Académique Documents
Professionnel Documents
Culture Documents
ISBN-13: 978-0-7167-7324-5
ISBN-10: 0-7167-7324-4
First printing
Janet Vigna
Grand Valley State University
Gunjan Sinha
Matthew Tontonoz
v
From the Authors
The development of this book has taken us all on an extremely long and winding road, on which
we have met fascinating people and had incredible experiences. The authors would like to thank
Elizabeth Widdicombe, Kate Parker, and the folks at W. H. Freeman and Company and Scientific
American for supporting this vision for biology education. They recognized our diverse strengths
and brought us together to make this vision a reality. We have learned so much from one another
on this challenging and rewarding professional journey, and none of us has likely worked so hard
and so passionately on a project as we all have on this one.
We would like to thank all of the people who were interviewed and generously contributed in-
formation for these chapters. Their stories are central to the impact that this book will have on the
students we teach. They are authentic examples of biology in a changing world, and they bring this
book to life.
A special thank you is required for our Senior Acquisitions Editor, Marc Mazzoni, for his unwav-
ering encouragement and ability to bring stable direction and support to the project. Developmen-
tal Editors Andrea Gawrylewski and Susan Weisberg and Assistant Editor Anna Bristow have spent
many hours in the pages of this book, editing the details, managing our chaos, and smoothing our
rough edges. We thank them for their dedication, patience, experience, and expertise. Thanks go
to Patrick Shriner and Amanda Dunning for their tireless work on our media and supplements
program. And we must thank Elaine Palucki, who has been with us from the very beginning, bring-
ing enthusiasm and a fresh voice to our discussions. Elaine has recruited an outstanding pool of
reviewers for this project, to whom we owe a debt of gratitude.
Many thanks to the production team, Leigh Renhard, Dana Kasowitz, Philip McCaffrey, Nancy
Brooks, Matthew Ball, Diana Blume, Bill Page, Christine Buese, Ted Szczepanski, Elyse Rieder, Ellen
Cash, and all the people behind the scenes at W. H. Freeman for translating our ideas into a beauti-
ful, cohesive product. We would like to thank Rachel Rogge and Jan Troutt at Precision Graphics
for their outstanding work on the Infographics. We appreciate their patience with the many edits
and quick timelines throughout the project. They do amazing work.
We’d like to thank Debbie Clare for her enthusiasm and hard work in promoting this book in the
biology education community. We thank the enthusiastic group of salespeople who connect with
biology educators across the country and do a wonderful job representing this book.
The authors would like to thank our families and friends who have been close to us during this
process. They have been our consultants, served as sounding boards about challenges, celebrated
our successes, shared our passions, and supported the extended time and energy we often diverted
away from them to this project. We are grateful for their patience and unending support.
And finally, a sincere thank you to our many teachers, mentors, and students over the years who
have shaped our views of biology and the world, and how best to teach about one in the context of
the other. You are our inspiration.
vi
Brief Contents
UNIT 1: What Is Life Made of? Chemistry, Cells, 12. Complex Inheritance 229
Energy Q&A: Genetics
1. Process of Science 1 13. Stem Cells and Cell Differentiation 253
Java Report Grow Your Own
2. Chemistry and Molecules of Life 19 UNIT 3: How Does Life Change over Time?
What Is Life? Evolution and Diversity
3. Cell Function and Structure 39 14. Natural Selection and Adaptation 271
Wonder Drug Bugs That Resist Drugs
4. Nutrition, Metabolism, Enzymes 59 Milestones in Biology Adventures in
Powerfoods Evolution 289
Charles Darwin and Alfred Russel Wallace on the trail
5. Energy Flow and Photosynthesis 81
of natural selection
Mighty Microbes
15. Nonadaptive Evolution and Speciation 299
6. Dietary Energy and Cellular Respiration 101
Evolution in the Fast Lane
Supersize Me?
16. Evidence for Evolution 321
UNIT 2: How Does Life Perpetuate? Cell Division A Fish with Fingers?
and Inheritance 17. Life on Earth 339
7. DNA Structure and Replication 121 Q&A: Evolution
Biologically Unique 18. Prokaryotic Diversity 359
Milestones in Biology The Model Makers 137 Lost City
Watson, Crick, and the structure of DNA 19. Eukaryotic Diversity 377
8. Genes to Proteins 143 Rain Forest Riches
Medicine from Milk 20. Human Evolution 395
What Is Race?
Milestones in Biology Sequence Sprint 161
Collins and Venter race to decode the human
UNIT 4: What Makes Up Our Environment?
genome
Ecology
9. Cell Division and Mitosis 169
21. Population Ecology 413
Paramedic Plants
On the Tracks of Wolves and Moose
10. Genetic Mutations and Cancer 187
22. Community Ecology 431
Fighting Fate
What’s Happening to Honey Bees?
11. Single-Gene Inheritance and Meiosis 203
23. Ecosystem Ecology 449
Rock for a Cause
The Heat Is On
Milestones in Biology Mendel’s Garden 221
24. Sustainability 471
An Austrian priest lays the foundation for modern
genetics Eco-Metropolis
1. Process of Science 1
Java Report Making sense of the latest buzz in
health-related news 2
1.1 Conflicting Conclusions 5 3. Cell Function and Structure 39
1.2 Science Is a Process: Narrowing Down the Wonder Drug How a chance discovery in a London
Possibilities 6 laboratory revolutionized medicine 40
1.3 Anatomy of an Experiment 8
3.1 How Penicillin Was Discovered 42
1.4 Sample Size Matters 9
3.2 Cell Theory: All Living Things Are Made of Cells 43
1.5 Everyday Theory vs. Scientific Theory 10
3.3 Membranes: All Cells Have Them 44
1.6 Caffeine Side Effects 11
3.4 Prokaryotic and Eukaryotic Cells Have Different
1.7 Correlation Does Not Equal Causation 14 Structures 45
1.8 From the Lab to the Media: Lost in Translation 15 3.5 Some Antibiotics Target Bacterial Cell Walls 46
3.6 Some Antibiotics Inhibit Prokaryotic
Ribosomes 48
3.7 Molecules Move Across the Cell Membrane 50
3.8 Eukaryotic Cells Have Organelles 51
UP CLOSE Eukaryotic Organelles 52–53
viii CONTENTS
4.6 Diet and Exercise Keep Bones Dense 71 6.8 Aerobic Respiration: A Closer Look 113
4.7 Enzymes Require Micronutrient Cofactors 73 6.9 Fermentation Occurs When Oxygen Is Scarce 114
4.8 Food Pyramids: Guides to a Balanced Diet 75 6.10 Photosynthesis and Aerobic Respiration Form a
Cycle 115
CONTENTS ix
8.5 The Two Parts of a Gene 150 10.1 Inheriting One Mutated BRCA1 Allele Increases the
8.6 Making a Transgenic Goat 151 Risk of Cancer 190
8.7 Gene Expression: An Overview 153 10.2 Mistakes in DNA Replication Can Produce
Mutations 191
8.8 Transcription: A Closer Look 154
10.3 Mutations in DNA Can Alter Protein Function and
8.9 Translation: A Closer Look 155
Cause Cancer 192
8.10 The Genetic Code Is Universal 156
10.4 What Causes Mutations? 194
Milestones in Biology Sequence Sprint 161 10.5 Mutations in Two Types of Cell Cycle Genes Cause
Collins and Venter race to decode the human Most Types of Cancer 195
genome 162 10.6 Tumors Develop in Stages as Mutations Accumulate
in a Cell 196
10.7 BRCA Mutation Increases the Risk of Breast
Cancer 197
10. Genetic Mutations and Cancer 187 Milestones in Biology Mendel’s Garden 221
Fighting Fate Some are genetically An Austrian priest lays the foundation for modern
predisposed to cancer—but surgery may cut their genetics 222
risk 188
x CONTENTS
13.1 Cells Are Organized into Tissues, Organs, and
Systems 256
13.2 Stem Cells in Tissues Have Regenerative
Properties 257
13.3 Engineering an Organ Using Stem Cells 258
13.4 Specialized Cells Express Different Genes 260
13.5 Regenerative Medicine 262
13.6 Embryonic vs. Adult Stem Cells 263
13.7 Somatic Cell Nuclear Transfer Creates Cloned
12. Complex Inheritance 229 Embryonic Stem Cells 264
Q & A: Genetics Complexities of human 13.8 Induced Pluripotent Stem Cells 266
genetics, from sex to depression 230
12.1 X and Y Chromosomes Determine Human
Sex 232
12.2 X-linked Traits Are Inherited on X
Chromosomes 235
12.3 Female Carriers Can Pass Disease Alleles to Their
Children 236
12.4 Y Chromosomes Pass Largely Unchanged from
Fathers to Sons 238
12.5 DNA Links Sally Hemings’s Son to Jefferson 239
12.6 Hair Texture Exhibits Incomplete Dominance 241
12.7 Human Blood Type Is a Codominant Trait 242 14. Natural Selection and
12.8 A Mismatched Blood Transfusion Causes Immune Adaptation 271
Rejection 243
Bugs That Resist Bugs Drug-resistant
12.9 Human Height Is Both Polygenic and
bacteria are on the rise. Can we stop
Multifactorial 244
them? 272
12.10 Serotonin Transporter Function Is Linked to
Depression 246 14.1 The Bacterium Staphylococcus aureus 274
12.11 Depression Is a Multifactorial Trait 247 14.2 How Beta-lactam Antibiotics Work 276
12.12 Chromosomal Abnormalities: Aneuploidy 248 14.3 How Bacteria Reproduce 277
12.13 Amniocentesis Provides a Fetal Karyotype 249 14.4 How Bacterial Populations Acquire Genetic
Variation 278
14.5 An Organism’s Fitness Depends on Its
Environment 279
14.6 Evolution by Natural Selection 280
14.7 Natural Selection Occurs in Patterns 281
14.8 Treating and Preventing Infection by Antibiotic-
Resistant Bacteria 284
CONTENTS xi
15. Nonadaptive Evolution and 17. Life on Earth 339
Speciation 299 Q & A: Evolution The history, classification, and
Evolution in the Fast Lane Can Florida’s phylogeny of life on earth 340
manatees cope with a rapidly changing 17.1 Unstable Elements Undergo Radioactive
environment? 300 Decay 342
15.1 Geographic Ranges of Manatees and Dugongs 303 17.2 Radioactive Decay Is Used to Date Some Rock
Types 343
15.2 The Founder Effect Reduces Genetic Diversity 304
17.3 Geologic Timeline of the Earth 346
15.3 Bottlenecks Can Reduce Genetic Diversity 305
17.4 The Geographic Distribution of Species Reflects
UP CLOSE Calculating Hardy-Weinberg Equilibrium 308
Their Evolutionary History 348
15.4 Gene Flow between Populations Increases Genetic
17.5 Movement of the Earth’s Plates Influences Climate
Diversity 311
and Biogeography 349
15.5 Species Are Reproductively Isolated 313
17.6 How Many Species Are There? 350
15.6 Physical Traits in the Order Sirenia 314
17.7 Classification of Species 351
15.7 The Mitochondrial DNA of Florida Manatees Lacks
17.8 How to Read an Evolutionary Tree 352
Genetic Diversity 315
17.9 DNA Defines Three Domains of Life: Bacteria,
15.8 Allopatric Speciation: How One Species Can Become
Archaea, Eukarya 354
Many 316
xii CONTENTS
18.7 Exploring Archaeal Diversity 371 20.8 Traits of Modern Humans Reflect Evolutionary
18.8 Energy from the Earth Fuels Life at Lost City 372 History 406
20.9 Natural Selection Influences Human
Evolution 408
20.10 The Evolution of Skin Color 410
CONTENTS XIII
22.3 Flowering Plant Reproduction Relies on 23.10 Measuring Atmospheric Carbon Dioxide
Pollinators 436 Levels 465
22.4 Energy Flows Up a Food Chain 438 23.11 Anthropogenic Production of Greenhouse
22.5 A Honey Bee Food Web 439 Gases 467
22.6 Organisms Live Together in Symbioses 440
22.7 Pollinators Have Different Ecological Niches 442
22.8 Bees Compete for Resources 443
22.9 What is Causing Colony Collapse Disorder? 445
XIV CONTENTS
Biology for a Changing World at a Glance
Biology for a Changing World was written by a team of two full-time college biology
instructors and two science writers, with extensive input from nonmajors biology instructors
ac ross t he Un ited St ates a nd Ca nada. The aut hors ident i f ied newswor t hy
stories to convey key concepts, then gathered feedback from instructors to ensure that these stories
are relevant, useful, and (most important) interesting to students.
Key Features
■ Engaging stories carry students through each chapter, “This format does exactly what I would like to
demonstrating how biology relates to their daily lives. do—it takes a real-life example as an application
of the material and uses the example in the form
■ Magazine-style design balances words and images while
of an unfolding story to both teach the material
providing students with the learning tools they need.
to the student and at the same time demonstrate
why and how the material is important to society
and the student today.”
—Chris Haynes, Shelton State Community College
Medicine
from milk
Scientists genetically modify animals to make medicine
I
n a Massachusetts barn nestled among wil- number of blood donors. Transgenic goats,
low and oak trees, rows of juglike machines however, can produce massive amounts of the
drone in a constant hum. Goats, dozens of drug in a relatively short period of time. More-
SEBASTIANKNIGHT/DREAMSTIME.COM
them, are being milked. But this is no ordi- over, relying on a herd of goats instead of human
nary dairy operation. This farm is among several volunteers ensures a consistent supply. And
worldwide practicing the art of “pharming”— because the animals live in a controlled envi-
TRANSGENIC
using genetically modified animals to churn out Refers to an organism
therapeutic drugs. that carries one or the Washington Post in February 2009, when All proteins are made of the same building
“This is very exciting, it is novel and has great more genes from a the company’s drug for antithrombin defi- blocks called amino acids. There are 20 differ-
The first drug produced from such trans-
genic animals is already available, manufac- potential for where we can go with this new different species. ciency was approved for market. ent amino acids in all. All amino acids have the
tured by GTC Biotherapeutics, a firm based in technology.” —Bernadette Dunham PROTEIN
same basic core structure, but each also has a
Framingham, Massachusetts. The drug con- A macromolecule Antithrombin: From Gene to Protein unique chemical side group that distinguishes
sists of a human protein called antithrombin ronment, there is less risk of transmitting infec- made up of repeating Antithrombin is a protein. Recall from Chapter the amino acids from one another. Amino acids
subunits known as 2 that proteins are one of the four main macro- bond together to form linear chains. The human
that was extracted from transgenic goats’ milk. tions such as HIV and hepatitis to healthy people amino acids, which
Antithrombin is most commonly used to treat through contaminated donor blood. determine the shape molecules that make up cells. Proteins have antithrombin protein is a chain of 432 amino
patients who either inherit or acquire a defi- Because of all these advantages, some people and function of a myriad functions in the body: they allow our acids. Many human proteins are in this size
protein. Proteins play muscles to contract, give our hair and skin its range, but chain lengths vary from just a few to
ciency of the antithrombin protein, which puts are predicting that transgenic animals may one
many critical roles in
them at risk of developing dangerous blood day replace human donors as the source for texture, and facilitate the thousands of chemi- thousands of amino acids. The longest human
living organisms.
clots. therapeutic agents extracted from blood. “This cal reactions that occur in our cells. In fact, protein, titin, is a single chain of 34,350 amino
For decades, scientists had extracted anti- is ver y exciting, it is novel and has AMINO ACIDS proteins play a huge role in all basic cellular acids.
The building blocks of functions. Proteins can perform such a variety The sequence of amino acids in any given
thrombin from human blood donations. But great potential for where we can go with this proteins. There are 20
blood contains only small amounts of anti- new technology,” Bernadette Dunham, director different amino acids.
of different tasks because they come in many chain makes each chain unique, and also deter-
thrombin, and the supply depends on the of the FDA’s Center for Veterinary Medicine, told shapes and sizes. mines how that chain ultimately folds into a
144 UNIT 2: HOW IS LIFE PERPETUATED? CELL DIVISION AND INHERITANCE CHAPTER 8: GENES TO PROTEINS 145
Cell
Chromosome
Nucleus
DNA molecules
are organized into
discrete structures If a single DNA molecule were stretched
called chromosomes. out it would be 1 to 3 meters long.
• Test Your Knowledge self-tests are aligned with each chapter’s PROTEIN STRUCTURE AND j USE IT
FUNCTION 7. You are a doctor. Your patient has reduced
• Know It questions assess general comprehension HINT See Infographics 8.1–8.4. 8. If you wanted to use genetic engineering to
increase the amount of antithrombin this patient
j KNOW IT produces, would you modify the regulatory
• Use It questions assess whether students can apply what they’ve 1. What determines a protein’s function?
“This is a great way to reinforce the ‘science of the story.’ The Know describe the relationship between the insulin gene
and the insulin protein.
use? Why? If you wanted to produce melanin in
yeast cells, what part of the melanin gene would
you use? Why?
