nancy.
Ludwig W., Klenk H.P. (2001). Overview: A phylogenetic backbone and taxonomic
framework for procaryotic systematics. In: R.W. BDRaC (ed). Bergey's manual of systematic
bacteriology, Springer-Verlag, New York, N.Y. edn. pp 49-65.
Mackay D., Shiu W.Y., Ma K.C. (1992). Illustrated handbook of physical-chemical
properties and environmental fate for organic chemicals. Lewis Publishers 2.
Macnally D.L., Mithelcic J.R., Lueking D.R. (1998). Biodegradation of three- and four-ring
polycyclic aromatic hydrocarbon under aerobic and denitrifying conditions. Environ. Sci.
Technol. 32: 2633-2339.
Maeng J.H., Sakai Y., Tani Y., Kato N. (1996). Isolation and characterization of a novel
oxygenase that catalyzes the first step of n-alkane oxidation in Acinetobacter sp strain M-1. J.
Bacteriol. 178: 3695–3700.
Maier T., Foerster H. H., Asperger O., Hahn U. (2001). Molecular characterization of the
56-kDa CYP153 from Acinetobacter sp. EB104. Biochem Biophys Res Commun 286: 652-
658.
Maki H., Ishihara M., Harayama S. (1997). Application of wastewater sludge to microbial
degradation of crude oil. In situ and On-site Bioremediation (4) 371-375.
Maki H., Sasaki T., Harayama S. (2001). Phto-oxidation of biodegraded crude oil and
toxicity of the photo-oxidized products. Chemosphere 44:1145-1151.
Mallick S., Chatterjee S., Dutta T.K. (2007). A novel degradation pathway in the
assimilation of phenanthrene by Staphylococcus sp. strain PN/Y via meta-cleavage of 2-
hydroxy-1-naphthoic acid: formation of trans-2,3-dioxo-5-(2'-hydroxyphenyl)-pent- 4-enoic
acid." Microbiology 153(7): 2104-2115.
Mannee P., Prayad P., Edward S., Upathan A., Ladda T. (1998). Biodegradation of crude
oil by soil microorganisms in the tropic. Biodegrad. 9: 83-90.

142
Références bibliographiques

Marcoux J., Déziel E., Villemur R., Lépine F., Bisaillon G., Beaudet R. (2000).
Optimization of high-molecular- weight polycyclic aromatic hydrocarbon degradation in a
two-liquid-phase bioreactor. J. appl .Microbiol. 88(4):655-662.
Marchal R., Penet S., Solano-Serena F., Vandecasteele J.P. (2003), Gasoline and Diesel
Oil Biodegradation, Oil & Gas Science and Technology – Rev. IFP, Vol. 58, No. 4, pp. 441-
448.
Margesin R., Schinner F. (2001). Bioremediation (natural attenuation and biostimulation) of
diesel-oil-contaminated soil in an alpine glacier skiing area. Appl. Environ. Microbiol. 67:
3127-3133.
Margesin R., Labbé D., Schinner F., Greer C.W., Whyte L. G. (2003). Characterization of
Hydrocarbon-Degrading Microbial Populations in Contaminated and Pristine Alpine Soils.
Appl. Environ. Microbiol. 69:3085-3092.
Marín M.M., Smits T. H. M., Van Beilen J.B., Rojo F. (2001). The alkane hydroxylase
gene of Burkholderia cepacia RR10 is under catabolite repression control. Journal of
Bacteriology 183:4202-4209.
Marquez-Rocha F.J., Hernandez-Rodriguez V., Lamela M.T. (2001). Biodegradation of
diesel oil in soil by a microbial consortium. Water, Air, Soil Pollut. 128, 313-320.
Marquez-Rocha F.J., Olmos-Soto J., Concepcion Rosano-Hernandez M.C., Muriel-
Garcia M. (2005). Determination of the hydrocarbon-degrading metabolic capabilities of
tropical bacterial isolates. Intern. Biodeterio. Biodegrad. 55: 17-23.
Matsuzawa S., Nasser-ali L., Guarrigues P. (2001). Photolytic behavior of polycyclic
aromatic hydrocarbons in diesel particulate matter deposited ont he ground. Environ. Sci.
Technol. 35(15):3139-3143.
Maughan H., Van der Auwera G. (2011). Bacillus taxonomy in the genomic era finds
phenotypes to be essential though often misleading. Infect. Genet. Evol. 11: 789-797.
McKenna E. J. (1972). Microbial metabolism of normal and branched chain alkanes. In
Degradation of synthetic organic molecules in the Biosphere. San Francisco, Academy of
Science, Washington, D.C.
Meador J.P., Stein J.E., Reichert W.L.,Varanasi U. (1995). Bioaccumulation of polycyclic
aromatic hydrocarbons by marine organisms. Reviews of environmental contamination and
toxicology. 143: 79-165.
Mearns A.J., Reish D.J., Oshida P.S., Buchman M., Ginn T., Donnelly R. (2008). Effects
of pollution on marine organisms. Water Environment Research. 80: 1918-1979.
Meckenstock R.U., Annweilet E., Michaelis W., Richnov H. H., Schink (2000). Anaerobic
naphthalene degradation by sulfate-reducing enrichment culture. Appl. Environ. Microbiol. 66
(7): 2743-2747.
Mendum T.A., Sockett R. E., Hirsch P. R. (1998). The detection of Gram-negative bacterial
mRNA from soil by RT-PCR. FEMS. Microbiol. Lett. 164, 369-373.
Miyata N., Iwahori K., Foght J.M., Gray M.R. (2004). Saturable, energy-dependent uptake
of phenanthrene in aqueous phase by Mycobactetium sp strains RJGII-135. Appl. Environ.
Microbiol. 70: 363-369.
Molina M., González N., Bautista L., Sanz R., Simarro R., Sánchez I., Sanz J. (2009).
Isolation and genetic identification of PAH degrading bacteria from a microbial consortium.
Biodegradation 20(6): 789-800.