It and Use It segments. reinforce scientific information and allow the GENE STRUCTURE
All genes have two key parts: a regulatory sequence j USE IT
10. Explain why scientists used the beta casein
and a coding sequence. To review gene structure,
student to apply concepts to everyday situations.” refer to Infographics 8.4 and 8.5. regulatory sequence to express human antithrombin
in goats’ milk.
j KNOW IT
—Pamela Anderson Cole, Shelton State Community College 5. The difference between two alleles of a gene is
best ascertained by
GENE EXPRESSION
Gene expression is the multistep process of
converting the information of DNA into proteins.
a. examining the amount of protein produced
from each allele.
b. examining the structure of the protein HINT See Infographics 8.7–8.10.
produced from each allele.
c. examining the amount of mRNA produced j KNOW IT
from each allele. 11. For each structure or enzyme listed, indicate by
chromosome in the nucleus where d. examining the nucleotide sequence of each N (nucleus) or C (cytoplasm) its active location in
allele. eukaryotic cells:
it can be used again in transcription. RNA polymerase ______
6. If a functional allele of antithrombin is expressed, Ribosome ______
a. blood clots will be more likely to form in the tRNA ______
wrong place. mRNA ______
■ Running Glossary provides b. blood clots will be less likely to form in the
wrong place.
c. functional antithrombin protein will be
present in blood.
to the ribosome, immediate, concise definitions for key d. a and c
e. b and c
it to the growing TRANSFER RNA
chain (Infographic (tRNA)
A type of RNA that
terms. 158 UNIT 2: HOW IS LIFE PERPETUATED? CELL DIVISION AND INHERITANCE
helps ribosomes
he human genome assemble chains of
ny thousands of dif- amino acids during
translation.
ins, each one is
her from a starting ANTICODON
s. In the same way The part of a tRNA
abet can spell hun- molecule that binds to
a complementary
ds, the basic set of mRNA codon.
dreds of thousands
Biology for a Changing World is supported by a robust set of study and teaching resources and
products. These support materials have been written by a team of experienced nonmajors edu-
cators and are tied together by peer-reviewed Learning Objectives for each chapter. These objec-
tives allow instructors to identify the core concepts that most challenge their students and enable
them to target student needs earlier and more effectively. In addition, they provide instructors
with a way to demonstrate that their students have mastered specific chapter goals.
Our program is outlined below, please ask your sales representative to see our supplement
sampler for more clarification.
■ Instructor Resources
• Story Abstracts The abstracts offer a brief story synopsis, providing interesting details
relevant to the chapter and to the online resources not found in the book.
• Active Learning Activities Our activities aim to enhance the student’s natural curiosity
and to inspire critical thinking about the topics. These will also provide alternative
examples to the stories in the text.
• Clicker Questions Designed to be used by students working in teams as well as in large
lectures.
• Optimized Figure JPEGS and PowerPoints Infographics are optimized and split apart
to be used for projection in large lecture halls.
• Stepped Art Sequences and Animations Every piece of art in the text is interactive in
some way, either through an art sequence or an animation.
• Lecture PowerPoints—Prebuilt lectures to help with the transition to a new textbook.
• Test Questions/Quizzes All assessment is organized into the textbook’s “Know it” and
“Use it” categories.
■ Student Products
• Interactive e-book Priced lower than the printed textbook and featuring seamlessly
integrated interactive resources and study tools.
• BioPortal A learning space combining our fully customizable e-book, student resources,
news feeds, and homework management tools.
• Printed Study Guide Covers all the topics in each chapter, breaking down each
infographic by offering students clear learning objectives and providing questions to test
their critical thinking.
• Free Book Companion Web Site Featuring most student resources in an online format.
We would like to thank the many reviewers who have helped with the development of this text.
Stephanie Aamodt, Louisiana State Joseph Bruseo, Holyoke Community College Jacquelyn Duke, Baylor University
University–Shreveport Mark Buchheim, University of Tulsa Michael Edgehouse, Cabrillo College
Marilyn Abbott, Lindenwood University Anne Bunnell, East Carolina University Susan S. Epperson, University of Colorado at
Julie Adams, Ohio Northern University Jamie Burchill, Troy University Colorado Springs
Tadesse A. Addisu, Northern Virginia Greg Butcher, Centenary College of Louisiana Paul Farnsworth, University of New Mexico
Community College–Annandale David Byres, Florida State College at Steven Fields, Winthrop University
Adjoa Ahedor, Rose State College Jacksonville–South Campus Lynn Firestone, Brigham Young
Ann Aguanno, Marymount Manhattan Carolee Caffrey, Hofstra University University–Idaho
College Jane Caldwell, Washington & Jefferson Teresa Fischer, Indian River Community
Zulfiqar Ahmad, East Tennessee State College College
University Jamie Campbell, Truckee Meadows Carey Fox, Brookdale Community College
Mark Ainsworth, Seattle Central Community College Karen Francl, Radford University
Community College Shillington Cara, Eastern Michigan Barbara S. Frank, Idaho State University
Carol Allen, Montgomery College University Diane Fritz, Northern Kentucky University
Pamela Anderson Cole, Shelton State Michael Carr, Oakton Community College Richard Gardner, Southern Virginia
Community College Dale Casamata, University of North Florida University
Ken Andrews, East Central University Deborah A. Cato, Wheaton College Shelley Garrett, Guilford Technical Commu-
Corrie Andries, Central New Mexico Jeannie Chapman, University of South nity College
Community College Carolina–Upstate Phil Gibson, University of Oklahoma
Josephine Arogyasami, Southern Virginia Xiaomei Cheng, Mount St. Mary’s College Julie L. Glenn, Gainesville State College–
University Steven D. Christenson, Brigham Young Oconee Campus
Joseph A. Arruda, Pittsburg State University University–Idaho Inna Goldenberg, Oakton Community College
Tami Asplin, North Dakota State University Kimberly Cline-Brown, University of Stephen Gomez, Central New Mexico Com-
Kim Atwood, Cumberland University Northern Iowa munity College
Felicitas Avendano, Grandview University Yvonne Cole, Lindenwood University Brad Goodbar, College of the Sequoias
James Backer, Daytona State College Claudia Cooperman, Philadelphia University Kate Goodrich, Widener University
David Bailey, Delta College Erica Corbett, Southeastern Oklahoma State Sherri Graves, Sacramento City College
Andy Baldwin, Mesa Community College University Madoka Gray-Mitsumune, Concordia
Mary Ball, Carson-Newman College David Corey, Midlands Technical College– University
Verona Barr, Heartland Community College Beltline Campus Bradley Griggs, Piedmont Technical College
Tina Beams Jones, Shelton State Community Cathy Cornett, University of Cheryl Hackworth, West Valley College
College Wisconsin–Platteville Janelle Hare, Morehead State University
Lynne Berdainer, Gainesville State College Frank Coro, Miami-Dade College– Katherine Harris, Hartnell College
Christine Bezotte, Elmira College InterAmerican Campus Joe Harsh, Butler University
Bill Rogers, Ball State University Angela Costanzo, Hawaii Pacific University Roberta Hayes, St. Johns College of Liberal
Curtis Blankenspoor, Calvin College Richard Cowart, University of Dubuque Arts and Sciences
Lisa Boggs, Southwestern Oklahoma State Jan Crook-Hill, North Georgia College and Chris Haynes, Shelton State Community
University State University College
Cheryl Boice, Lake City Community College Peter Cumbie, Winthrop University Steve Heard, University of New Brunswick
Larry Boots, University of Montavello Kathleen L. Curran, Wesley College Jason Heaton, Samford University
Barbara Boss, Keiser University Jennifer Cymbola, Grand Valley State Susan Hengeveld, Indiana University
Brenda Bourns, Seattle University University Kelly Hogan, University of North Carolina–
Bradley Bowden, University of Connecticut Gregory Dahlem, Northern Kentucky Chapel Hill
Mark Boyland, Union University University Andrew Holmgren, Heartland Community
Dean Bratis, Villanova University Don Dailey, Austin Peay State University College
Mimi Bres, Prince George’s Community Michael S. Dann, Pennsylvania State Ann Marie Hoskinson, Minnesota State
College University University–Mankato
Randy Brewton, University of Farahad Dastoor, University of Maine Tim Hoving, Grand Rapids Community
Tennesee–Knoxville Cara L. Davies, Ohio Northern University College
Marguerite (Peggy) Brickman, University of Renne Dawson, University of Utah Tonya Huff, Riverside Community College
Georgia Nishantha de Silva, Lock Haven University Evelyn Jackson, University of Mississippi
Clay Britton, Methodist University Jodi Denuyl, Grand Valley State University Laurie Johnson, Bay College
Gregory Brown, McGill University Elizabeth DeStasio, Lawrence University Tanganika K. Johnson, Southern University
Carole Browne, Wake Forest University Chris Dobson, Grand Valley State University and A&M College
Sara Browning, Palm Beach Atlantic Therese Dudek, Kiswaukee College
University Denise Due-Goodwin, Vanderbilt University
ACKNOWLEDGMENTS XIX
David Jones, Dixie State College Margaret Oliver, Carthage College University–Bakersfield
Jackie Jordan, Clayton State University Joanna Padolina, Virginia Commonwealth Amanda Starnes, Emory University
Marian Kaehler, Luther College University Alicia Steinhardt, Hartnell College
John Kell, Radford University Karen Pasko, Emmanuel College Bethany Stone, University of Missouri
Michael Kennedy, Missouri Southern State Forrest E. Payne, University of Arkansas at Christine Stracey, Westminster College
University Little Rock Sheila Strawn, University of Oklahoma
Janine Kido, Mt. San Antonio College Joseph Peabody, Brigham Young University– Steve Taber, Saginaw Valley State University
Kerry Kilburn, Old Dominion University Independent Study John R. Taylor, Southern Utah University
Dennis J. Kitz, Southern Illinois Linda Peters Sonia Taylor, Lake City Community College
University–Edwardsville Stephanie Toering Peters, Wartburg College Don Terpening, State University of New
Cindy Klevickis, James Madison University William Pietraface, State University of New York–Ulster
Jeannifer Kneafsey, Tulsa Community College York–Oneonta Pamela Thineson, Century College
Brenda Knotts, Eastern Illinois University Joel Piperberg, Millersville University Janice Thomas, Montclair State University
Olga Kopp, Utah Valley College Gregory J. Podgorski, Utah State University Paula Thompson, Florida State College at
Ari Krakowski, Laney College Jeff Podos, University of Jacksonville–North Campus
Dan Krane, Wright State Massachusetts–Amherst Heather Throop, New Mexico State University
Wendy A. Kuntz, Kapiolani Community Therese Poole, Georgia State University Sanjay Tiwary, Hinds Community College–
College Michelle Priest, Irvine Valley College Raymond Campus
Holly Kupfer, Central Piedmont Kenneth Pruitt, University of Texas at Jeff Travis, State University of New
Community College Brownsville York–Albany
Dale Lambert, Tarrant County College Dianne Purves, Crafton Hills College Eileen Underwood, Bowling Green University
Kirkwood Land, University of the Pacific Scott Quinton, Johnson County Community Craig Van Boskirk, Florida State College at
Elaine Larsen, Skidmore College College Jacksonville–Deerwood Center
Mary Lehman, Longwood University Logan Randolph, Polk Community College Bina Vanmali, University Missouri–Columbia
Beth Leuck, Centenary College of Louisiana Nick Reeves, Mt. San Jacinto College–Menifee José Vázquez, New York University
Robert Levine, McGill University Kim Regier, University of Colorado–Denver R. Steve Wagner, Central Washington
Patrick Lewis, Sam Houston State University Nancy Rice, Western Kentucky University University
Tammy Liles, Bluegrass Community College Stanley Rice, Southeastern Oklahoma State Rebekah Waikel, Eastern Kentucky
Susanne Lindgren, California State University University
University–Sacramento Brendan Rickards, Gloucester County College Timothy Wakefield, John Brown University
Matthew Linton, University of Utah Jennifer Robbins, Xavier University Helen Walter, Mills College
Cynthia Littlejohn, University of Southern Laurel Roberts, University of Pittsburg Paul Wanda, Southern Illinois
Mississippi Peggy Rolfsen, Cincinnati State Technical University–Edwardsville
Madelyn Logan, North Shore Community and Community College Katherine Warpeha, University of Illinois at
College Amy Rollins, Clayton State University Chicago
Ann S. Lumsden, Florida State University Deanne Roquet, Lake Superior College Arthur C. Washington, Florida Agricultural
Will Mackin, Elon University Karen Rose, Shelton State Community College and Mechanical University
Paul H. Marshall, Northern Essex Barbara Salvo, Carthage College Amanda Waterstrat, Eastern Kentucky
Community College Ken Saville, Albion College University
Mary Martin, Northern Michigan University Michael Sawey, Texas Christian University Kathy Webb, Bucks Country Community
Ron Mason, Mt. San Jacinto College–Menifee Karen Schaffer, Northwest Missouri State College
Helen Mastrobuoni, County College of Morris University Karen Wellner, Arizona State University
Amie Mazzoni, Fresno City College Daniel Scheirer, Northeastern University Mike Wenzel, California State
Rob McCandless, Methodist Bronwyn Scott, Bellevue College University–Sacramento
Brett McMillan, McDaniel College David Serrano, Broward College–Central Brad Wetherbee, University of Rhode Island
Malinda McMurry, Morehead State University Campus Alicia Whatley, Troy University
Michael McVay, Green River Community Marilyn Shopper, Johnson County Communi- Robert S. Whyte, California University of
College ty College Pennsylvania
Scott Medler, State University of New Laurie Shornicle, University of Missouri–St. Tara Williams-Hart, Lousiana State
York–Buffalo Louis University–Shreveport
Judith Megaw, Indian River State College Brad Shuster, New Mexico State University Christina Wills, Rockhurst University
Diane L. Melroy, University of North Tamara Sluss, Kentucky State University Carol Wymer, Morehead State University
Carolina–Wilmington Patricia Smith, Valencia Community College– Lan Xu, South Dakota State University
Paige Mettler-Cherry, Lindenwood University East Campus Rick Zechman, California State
Jim Mickle, North Carolina State University Sharon Smth, Florida State College at Jack- University–Fresno
Hugh Miller, East Tennessee State University sonville–Deerwood Center Michelle Zjhra, Georgia Southern University
Scott Moody, Ohio University Adrienne Smyth, Worcester State University Elena Zoubina, Bridgewater College
John Moore, Taylor University James Sniezek, Montgomery College Jeff Zuiderveen, Columbus State University
Lia Muller, San Diego Mesa College Andrea Solis, Mount St. Mary’s University
Ann Murkowski, North Seattle Community Anna Bess Sorin, University of Memphis
College Carol St. Angelo, Hofstra University
Shawn Nordell, University of St. Louis Wendy Stankovich, University of
Peter Oelkers, University of Wisconsin–Platteville
Michigan–Dearborn Rob Stark, California State
xx ACKNOWLEDGMENTS
Chapter 1 Process of Science
Java Report
1
Chapter 1 Process of Science
Java Report
Making sense of the latest buzz in
health-related news
I
n 1981, a study in the New England Journal of A sometime health villain, coffee’s repu-
Medicine made headlines when it reported tation seems to be on the rise. Recent studies
that drinking two cups of coffee a day have suggested that, far from causing
doubled a person’s risk of getting pancre- disease, the beverage may actually help
atic cancer; five or more cups a day supposedly prevent a number of conditions—everything
tripled the risk. “Study Links Coffee Use to from Parkinson disease and diabetes to cancer
Pancreas Cancer,” trumpeted the New York and tooth decay. A 2010 CBS News headline
Times. “Is there cancer in the cup?” asked announced, “Java Junkies Less Likely to Get
Time magazine. The lead author of the study, Tumors,” and a blog proclaimed, “Morning Joe
Dr. Brian MacMahon of the Harvard School of Fights Prostate Cancer.” The September 2010
Public Health, appeared on the Today show to issue of Prevention magazine ran an article
warn of the dangers of coffee. “I will tell you that titled “Four Ways Coffee Cures.”
I myself have stopped drinking coffee,” said Not everyone is buying the coffee cure, how-
MacMahon, who had previously drunk three ever. Public health officials are increasingly
cups a day. alarmed by our love affair with—some might
Just five years later, MacMahon’s research say, addiction to—caffeine. Emergency rooms
group was back in the news reporting in the are reporting more caffeine-related admis-
same journal that a second study had found no sions, and poison control centers are receiving
link between coffee and pancreatic cancer. more calls related to caffeine “overdoses.” In
Subsequent studies, by other authors, also response, the state of California is even consid-
failed to reproduce the original findings. ering forcing manufacturers to put warning
INFOGRAPHIC 1.2
Science Is a Process: Narrowing Down the Possibilities
Multiple scientists doing multiple experiments narrow down the pool of possible hypotheses. Those
that are rigorously tested and supported by other experiments emerge with greatest confidence.
Results
Rigorously test this hypothesis
support
with more experiments.
hypothesis.
H1
Q3 H4
Results do
Test alternative not support
Q4 hypotheses. hypothesis.
each test. Thus, the control group was identical Size Matters
to the experimental group in every way except Consider the size of Ryan’s experiment—40 peo-
for the consumption of caffeine. ple, tested on two different days. That’s not a
PLACEBO EFFECT
The effect observed In this experiment, caffeine consumption very big study. Could the results have simply
when members of a was the independent variable—the factor been due to chance? What if the 20 people who
control group display that is being changed in a deliberate way. The drank caffeinated coffee just happened to have
a measurable
response to a placebo
tests of memory are the dependent variable— better memory?
because they think the outcome that may “depend” on caffeine One thing that can strengthen our confidence
that they are receiving consumption. in the results of a scientific study is sample
a “real” treatment.
Ryan found that people who drank decaffein- size. Sample size is the number of individuals
INDEPENDENT ated coffee did worse on tests of memory func- participating in a study, or the number of times
VARIABLE tion in the afternoon compared to the morning. an experiment or set of observations is
The variable, or factor, By contrast, the experimental group who drank
being deliberately
caffeinated coffee performed equally well on
changed in the
experimental group. morning and afternoon memory tests. The
results, which were reported in the journal Psy-
DEPENDENT chological Science, support the hypothesis that
VARIABLE
The measured result
caffeine, delivered in the form of coffee,
of an experiment, improves memory—at least in certain people
analyzed in both the (Infographic 1.3).
experimental and
Because other factors might, in theory,
control groups
explain the link between coffee and mental
SAMPLE SIZE performance (perhaps coffee drinkers are
The number of more active, and their physical activity rather
experimental subjects
than their coffee consumption explains their
or the number of times
an experiment is mental performance), it’s too soon to see these
repeated. In human results as proof of coffee’s memory-boosting
studies, sample size is powers. To win our confidence, the experi-
the number of
subjects.
ment must be repeated by other scientists and,
if possible, the methodology refined.
repeated. The larger the sample size, the more the case of the side effects, was this a group
likely the results will have statistical signifi- of 20 patients (15% of 20 patients is 3 people), or
cance—that is, they will not be due to random was it 2,000? Only with a large enough sample
chance (Infographic 1.4). size can we be confident that the results of
News reports are full of statistics. On any a given study are statistically significant and
given day, you might hear that 75% of the Ameri- represent something more than chance. More-
can public opposes a piece of legislation. Or that over, it’s important to consider the population
15% of a group of people taking a medication being studied. For example, do the people
experienced a certain unpleasant side effect— reporting their views on a piece of legislation STATISTICAL
SIGNIFICANCE
like nausea or suicidal thoughts—compared to, represent a broad cross section of the public, A measure of
say, 8% of people taking a placebo. Are these or are most of them watchers of the same tele- confidence that the
differences significant or important? Whenever vision network, whose views lie at one results obtained are
“real,” rather than due
you hear such numbers being cited, it’s impor- extreme? Likewise, in Ryan’s study, are the
to random chance.
tant to keep in mind the total sample size. In 65-year-old self-described “morning people”
100 100
Score on memory test
60 60
40 40
20 20
0 0
0 100 200 300 0 100 200 300
mg caffeine per day mg caffeine per day
Conclusions drawn from these data might These data show a more convincing positive effect of
suggest that caffeine has only a slight positive caffeine on memory, a 45% average increase, because
influence on memory, a 15% average increase, it is supported by more data. A statistical analysis would
but could easily be inconclusive, because of show that this positive influence is significant — in other
the small sample size. words, it is not due to chance.
Cell Theory:
If you carry an All living things
umbrella with you, The freezer is are made of cells.
it won’t rain. the safest place
to keep valuables.
Theory of
General Relativity:
You feel more Gravity influences
cheerful when time and space.
you wear bright
clothing.
Theory of Evolution
by Natural Selection:
Populations of organisms
change over time, adapting
to their environment.
athletes and 60% of 287 cyclists said they con- feine blocks the effect of adenosine in the brain
sumed caffeine to enhance their performance. and keeps us from falling asleep.
Recognizing caffeine’s reputation as a perfor- Though our understanding of the chemistry
mance-enhancing drug, the International is relatively new, humans have enjoyed coffee’s
Olympic Committee prohibited kick for more than a thousand
athletes from using it until 2004 Some researchers years. It’s said that an Ethiopian
(when it decided to allow it, pre- goatherd found his goats acting
contend that
sumably because it had become unusually frisky one afternoon
too common a substance to coffee’s mind- after munching the leaves of a
regulate). boosting effects small bush. Chewing a few of the
While the exact mechanisms are an indirect shrub’s berries himself, he got a
are not fully understood, scien- result of the cycle caffeine buzz, and the rest was
tists think that caffeine exerts its history. Today, caffeine is the
energizing effect by counteract-
of dependency. most wildly used stimulant on
ing the actions of a chemical in the planet (Table 1.1).
the brain called adenosine. Adenosine is the In fact, consumption of caffeinated beverages
body’s natural sleeping pill—its concentration has skyrocketed in the past 25 years; for exam-
increases in the brain while you are awake and ple, young people now drink far more soda than
by the end of the day promotes drowsiness. Caf- milk. A 2009 study in the journal Pediatrics
Coffee 8 oz 95 mg and up
Sprite 12 oz (1 can) 0 mg
For more than 30 years, researchers at the tion—between caffeine and lower incidence of
Veterans Affairs Medical Center in Honolulu Parkinson disease, it does not necessarily show
followed more than 8,000 Japanese-American that caffeine prevents the disease. In other
men, gathering all sorts of information about words, correlation is not causation. Perhaps
them: their age, diet, health, smoking habits, the people who like to drink coffee have differ-
and other characteristics. Of these men, ent brain chemistry, and it’s this different
102 developed Parkinson disease. What did brain chemistry that explains the differing
these 102 men have in common? Epidemiolo- incidence of Parkinson disease among coffee
gists found that none of them drank caffeinated drinkers (Infographic 1.7).
beverages—no coffee, soda, or caffeinated tea. Indeed, other studies have found that ciga-
By contrast, coffee drinkers had a lower inci- rette smoking also correlates with a lower risk of
dence of Parkinson disease. In fact, those who Parkinson disease. Both coffee drinking and
drank the most coffee were the least likely to smoking could be considered types of thrill
get the disease. Men who drank more than two seeking, behavior observed in people who
12-ounce cups of coffee each day had one-fifth enjoy the “high” they get from stimulants such
the risk of getting the disease compared to as caffeine or nicotine. The lower risk of Parkin-
non—coffee drinkers. son disease among coffee drinkers might there-
So does coffee prevent Parkinson disease? fore result from thrill-seeking brain chemistry
The occurrence and progression of many dis- that also happens to resist disease—rather than
eases are affected by a complex range of fac- being caused by either smoking or drinking cof-
tors, including include age, sex, diet, genetics, fee per se.
CORRELATION and exposure to bacteria and environmental Moreover, the study followed Japanese-
A consistent chemicals, as well as lifestyle factors like drink- American men. Would the same relationship of
relationship between
two variables.
ing, smoking, and exercise. Although the study caffeine and Parkinson disease be seen in
discussed here suggests a link—or correla- other ethnic groups or in women? Several
3.5
Coffee intake, oz/day Less coffee
Nondrinkers correlates with
3.0 4–8 higher incidence Possible explanations
12–16 of Parkinson for these results:
20–24 disease. • Drinking coffee reduces risk of
developing Parkinson disease.
Cumulative incidence, %
2.5 28+
• People who are at risk for
developing Parkinson disease
2.0 are less likely to drink coffee.
• Drinking coffee masks the
symptoms of Parkinson
1.5 disease, thereby reducing the
rate of diagnosis of Parkinson
disease in coffee consumers.
More coffee
1.0 correlates with
lower incidence
of Parkinson
0.5 disease.
0
0 5 10 15 20 25 30
Year of follow-up
! • Complexity of a disease makes it unlikely that every variable can be controlled for.
• Small sample sizes can influence accuracy of results.
• The specific population in the study may not be representative of the general population.
other epidemiological studies have found a other scientists unravel the mechanisms that
correlation between caffeine consumption and underlie Parkinson’s onset.”
a lower incidence of Parkinson disease in men To get a clearer picture of caffeine’s role in
of other ethnicities. But in women the results Parkinson disease, researchers could conduct a
have been inconclusive. All in all, there’s still type of experiment known as a randomized
no direct evidence that caffeine actually pre- clinical trial, in which the effects of coffee are RANDOMIZED
vents the disease in either men or women. measured directly under controlled condi- CLINICAL TRIAL
“While our study found a strong correlation tions. One could divide a population into two A controlled medical
experiment in which
between coffee drinkers and low rates of Parkin- groups, put one group on coffee and the other
subjects are randomly
son’s disease,” said the study’s lead author, on decaf, and then follow both groups for a chosen to receive
G. Webster Ross in a press release issued by the number of years to see which one had the either an experimental
U.S. Department of Veterans Affairs, “we have higher incidence of disease. The problem treatment or a
standard treatment
not identified the exact cause of this effect. I’d with such a study is that it is often very expen- (or placebo).
like to see these findings used as a basis to help sive to conduct, and it can be difficult to get
people to stick to the regimen for the length of Nevertheless, such studies are often quite
the study. (And such studies are unethical if influential and newsworthy—like the supposed
the experimental treatment is likely to cause link between coffee and pancreatic cancer that
harm.) made headlines in 1981. That study was based
on a single epidemiological study, which was
Getting Beyond the Buzz later discounted by further research.
While a lower risk of Parkinson disease repre- Journalists face unique challenges in cover-
sents a potential boon to coffee drinkers, the ing health news, says Gary Schwitzer of Health-
news for caffeine addicts isn’t all good. Over the NewsReview.org: “They must cover complex
years, epidemiological studies have linked caf- topics, do it quickly, creatively, accurately,
feine consumption to higher rates of various completely and with balance—and then be sure
diseases, including osteoporosis, fibrocystic they don’t ‘dumb it down’ too much for a gen-
breast disease, and bladder cancer. As with eral news audience. . . . If they can’t do it right,
the link to Parkinson disease, however, such they must realize the harm they can do by
correlations do not necessarily prove that reporting inaccurately, incompletely, and in an
caffeine causes any of these diseases. imbalanced way” (Infographic 1.8).
What Is Life?
j What You Will Be Learning
2.1 Some Functional Characteristics of Living
Organisms
2.2 All Matter on Earth Is Made of Elements
2.3 Carbon Is a Versatile Component of Life’s
Molecules
UP CLOSE Molecules of Life: Carbohydrates,
Proteins, Lipids, Nucleic Acids
2.4 A Layer Rich in Phospholipids Defines Cell
Boundaries
2.5 Water Is a Good Solvent Because It Is Polar
2.6 Water Is “Sticky” Because It Forms Hydrogen
Bonds
2.7 Solutions Have a Characteristic pH
19
Chapter 2 Chemistry and Molecules of Life
What Is Life?
Evidence from space heats up an age-old debate
W
ith a flash of fiery light, a shooting named ALH84001, after Allan Hills, the patch of
star streaks across the night sky. ice where it was discovered.
Thirteen thousand years later, on Each year, tens of thousands of such meteor-
December 27, 1984, geologist ites, often called shooting stars, fall to earth.
Roberta Score picks up that shooting star and Most are commonplace chunks of interstellar
holds it in her mittens. It is a grape- debris left over from the dawn of the
fruit-size rock, weighing just over 4 solar system. But this one was special.
pounds, whose dark gray-green color At 4.5 billion years old, it is by far the
stands out sharply against the bril- oldest of only a handful of meteorites
liant white of the frozen Antarctic ice known to have come from Mars.
cap. NASA scientists believe the rock was
Score is one of a team of six kicked off the surface of Mars and jet-
researchers with ANSMET, the Antarctic Search tisoned into space when a comet or meteorite
for Meteorites program, who for six weeks every struck that planet some 16 million years ago. It
year crisscross the mile-thick ice in snowmo- then floated in space until nudged again, this
biles, searching for booty from space. time toward earth.
Score knew the rock was special as soon as In 1996, just 12 years after its discovery, the
she saw it. Coated in a layer of molten glass, or rock was catapulted into international fame
fusion crust, it had the telltale sign of having when a team of NASA researchers claimed to
blazed through the atmosphere, but was other- have found evidence of Martian life inside it.
wise unique in color and texture. “Yowza- Presenting their findings in the journal Sci-
Yowza,” wrote the team in their field report. The ence, lead author David McKay, a planetary
first meteorite to be catalogued that year, it was scientist at NASA’s Johnson Space Center,
described what he said was convincing evi- Montreal Gazette. “E.T., phone Mars,”
dence of “primitive life on early Mars” found requested the Boston Globe. President Bill Clin-
within the ancient rock. ton held a press conference to mark the occa-
sion, declaring, “Today, rock 84001 speaks to
us across all those billions of years and millions
“If this discovery is confirmed, it of miles. It speaks of the possibility of life. If
this discovery is confirmed, it will surely be
will surely be one of the most one of the most stunning insights into our uni-
stunning insights into our verse that science has ever uncovered.”
universe that science has ever And yet what began with excitement and fan-
uncovered.” –Bill Clinton fare quickly took a decidedly sour turn when
other researchers stepped up to cast doubt on the
evidence. The microscopic findings in the mete-
The report sent shock waves through the orite could have been produced without life,
press: “Life on Mars: Official,” proclaimed the skeptics argued. NASA scientists had overblown
UK Daily Mirror. “We’re Not Alone,” echoed the the significance of their findings, critics said.
C
5 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
Rb Sr Y Zr Nb Mo Tc Ru Rh Pd Ag Cd In Sn Sb Te I Xe
6 55 56 57 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86
Cs Ba *La Hf Ta W Re Os Ir Pt Au Hg Tl Pb Bi Po At Rn
7 87 88 89 104 105 106 107 108 109 110
Fr Ra †Ac Rf Ha 106 107 108 109 110
–
The periodic table of elements represents all known elements on earth.
Each element is placed in order on the periodic table of elements by its atomic + +
number, the number of protons found in the nucleus of its corresponding atom. –
+
+
Protons are positively charged
particles found in the nucleus of an – –
atom. A carbon atom has 6 protons.
–
The atomic mass of an atom is
determined by adding the number of Electrons are negatively charged
protons and neutrons. One type of particles that orbit around the nucleus Neutrons are uncharged particles
carbon atom has an atomic mass of 12. of an atom in distinct energy shells. A found in the nucleus of an atom. One
carbon atom has a total of 6 electrons. type of carbon atom has 6 neutrons.
C O
H H
H H
C C H O C O
H O H O
O
C C
O
H H
PROTON
A positively charged Life’s Recipe number of positively charged protons, nega-
subatomic particle
So far, all life we know of—from amoeba to tively charged electrons, and neutral neu-
found in the nucleus
of an atom. leaf to zebra—uses the same basic chemical trons each atom has.
recipe: a stew of carbon-based ingredients The element carbon, for example, is made up
ELECTRON floating in a broth of water. Carbon is one of of atoms with six protons, six electrons, and six
A negatively charged
subatomic particle
approximately 100 different elements found neutrons. The relatively heavy protons and neu-
with negligible mass. on earth. Elements are substances that cannot trons are packed into the atom’s dense core, or
be broken down by chemical means into nucleus, while the tiny electrons orbit around
NEUTRON smaller substances. They are considered the it (Infographic 2.2).
An electrically
uncharged subatomic fundamental components of anything that Carbon is the fourth most common element
particle found in the takes up space or has mass—the matter in the in the universe and the second most common
nucleus of an atom. universe. element in your body. In fact, just six elements
The smallest unit of an element that still make up the bulk of you: oxygen (65%), carbon
NUCLEUS
The dense core of an retains the property of an element is an atom. (18.5%), hydrogen (9.5%), nitrogen (3.3%), and
atom. What gives each atom its identity is the specific phosphorus and sulfur (2%).
MONOMER
One chemical subunit
of a polymer.
POLYMER
A molecule made up
of individual subunits,
called monomers,
linked together in a
chain.
MONOSACCHARIDE
The building block, or
monomer, of a
carbohydrate.
AMINO ACID
The building block, or
monomer, of a protein.
NUCLEOTIDE
The building block, or
monomer, of a nucleic
acid. Microscopic fossil-like structures found in the ALH84001 meteorite. NASA/JSC
Glucose is an
important
monosaccharide.
Amino Acid
There are 20 different amino H O
acids found in proteins. Amino N C C Carboxyl
Each amino acid shares a group H H OH group
common “core” structure
(shown in green).
H
CH C
3 H3 N
CH 3 CH 3 CH
O NH 2
CH CH CH 2
2 C
CH 3 CH 2
CH 3
H val leu CH OH CH 2
CH
3 CH 2 trp
CH 3 CH 2
gly ala CH
2 CH 2 CH 2
pro
S ser glu
u
CH 2
le
O H H H H H H H H H Unsaturated Cholesterol
H H H
C C C C C C C H H HO
C C C
C C C C
O H H H H H H H C H
H H H H Sterols
H
Fatty Acids Sterols have four connected carbon rings. Cholesterol is a
Fatty acids contain long chains of carbon atoms sterol that’s an important component of cell membranes.
bonded to one another and to hydrogen atoms. Other sterols may be hormones or color-inducing pigments.
H H2C O
Triglycerides Phospholipids
Triglycerides, also known as fat, have three fatty acid chains Phospholipids have two fatty acid chains and a phosphate
attached to a glycerol molecule. Fats store large amounts group attached to a glycerol molecule. Phospholipids are an
of energy and also provide padding and thermal insulation. important component of cell membranes.
Base
C O G T
C
OH U G A
P A
O C
C
Sugar A
C G T
P OH
O
C
C
Nucleotide OH
P O
Nucleotides share a common “core” structure, C
A simple cell
Water inside
Water inside the cell dissolves
molecules and supports their chemical
interaction required for cell functions.
Water-hating tails
(hydrophobic)
Phospholipid bilayer
known as nanobacteria—“nano” for their excep- repels water and a hydrophilic (“water-lov-
tionally tiny size. The largest of the fossilized ing”) end that attracts it. What happens when
beans are 100 nanometers in diameter—less a bunch of partly hydrophobic, partly hydro-
than 1/100 the width of a human hair. philic molecules are surrounded by water?