143
Références bibliographiques

Morgan P., Waykinson R.J (1989). Hydrocarbon degradation in soils and methods for soil
biotreatment. CRC Crit. Rev. Biotechnol 8:305- 333.
Moody J. D., Freeman J. P., Doerge D.R., Cerniglia C.E. (2001). Degradation of
Phenanthrene and Anthracene by Cell Suspensions of Mycobacterium sp. Strain PYR- 1.
Appl. Environ. Microbiol. 67(4): 1476-1483.
Moser R., Stahl U. (2001). Insights into the genetic diversity of initial dioxygenases from
PAH-degrading bacteria. Appl. Microbiol. Biotechnol. 55:609-618.
Mrozik A., Piotrowska-Seget Z., Labuzek S. (2003). Bacterial degradation and
bioremediation of polycyclic aromatic hydrocarbons. Polish J. Environ. Studies 12:15-25.
Mueller J. G., Chapman P. J., Pritchard P. H. (1989). Action of a fluoranthene-utilizing
bacterial community on polycyclic aromatic hydrocarbon components of creosote. Appl.
Environ. Microbiol. 55:3085-3090.
Mueller J. G., Chapman P. J., Blattmann B. O., Pritchard P. H. (1990). Isolation and
characterization of a fluoranthene-utilizing strain of Pseudomonas paucimobilis. Appl.
Environ. Microbiol. 56 :1079-1086.
Mueller J. G., Devereux R., Santavy D. L., Lantz S. E., Willis S. G. Pritchard P. H.
(1997). Phylogenetic and physiological comparisons of-degrading bacteria from
geographically diverse soils. Antonie van Leeuwenkoek, 71 :329-343.
NAFTEC Spa (2007). Journée d’étude sur la consommation du Gas-oil- Alger, 07 juillet
2007- Naftec Spa. Sonatrach.
NAFTEC Spa (2010a). Apport mensuel d’activités –QHSE- Qualité, hygiène, sécurité,
environnement – Activité Aval- Division raffinage. Sonatrach.
NAFTEC Spa (2010b). Département HSE - hygiène, sécurité, environnement. Etude de
danger et audit environnemental.
Nam K., Alexander M., (2001), Relationship between biodegradation rate and percentage of
a compound that becomes sequestered in soil, Soil Biology & Biochemistry, 33, 787-792.
Nakamiya K., Sato A., Takahara Y., Iida, T. (1985). Micorbial oxidation of isoterpenoïd
alkanes, phytane, norpristane and farsnesane. Agric. Biol. Chem 49: 1993-2002.
Nogales B., Moore E. R., Llobet-Brossa E., Rossello-Mora R., Amann R., Timmis K.N.
(2001). Combined use of 16S ribosomal DNA and 16S rRNA to study the bacterial
community of polychlorinated biphenyl-polluted soil. Appl. Environ. Microbiol. 67: 1874-
1884.
Obayori O.S., Adebusoye S.A., Adewale A.O., Oyetibo G.O., Oluyemi O.O., Amokun
R.A., Ilori M.O. (2000). Differential degradation of crude oil (Bonny Light) by four
Pseudomonas strains. J. Environ. Sci. 21: 243-248.
Olson J.J., Mills G., Herbert B.E., Morris P. J. (1999). Biodegradation rates of separated
diesel components. Environ Toxicol. Chem. 18:2448-2453.
Overcash M.R., Pal D. (1979). Design of land treatment system for industrial wastes: theory
and practice. Ann.Arbor Sci.159-219.
Paisse P., Duran R., Coulon F., Goñi-Urriza M. (2011). Are alkane hydroxylase genes
(alkB) relevant to assess petroleum bioremediation processes in chronically polluted coastal
sediments? Appl. Microbiol. Biotechnol. DOI 10.1007/s00253-011-3381-5.
Pamp S.J., Tolker-Nielsen T. (2007). Multiple roles of biosurfactants in structural biofilm
development by Pseudomonas aeruginosa. J. Bacteriol. 189:2531-2539.