If these structures were bacteria, it would They form a lipid sandwich: the hydrophobic
CELL
mean life on Mars shared something very fun- tails cluster together, burying themselves in The basic structural
damental with life on earth: cells. Cells are the the middle of the membrane, as far away from unit of living
basic structural unit of life on earth; they are water as possible; the hydrophilic heads face organisms.
what enclose life, giving it boundaries. Humans out, exposed to the watery environment. The
PHOSPHOLIPID
contain trillions of cells; some organisms, like resulting phospholipid bilayer forms a semi- A type of lipid that
bacteria, are made of only one. permeable barrier to substances on either forms the cell
All cells have the same basic structure: they side of it (Infographic 2.4). membrane.
are water-filled sacs bounded by a membrane The original team of NASA researchers
PHOSPHOLIPID
rich in lipids. The membrane is essentially a argued that at least some of these oval lumps BILAYER
sandwich of lipids. In particular, the lipid could be the remains of bacteria-like organisms. A double layer of lipid
membrane is made of a type of lipid called a But other scientists were skeptical, arguing that molecules that
characterizes all
phospholipid. Each phospholipid has one the lumps were far too small to house the neces- biological membranes.
hydrophobic (“water-fearing”) end that sary components of living cells. More likely,
Canyon. The Phoenix Lander also found telltale meteorite, carrying CO2 from the Martian BASE
signs of liquid water’s past on the surface of atmosphere into the rock. A substance that
Mars in the form of salt deposits like those you Where all this water went, no one knows. reduces the hydrogen
ion concentration of
can see when seawater evaporates. But some scientists suspect that liquid water solutions, making them
more basic.
j KNOW IT j USE IT
1. Which of the following is not a generally 8. How would you assess whether or not a possibly
recognized characteristic of most (if not all) living living organism from another planet were truly
organisms? alive?
a. the ability to reproduce
b. the ability to maintain homeostasis 9. Which of the characteristics of living organisms
c. the ability to obtain energy directly from (if any) allow you to distinguish between living and
sunlight formerly living (that is, dead) organisms? Explain
d. the ability to sense and respond to the your answer.
environment
e. the ability to grow 10. What are the arguments for and against viruses
being considered living organisms?
2. What is homeostasis? Why it is important to
11. If, in a mound of dirt, you had evidence that
living organisms?
carbon dioxide was being consumed and converted
to glucose, what could you conclude about the
3. The basic building blocks of life are
presence of a living organism? Explain your answer.
a. DNA molecules.
b. cells.
12. How does a sterol, such as cholesterol, differ
c. proteins.
from a triglyceride? Structurally, what do
d. phospholipids.
triglycerides and phospholipids have in common?
e. inorganic molecules
4. What subatomic particles are located in the WATER: THE SOLVENT OF LIFE
nucleus of an atom? Water has many properties that make it a suitable
a. protons medium for living things and their chemical
b. neutrons reactions.
c. electrons
d. protons, neutrons, and electrons HINT See Infographics 2.5–2.7.
e. protons and neutrons
j KNOW IT
5. When an atom loses an electron, what 13. Is olive oil hydrophobic or hydrophilic? What
happens? about salt? Explain your answer.
a. It becomes positively charged.
b. It becomes negatively charged. 14. Two water molecules can bond to each other by
c. It becomes neutral. _____________ bonding; this is an example of
d. Nothing happens. __________________.
e. atoms cannot lose an electron because atoms a. hydrogen; adhesion
have a defined number of electrons b. covalent; adhesion
c. non-covalent; cohesion
6. What does it mean to say a macromolecule is a d. covalent; cohesion
polymer? Give an example. e. hydrogen; cohesion
16. As an acidic compound dissolves in water, the pH 20. Why do deserts cool off more at night than do
of the water __________. seaside towns?
a. becomes higher
b. remains neutral 21. Which of the following would be most likely to
c. becomes lower dissolve in olive oil?
d. doesn’t change a. a polar molecule
e. becomes basic b. a nonpolar molecule
c. a hydrophilic molecule
17. The bond between the oxygen atom and a d. a and c
hydrogen atom in a water molecule is a(n) e. b and c
___________ bond.
a. covalent
SCIENCE AND ETHICS
b. hydrogen
22. One approach to finding out if there is life on
c. ionic
Mars is to bring Martian dirt samples to earth for
d. hydrophobic
analysis. What are possible considerations for
e. noncovalent
science and society if a Martian life form is released
on earth? If an earth life form is introduced onto
18. How do ionic bonds compare to hydrogen
Mars?
bonds? What are the similarities and differences?
Wonder Drug
39
Chapter 3 Cell Function and Structure
Wonder Drug
How a chance discovery in a London laboratory
revolutionized medicine
O
n a September morning in 1928, biolo- including Streptococcus, Staphylococcus, and
gist Alexander Fleming returned to Pneumococcus. Fleming published his results
his laboratory at St. Mary’s Hospital in in 1929 in the British Journal of Experimental
London after a short summer vaca- Pathology. He named the antibacterial sub-
tion. As usual, the place was a mess—his bench stance “penicillin,” after the fungus producing
piled high with the petri dishes on which he it, Penicillium notatum. It was the birth of the
was growing bacteria. On this day, as Fleming first antibiotic.
sorted through the plates, he noticed that one Fleming was not the first to notice the bacte-
was growing a patch of fluffy white mold. It had ria-killing property of Penicillium, but he was
been contaminated, likely by a rogue mold the first to study it scientifically and publish
spore that had drifted in from a neighboring the results. In fact, Fleming had been looking
laboratory. for bacteria-killing substances for a number of
Fleming was about to toss the plate in the sink years, ever since he had served as a medical
when he noticed something unusual: wherever officer in World War I and witnessed soldiers
mold was growing, there was a zone around the dying from bacteria-caused infections. He had
mold where the bacteria did not seem to grow. already discovered one such antimicrobial
ANTIBIOTIC
Curious, he looked under a microscope and saw agent—the chemical lysozyme—which he
A chemical that can
that the bacterial cells near the mold had burst, detected in his own tears and nasal mucus, so slow or stop the
or lysed. Something in the mold was killing the he knew what bacteria-killing signs to look for. growth of bacteria;
bacteria. If you’ve ever seen a piece of moldy bread or many antibiotics are
produced by living
Experiments confirmed that the mold was rotting fruit, then you’ve met the Penicillium
organisms.
capable of killing many kinds of bacteria, fungus. It doesn’t look very impressive, but the
chemical it produces ushered in a whole new destructive effects on bacteria without harming
age of medicine. For the first time, doctors had their human or animal host, even if taken
a way to treat such deadly illnesses as bacterial internally.
pneumonia, syphilis, and meningitis. As
physician Lewis Thomas, former president of
“We could hardly believe our eyes
Memorial Sloan-Kettering Cancer Center in
New York City, wrote in his 1992 memoir Frag- on seeing that bacteria could be
ile Species, “We could hardly believe our eyes killed off without at the same
on seeing that bacteria could be killed off with- time killing the patient. It was
out at the same time killing the patient. It was not just amazement, it was a
not just amazement, it was a revolution” (Info-
graphic 3.1).
revolution.” –Lewis Thomas
CELL THEORY
The concept that all
living organisms are Bug Bullet Although Fleming didn’t know it at the time,
made of cells and that What makes antibiotics special is not just their penicillin and other antibiotics preferentially
cells are formed by the ability to kill bacteria. After all, cyanide and kill bacteria because they target what is unique
reproduction of
existing cells.
soap kill bacteria just fine. The important thing about bacterial cells. According to the cell the-
about antibiotics is that they exert their ory, all living things are made of cells, and
Penicillium
Penicilliummold
mold
Molds (fungi): Elodea (an aquatic plant): Humans (these are heart
single and multicellular eukaryotic cells a multicellular eukaryote cells): multicellular eukaryotes
CELL MEMBRANE
A phospholipid bilayer
with embedded other elements in common: ribosomes, which
to understand first what the two cell types have
proteins that forms
the boundary of all in common. All cells, both prokaryotic and eu- synthesize the proteins that are crucial to
cells. karyotic, are surrounded by a cell membrane. cell function; and DNA, the molecule of
This f lexible yet sturdy structure forms a heredity.
CYTOPLASM
boundary between the external environment Beyond these three features, however—cell
The gelatinous,
aqueous interior of all and the cell’s watery cytoplasm and literally membrane, ribosomes, and DNA—the two cell
cells. holds the cell together. Partly hydrophobic, types are structurally quite different. In a pro-
partly hydrophilic molecules known as phos- karyotic cell, for instance, the DNA floats freely
RIBOSOME
A complex of RNA and pholipids make up the bulk of the cell mem- within the cell’s cytoplasm, while in a eukary-
protein that carries brane, and proteins embedded in the otic cell it is housed within a central command
out protein synthesis membrane perform particular functions, such center called the nucleus. The nucleus is one
in all cells. of many organelles found within eukaryotic
as transporting nutrients in and wastes out.
NUCLEUS The cell membrane forms a semipermeable cells, but not in their simpler prokaryotic cous-
The organelle in barrier to substances on either side of it (Info- ins (Infographic 3.4).
eukaryotic cells that graphic 3.3). Penicillin kills bacteria because of one im-
contains the genetic
In addition to a f lexible cell membrane, portant difference between prokaryotic and
material.
both prokaryotic and eukaryotic cells have two eukaryotic cells. Unlike human and other ani-
INFOGRAPHIC 3.3
Membranes: All Cells Have Them
Phospholipid Membranes that form the cell membrane and various organelles are
phospholipid bilayers with embedded and attached proteins. Membranes
CH3
are semipermeable, selectively allowing the passage of substances from
H 2C N+ CH3 one side to the other.
Hydrophilic CH2 CH3 Choline
head group Phospholipids form two layers when Hydrophilic heads face
O
there is water on two sides — outside out to interact with
O P O– Phosphate the cell and in the cytoplasm. water on both sides.
group
O
H 2C CH CH2
Glycerol
O O
C O C O
Hydrophilic
tail CH2 CH2
CH2 CH2
CH2 CH2
CH2 CH2
CH2 CH2
CH2 CH2 Cell membrane
CH2 HC
CH2 CH
CH2 CH2
CH2 CH2 Membrane
CH2 CH2 proteins
Hydrophobic tails
CH2 CH2
gather in the middle
CH2 CH2 of the membrane.
CH2 CH2
CH2 CH2
CH2 CH2
CH3 CH3
Fatty acid
Cell membrane
Cytoplasm
Ribosomes
Genetic material
(DNA)
Prokaryotic cells
have a cell wall.
Eukaryotic cells have specialized compartments
(organelles) for specific cell functions.
Peptidoglycan
cell wall
Fewer solute
molecules
outside the cell
Water moves into
the cell by osmosis.
Antibiotic
mold juice made a “reasonably death toll that would result from
good” topical antiseptic, he With few other the hostilities. Millions of soldiers
noted in a 1940 paper that “the antibacterial and civilians had died in World
trouble of making it seemed not medicines War I, many not as a result of di-
worth while,” and largely gave rect combat injuries but from in-
available,
up working on it. fections resulting from surgeries
Ten years would pass before
penicillin suddenly meant to treat those injuries.
anyone reconsidered Fleming’s became the focus With few other antibacterial
mold. By then, history had inter- of research during medicines available, penicillin
vened and given new urgency to World War II. suddenly became the focus of re-
the search for antibacterial search during World War II.
medicines. In 1938, Ernst Chain, a German-
Jewish biochemist, was working in the pathology
From Fungus to Pharmaceutical department at Oxford University, having fled Ger-
On September 1, 1939, Germany invaded Po- many for England in 1933 when the Nazis came to
land, plunging the world into war for the second power. Both Chain and his supervisor, Howard
time in a generation. With the horrors of World Florey, were interested in the biochemistry of an-
War I still seared into memory, many feared the tibacterial substances. Chain stumbled across
Prokaryotic Ribosome:
Antibiotic disrupts
Genetic instructions ribosome function.
from the nucleus
enter the ribosome.
No protein formed
Bacterial ribosome
Eukaryotic Ribosome:
Antibiotic
Antibiotic does not
affect the ribosome.
Genetic instructions
Using these
from the nucleus
instructions,
enter the ribosome.
a new protein
chain is formed.
Functional protein
OH OH OH
O O O O
C C
P C
C C C Eukaryotic ribosomes are
P C P C
unaffected by antibiotic.
Proteins are still produced.
Human ribosome
out from an area of higher concentration to one one of their ends outside the cell and the other
of lower concentration—think of food coloring inside. By acting as a kind of channel, carrier,
diffusing in a glass of water. Because the sub- or pump, transport proteins provide a passage-
stance is moving from the side of the membrane way for those large or hydrophilic molecules to
TRANSPORT with a higher concentration to the side with a cross the membrane. They are also very spe-
PROTEINS lower concentration, no energy is required to cific: a protein that transports glucose will not
Proteins involved in move substances across the membrane. Take transport calcium ions, for example. The cells
the movement of
molecules across the
oxygen, for example. The concentration of oxy- of your body contain hundreds of types of
cell membrane. gen molecules, which are small and uncharged, transport proteins.
is often higher outside the cell and lower inside. Some antibiotics are small hydrophobic mol-
FACILITATED This concentration difference, or gradient, al- ecules that can cross the cell membrane directly
DIFFUSION
The process by which lows oxygen to diffuse easily into the cell—a by simple diffusion—tetracycline, for example.
large or hydrophilic good thing, because the cell needs oxygen in Others, including penicillin and streptomycin,
solutes move across a order to survive. require the assistance of transport proteins.
membrane from an
But the cell also needs some large or hydro- Transport proteins can move substances either
area of higher
concentration to an philic molecules in order to survive—one of up or down a concentration gradient. When a
area of lower them is glucose, the cell’s energy source. To substance uses a transport protein to move
concentration with move such molecules across the membrane the down a concentration gradient, the process is
the help of transport
proteins.
cell makes use of transport proteins. Trans- called facilitated diffusion. Like simple diffu-
port proteins sit in the membrane bilayer with sion, facilitated diffusion requires no energy
Higher concentration
Transport
proteins
Energy
Lower concentration
since the substance is moving from a higher to breaking down the antibiotic with enzymes. Why
a lower concentration. Facilitated diffusion is would bacteria have such built-in mechanisms
the way many antibiotics pass through bacte- for counteracting or resisting drugs? Remember
rial cell membranes. that penicillin was originally isolated from a liv-
Just because an antibiotic makes it inside a ing organism, a fungus. Streptomycin was origi-
bacterial cell, however, doesn’t mean it will stay nally isolated from microorganisms living in soil.
there. Some bacteria have transport proteins Microorganisms have evolved chemical defenses
that can actively pump the antibiotic back out of as a way to protect themselves from other organ-
the cell. This bacterial counteroffensive mea- isms. In turn, these organisms have evolved
sure is an example of active transport, in countermeasures that give them resistance. Hu-
which proteins pump a substance uphill from mans thus find themselves embroiled in a battle
an area of lower concentration to an area of originally waged solely between microorgan- ACTIVE TRANSPORT
higher concentration, a process that requires isms. We have “amplified a local warfare among The energy-requiring
energy. In this case, active transport keeps the microbes in a few grams of soil into a global plan- process by which
solutes are pumped
antibiotic concentration in the bacterial cell etary war between Man and Microbe,” writes
from an area of lower
low, but the cell must expend energy to keep Alexander Tomasz, a microbiologist at the Rock- concentration to an
pumping the antibiotic out (Infographic 3.7). efeller University, in the book Fighting Infection area of higher
Pumping antibiotics out of the bacterial cell is in the 21st Century. In the early 1980s Tomasz concentration with
the help of transport
one way bacteria can resist the destructive power helped discover how penicillin works, and is
proteins.
of an antibiotic. Other ways include chemically now an expert on antibiotic resistance.
Nucleus
Endoplasmic
reticulum
Ribosomes
Mitochondrion
Lysosome
Golgi apparatus
DNA
(genetic material)
Nuclear envelope
Vesicle Ribosomes
Golgi
The Golgi is a series of flattened membrane compartments, whose purpose is to process and package proteins produced in the rough
endoplasmic reticulum. The processed molecules are packaged into membrane vesicles, then targeted and transported to their
final destinations.
2. As the proteins make their way
through the Golgi, they are processed.
3. Proteins are then packaged into
transport vesicles, which deliver the
1. Transport proteins to their final destination.
vesicle delivers
proteins from the
rough endoplasmic Transport vesicle
reticulum to the
Golgi.
The Nucleus, Endoplasmic Reticulum and Golgi Work Together to Produce and Transport Proteins
Cell membrane
Ribosome
Ribosome
Granum
Thylakoid
Outer membrane membranes
Inner membrane
Inner and outer
membranes
Lysosome
Lysosomes are the cell’s “recycling centers.” Full of digestive enzymes, lysosomes break down
worn out cell parts or molecules so they can be used to build new cellular structures.
Damaged
cell parts
Outside of cell Cytoplasm Digestion are digested
so their parts
Cell membrane can be recycled.
Cell membrane
Cytoskeleton
The cytoskeleton is a meshwork of protein fibers
that carry out a variety of functions, including cell
support, cell movement and movement of
structures within cells. Each type of
cytoskeletal fiber has a specific
structure and function.
allows cells to move and maintain their shape, DNA, just like prokaryotic cells. They also contain LYSOSOME
much the same way that your skeleton does. ribosomes that are similar in structure to pro- An organelle in
Prokaryotic cells carry out similar functions karyotic ribosomes—so similar, in fact, that some eukaryotic cells filled
with enzymes that can
of energy conversion and protein transport, but antibiotics that target prokaryotic ribosomes can
degrade worn-out
they don’t contain these processes within sepa- affect the ribosomes in eukaryotic mitochondria, cellular structures.
rate organelles; everything occurs in the which accounts for both the toxicity and the side
cytoplasm. effects of these antibiotics. CYTOSKELETON
A network of protein
How did eukaryotic cells develop their
fibers in eukaryotic
factory-like compartments? That question has Winning the Battle, Losing the War cells that provides
long intrigued biologists. One fascinating hy- To those who first benefited from its healing structure and
pothesis was proposed in the 1960s by biologist powers, penicillin seemed a wonder drug, a facilitates cell
movement.