144
Références bibliographiques

Pandey G., Jain R. K. (2002). Bacterial Chemotaxis toward Environmental Pollutants: Role
in Bioremediation. Applied and Environmental Microbiology. 68: 5789-5795.
Parales J.V., Kumar A., Parales R.E. Gibson D.T. (1996). Cloning and sequencing of the
genes encoding 2-nitrotoluene dioxygenase from Pseudomonas sp. JS42. Gene, 181, 57-61.
Parales R.E., Bruce C.N., Schmid A., Wackett L.P. (2002). Biodegradation,
biotransformation, and biocatalysis (B3). Appl. Environ. Microbiol. 68 (10): 4699- 470.
Parales R.E. (2003). The role of active-site residues in naphthalene dioxygenase. J. Ind.
Microbiol. Biotechnol. 30(5): 271-278.
Park J.H., Zhao X., Voice T.C. (2001). Biodegradation of non-desorbable naphthalene in
soils. Environmental Science and Technology, 35, p. 2734-2740.
Pelmont J. (1995). Bactéries et environnement-adaptation biologique, Tome 1. OPU. P. 875.
Penet S., Vendeuvre C., Bertoncini F., Marchal R., Monot F. (2006). Characterization of
biodegradation capacities of environmental microflorae for diesel oil by comprehensive two-
dimensional gas chromatography. Biodegradation, 1-9.
Pérez-Silva R.M., Rodriguez A.A., Gomez Montes de Oca J.M., Moreno D.C. (2006).
Biodegradation of crude oil by Pseudomonas aeroginosa AT18 strain. Tecnologia Quimiqua
Vol XXVI, N 1.
Persson N.A., Welander T.G. (1994). Biotreatment of petroleum hydrocarbons-containing
sludges by landfarming.. In: Hinchee RA, Alleman BC, Hoeppel RE and Miller RN (eds)
Hydrocarbon Bioremediation (pp 335-342). Lewis Publishers, Boca Raton, Florida.
Pfennig N., Trüper H.G. (1992). The family Chromatiaceae. InThe Prokaryotes. Balows, A,
Trüper, H.G, Dworkin, M, Harder W, Schleifer, K.H, (eds). New York, USA: Springer-
Verlag pp 3200–3221.
Phale P.S., Basu A., Majhi P.D., Deveryshetty J., Vamsee-Krishna C., Shrivastava R.
(2007). Metabolic Diversity in Bacterial Degradation of Aromatic Compounds." OMICS: A
Journal of Integrative Biology 11(3): 252-279.
Phillips D.H.(1999). Polycyclic aromatic hydrocarbons in the diet, Mutation Research.443:
139-147.
Pinkart H.C., White, D.C. (1997). Phospholipids biosynthesis and solvent tolerance in
Pseudomonas putida strains. Journal of Bacteriology. 179: 4219-4226.
Pirnik M. P. (1977). Microbial oxidation of methyl branched alkanes. CRC Crit Rev
Microbiol 5: 413-422.
Rappe M.S., Giovanonni S.J. (2003). The uncultured microbila majority. Annu Rev
Microbiol 57:369-394.
Reid B., Jones K.C., Semple K.T. (2000). Bioavailability of persistent organic polluants in
soils and sediments: a perspective on mechanisms, consequences and assessment. Environ.
Pollut. 108: 103-112.
Rentza J.A., Alvarezb, Schnoor P.J.J. (2008). Benzo[a]pyrene degradation by
Sphingomonas yanoikuyae JAR02. Environ Pollut 151: 669-677.
Richard J. Y., Vogel T. M. (1999). Characterization of soil bacterial consortium capable of
degrading diesel fuel. Int Biodeter Biodeg 44: 93-100.
Rhee S.K., Liu X., Wu L., Chong S.C., Wan X., Zhou J. (2004). Detection of genes
involved in biodegradation and biotransformation in microbial communities by using 50-Mer
oligonucleotide microarrays. Appl. Environ. Microbiol. 70 : 4303-4317.