Lynn Margulis, who argued that eukaryotic or- magic bullet. A once-lethal bacterial infection
Powerfoods
59
Chapter 4 Nutrition, Metabolism, Enzymes
Powerfoods
Foods fit to fight chronic disease
F
ood giant Nestlé is perhaps best known on the market, may cut cholesterol levels; and
for its chocolate, cereals, and other sun- a yogurt fortified with calcium may help stave
dry foods—products that taste good off the bone-thinning disease known as osteo-
but aren’t always good for your health. porosis. These so-called functional foods, also
But the company sells much more than just called nutraceuticals—a play on the word
snack foods. At its mountainside research labo- “pharmaceuticals”—represent the next wave in
ratory near Lausanne, Switzerland, for more food science.
than 10 years company scientists have been Food manufacturers have long tinkered with
developing products with a nutritional bang. In their food products by pumping in “healthful”
September 2010, Nestlé established a separate extras, from vitamins to oat bran. However,
division, Nestlé Health Science, to develop very few of these foods with added nutrients
products that exclusively target diseases and have been tested in clinical trials to prove that
also to stake a claim in a rapidly growing mar- they actually improve health. But tough food
ket. The company’s goal: to keep chronic dis- labeling laws in the European Union and the
eases at bay with food containing therapeutic threat of more stringent regulation in the United
ingredients. States are forcing large food companies such as DIABETES
Some of these products are already on the Nestlé and others to change. With their nutra- A disease
market. In 2006, for example, the company ceuticals, Nestlé aims “to provide health bene- characterized by
abnormally high
introduced to the United States and Canada a fits whose value has been demonstrated and
blood-sugar levels.
snack drink called Boost Glucose Control that justified by science,” says Nina Backes, media
doesn’t cause dangerous spikes in blood-sugar spokesperson at Nestlé. OSTEOPOROSIS
levels, which is a concern for people with But do they work? And is eating such “manu- A disease
characterized by
diabetes. Another Nestlé product, a low-fat factured” food healthier than eating freshly pre- thinning bones.
milk containing less saturated fat than others pared food?
Macronutrients from the diet Cells consist of four main types of organic molecules: proteins, carbohydrates,
are digested in our mouth, fats, and nucleic acids. They synthesize these molecules from the breakdown
stomach, and small intestine. products of the macronutrients in the foods we eat.
Digestion breaks food into subunits, The body’s cells build macromolecules
which then travel from the intestines from these subunits. The new macro-
into the bloodstream where they are molecules make up cell structures to
transported to the body’s cells. help cells carry out important functions.
Carbohydrate
Simple sugars
half the time that we spent cooking and clean- Oat bran, for example, a natural ingredient
ing during the 1960s. And consumption of pro- found in oatmeal, has been shown to lower cho-
cessed foods is at historic levels. lesterol, reduce blood pressure, and conse-
Paradoxically, Americans have become more quently cut the risk of heart disease. So food
health-conscious than ever. We have access manufacturers have added oat bran to many
to the latest health news, much of which focuses types of foods, including bread and pasta. Like-
on reporting the health benefits of this or wise, omega-3 fatty acids—a type of essential
that nutrient. In response to consumer demand, fatty acid that is naturally found in such fatty
the food industry several years ago began trying fish as mackerel, sardines, and salmon—may
to make its processed food more healthful promote cardiovascular health and carry other
by putting nutrients in and taking food addi- health benefits. Consequently, many companies
tives—such as the hydrogenated oil known have started adding omega-3 fatty acids to prod-
as trans fat that scientists have found to harm ucts such as margarine, cereals, and eggs. And
health—out. many foods, from breakfast cereal to orange
Active site
Enzyme
Active site
Enzyme
ANABOLIC
REACTION
including cardiovascular disease, kidney fail-
Any chemical reaction ure, and blindness.
that combines simple To combat high blood sugar, many diabetics
molecules to build
inject themselves with insulin. But as insulin
more-complex
molecules. causes sugar in the blood to rush into cells,
blood sugar can plummet quickly. Low blood
METABOLISM sugar is equally dangerous: it can cause sweat-
All biochemical
ing, shakiness, hunger, dizziness, and nausea.
reactions occurring in
an organism, including To stave off these highs and lows, diabetics are
reactions that break advised to regulate the amount of sugar in their
down food molecules diet.
and reactions that
build new cell
Because the body breaks down most carbo-
structures. hydrates into sugars, carbohydrates present
the most trouble for diabetics—patients must
INSULIN
keep track of the amount of carbs in their diets.
A hormone secreted
by the pancreas that Not all carbohydrates are the same, however, To combat high blood sugar, many diabetics inject
regulates blood sugar. nor do all types cause spikes in blood sugar. themselves with insulin.
Glucose is absorbed
O O
into the bloodstream
OH OH OH and delivered to cells.
Starch
c. Fibers act as structural Humans do not have an
No human
carbohydrates in enzyme that can break enzyme has
plants. the bonds between the the shape for
glucoses in fiber. binding fiber. Fiber passes undigested
OH CH2OH OH through the digestive
O system and is
eliminated from the
O
body in feces.
Fiber CH2OH OH CH2OH
a. Quicker release of sugar Pancreas When simple sugars enter the bloodstream, insulin binds to cells
Digestible Simple and signals them to take up the sugar. Diabetics have a faulty
Insulin insulin response, which causes high blood sugar.
complex sugars Red blood cell
carbohydrate
2 Capillary
1
3
2 Capillary
1
3
Beta-glucan fiber
another 40 million suffer from low bone den- deteriorates—in women the process accelerates
sity, a condition that can lead to osteoporosis. after menopause. Over a lifetime, women lose
Studies have shown that a diet rich in certain about 35% of dense surface bone and 50% of
nutrients and exercise can either slow the dis- spongy interior bone; men lose 20% of their sur-
ease or prevent it altogether. So Nestlé scientists face bone and about 30% of their interior bone.
have come up with something that they claim While bone gain and loss is a natural phenom-
may help fight osteoporosis: a powdered drink enon, nutrition and exercise influence how
mix that contains nutrients necessary to build dense our bones eventually become and can MINERAL
bone. slow down bone loss. The mineral calcium, for An inorganic chemical
example, is especially important for bone element required by
organisms for normal
Building and Rebuilding Bone health because bone is primarily made up of
growth, reproduction,
Although they seem fixed, our bones are in calcium. Around 99% of the body’s calcium is and tissue
constant flux. They build up and break down locked up in our bones. Calcium is what makes maintenance;
in cycles over a lifetime. By the time we are our bones rigid and strong. The mineral phos- examples are calcium,
iron, potassium, and
20 to 30 years old, our bones are the most phorus is the second most important constitu- zinc.
dense they will ever be. After that, bone mass ent of bone. About 85% of our body’s store of
INFOGRAPHIC 4.6
Diet and Exercise Keep Bones Dense
Foods like milk
Diet and lifestyle contribute to bone density
and broccoli
changes over time. Bones are primarily made
provide us with
of the minerals calcium and phosphorus, which
the minerals
a healthy diet provides.
calcium and
phosphorus.
Muscle contractions during weight-bearing exercise stress bone, stimulating bone cells to deposit
calcium and phosphorus into bone tissue, provided these minerals are present in the diet.
Vitamin C Un-modified
cofactor procollagen Collagen
Enzyme
1. An enzyme that helps 2. The enzyme’s active 3. The enzyme modifies the
make functional collagen site can only bind procollagen and releases
from procollagen requires procollagen in the it for further processing
vitamin C as a cofactor. presence of vitamin C. by other enzymes.
Additional
enzyme
Bone cells Bone matrix containing processing
collagen fibers
from vitamin D, “the other micronutrient and vegetables and diets rich in vitamin E have
needs for optimizing bone health can be easily a lower risk of developing certain cancers. The
met by a healthy diet that is high in fruits and reason for the discrepancy isn’t clear. Some
vegetables.” Five servings a day of fruits and speculate that vitamin supplementation to stave
vegetables should do it (Table 4.1). off disease might work better in people who are
Moreover, researchers are finding that sup- deficient in vitamins—most studies haven’t sep-
plements or the nutrients in fortified foods may arated healthy participants from deficient ones.
not be equivalent to the nutrients obtained Others argue that vitamins may confer health
directly from whole foods. Studies that have fol- benefits only in combination with other as yet
lowed large groups of people who take vitamin unidentified plant compounds. Or, as Ordovas
E or beta-carotene supplements to stave off can- points out, functional foods may simply work
cer, for example, have found no benefit from better in some people than in others. The
these supplements. Meanwhile, epidemiology research defining such populations, however,
studies show that people who eat lots of fruits has yet to be done. Whatever the reason, it is
j A diet rich in vegetables and dairy products meets our micronutrient needs. Otherwise,
nutritional supplements can help fill in dietary gaps.
PROBLEMS PROBLEMS
MINERAL FUNCTION FOOD SOURCES OF DEFICIENCY OF EXCESS
Calcium Bone and teeth formation, blood Dairy products, green Osteoporosis, stunted growth Kidney stones
clotting vegetables, legumes
Iron Components of hemoglobin in red Green vegetables, beef, liver Anemia, fatigue, dizziness, Constipation, risk of
blood cells; carries oxygen headaches, poor concentration type 2 diabetes
throughout the body
Potassium Electrolyte balance, muscle Fruits, vegetables, meat Muscle weakness, neurological Muscle weakness,
contraction, nerve function disturbances heart failure
Sodium Electrolyte balance, muscle Salt, bread, milk, meat Muscle cramps, reduced High blood pressure
contraction, nerve function appetite, neurological
disturbances
Water-Soluble Vitamins: Organic molecules not synthesized by the body. Excess vitamin is
excreted in urine and so does not harm health.
PROBLEMS PROBLEMS
VITAMIN FUNCTION FOOD SOURCES OF DEFICIENCY OF EXCESS
B1 (thiamine) Cofactor for enzymes involved in Leafy vegetables, whole Heart failure, depression None
energy metabolism and nerve grains, meat
function
Folate Cofactor for enzymes involved in Dark green vegetables, nuts, Neural tube defects, anemia None
DNA synthesis and cell production legumes, whole grains
B12 Cofactor for enzymes involved in Meat, milk, eggs Anemia, neurological None
the breakdown of fatty acids and disturbances
amino acids and nerve cell
maintenance
C Cofactor for enzymes involved in Citrus fruits Scurvy, poor wound healing None
collagen synthesis; improves iron
absorption and immunity
Fat-Soluble Vitamins: Organic molecules not synthesized by the body (except vitamin D).
Excess vitamin is stored in fat cells and can harm health.
PROBLEMS PROBLEMS
VITAMIN FUNCTION FOOD SOURCES OF DEFICIENCY OF EXCESS
A (retinol) Component of eye pigment, Fruits and vegetables, liver, Skin problems, blindness Headaches, intestinal
supports skin, bone, and tooth egg yolk pain, bone pain
growth, supports immunity and
reproduction
D Calcium absorption, bone growth Fish, dairy products, eggs Bone deformities Kidney damage
E Antioxidant, supports cell Green leafy vegetables, Neural tube defects, anemia, Fatigue, headaches,
membrane integrity legumes, nuts, whole grains digestive-health problems blurred vision, diarrhea
K Supports synthesis of blood Green leafy vegetables, Abnormal blood clotting, Liver damage, anemia
clotting factors cabbage, liver bruising
USE SPARINGLY:
RED MEAT & BUTTER
REFINED GRAINS: WHITE RICE, BREAD & PASTA
POTATOES
SUGARY DRINKS & SWEETS
SALT
OPTIONAL:
ALCOHOL IN MODERATION
(Not for everyone)
HEALTHY FATS/OILS:
OLIVE, CANOLA, SOY, CORN,
SUNFLOWER, PEANUT
& OTHER VEGETABLE OILS;
DAILY MULTIVITAMIN TRANS-FREE MARGARINE
PLUS EXTRA VITAMIN D NUTS, SEEDS, BEANS & TOFU FISH, POULTRY & EGGS
(For most people)
WHOLE GRAINS:
BROWN RICE,
WHOLE WHEAT PASTA,
OATS, ETC.
clear that no supplement or food additive can should be eating. While there are many food
replace the health benefits provided by food in pyramids, each with slightly different recom-
its most natural and least processed form—at mendations, all emphasize whole grains as a
least not yet. staple food and recommend eating refined
To help and persuade consumers to eat more grains and sweets only sparingly (Infographic
fresh foods, public health experts and the U.S. 4.8).
Department of Agriculture have over the past Nestlé scientists don’t disagree. “It is always
20 years been devising and updating food pyra- better to obtain your nutrients by eating a bal-
mids that show the relative importance of each anced diet in reasonable quantities,” says
food group and how much from each group we Brian Fern, a research scientist at Nestlé. But
people don’t always have the time to eat right, and mackerel also contain vitamin D, but many
he adds. Americans eat relatively little fish.
As an example, Fern points to vitamin D.
Public health experts are increasingly ringing
alarm bells over studies that show Americans “The public shouldn’t think that
are not getting enough of the vitamin, which consuming these foods can
the body synthesizes when exposed to sun- compensate for unhealthy
light. For most people in America with fair to dietary or lifestyle habits.”
olive skin, 15 minutes a day of strong sunshine
is sufficient. But because most people today
–José Ordovas
work in offices, many don’t spend enough time
outdoors. And in the most northern states, the And while nutritionists such as Jeya Henry
sun isn’t strong enough in the winter to pro- and José Ordovas agree that some supplements
duce vitamin D from the small amount of skin or functional foods can help consumers strug-
that is exposed. gling to conform to diets or meet standard
For people who don’t spend much time in the nutrient recommendations, they advise against
sun, taking a vitamin D supplement might be a putting too much faith in substitutes. “Too
good idea, says Fern. In America, milk is forti- often the public trusts and consumes products
fied with vitamin D. But, for various reasons, not based on promises and unfounded claims,”
everyone drinks milk. Oily fish such as sardines says Ordovas. ■
HINT See Infographics 4.1, 4.2,4.5, 4.6, 4.8. 8. What effect would a meal heavy in starch and
fiber have on blood-sugar levels compared to a meal
j KNOW IT heavy in starch alone?
1. Digesting starch releases which of the following
subunits? 9. Starch and fiber are both complex
a. amino acids carbohydrates made of joined glucose subunits.
b. fatty acids From the way our bodies digest both types of
c. monosaccharides carbohydrates, would you say a diet rich in fiber
d. fiber would produce higher or lower blood-sugar levels?
e. proteins Explain your answer.
2. The digestion of starch is a type of metabolic 10. Cell membranes are made of phospholipids.
reaction known as a(n) _______________ reaction. What are the dietary source(s) of phospholipids?
3. Which of the following foods is the most 11. For a person with type 1 diabetes, will insulin be
protein-rich? more effective if taken between meals or at meal
a. olive oil times? Explain your answer.
b. chocolate
c. baby back ribs 12. Nestlé’s bone density–boosting drink, described
d. whole-wheat bread in this chapter, contains, among other ingredients,
e. orange juice calcium and vitamins C and D. Which of these three
nutrients—calcium, vitamin C, and vitamin D—does
4. Which subunit is needed in order to build DNA? each of the following foods contain? Does any food
a. amino acids contain all three?
b. monosaccharides a. organic milk, straight from the cow, with no
c. starch supplementation
d. fatty acids b. milk fortified with vitamin D
e. nucleotides c. oranges
d. orange juice fortified with calcium
5. Eating which of the following will cause blood- e. sardines
sugar levels to spike most rapidly?
a. protein
b. starch ENZYME FUNCTION
c. fiber Enzymes speed up the rate of chemical reactions in
d. fats the body. Many enzymes require “helper”
e. starch and fiber combined substances to function.
6. Which of the following disorders is characterized HINT See Infographics 4.3, 4.4, and 4.7.
by poor regulation of blood-sugar levels?
a. obesity j KNOW IT
b. osteoporosis 13. The substrate of an enzyme is
c. diabetes a. an organic accessory molecule.
d. scurvy b. what is released at the end of an enzyme-
e. all of the above speeded reaction.
c. the shape of the enzyme.
j USE IT d. one of the amino acids that make up the
7. Which of the following molecules can be built enzyme.
directly from protein subunits? e. what the enzyme acts on.
Mighty Microbes
81
Chapter 5 Energy Flow and Photosynthesis
Mighty Microbes
Can scientists make algae into the next global fuel source?
A
s an engineer working for the Navy to turn his attention toward what he felt was the
SEALS in 1978, Jim Sears took a night- world’s biggest problem: dwindling fossil fuel
time scuba dive off the coast of Panama reserves. After he did some thinking and a little
City, Florida, one of many he took to do research, the tiny, glowing organisms that had
underwater research. The dive started out rou- wowed him during his dive more than a decade
tinely, but then, suddenly, glow- earlier came to mind, in part
ing phosphorescent algae Algae also have because of a Web site he stum-
appeared as if out of nowhere. bled across that discussed the
When Sears put his hands out in
the amazing unique properties of algae. He
front of him, sparkling streamers ability to convert realized suddenly that they might
of microbes came off his finger- the energy of be able to help.
tips. “It was magical,” he recalls. sunlight directly Algae are perhaps best known
Sears is an inventor with for the green, red, or bluish hue
into forms of
many and varied inventions to they give to the surfaces of ponds
his credit. When working for the
energy usable by and lakes, but they have other
Navy in the 1970s and 1980s, he other organisms. unique characteristics, too. They
built an underwater speech were among the first eukaryotic
descrambler and a portable mine detector, life forms to appear on our planet, and in many
among other things. Later he moved on to more ways we can thank them for our very existence,
creative ventures, including a “hump-o-meter” because they fill the atmosphere with the oxy-
that could tell farmers when their animals were gen that supports the majority of life on earth.
in heat or mating. Algae also have the amazing ability to convert
But the seeds of his real claim to fame weren’t the energy of sunlight into forms of energy
sown until 2004, when Sears was working on usable by other organisms. This makes them
agricultural electronics. That’s when he began prodigious fuel-producers. Algae convert the
energy of sunlight and produce not just their fuel. “The more I looked into them, the more
own food but also an oil that is very similar to amazing they were,” Sears says.
common vegetable oil. It accumulates inside the And that’s good news, because America is
microbes’ tiny cells, and once extracted, it can desperate for new fuels. After all, Americans
be processed to make biodiesel, gasoline, or jet burn through 378 million gallons of gasoline a
day, enough to fill about 540 Olympic-size
swimming pools. And despite the fact that our
demand will likely increase over the course of
the next 25 years, the sources of our precious
gasoline—petroleum reserves buried deep
underground— are finite, take millions of years
to replenish, and largely lie outside U.S. borders
(Table 5.1).
Scientists and politicians are now turning
toward alternatives such as biofuels, that is,
fuels made from biological material. In an
effort to end our addiction to oil, in 2007 Presi-
dent George W. Bush signed the Energy Inde-
pendence and Security Act, which requires the
United States to produce 36 billion gallons of
renewable fuels by 2022, of which 21 billion
gallons must be advanced biofuels (and not
Bioluminescent algae glow along the shore. corn-based ethanol) (Infographic 5.1).
Petroleum
40% 1% Solar Energy
Renewable
Energy
7% 36% Hydroelectric
Natural Gas
23% 5% Wind Energy
Source: EIA, Renewable Energy Consumption and Electricity Preliminary 2007 Statistics,
Table 1: U.S. Energy Consumption by Energy Source, 2003–2007 (May 2008).
Energy Basics
Energy isn’t just needed to fly planes and drive ENERGY
cars, of course. Energy—defined as the capac- The capacity to do
work. Cellular work
ity to do work—is critical to all life on earth.
includes processes
Energy powers every activity we perform, such as building
from the more obvious ones like breathing, complex molecules
thinking, and running to less obvious activities and moving
substances in and out
like building the molecules that make up our of the cell.
A traffic jam in Los Angeles. bodies. Without a source of energy, all life on
Australia 39,033 United Arab Emirates 5,432 United Arab Emirates 13,340
*In million tonnes of oil equivalent. One tonne equals approximately 2,205 lbs.
Source: EarthTrends and BP plc, 2006.
earth would grind to a halt, like a cell phone be created—they must obtain it from an outside
with a dying battery. source. Humans and other animals obtain the
Organisms can’t simply create energy when energy they need by eating food. We’ve already
they need it, however—as we’ll see, energy cannot seen that our digestive systems break down food
to obtain nutrients (Chapter 4). As these mol-
ecules are further broken down, the energy stored
in the molecules is made available to do work. The
bonds that hold molecular subunits together rep-
resent a form of stored chemical energy; break-
ing these bonds releases that stored energy,
making it available to power cell functions.
Algae could be the world’s next energy source
because these tiny organisms are very efficient
energy converters—the oil they produce is rich in
CHEMICAL ENERGY chemical energy. All they need in order to make
Potential energy this oil is sunlight, carbon dioxide, water, and
stored in the bonds of
biological molecules. The Toyota Algaeus, powered by algae, gasoline, and two key nutrients: nitrogen and phosphorus.
batteries. Give them these tidbits, and algae grow rapidly—
Carbohydrates
• Fermented for
ethanol
Manipulate
• Burned for
added
electricity
nutrients to
increase
oil yield.
Proteins
• Animal
feed
Algae Carcasses
(Biomass)
• Burned for electricity
Grow algae in open ponds Harvest and break open algae and heat
or closed bioreactors. cells. Separate the components. • Organic
fertilizer
some strains double their volume in 12 hours—all made from plants like soybeans and oil palm,
the while accumulating organic molecules inside algae take the prize in terms of how much fuel
their tiny cells. These molecules include oils that they can produce for the amount of space they
can be used to make fuel and sugars that can be take up. According to the U.S. Department of
converted into biofuels like ethanol and butanol. Energy, if American soybean farmers had con-
The latter can be mixed with gasoline to power verted all of their crops in 2007—on about 67
hybrid cars (Infographic 5.2). million acres of land—into biofuel, they would
Sears wasn’t the first to consider algae’s fuel have provided the country with only enough on-
potential. In 1978—the same year Sears took his road diesel to meet 6% of the nation’s needs
fateful night dive—the U.S. Department of (Table 5.2).
Energy started its Aquatic Species Program, On the other hand, if farmers had grown algae
with the goal of exploring algae’s fuel possibili- on this same amount of land in open ponds or
ties. But when oil fell to $20 a barrel in 1996, the containers, they would have produced enough
government abandoned the program, assuming fuel to supply all our country’s diesel needs. And
that oil made from algae would always be too because algae can be cultivated on land that is
expensive. Now, with oil prices much more vola- unsuitable for food crops, production of algal
tile and overall creeping higher and higher, bio- biofuel doesn’t compete with or take resources
fuel from algae has become an attractive option away from food production (which is a common
again. criticism of corn-derived ethanol). Extracting
How do algae stack up against other biofuels? fuel from algae is also less energy-intensive than
Compared to corn-based ethanol and fuels for other biofuel sources. To make ethanol, for
j Biofuels are getting a bad rap as stories of rising food prices and shortages fill the news. But
the environmental, energy, and land-use impacts of the crops used to make the fuels vary
dramatically. Current fuel sources—corn, soybeans, and canola—are more environmentally
damaging than alternatives that are under development.
% OF
EXISTING
U.S. CROP
GREENHOUSE LAND
GAS NEEDED TO
EMISSIONS* PRODUCE
(KG OF CO2 ENOUGH
CREATED Use of resources during growing, FUEL TO
Fuel source PER harvesting, and refining of fuel MEET
MEGAJOULE HALF OF
USED TO OF ENERGY U.S. PROS AND
CROP PRODUCE PRODUCED) WATER FERTILIZER PESTICIDE ENERGY DEMAND CONS
Corn Ethanol 81–85 High High High High 157–262 Technology ready
and relatively
cheap; reduces
food supply
Switch Ethanol –24 Medium- Low Low Low 60–108 Won’t compete
grass low with food crops;
technology not
ready
Wood Ethanol, N/A Medium Low Low Low 150–250 Uses timber
residue biodiesel waste and other
debris;
technology not
fully ready
Algae Biodiesel –183 Medium Low Low High 1–2 Potential for
huge production
levels; technology
not ready
*Emissions produced during the growing harvesting, refining, and burning of fuel; gasoline is 94, diesel is 83. A megajoule is 1 million joules.
Source: Groom et al., Conservation Biology, 2008.
Heat Lost
(Kinetic Energy)
Muscle
Movement
(Kinetic
1. A cyclist takes in stored 2. Digestion breaks Energy) 3. A
At the top of the hill, the cyclist has
(potential) chemical tthe chemical bonds potential energy. As he coasts down the
energy in the form of and releases energy, hill, this potential energy is converted into
an energy bar. which is used to contract kinetic energy, which takes the form of
muscles and generate heat. spinning bicycle wheels and heat.
instance, farmers typically start with corn, which Consider a cyclist who eats a cereal bar
requires more energy to grow than algae do. before an uphill ride. The bar contains poten-
Then they have to ferment the corn into ethanol, tial energy in the chemical bonds that hold
and finally they must harvest the ethanol. It’s a the molecules of that bar together. When the
multistep process that requires precious farm- cyclist eats and digests the bar, digestion
land, clean water, and energy inputs. In addition, breaks those chemical bonds, and the stored
energy has to be transferred, first from sunlight potential energy is released. As the cyclist
into corn, then from corn into ethanol. Algae are climbs the hill, his body converts this potential
far simpler life forms, and therefore more effi- energy into the kinetic energy of muscle con-
cient: using sunlight and carbon dioxide, they traction and heat. At the top of the hill, he
produce fuel automatically. And they can be relies once again on potential energy to get him
POTENTIAL ENERGY
grown on poor-quality lands that could not be downhill. His relatively higher position means
Stored energy.
used for other crops. that he has “positional” potential energy.
With so much talk about dwindling energy As the cyclist coasts down the hill, the friction KINETIC ENERGY
reserves, it’s tempting to think that energy is of the wheels on the ground converts his posi- The energy of motion
or movement.
something that we simply use up over time. But tional potential energy into the kinetic energy
energy cannot be created or destroyed. When of moving wheels and heat. From start to finish, HEAT
energy is transferred from food or fuel to the from cereal bar to spinning wheels, energy is The kinetic energy
organisms or products that use it, that energy is converted from one form into another. With generated by random
movements of
not destroyed—it merely changes form. This is a every conversion, though, some energy is lost as molecules or atoms.
principle known as the “conservation of energy.” heat (Infographic 5.3).
Biofuel from algae has a similar life story: through the last one as they convert the chemi-
algae use the energy from the sun to produce oil cal energy of the fuel into the heat and kinetic
molecules called triacylglycerols that contain energy of motor movement. Just how good your
energy-storing bonds. When these bonds are car is at converting the chemical energy of gas
broken during combustion, they release large into the kinetic energy of car speed determines
amounts of energy that can be used to power your mpg—your miles per gallon. If an engine
machines. The chemical energy in the triacyl- doesn’t combust efficiently, some of the fuel
glycerols is converted to heat energy that warms molecules will undergo chemical reactions and
gas molecules. The expansion of the heated gas be converted to other molecules—like pollut-
molecules (kinetic energy) pushes the pistons in ants—rather than power the pistons as heat. If
a car’s engine, which cause the wheels to move the pistons can’t use the heat efficiently, the
(kinetic energy). heat will leave the car without powering the
The conversion of energy from one form to wheels. At each step of energy transformation,
another isn’t 100% efficient, though. With each energy is lost from the car system and into the
energy transformation, a bit of energy is lost to environment, and then we’re back to the fuel
the environment as heat. This is why our bodies pump one more time (Infographic 5.4).
heat up when we exercise and car engines are
warm after being driven. In the case of a car Energy’s Beginnings
engine, the generation of heat serves a purpose Tom Allnutt calls himself an “algae guy.” While
(to power the pistons), but heat loss to the out- a student at Virginia Tech in the 1970s, he
side of the car is inefficient. This inefficiency is decided on a whim to take a class in phycology—
the reason we need to keep supplying energy to the study of algae—and immediately he was
any system. We eat three meals a day to replen- hooked. Algae fascinate him in part because
ish the energy our bodies have lost as heat and they can survive pretty much anywhere, from
converted into the chemical energy of cells and the scalding thermal vents in Yellowstone
the kinetic energy of movement. Similarly, cars National Park to the dry bitter cold of Antarc-
need a new tank of fuel after they have burned tica, where Allnutt later spent 3 years as a
INFOGRAPHIC 5.5
Autotrophs Convert Light Energy into Chemical Energy
Autotrophs are organisms that carry out photosynthesis,
a process that converts light energy into chemical energy.
Usable Energy:
Some of the chemical energy
Immediate is converted into a form that is
energy
available to power cellular
functions.
Stored Energy:
Photosynthesis Some of the chemical energy
is stored as potential energy in
molecules like oil.
Chloroplast
Chemical
Sunlight
energy
“Photo-” “synthesis”
O2 Glucose
Inputs Outputs
+ + +
Sunlight Water Carbon dioxide Oxygen Glucose
H2O CO2 O2 C6H12O6
only renewable, then, they are also more envi- the sun’s radiation into new cell mass. While glu-
ronmentally friendly when they are burned. cose is the major product of photosynthesis,
Photosynthetic algae (and plants) complete other smaller sugars are produced during the
photosynthesis in two parts: a “photo” part and “synthesis” reactions. Glucose and these other
a “synthesis” part. During the “photo” part, sugars provide the building materials for a vari-
light energy is captured in chemical form. ety of metabolic reactions in the cell—for exam-
During the “synthesis” part, this chemical ple, the assembly of amino acids for protein
energy is used to generate glucose molecules synthesis, and the synthesis of the oils that make
using the carbon atoms of carbon dioxide. The up biofuels.
entire process occurs in an organelle present Mass-producing algae, however, is not as
in leaves and algae called the chloroplast (Info- simple as just putting microbes in a pond with
graphic 5.6). some carbon dioxide, sitting back, and watch- CHLOROPLAST
Through photosynthesis, algae can convert ing them grow. One problem is that algae need The organelle in plant
up to 6% of the sun’s radiation into new cell to be stirred frequently to incorporate carbon and algae cells where
photosynthesis
mass, according to the U.S. Department of dioxide, a process that requires a lot of extra occurs.
Energy—most crop plants convert only 1–2% of energy. Aurora Biofuels, an algae company
Wavelength in nanometers
400 Violet
X-rays
450 Indigo
500 Blue Photons move in
Ultraviolet radiation waves of varying
550 475 nm
length. The human
Green
Near-infrared radiation 600 eye perceives each
650 Yellow wavelength as a
Infrared radiation different color.
700 Orange
750 Red
Microwaves
750 nm
Radio waves
H2O CO2
(from the roots) (from the air)
ATP Chloroplast
Sunlight
Chemical energy from
e– light reactions
Light Carbon
Internal chloroplast reactions ATP reactions
membranes containing
chlorophyll e–
O2 Glucose
(to the air)
Oxygen (O2) Glucose (C6H12O6)
This gas is a by-product of water splitting The carbohydrate product of photosynthesis, glucose,
during the light reactions. contains the chemical energy converted from sunlight and
the fixed carbon from atmospheric CO2.
microorganisms to regenerate after being were restored in this way, one-seventh of the
destroyed—and in the mean- world’s greenhouse gas problem
time, the damaged soil is unable “Algae truly are would be solved because of the
to remove carbon dioxide from vast amounts of carbon dioxide
the atmosphere.
the foundations of that would be pulled out of the
Sears, however, has a solu- our entire planet.” atmosphere by the photosyn-
tion. His new company takes –Jim Sears thetic cyanobacteria in the regen-
small samples of microorgan- erated soil.
isms from healthy soil, grows them in a con- When you think about it, it’s amazing that
tained facility, and then transplants them to organisms like algae and cyanobacteria that
damaged soil, where they spread out and thrive. seem so simple could be so vital to life on earth.
He estimates that if 1 billion hectares of land But they are. Not only did they provide the
j USE IT j KNOW IT
7. Global warming is linked to elevated
12. Photosynthetic algae are
atmospheric carbon dioxide levels. How might this
a. eukaryotic autotrophs.
affect photosynthesis? If global warming should
b. prokaryotic autotrophs.
cause ocean levels to rise, in turn causing forests to
c. eukaryotic heterotrophs.
be immersed in water, how would photosynthesis be
d. prokaryotic heterotrophs.
affected?
Supersize Me?
j What You Will Be Learning
6.1 Body Mass Index (BMI)
6.2 Obesity Is Influenced by Biology and Culture
6.3 Americans Eat Large Portions
6.4 Food Powers Cellular Work
6.5 Glycogen and Fat Store Excess Calories
6.6 ATP: The Energy Currency of Cells
6.7 Aerobic Respiration Transfers Food Energy to
ATP
6.8 Aerobic Respiration: A Closer Look
6.9 Fermentation Occurs When Oxygen Is Scarce
6.10 Photosynthesis and Aerobic Respiration
Form a Cycle
101
Chapter 6 Dietary Energy and Cellular Respiration
Supersize me?
Changing our culture of eating
F
or years Paul Rozin, a professor of psy- what comes with it: obesity has ushered in
chology at the University of Pennsylva- increased rates of heart disease, diabetes, and
nia, was baffled by this question: How other related illnesses. In fact, by 2020 chronic
are the French able to eat rich cheeses, illnesses resulting from obesity will likely kill
butter-laden sauces, fatty meat, and still stay more people than infectious diseases.
slimmer than Americans? Why are people getting heavier? Biologists
As of 2008, a whopping 72% of American argue that humans are predisposed to gain
men and 64% of American women were over- weight. Throughout human evolution, famine
weight or obese. Compare these was the norm, and people had to
figures to the corresponding How are the work hard to grow or hunt and
ones in France: about 56% of gather their food. Our bodies
men and 40% of women.
French able to eat have adapted by storing extra
Americans aren’t the only rich cheeses, food as fat for times when food is
ones tipping the scales in greater butter-laden scarce.
numbers. People around the sauces, fatty How heavy is too heavy? Even
world are getting heavier. As of with a few extra pounds here and
meat, and still
2005, approximately 1.6 billion there, most people still fall within
adults over the age of 15 were
stay slimmer than a healthy weight range. Only
overweight and at least 400 mil- Americans? when our total body fat passes a
lion were obese, according to certain point do the scales tip
the World Health Organization (WHO). By toward unhealthy. That point depends on a BODY MASS INDEX
2020, WHO expects those numbers to double, number of factors, including gender, body type, (BMI)
a figure that will amount to almost half of and frame size. To get a rough estimate, some An estimate of body
fat based on height
today’s global population. Our increasing girth health care professionals rely on the body mass
and weight.
alone wouldn’t be a problem were it not for index (BMI). The BMI estimates body fat from
+ =
Males
40
Females
Average % Obese
30
20
10
0
Japan Italy France Germany Canada United United
Kingdom States
Source: Organisation for Economic Co-operation Country
and Development, Health Data, 2004.
INFOGRAPHIC 6.3
Americans Eat Large Portions
Researchers compared portion sizes in restaurants in
Philadelphia to those in Paris. In all but one restaurant,
U.S. portions were larger at least half the time. The average
portion size in Paris was 277 grams; the average size in For sampled menu items, Numbers >1 reflect larger
Philadelphia was 346 grams. Philadelphians eat an average U.S. restaurants consistently portion sizes in the U.S.,
of 25% more food than Parisians at every meal. serve larger portion sizes. compared to France
Simple
Energy
sugars
4 Calories/gram
Protein
Energy
Amino acids 4 Calories/gram
Fat
Nucleic acid
Fatty acids
and glycerol Energy
9 Calories/gram
The body breaks down
ingested food into subunits,
which then pass into the Nucleotides
bloodstream, which delivers
Not a significant source
them to the body’s cells.
of energy for cells
Scientists measure energy in units called calo- All our activities—everything from thinking
ries. A calorie (in lower case) is the amount of and digesting to sleeping and running—require
energy required to raise the temperature of 1 energy. So all bodies expend some Calories each
gram of water by 1o Celsius. In essence, a calorie day just to stay alive. A person’s daily energy
is a measurement of energy—the capacity to needs largely depend on gender, age, body type,
perform a certain amount of work. On most and activity levels. A sedentary college-age aver-
food labels, the amount of energy stored is age-size male, for example, would need to ingest
calorie
The amount of energy listed in kilocalories, which are also referred to anywhere between 2,200 and 2,400 Calories
required to raise the as kcals or as Calories (the capital “C” indicates per day to power his activities and maintain his
temperature of 1 gram that kilocalories, not calories, are meant). One weight, whereas a football player would need
of water by 1o Celsius.