145
Références bibliographiques

Rocha-Carlos A., Pedregosa Ana M., Laborda F. (2011). Biosurfactant-mediated


biodegradation of staight and methyl-branched alaknes by Pseudomonas aeroginosa ATCC
55925. A Springer Open Journal. AMB Express, 1:9.
Rockne K.J., Chee-Sanford J.C, Sanford R.A, Hedlund B.P, Staley J.T, Strand S.E
(2000). Anaerobic naphthalene degradation by microbial pure cultures under nitrate-reducing
conditions. Appl. Environ. Microbiol. 66: 1595-1601.
Rontani J.F., Bertrand J.C., Blanc F., Giushi G. (1986). Gas Chromatography and gas
chromatography/mass spectrometry applied to the determination of a new pathway of pristane
degradation by a marine mixed bacterial population. Mar Chem 18: 9-16.
Rojas A., Duque E., Mosqueda G., Golden G., Hurtado A., Ramos J.L., Segura A.
(2001). Three efflux pumps are required to provide efficient tolerance to toluene in
Pseudomonas putida DOT-T1E. Journal of Bacteriology. 183: 3967-3973.
Roling W.F., Van Verseveld H.W. (2002). Natural attenuation: what does the subsurface
have in store? Biodegradation, 13: 53-64.
Röling W.F., de Brito Couto I.R., Swannell R.P., Head I.M. (2004). Response of Archaeal
communities in beach sediments to spilled oil and bioremediation. Applied and
Environmental Microbiology. 70: 2614-2620.
Romero M.C., Cazau M.C., Giorgieri S., Arambarri A.M. (1998). Phenanthrene
degradation by microorganisms isolated from a contaminated stream. Environ. Pollut. 101:
355-359.
Romine M. F., Stillwell L. C., Wong K.K., Thurston S. J., Sisk E. C., Sensen C.,
Gaasterland T., Fredrickson J. K. Saffer J. (1999). Complete sequence of a 184-kilobase
catabolic plasmid from Sphingomonas aromaticivorans F199. J. Bacteriol.181: 1585-1602.
Rosenberg E. (1986). Microbial surfactants. Crit Rev Biotechnol 3: 109-132.
Rotani J.F., Bonin P. (1992). Utilization of n-alkyl- substituted cyclohexanes by a marine
Alcaligene. Chemosphere (24): 1441-1446.
Roy P. K., Singh H. D., Baruah J.N. (1978). Metabolism of n-alkane in Endomycopsis
lipolytica (Saccharomycopsis lipolytica): Part IV--Characteristics of lipid formation from
nalkanes by non-proliferating cells. Indian J. Biochem. Biophys. 15: 456-461.
Royal-Haskoning (2003). Fact sheets on production, use and release of priority substances
in the WFD, anthracene, final version. Royal Haskoning.
Ruder A.M. (2006). Potential health effects of occupational chlorinated solvent exposure,
Ann N Y Acad. Sci.1076:207-227.
Saito A., Iwabuchi T., Harayama S. (2000). A novel phenanthrene dioxygenase from
Nocardioides sp strain KP7: Expression in Escherichia coli. J. Bacteriol. 182: 2134-2141.
Saker H. (2007). Analyse et dosage des hydrocarbures présents dans les eaux de mer du
littoral de SKIKDA. Mémoire de Magister. Université du 20 Aoùt 1955-SKIKDA.
Salanitro J.P. (2001). Bioremediation of petroleum hydrocarbons in soil. Adv in Agron 72:
53-105.
Salgado-Brito R., Neria M.I., Mesta-Howard M., Diaz Cedillo F., Wang E.T. (2007).
Oxidation of solid paraffin (C11-40) by Pseudomonas aeroginosa MGP-1. Ann Microbiol. 57:
321-328.
Samanta S.K., Singh O.V., Jain R.K. (2002). Polycyclic aromatic hydrocarbons:
Environmental pollution and bioremediation. Trends in Biotechnology. 20: 243-248.

146
Références bibliographiques

Sanger F., Nicklen S., Coulson A.R. (1992). DNA sequencing with chain-terminating
inhibitors. 1977. Biotechnology (Reading, Mass.). 24: 104-108.
Sariaslani F.S., Omer C.A. (1992). Actinomycete cytochrme P-450 involved in oxidative
metabolism: Biochemistry and molecular biology. Crit. Rev. Plant Sci. 11: 1-16.
Schloss P.D., Handelsman J. (2008). A statistical toolbox for metagenomics: assessing
functional diversity in microbial communities. BMC Bioinformatics. 9: 34.
Sato T., Hu J.P., Yamaura M., Washio J., Matsuyama J., Takahashi N. (2003).
Identification of mutans streptococci by restriction fragment length polymorphism analysis of
polymerase chain reaction-amlified 16S ribosomal RNA genes. Oral Microbiol. Immunol.
18:323-326.
Schell M.A., Wender P.E. (1986). Identification of the nahR gene product and nucleotide
sequences required for its activation of the sal operon. J. Bacteriol. 166: 9-14.
Schloss P.D., Handelsman J. (2005). Introducing DOTUR, a computer program for defining
operational taxonomic units and estimating species richness. Appl. Environ. Microbiol. 71:
1501-1506.
Scriban R. (1999). Biotechnologie.5ème édition, Tec.et doc. Lavoisier, Paris, France.
Seo J.S., Keum Y.S., Hu y., Lee S.E., Li Q.X. (2007). Degradation of phenanthrene by
Burkholderia sp. C3: initial 1,2- and 3,4-dioxygenation and meta- and orthocleavage of
naphthalene-1,2-diol. Biodegradation 18(1): 123-131.
Seo J.S., Keum Y.S., Li Q.X. (2009). Bacterial Degradation of Aromatic Compounds.
International Journal of Environmental Research and Public Health 6(1): 278-309.
Shirai K. (1987). Catechol production from benzene through reaction with resting and
immobilized cells of a mutant strain of Pseudomonas. Agric. Biol. Chem. 51:121– 128.
Sikkema J., De Bont J.A.M., Poolman B. (1994). Interaction of cyclic hydrocarbons with
biological membranes. Journal of bacteriology (269): 8022-8028 Hydrocarbon Microbiology
Rewiews (59): 201-222.
Sikkema J., De Bont J.A.M., Poolman B. (1995). Mechanisms of membrane toxicity of
hydrocarbons. Microbiological Reviews. 59: 201-222.
Singer M.E., Finnerty W. R. (1984). Microbial metabolism of straight-chain and branched
alkanes. New York: Macmillan Publisher.
Smail N., Khalef R. (2007). Production de Gas-oil et perspectives à court et moyen terme.
Journée d’étude sur la consommation du Gas- oil- Alger, le 07 juillet 2007. Groupe
SONATRACH- Société Nationale de Raffinage de Pétrole NAFTEC Spa.
Smit E., Leeflang P., Gommans S., Van den Broek J., Van Mil S., Wernars K. (2001).
Diversity and seasonal fluctuations of the dominant members of the bacterial soil community
in a wheat field as determined by cultivation and molecular methods. Appl. Environ.
Microbiol. 67:2284-2291.
Smith M.R. (1990). The biodegradation of aromatic hydrocarbons by bacteria.
Biodegradation 1:191-203.
Smits T.H., Röthlisberger M., Witholt B., Van Beilen J. B. (1999). Molecular screening
for alkane hydroxylase genes in gram-negative and gram-positive strains. Environ. Microbiol.
1: 307-317.