Calorie is equal to 1,000 calories, or 1 kcal. more than 3,200 Calories a day to power and
CALORIE Of all the organic molecules, fats are the most maintain his. Exercise or other physical activi-
1,000 calories or energy dense: each gram of fat stores approxi- ties require additional energy beyond the
1 kilocalorie (kcal); the mately 9 Calories in its chemical bonds. Proteins basic life-sustaining energy needs of the body.
capital “C” in Calorie
indicates “kilocalorie.” and carbohydrates are about half as energy Consequently, athletes, or those who exercise a
The Calorie is the dense: each gram stores about 4 Calories. great deal, generally need to eat more to fuel
common unit of Clearly, a 200-gram serving of fatty bacon con- their activities than do their less-active peers.
energy used in food
tains many more Calories than does a 200-gram Exactly how much more should an athlete
nutrition labels.
serving of asparagus (Infographic 6.4). eat? Consider the college football player, who
thought. Now suppose that same athlete ate a 8 oz. unsweetened green tea 2
cheeseburger off-season. It would take 1.5 hours
1 large slice whole wheat bread 79
of slow swimming, or 2.5 hours of walking, or 3
hours of cycling at 5.5 miles per hour, to use up ½ cup cooked white rice 102
that extra energy (Table 6.1). 12 oz. nonfat milk 120
Surprisingly, not everyone burns energy at
the same rate. There are people who seem 12 oz. cola 140
to be able to eat to their heart’s content 1 glazed doughnut 200
and hardly gain an ounce. And there are
1 slice thick-crust cheese pizza 256
those who seem to gain weight just by looking
at food. Genetics plays a large role in how 1 Starbucks grande mocha 380
frappucino with whipped
much food each one of us actually needs, but
cream
there are other factors, too—gender, for one.
Men, because their bodies naturally produce 1 McDonald’s Big Mac 540
more muscle-building hormones than do 1 Burger King Whopper 670
women’s, generally have more muscle mass
CALORIES BURNED DURING SELECT ACTIVITIES*
and therefore need to eat more than women
do. Since muscle cells burn more calories ACTIVITY CALORIES/HOUR
than do fat cells, the ratio of muscle mass Sleeping 55
compared to fat content in our bodies is
Sitting 85
another factor.
Standing 100
Putting on Pounds Office work 140
Our bodies are fairly efficient at extracting
energy from food, but we humans eat not only Golf (walking) 240
for sustenance but also for pleasure—which is Gardening (planting) 250
where problems can arise. Many of us eat more
Walking (3 mph) 280+
food than our bodies need. We also have a natu-
ral preference for fatty and sugary foods because Tennis 350+
such foods are energy dense. For our ancestors, Biking (moderate) 450+
it was likely important to load up on those foods
Jogging (5 mph) 500+
to store energy for times when food was scarce.
Today, this ancient taste preference has become Swimming (active) 500+
a vice that snack food companies have become Hiking 500+
very good at exploiting. For the large majority of
us, when we eat Calories beyond what our bod- Power walking 600+
ies require, the extra energy is stored in one of Cycling (stationary) 650
two places: as glycogen in muscle and liver
Squash 650+
cells, or as triglycerides in fat cells.
Glycogen is the energy-storing carbohydrate Running 700+
found in animal cells. You can think of glycogen *Approximate number of Calories burned per hour by a
as a short-term storage system. When we require 150-pound woman.
Fat cell
short bursts of energy—as in a sprint, for exam- could burn fat for energy to carry them through
ple—the body breaks down glycogen to obtain times of food scarcity. Today, people in most of
energy. However, because a gram of glycogen the developed world have plenty of food. But
stores only half as many Calories as a gram of fat they are largely sedentary and eat more Calories
(about 4 Calories per gram versus 9), our bodies than they need—which is why they’ve started to
would have to carry around twice as much gly- pack on, and keep on, the pounds (Infographic
GLYCOGEN cogen to store the same amount of Calories. So 6.5).
A complex animal our bodies store most excess Calories as fat, Because each type of energy-rich organic
carbohydrate, made
up of linked chains of which actually allows us to carry around less molecule that we ingest—whether protein, car-
glucose molecules, weight overall. The downside, however, is that bohydrate, or fat—stores a different amount of
that stores energy for it takes sustained activity to burn fat. The body energy, it’s not only how much we eat but also
short-term use.
burns fats only after it has already used up food what we eat that contributes to weight gain. We
TRIGLYCERIDE molecules in the bloodstream and in stored are more likely to gain weight from a portion of
A type of lipid found in glycogen. ice cream than an equivalent portion of broc-
fat cells that stores For our ancestors who lived during times of coli, for example, because ice cream contains
excess energy for
long-term use.
frequent famine, this system of storing Calories more fat—and therefore more Calories—than
as fat would have come in handy. Their bodies broccoli.
Money Conversion:
Phosphate groups N
N
ATP Adenine
O– O– O–
NO N
–O P O P O P O
Ribose
O O O
Adenosine triphosphate is a
nucleotide that stores chemical
energy in the bonds between
its phosphate groups. Breaking
Make Purchases these bonds releases energy.
Power Cell
Functions
a molecule called adenosine triphosphate bonds is then captured and converted into the
(ATP) that our cells use to carry out energy- molecular bonds that make up ATP. When ATP
requiring functions. bonds are broken, energy is released, allowing
You can think of food as a bar of gold: it has a cells to “spend” their ATP currency and carry
great deal of value, but if you carried that gold out normal cellular functions.
bar to your local convenience store, you The primary process that all eukaryotic
ADENOSINE wouldn’t be able to buy even a cup of coffee with organisms, including plants, use to convert
TRIPHOSPHATE
it. You would first have to convert your gold bar energy stored in food molecules to form ATP is
(ATP)
The molecule that into bills and coins. ATP is the energetic equiva- called aerobic respiration. Of the subunits
cells use to power lent of bills and coins; it’s currency that your released from food, sugar—in the form of glu-
energy-requiring body can actually spend (Infographic 6.6). cose—is the most common source of energy for
functions; the cell’s
energy “currency.”
To make ATP, our bodies first break down all organisms, from bacteria to humans. The
food molecules into their smaller subunits aerobic respiration of glucose can be summa-
AEROBIC through the process of digestion. Once released rized by this equation:
RESPIRATION
from food, such subunits as fatty acids, glycerol,
A series of reactions Glucose + Oxygen ⎯→
that occurs in the amino acids, and sugars leave the small intes-
Carbon dioxide + Water
presence of oxygen tine and enter the bloodstream, which trans-
and converts energy
+ Energy (+ heat)
ports them to the body’s cells. Inside the cells,
stored in food into
enzymes break apart the bonds holding these That is, the bonds holding the glucose molecule
ATP.
subunits together. The energy stored in those together are broken. Oxygen from the air we
Glucose Mitochondria
(from the intestine)
ATP
Carbon dioxide
2. Cells break the chemical bonds of food Water (to the lungs)
molecules to release energy, which is
used to make ATP. Water and carbon
Animal Cell
dioxide are produced as waste products.
Inputs Outputs
+ + +
Glucose Oxygen Carbon dioxide Water Energy
C6H12O6 O2 CO2 H2O ATP
breathe is consumed in the process. When the bon atoms. The process releases CO2, which is
GLYCOLYSIS
bonds of glucose are broken, the energy ultimately exhaled from an organism’s lungs. A series of reactions
released is used to form ATP and heat. Water The electrons stripped from the carbon that breaks down
and carbon dioxide are given off as waste prod- bonds are carried to the inner membranes of sugar into smaller
units; glycolysis takes
ucts of the process (Infographic 6.7). the mitochondria, where they go through the place in the cytoplasm
Aerobic respiration is a multistep process that last step of aerobic respiration: electron trans- and is the first step of
takes place in different parts of the cell. The initial port. Electrons stripped from the bonds in both aerobic
steps of this process, known as glycolysis, take respiration and
glucose contain a lot of potential energy. Dur-
fermentation.
place in the cell’s cytoplasm. Glycolysis is a series ing electron transport, these energetic elec-
of chemical reactions that splits glucose into two trons are passed like hot potatoes down a CITRIC ACID CYCLE
smaller molecules. The products of glycolysis chain of molecules, mostly proteins, in the A set of reactions that
takes place in
then enter the cell’s mitochondria, where the inner mitochondrial membrane. Eventually
mitochondria and
last two steps of aerobic respiration occur. the electrons pass to oxygen molecules, which helps extract energy
During the second step of aerobic respiration, accept the electrons and combine with hydro- (in the form of high-
the citric acid cycle, a series of reactions gen atoms to produce water. As electrons pass energy electrons)
from food; the second
strips electrons from the bonds between car- down the chain, they supply the energy needed step of aerobic
respiration.
Cytoplasm
ELECTRON
TRANSPORT
A process that takes
place in mitochondria to form ATP. This last stage, electron transport, Feel the Burn
and produces the bulk produces the bulk of ATP (Infographic 6.8). Aerobic respiration requires a continual source
of ATP during aerobic We’ve focused on glucose, but cells can also of oxygen (“aerobic” means “in the presence of
respiration; the third
burn fats and amino acids for fuel during aero- oxygen”). If the rate at which cells consume oxy-
step of aerobic
respiration. bic respiration. Because fats generally have gen exceeds the rate at which they take it in
more carbon–hydrogen bonds than do sugars when we breathe, aerobic respiration comes to
FERMENTATION and amino acids, they have more electrons to be a halt; the electron transport chain has no oxy-
A series of chemical
reactions that takes
stripped in the citric acid cycle. More electrons gen to which it can deliver electrons. While gly-
place in the absence of stripped means that more ATP molecules are colysis still occurs in the absence of oxygen, its
oxygen and converts produced during electron transport (which also products are shunted into a different process,
some of the energy explains why a gram of fat contains more Calo- called fermentation, which takes place in
stored in food into ATP.
Fermentation produces ries than a gram of sugar or protein). the cell’s cytoplasm (as opposed to the
far less ATP than does
aerobic respiration.
CHAPTER 6: DIETARY ENERGY AND CELLULAR RESPIRATION 113
mitochondria). Instead of carbon dioxide, fer- take advantage of these fermentation reactions
mentation in humans and other animals pro- when they make alcoholic beverages. Brewer’s
duces a waste product called lactic acid. yeast, for example, is a fungus that ferments
Because fermentation bypasses both the cit- sugar in the absence of oxygen, producing alco-
ric acid cycle and electron transport, much less hol as a result. Humans use brewer’s yeast to
ATP is produced—only about 2 molecules of ATP make beer and wine.
from each molecule of glucose compared to 36 Since fermentation does not break glucose
ATP produced by aerobic respiration (Info- down as completely as does aerobic respira-
graphic 6.9). tion, there is still quite a bit of carbohydrate
In humans, fermentation takes place primar- energy left in such beverages as beer and wine,
ily during bursts of energy-intensive tasks, such about 7 Calories per gram—which explains why
as sprinting or power weight-lifting. It is, in most weight-loss diets eliminate alcohol.
essence, a back-up plan for times when oxygen Even during aerobic respiration, however,
isn’t available. (The panting you experience on our bodies don’t convert every Calorie in food
a treadmill is your body’s way of trying to obtain into ATP. The chemical processes aren’t 100%
more oxygen.) But for many organisms, like cer- efficient, so some energy is always released as
tain fungi and bacteria, fermentation is the heat, which keeps your body warm.
main way of obtaining energy. In some of these It’s important to remember that aerobic res-
organisms, fermentation produces alcohol piration does not create energy—it only
rather than lactic acid as a by-product. Humans extracts it from food. All the food we eat—
INFOGRAPHIC 6.9
Fermentation Occurs When Oxygen Is Scarce
Glycolysis occurs whether or not oxygen is present. In the absence of oxygen, fermentation reactions follow glycolysis.
Fermentation occurs in the cytoplasm and converts the products of glycolysis into lactic acid (or alcohol in some
organisms). The only ATP produced is the small amount produced during glycolysis.
Fermentation
Glycolysis Reactions
Fermentation
products
(e.g. lactic acid
Glucose or alcohol)
2 ATP Mitochondria
This is the only (not used in
ATP produced, fermentation)
far less than is
produced during
aerobic respiration.
Animal cell
whether burger, chicken leg, or Caesar salad— sugar during photosynthesis. In this way, pho-
originally gets its energy from the sun, by way tosynthesis and respiration form a continual
of photosynthesis. Photosynthesizers such as cycle, with the outputs of one process serving
plants and algae capture the energy of sunlight as the inputs of the other (Infographic 6.10).
and convert it into chemical energy stored in
sugar. We then eat this sugar (or eat animals The Culture of Eating
that have eaten this sugar), and that stored Some scientists are interested in understanding
energy becomes available to us. Plants benefit how humans metabolize food in order to find a
from the relationship, too: plants use our car- means of blocking some Calorie-dense mol-
bon dioxide waste as raw material for making ecules from being absorbed by the body. Food
INFOGRAPHIC 6.10
Photosynthesis and Aerobic Respiration Form a Cycle
Photosynthesis and respiration
form a continual cycle, with the Carbon dioxide produced during respiration
output of one process serving as the is used by plants and algae to produce glucose
inputs of the other. and oxygen during photosynthesis.
Light energy
Carbon dioxide
Photosynthesis Respiration
ATP
Glucose
Oxygen
Santé et la Recherche Médicale in Villejuif, their products to give them a longer shelf life SATURATED FAT
France. As American music, movies, and cloth- or a pleasing texture. Hydrogenated fat An animal fat, such as
ing have become pervasive in other countries, behaves in the body much like saturated fat, butter; saturated fats
so, too, have our eating habits. More and more the type of fat found in butter and other animal are solid at room
temperature.
French people are eating large amounts of nutri- products. Studies have shown that eating large
Summary
Q The macronutrients in our food (proteins, Q In the absence of oxygen, fermentation
carbohydrates, and fats) are sources of follows glycolysis and produces lactic acid in
dietary energy. animals (or, in some organisms, alcohol).
Q Fats are the most energy-rich organic
Fermentation produces far less ATP than does
molecules in our diet. Fats contain twice as aerobic respiration.
many Calories per gram as carbohydrates Q Exercise helps burn stored Calories. A
and proteins. combination of eating fewer Calories and
Q When we consume more Calories than we
exercising more will result in weight loss,
use, our bodies store the excess energy in the although hereditary factors play a large role in
bonds of glycogen and body fat. Fats store determining a person’s weight.
more energy than does glycogen. Q During exercise, glycogen is used first.
Q Cells carry out chemical reactions that
Stored fats are tapped only when glycogen
break down food to obtain usable energy in stores have been depleted, as might occur
the form of ATP. during long periods of exercise.
Q Photosynthesis and respiration form a
Q In the presence of oxygen, aerobic
respiration produces large amounts of ATP cycle: the carbon dioxide given off by animals,
from the energy stored in food. plants, and all organisms that perform
aerobic respiration is used by
Q Aerobic respiration occurs in three stages: photosynthesizers to make glucose and
(1) glycolysis, (2) the citric acid cycle, and oxygen during photosynthesis.
(3) electron transport. The first stage occurs
in the cytoplasm, the latter two in
mitochondria. Electron transport produces
the bulk of ATP.
Biologically Unique
121
Chapter 7 DNA Structure and Replication
Biologically unique
How DNA helped free an innocent man
R
oy Brown thought the police were just to death. It was obvious that Kulakowski had
checking up on him when an officer struggled; her body was covered with defensive
knocked on his door one day in May wounds.
1991. Brown, a self-professed hard Although Kulakowski was not involved in
drinker who earned a living selling magazine Brown’s case, officers arrested Brown that day
subscriptions, had only a week before been on suspicion of murder. Eight months later, a
released after serving an 8-month prison term. jury found Brown guilty of homicide and sen-
His crime: threatening to kill the director of the tenced him to prison for 25 years to life. The
Cayuga County Department of Social Services prosecution argued that Brown’s motive was
in upstate New York. A case- revenge against the Depart-
worker had deemed Brown ment of Social Services. But
unfit to care for his 7-year-old what really nailed the case was
daughter. Furious, Brown had testimony from an expert who
threatened to kill the director and other work- stated that bite marks on the victim’s body
ers. But he had served his time. What could the matched Brown’s teeth.
officer want from him now? Brown, however, maintained his innocence.
Three days earlier, police had found the bat- “I never knew Ms. Kulakowski, and I had noth-
tered body of a woman lying in the grass about ing to do with that woman’s death . . . I am truly
300 feet from the farmhouse where she lived. innocent,” he told the court and onlookers after
Someone had burned the place to the ground. the verdict had been announced.