147
Références bibliographiques

Smits T. H., Balada S. B., Witholt B., Van Beilen J. B. (2002). Functional analysis of
alkane hydroxylases from gram-negative and gram-positive bacteria. J. Bacteriol. 184: 1733-
1742.
Smits T.H.M., Witholt B., Van Belien J.B. (2003). Functional characterization of genes
involved in alkane oxidation by Pseudomonas aeroginosa. Antonie Van Leewenhoek 84: 193-
200.
Smith C.A., Hyman M.R. (2004). Oxidation of methyl tert-butyl ether by alkane
hydroxylase in dicyclopropylketone-induced and n-octane-grown Pseudomonas putida GPo1.
Appl. Environ. Microbiol. 70: 4544-4550.
Snapper S.B., Melton R.E., Mustafa S., Kieser T., Jacobs W. R.J. (1990). Isolation and
characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis.
Mol. Microbiol. 4: 1911-1919.
Sokolovska I., Rozenberg R., Riez C., Rouxhet P.G., Agathos S. N., Wattiau P. (2003).
Carbon source-induced modifications in the mycolic acid content and cell wall permeability
of Rhodococcus erythropolis E1. Appl. Environ. Microbiol. 69: 701.
Solano-Serena F., Marchal R., Ropars M., Lebeault J. M., Vandecasteele J.P. (1999).
Biodegradation of gasoline: kinetics, mass balance and fate of individual hydrocarbons. J.
Appl. Microbiol. 86: 1008-1016.
Solano-Serena F., Marchal R., Casaregola S., Vasnier C., Lebeault J. M., Vandecasteele
J. P. (2000). A Mycobacterium strain with extended capacities for degradation of gasoline
hydrocarbons. Appl. Environ. Microbiol. 66 : 2392-2399.
Soltani M. (2004). Distribution lipidique et voies métaboliques chez quatre bactéries Gram
négatives hydrocarbonoclastes. Variation en fonction de la source de carbone. Thèse de
doctorat de l’université Paris 6, spécialité chimie analytique, p. 284.
Sotsky J. B., Greer C. W., Atlas R. M. (1994). Frequency of genes in aromatic and aliphatic
hydrocarbons biodegradation pathways within bacterial populations from Alaskan sediments.
Can. J. Microbiol. 40:981-985.
Stancu M.M., Grifoll M. (2011). Multidrug resistance in hydrocarbon-tolerant Gram-
positive and Gram-negative bacteria. J. Gen. Appl. Microbiol. 57(1):1-18.
Stapleton R.D., Bright N.G., Sayler G.S. (2000). Catabolic and genetic diversity of
degradative bacteria from fuel-hydrocarbon contaminated aquifers. Microb Ecol 39, 211-221.
Stolz A. (2009). Molecular characteristics of xenobiotic-degrading sphingomonads. Appl.
Microbiol. Biotechnol. 81(5): 793-811.
Sudip K.S., Om V.S., Rakesh K.J. (2002). Polycyclic aromatic hydrocarbon: environmental
pollution and bioremediation. Trends Biotechnol 20: 243-248.
Suen W.C., Haigler B.E., Spain J.C. (1996). 2, 4-dinitrotoluene dioxygenase from
Burkhlderia sp. strain DNT : Similarity to Naphtalene dioxygenase. J. Bacteriol. 178:4926-
4934.
Spencer P.S., Kim M.S., Sabri M.I. (2002). Aromatic as well as aliphatic hydrocarbon
solvent axonopathy. Int. J. Hyg. Environ. Health. 205: 131-136.
Stefanoff J.G., Garcia M.B. (1995). Physical conditioning to enhance bioremediation
excavated hydrocarbon contaminated soil at Mc Clellan Air Force Base. Environ Prog 14,
104-110.

148
Références bibliographiques

Straube W.L.N., Hansen C.C., Ringleberg L.D., Pritchard P. H. Jones-Meehan J. (2003).


Remediation of polyaromatic hydrocarbons (PAHs) through landfarminig with biostimulation
and bioaugmentation. Acta Biotechnology, 23: 179-196.
Syakti A.D. (2004). Biotransformation des hydrocarbures pétroliers et effets sur les acides
gras phospholipidiques de bactéries hydrocarbonoclastes marines. Thèse de doctorat,
Université de Droit, d’Economie et des Sciences (Aix Marseille III), Marseille, France pp.
Takizawa N., Iida T., Sawada T., Yamauchi K., Wang Y.W., Fukuda M., Kiyohara H.
(1999). Nucleotide sequences and characterization of genes encoding naphthalene upper
pathway of Pseudomonas aeruginosa Pak1 and Pseudomonas putida OUS82. J. Biosci.
Bioeng.87: 721-731.
Talbi Z., Haddou B., Bouberka Z., Derriche Z. (2009). Simultaneous elimination of
dissolved and dispersed pollutants from cutting oil wastes using two aqueous phase extraction
methods. Journal of Hazardous materials 163: 748-755.
Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. (2011). MEGA5:
molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods. Mol. Biol. Evol. 28:2731-2739.
Thangaraj K., Kapley A., Purohit H. (2008). Characterization of diverse Acinetobacter
isolates for utilization of multiple aromatic compounds. Bioresour Technol. 99: 2488-2494.
Theron J., Cloete T. E. (2000). Molecular techniques for determining microbial diversity
and community structure in natural environments. Crit Rev Microbiol 26: 37-57.
Thiele-Bruhn S., Brummer G. W. (2004). Fractionated extraction of polycyclic aromatic
hydrocarbons (PAHs) from polluted soils: estimation of PAH fraction degradable through
bioremediation. Eur. J. Soil Sci. 55: 567-578.
Thijsse G.J.E., Van der Linden A.C. (1961). Iso-alkanes oxidation by a Pseudomonas. Ant
van Leeuw 27: 171-179.
Thomas J. M., Yordy J. R., Amador J. A. Alexander M. (1986). Rates of dissolution and
biodegradation of water-insoluble organic compounds. Appl. Environ. Microbiol. 52: 290-
296.
Thompson I.P., Van Der Gast C.J., Ciric L., Singer A.C. (2005). Bioaugmentation for
bioremediation: The challenge of strain selection. Environmental Microbiology. 7: 909-915.
Tiburtius E.R.L., Peralta-Zamora P., Emmel A. (2005). Treatment of gasoline-
contaminated waters by advanced oxidation processes. Journal of Hazardous Materials 126:
86-90.
Tissot B.P., Welte D.H. (1984). Petroleum formation and occurence. Berlin, Heidelberg,
New York.
Toledo F.L., Calovo C., Rodelas J., Gonzales-Lopez J. (2006). Selection and identification
of bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons removal
capacities. Systematic Appl. Microbiol. 29: 244-252.
Torsvik V., Sorheim R., Goksoyr J. (1996). Total bacterial diversity in soil and sediment
communities : A review. J. Ind. Microbiol. 17: 170-178.
Tsitko I.V., Zaitsev G.M., Lobanok A.G., Salkinoja-Salonen M.S. (1999). Effect of
aromatic compounds on cellular fatty acid composition of Rhodococcus opacus. Appl. Env
Microb. 65: 853-855.

149
Références bibliographiques

Ulrici W (2000). Contaminant soil areas, different countries and contaminant monitoring of
contaminants. Environmental Process II. Soil Decontamination Biotechnology, HJ. Rehm and
G. Reed, (Eds) 11: 5–42.
Van Beilen J.B., Penninga D., Witholt B. (1992b). Topology of the membrane-bound
alkane hydroxylase of Pseudomonas oleovorans. J. Biol. Chem. 267:9194-9201.
Van Beilen J.B., Wubbolts M.G., Witholt B. (1994). Genetics of alkane oxidation by
Pseudomonas oleovorans. Biodegradation 5: 161-174.
Van Beilen J.B., Panke S., Lucchini S., Franchini A. G., Rothlisberger M., Witholt B.
(2001). Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking
insertion sequences: evolution and regulation of the alk genes. Microbiology 147:1621-1630.
Van Beilen J.B., Li Z., Duetz W. A., Smits T. H., Witholt B. (2003). Diversity of alkane
hydroxylase systems in the environment. Oil & Gas Science and Technology - Rev IFP
58:427-440.
Van Beilen J.B., Funhoff E.G. (2005). Expanding the alkane oxygenase toolbox: new
enzymes and applications. Curr. Opin. Biotechnol. 16:308-314.
van der Meer J.R., Devos W.M, Harayama S, Zehnder A.J.B. (1992). Molecular
mechanisms of genetic adaptation to xenobiotic compounds. Microbiol. Rev. 56: 677-694.
Van der Meer J.R., Sentchilo V. (2003). Genomic islands and the evolution of catabolic
pathways in bacteria. Curr. Opin. Biotechnol. 14: 248-254.
Van Hamme J.D., Singh A., Ward O.P. (2003). Recent advances in petroleum
microbiology. Microbiology and Molecular Biology Reviews. 67: 503-549.
Vandecasteele J.P. (2005b). Les hydrocarbures naturels dans l'environnement. In
Microbiologie pétrolière. Technip (ed). Paris: IFP publications, pp. 41-73.
Van Ravenswaay C.J.C., Van der Linden A.C. (1971). Substrate specificity of the paraffin
hydroxylase of Pseudomonas aeruginosa. Antonie van Leeuwenhoek. 37: 339-353.
Vila J, Lopez Z, Sabate J, Minguillon C, Solanas A.M, Grifoll M (2001) Identification of a
novel metabolite of pyrene by mycobacterium sp. strain AP1: actions of the isolate on two-
and three-ring polycyclic aromatic hydrocarbons. Appl. Environ. Microbiol. 67: 5497-5505.
Vinas M., Grifoll M., Sabate J., Solanas A. M. (2002). Biodegradation of a crude oil by
three microbial consortia of different origins and metabolic capabilities. J. Ind. Microbiol
Biotechnol 28 : 252-260.
Vogel T., Ballerini D. (2001). Biorestauration des sols et des aquifères contaminés par des
hydrocarbures et des composés halogénés. Bull.Soc.Fr.Microbiol., 16(3) : 204- 209.
Volkering F., Breure A. M., Sterkenburg A., Van Andel J.G. (1992). Microbial
degradation of polycyclic aromatic hydrocarbons: effect of substrate availability on bacterial
growth kinetics. Appl. Microbiol. Biot., 36: 548-552.
Vomberg A., Klinner U. (2000). Distribution of alkB genes within n-alkane-degrading
bacteria. J. Appl. Microbiol. 89: 339-348.
Von Mersi W, Schinner F (1991). An improved and accurate method for determining the
dehydrogenase activity of soils with iodonitrotetrazolium chloride. Biol. Fertil. Soils 11:216-
220.
Wallace S., Kadlec R. (2005). BTEX degradation in a cold-climate wetland system. Water
Science And Technology 51, 165-171.

150
Références bibliographiques

Walzer G., Rosenberg E., Ron E.Z. (2008). Identification of outer membrane proteins with
emulsifying activity by prediction of-barrel regions. Journal of Microbiological Methods. 76:
52-57.
Wang W., Wang L., Shao Z. (2010). Diversity and abundance of oil-degrading bacteria and
alkane hydroxylase (alkB) genes in the subtropical seawater of Xiamen Island. Microbiol.
Ecol. 60: 429-439
Warne Zouekia C., Ghoshalb S., Tufenkjia N. (2010). Bacterial adhesion to hydrocarbons:
Role of asphaltenes and resins. Colloids and Surfaces B: Biointerfaces 79: 219–226.
Watanabe K., Teramoto M., Futamata H., Harayama S. (1998). Molecular detection,
isolation and physiological characterization of functionally dominant phenol-degrading
bacteria in activated sludge. Appl. Environ. Microbiol. 64: 4396-4402.
Watanabe K., Baker P.W. (2000). Environmentally relevant microorganisms. Journal of
Bioscience and Bioengineering. 89: 1-11.
Watanabe K., Hamamura N. (2003). Molecular and physiological approaches to
understanding the ecology of pollutant degradation. Current Opinion in Biotechnology. 14:
289-295.
Watkinson R.J., Morgan P. (1990). Physiology of aliphatic hydrocarbon-degrading
microorganisms. Biodegradation 1: 79-92.
Whitman B.E., Lueking D.R., Mihelcic J.R. (1998). Naphthalene uptake by a Pseudomonas
fluorescens isolate. Can. J. Microbiol. 44: 1086-1093.
Whyte L.G., Bourbonnière L., Greer C.W. (1997b). Biodegradation of petroleum
hydrocarbons by psychrotrophic Pseudomonas strains possessing both alkanes (alk) and
naphthalene (nah) catabolic pathways. Appl. Environ. Microbiol. 63: 3719-3723.
Whyte L. G., Hawari J., Zhou E., Bourbonniere L., Inniss W. E., Greer C.W. (1998).
Biodegradation of variable-chain-length alkanes at low temperatures by a psychrotrophic
Rhodococcus sp. Appl. Environ. Microbiol. 64: 2578-2584.
Wick L. Y., De Munain A. R., Sprngael D., Harms H. (2002). Responses of
Mycobacterium sp. LB501T to the low bioavailability of solid anthracene. Appl. Microbiol.
Biot. 58: 378-385.
Widada J., Nojiri H., Kasuga K., Yoshida T., Habe H., Omori T. (2002). Molecular
detection and diversity of polycyclic aromatic hydrocarbon-degrading bacteria isolated from
geographically diverse sites. Appl. Microbiol. Biotechnol. 58: 205-209.
Wilcke W. (2000). Polycyclic Aromatic Hydrocarbons (PAHs) in soil - a Review. Journal of
Plant Nutrition and Soil Science, 163:p. 229-248.
Williams P.A., Sayers J.R. (1994). The evolution of pathways for aromatic hydrocarbon
oxidation in Pseudomonas. Biodegradation. 5: 195-217.
Wilson M. S., Bakermans C., Madsen E. L. (1999). In Situ, Real-Time Catabolic Gene
Expression: Extraction and Characterization of Naphtalene Dioxygenase mRNA Transcripts
from Groundwater. Appl. Environ. Microbiol. 65: 80-87.
Wodzinski R. S., Coyle J.E. (1974). Physical state of phenanthrene for utilisation by
bacteria. Applied Microbiology, 27: 1081-1084.
Woese C.R., Kandler O., Wheelis M.L. (1990). Towards a natural system of organisms -
proposal for the domains archaea, bacteria, and eucarya. Proc. Natl. Acad. Sci. USA. 87:
4576-4579.

151
Références bibliographiques

Woese C. R. (1987). Bacterial evolution. Microbiol. Rev. 51: 221-271.


Woese C. R., Fox G. (1977). Phylogenetic structure of the prokaryotic domain: the primary
kingdoms. Proc. Natl. Acad. Sci. USA 74:5088- 5090.
Wong J.W.C., Zhao Z., Zheng G. (2010). Biosurfactants from Acinetobacter calcoaceticus
BU03 enhance the bioavailability and biodegradation of polycyclic aromatic Hydrocarbons.
Proceeding of the annual international conference on soils, sediments, water and energy:
Vol. 15, Article 5.
Woods J., Kung J., Kingston D., Kotlyar L., Sparks B., McCracken T. (2008). Canadian
Crudes: A Comparative Study of SARA Fractions from a Modified HPLC Separation
Technique. Oil and Gas Sci and Technol – Rev. IFP. 63(1):151-163.
Xie M., Alonso H., Roujeinikova A. (2011). An imporved procedure for the purification of
catalytically active alkane hydroxylase from Pseudomonas putida GPo1. Appl Biochem
Biotechnol 165: 823-831.
Yakimov M.M., Timmis K.N., Golyshin P.N. (2007). Obligate oil-degrading marine
bacteria. Current Opinion in Biotechnology 18(3): 257-266.
Yassaa N., Cecinato A. (2005). Composition of torched crude oil organic particulate emitted
by refinery and its similarity to atmospheric aerosol in the surrounding area. Chemosphere 60:
1660–1666.
Yerushalmi R., Baldridge K.K., Scherz A. (2003). An experimental look into subelectron
charge flow. J. Am. Chem. Soc. 125(42):12706-7.
Ye D., Siddiqi M. A., Maccubbin A. E., Kumar S., Sikka H.C. (1996). Degradation of
polynuclear aromatic hydrocarbons by Sphingomonas paucimobilis. Environ. Sci. Technol.
30: 13è-142.
Yen K.M., Gunsalus I.C. (1982). Plasmid gene organization: naphthalene/salicylate
oxidation. Proc. Natl. Acad. Sci. USA 79:874-878.
Youssef N., Sheik C. S., Krumholz L. R., Najar F. Z., Roe B. A., Elshahed M. S. (2009).
Comparison of Species Richness Estimates Obtained Using Nearly Complete Fragments and
Simulated Pyrosequencing-Generated Fragments in 16S rRNA Gene- Based Environmental
Surveys. Applied and Environmental Microbiology 75(16): 5227-5236.
Yu S.H., Ke L., Wong S.Y., Tam N.F (2005). Degradation of polycyclic aromatic
hydrocarbons by a bacterial consortium enriched from mangrove sediments. Environ. Int.
31(2): 149-154.
Zhang Y., Miller R.M. (1994). Effect of a Pseudomonas rhamnolipid biosurfactants on cell
hydrophobicity and biodegradation of octadecane. Appl Environ. Microbiol. 60: 2101-2106
Zhuang W.Q., Tay J.H., Maszenan S.T., Tay S.T. (2002). Bacillus naphthovorans sp. nov.
from oil-contaminated tropical marine sediments and the role in naphtalene biodegradation.
Appl. Microbiol. Biotechnol. 58: 547-553
Zhang J., He M., Shi Y. (2009). Comparative sorption of benzo(a)pyrene to different humic
acids and humin in sediments. J. Hazard. Mater. 166, 802-809.
Zhang Z., Gai L., Hou Z., Yang C., Ma C., Wang Z., Sun B., He X., Tang H., Ping Xu P.
(2010). Characterization and biotechnological potential of petroleum-degrading bacteria
isolated from oil-contaminated soils. Bioresour. Technol. 101: 8452–8456.

152
Références bibliographiques

Zhang Z., Hou Z., Yang C., Ma C., Tao F., Xu P. (2011). Degradation of n-alkanes and
polycyclic hydrocarbons in petroleum by a newly isolated Pseudomonas aeroginosa DQ8.
Bioresource Technol.102: 4111-4116.
Zheng Z.M., Obbard J.P. (2002). Polycyclic aromatic hydrocarbon removal from soil by
surfactant solubilization and Phanerochaete chrysosporium oxidation. J. Environ. Qual. 31:
1842-1847.
Zhou H.W., Guo C.L., Wong Y.S., Tam N.F.Y. (2006). Genetic diversity of dioxygenase
genes in polycyclic aromatic hydrocarbon-degrading bacteria isolated from mangrove
sediments. FEMS Microbiology Letters. 262: 148-157.
Zimmerman J.R., Ghosh U., Millward R.N., Bridges T.S., Luthy R.G. (2004). Addition of
Carbon Sorbents to Reduce PCB and PAH Bioavailability in Marine Sediments:
Physicochemical Tests. Environmental Science and Technology 38, 5458.
Zhu X., Venosa A.D., Suidan M.T., Lee K. (2001). Guidelines for the bioremediation of
marine shorelines and freshwater wetlands. Land Remediation and Pollution Control
Division, National Risk Management Research Laboratory of the U.S. Environmental
Protection Agency.
Zuber B., Chami M., Houssin C., Dubochet J., Griffiths G., Daffe M. (2008). Direct
visualization of the outer membrane of mycobacteria and corynebacteria in their native state.
J. Bacteriol 190: 5672-5680.
Zwirglmaier K., Ludwig W., Schleifer K. H. (2004). Recognition of individual genes in a
single bacterial cell by fluorescence in situ hybridization- -RING-FISH. Mol. Microbiol. 1:89-
96.

153