The body was identified as that of Sabina Kula- Even from jail Brown never stopped trying to
kowski, a social worker at the Cayuga County prove his innocence. He repeatedly petitioned,
Department of Social Services. The crime was in vain, for a retrial. Then something unex-
horrific. The murderer had beaten the 49-year- pected happened. Brown uncovered additional
old Kulakowski, bit her several times, dragged evidence that strongly suggested he was not the
her outside, and then stabbed and strangled her perpetrator. The evidence was so compelling, in
122 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
fact, that in late 2004, after Brown had spent 12 DNA as Evidence
years in prison, his lawyers decided to contact How can scientists use DNA to identify a person?
the Innocence Project—a nonprofit organization The answer lies in the chemical makeup of this
founded in 1992 by Peter Neufeld and Barry molecule, often referred to as the “blueprint of
DEOXYRIBONUCLEIC
Scheck of the Benjamin N. Cardozo School of life.” Deoxyribonucleic acid, or DNA, is the
ACID (DNA) Law in New York City. Their mission: to use DNA hereditary molecule that is common to all life
The molecule of evidence to free people wrongly convicted of forms—from plants to bacteria to fungi—and
heredity, common to crimes. that is passed from parents to offspring. DNA
all life forms, that is
passed from parents When the jury convicted Brown in 1992, ana- serves as the instruction manual from which
to offspring. lyzing crime scene evidence for traces of DNA we are built; it’s the reason why you look like
wasn’t established practice yet, so DNA was your parents, an aunt, or perhaps even a
CHROMOSOME
rarely used as evidence in criminal cases. But grandparent.
A single, large DNA
molecule wrapped about a decade later, using DNA evidence in Where can you find DNA? The molecule
around proteins. court cases became standard practice as science exists inside the nucleus of almost every cell in
Chromosomes are increasingly showed that it was an extremely our body in the form of chromosomes, strands
located in the nuclei of
most eukaryotic cells.
accurate way to match crime scene evidence to of DNA wound around proteins. Humans have
perpetrators. 23 pairs of chromosomes in the vast majority
INFOGRAPHIC 7.1
What Is DNA and Where Is It Found?
Deoxyribonucleic acid, or DNA,
is the hereditary molecule common Each human cell has 23 pairs of
to all living organisms. It is the instruction chromosomes; one chromosome
manual from which an organism is built. of each pair is inherited from the
mother, the other from the
father. The 23rd chromosome
pair determines a person’s sex.
Cell
Chromosome
Nucleus
DNA molecules
are organized into
discrete structures If a single DNA molecule were stretched
called chromosomes. out it would be 1 to 3 meters long.
Each chromosome
consists of a single,
long DNA molecule
wrapped around proteins.
124 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Peter Neufeld and Barry
Scheck, founders of the
Innocence Project.
Some evidence commonly presented in tain way, pulled out, and where on the body it
criminal cases can be unreliable, including came from. Hair samples can exclude a suspect,
bite-mark analysis. In fact, studies show error but not positively identify one.
By contrast, each person’s DNA is unique.
“What we really hope to do now is use DNA as the To understand how DNA varies from person to
gold standard of reliability to weed out junk person, consider its structure. DNA is made up
of two strands of molecules, which are called
science.” —Peter Neufeld
nucleotides, linked together in long chains.
rates—the rate at which experts have falsely Each nucleotide has three parts: a sugar, a
identified bite marks as belonging to a particu- phosphate, and a base. The phosphate group
NUCLEOTIDES lar person—as high as 91%. Hair analysis can be of one nucleotide binds to the sugar group of
The building blocks of equally troublesome. In dozens of cases, Inno- the next nucleotide to form a long strand
DNA. Each nucleotide cence Project lawyers found that forensic scien- of nucleotides. Then, the two strands of
consists of a sugar, a
tists had testified that hairs from crime scenes linked nucleotides are bound together and
phosphate, and a
base. The sequence of matched the accused, explains Neufeld. But twisted around each other to form a spiral-
nucleotides (As, Cs, when scientists subsequently tested the DNA shaped double helix. The sugars and phos-
Gs, Ts) along a DNA inside the follicle cells from those hairs, the phates form the outside “backbone” of the
strand is unique to
each person.
DNA didn’t match. helix and the bases form the internal “rungs,”
The problem is that hair analyses, performed like steps on a twisting ladder. The bases are
DOUBLE HELIX under a microscope, can reveal only certain held together by a hydrogen bond (Infographic
The spiral structure characteristics; it can distinguish whether hair 7.2).
formed by two strands
of DNA nucleotides is human or animal, show a person’s ancestry The nucleotide rungs, made up of bases, are
bound together. (because of ethnic differences in hair texture), most useful in DNA profiling. There are four dif-
or whether the hair has been dyed, cut in a cer- ferent possible nucleotide bases: adenine (A),
126 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Kary Mullis receiving a Nobel Prize (in 1993) for developing the polymerase chain reaction.
A .M.—the same time the victim’s neighbors there’s no mistakes. DNA is God’s creation and
alerted the fire department that the farmhouse God makes no mistakes.”
was ablaze. Five days after Brown mailed his letter, Bench
The statements further noted that Bench, who threw himself in front of an Amtrak passenger
came home highly intoxicated, had left the bar at train and died instantly.
approximately 12:30 A .M. That left 60 to Soon after, the Innocence Project team took
75 minutes unaccounted for until he arrived on Brown’s case and filed a motion to have Kula-
home—although he lived only a mile from the bar. kowski’s nightshirt tested at a New York State
When Bench came home, he immediately went crime lab for DNA. The nightshirt was not only
inside to “wash up,” according to Heisner. bloodstained, it was also stained with saliva.
Brown realized that Bench would have had to Since both saliva and blood contain cells that
drive by the farmhouse to get home from the bar carry DNA, scientists could chemically extract
and thought it strange that Bench would not the DNA from the cells to create a DNA profile
have noticed the raging fire on his own prop- of the perpetrator.
erty. While not conclusive, this new evidence
was enough to prompt Brown’s lawyers to con- Making More DNA
tact the Innocence Project for help. In theory, creating a DNA profile is simple
Meanwhile, Brown decided to write Bench a enough, but there is a huge practical hurdle:
DNA PROFILE letter detailing what he had found and urge him having enough crime scene DNA to analyze.
A visual to confess. He warned him of his intent to obtain Although all body fluids and materials contain
representation of a a DNA test on evidence from the murder. “Judges cells that house our DNA, the amount left at
person’s unique DNA
can be fooled and juries make mistakes,” he crime scenes is very small. Without some way
sequence.
wrote, “[but] when it comes to DNA testing to increase the amount of DNA in a saliva stain,
INFOGRAPHIC 7.3
DNA Structure Provides a Mechanism for DNA Replication
Cell reproduction is a fundamental feature of life. For cells to reproduce, they must first replicate their DNA so that each
new cell contains a copy of the DNA molecule. Base pairing between DNA strands guides replication of two new strands.
Semi-conservative
1. Hydrogen bonds holding replication:
nucleotide base pairs
together break and the
helix is unwound.
2. An enzyme called
DNA polymerase adds
complementary nucleotides
(green) to a new strand using
the rules of base pairing,
A with T and G with C.
A
New T C
(green)
G 3. At the end, two copies of
the original DNA exist. Each
G
T
molecule consists of an
C
Old
A
(blue)
T
G
A
128 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 7.4
The Polymerase Chain Reaction Amplifies Small Amounts of DNA
The polymerase chain reaction (PCR) is similar to DNA from a sample
naturally occurring DNA replication, except that it Nucleotides A, T, G, C
occurs in a test tube and only replicates specific regions of DNA polymerase During each round of PCR:
a DNA molecule. From a starting sample of just a few
The two nucleotide strands separate,
molecules of DNA, PCR can make billions of copies.
Primers and each strand serves as a template
for the addition of nucleotides
DNA region
according to base-pairing rules:
to be replicated
A with T, G with C.
A T
G C
C G
Round 1
A T
A T
G 1. Heating C
C separates DNA G
A strands. T
Round 2
A
T
A T
G C G C
C G C G
A T A T
Round 3
2. Cooling allows DNA polymerase
to pair new nucleotides with the
original template strands.
> 1 billion copies (Round 30)
INFOGRAPHIC 7.5
DNA Profiling Uses Short Tandem Repeats
DNA profiling takes advantage of the fact that no two people have the same exact nucleotide sequence. The specific regions of
DNA that forensic scientists analyze are those that contain short tandem repeats (STRs). STRs are short stretches of repeated
DNA sequences. People differ in the number of copies of an STR sequence found along their chromosomes.
1 2 3 4
1 2 3 4 5 6
Person 2
1 2 3 4
Person 3
130 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
they can be of two different lengths—four
Each human cell contains vast amounts of DNA— repeats of AGCT on one chromosome and six
each cell carries on the order of 3 billion repeats of AGCT on the other chromosome,
nucleotide base pairs in its genome. for example. It is these differences in STR
lengths that forensic scientists use to distin-
guish between individuals (Infographic 7.5).
In addition to comparing lengths of AGCT
report was more conclusive: seven separate repeats, DNA profilers use STRs because these
stained pieces of the victim’s nightshirt con- DNA sequences differ from other types of DNA
tained DNA. found in our genome. Scientists divide DNA
Moreover, the report went on to state that six sequences into two general categories: those
of the pieces yielded mixtures of DNA, contain- that contain instructions for making proteins,
ing DNA from the victim and from another per- called coding regions, and those that do not.
son who was male. STRs are found in the so-called noncoding
regions of our DNA. While coding sequences
are extremely similar from person to person
DNA Profiling: How It Works (99% identical, to be precise), noncoding
Once cells from crime scene evidence are recov- sequences vary much more between individu-
ered, the next step is to analyze the DNA con- als. This variation in noncoding sequences pro-
tained within them. Human cells contain vast vides a kind of genetic fingerprint, which can
amounts of DNA—there are on the order of 3 bil- be used to identify someone uniquely.
lion nucleotide base pairs within the 23 chromo- Because they do not code for proteins, scien-
GENOME somes that compose the human genome. tists had long thought that noncoding regions
One complete set of What’s more, because each cell carries two sets served no purpose and dubbed them “junk
genetic instructions
of chromosomes—one set inherited from each DNA.” They now know that these regions, which
encoded in the DNA of
an organism. parent—there are approximately 6 billion make up about 98% of the human genome, do
nucleotide base pairs per cell. Figuring out the have important functions. For example, some of
SHORT TANDEM sequence of every nucleotide in the genome the noncoding DNA plays a regulatory role, con-
REPEATS (STRs)
Sections of a would be extremely time consuming and trolling how and when the coding regions are
chromosome in which expensive. So instead, forensic scientists use a used. And of course the presence in our genome
DNA sequences are short cut—they employ PCR to amplify specific of these noncoding regions is what makes DNA
repeated. profiling possible. (We’ll have more to say about
segments of DNA, and analyze just these seg-
CODING REGIONS ments. These segments are known as short coding and noncoding regions of DNA in Chap-
Sequences of DNA tandem repeats. ter 8, when we discuss gene expression and pro-
that serve as Short tandem repeats (STRs) are blocks tein synthesis.)
instructions for
of repeated DNA sequences found at points To create a DNA profile, scientists first employ
making proteins.
along our chromosomes. They are a bit like PCR to increase the amount of DNA at multiple
NONCODING nonsense words in our DNA: the sequence STR regions. Second, they use a method called
REGIONS AGCT repeated over and over again, for exam- gel electrophoresis to separate the replicated
DNA sequences that
do not hold ple. While all of us have STRs in the same STRs according to their length. Shorter STRs—
instructions to make places along our chromosomes, the exact those with fewer numbers of repeats—are
proteins. length of each STR varies from person to per- smaller and travel farther in the gel; longer
son. At a single STR site, one person may carry ones do not travel as far. When visualized with
GEL
ELECTROPHORESIS the AGCT sequence repeated six times while fluorescence, the separated segments of DNA
A laboratory another person might carry the AGCT create a specific pattern of bands that is unique
technique that sequence repeated four times. Also, since we to each person. It is this unique pattern that is
separates fragments
inherit two copies of every chromosome, called a DNA profile. Scientists can then com-
of DNA by size.
every person has two copies of each STR, and pare band patterns or profiles among people
132 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Roy Brown with his family
upon his release from prison.
INFOGRAPHIC 7.7
addition, they are lobbying for legislation to
DNA Profiling Uses Many Different STRs ensure that evidence from crimes is properly
collected and maintained, and also to ensure
To create a DNA profile, scientists analyze 15 different STRs (yellow boxes)
scattered among our chromosomes. Sharing the same number of repeats that anyone convicted of a crime can gain access
at any particular STR is relatively common — typically 5% to 20% of to DNA testing.
people share the same pattern at any one STR site. But it is the combined “The key is that DNA really gives us an oppor-
pattern of STR repeats at multiple sites that is unique to a person; the more
STRs tested, the more discriminating the test becomes.
tunity to start making the other institutions in
the system more scientific and reliable as well,”
says Neufeld.
An STR region on
TPOX chromosome 11
Vindication
D3S1358 The DNA that the New York State crime lab
extracted from the victim’s nightshirt contained
TH01 a mixture of DNA from the victim and another
D5S818 D8S1179
VWA person who was male. Analysis showed that this
FGA male DNA, however, did not match Roy Brown’s.
D7S820
CSF1PO DNA evidence excluded him as Kulakowski’s
murderer.
1 2 3 4 5 6 7 8 9 10 11 12
Additional testing eventually linked that
AMELX DNA evidence to Barry Bench. After Bench’s
suicide, of course, he couldn’t provide DNA
directly. So lawyers pursued the next best
D13S317
D16S539 D18S51 D21S11
AMELY option: a DNA sample voluntarily donated by
Bench’s biological daughter, Katherine Eck-
13 14 15 16 17 18 19 20 21 22 X Y stadt. Because we all receive one set of chromo-
somes from our mother, and one set from our
134 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Chapter 7 Test Your Knowledge
136 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Milestones in Biology
137
Milestones in Biology
138 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
I
n 1953, with inflated egos, James Watson
and Francis Crick announced to a crowd in
their favorite pub in Cambridge, England,
that they had found the secret of life. Given
the nature of their discovery, they had every
right to boast: they had finally revealed the
structure of DNA. They had succeeded where
other scientists had failed, and they were proud.
And although they likely didn’t realize it at the
time, theirs was a discovery that would usher in
an explosion of research on DNA and genetics
and push forward the study of anthropology,
evolution, and medicine.
But Watson and Crick’s success wasn’t merely
the result of a marriage between two great
minds. Scientific breakthroughs rarely result
from single scientists working in a vacuum.
Rather, breakthroughs happen after many
incremental discoveries made by different sci-
entists over years. And so it was with DNA. In
addition to their own insight, Watson and Crick
built on the discoveries of others. They also had
luck on their side.
James Watson was an
American scientist who in
It was a discovery that 1951 accepted a research posi-
would usher in an tion at Cambridge University
explosion of research on in England, where he met
Francis Crick. Crick was a
DNA and genetics.
Ph.D. student at the time,
studying protein structure
with a technique called x-ray crystallography.
Given their varied backgrounds, the men
didn’t appear obvious collaborators. Watson
was a prodigy. Twelve years younger than Crick,
he had earned his Ph.D at 22. Crick, by contrast,
was a late bloomer. He was 38 years old by the
time he had his Ph.D. But what they did share
was intellectual curiosity. Both had changed
their research focus several times. By their own
admission, both were more interested in solving
current hot topics in science—like the structure
of DNA—than pursuing the more obscure sci-
ence that each had trained to do.
Although DNA was first observed in cell
nuclei in the late 1860s, it took almost a century
before scientists realized its importance. For a
long time, the prevailing belief was that proteins
Adenin
e
structure of proteins and had built a molecular nin
A
e
Ad
e
model showing that some proteins exist as a A Cyt
osin
single-stranded, twisting helix. He backed up his e
T
C
model with lab experiments to prove his structure
Thy
min
was correct. If an eminent scientist like Pauling
e
could model a structure without first conducting
laboratory experiments, Watson and Crick
thought they might be able to do the same with
DNA.
Using wire and metal, Watson and Crick Rosalind Franklin and the Shape of DNA
began building scale models of DNA on the basis
of existing evidence about the chemical struc- Franklin’s 1951 x-ray diffraction studies of DNA showed that the structure
was likely helical, involving two strands that run in opposite directions,
ture of nucleotides. They initially built a three-
and that the phosphate groups were on the outside of the molecule. X-ray
helix model with the phosphate groups on the diffraction involves shooting x-rays at a crystallized version of a molecule and
inside and the bases radiating outward. But recording on film how the x-rays scatter when they bounce off its surface. The
experts who analyzed the structure deemed it image shown here is a view from the end of a DNA molecule looking
down its center.
chemically unstable.
Then came a crucial finding. In 1951, Watson
attended a lecture by a young scientist named
Rosalind Franklin. In her laboratory at King’s
College, London, she had been creating x-ray
diffraction pictures of DNA. X-ray diffraction
analyzes the way x-rays bounce off a sample of
material to determine characteristics of the
sample such as physical structure and chemical
composition. Franklin had observed that
increasing the humidity of a DNA sample could
cause it to elongate. She speculated that if the
phosphate part of the DNA formed the outside Rosalind Franklin X-ray diffraction image of DNA
of the molecule, water available from an July 25, 1920–April 16, 1958 The signature “X” in the middle of this
picture suggests a double-stranded helical
increase in humidity would readily interact
structure. The symmetry of the image
with it. This form of DNA would more closely suggests that the molecule is uniform in
resemble that found in the aqueous cell width along its length.
environment.
140 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Erwin Chargaff’s Work Provided a Clue to Base Pairing
Erwin Chargaff studied the nitrogenous bases of DNA. He found that no matter which DNA molecule he analyzed, it always
contained equal amounts of adenine and thymine bases and equal amounts of cytosine and guanine bases. These data
suggested that adenine must pair with thymine and that cytosine must pair with guanine. This base pairing further supported
the idea of a double-stranded DNA structure.
Thymine H Adenine
H 3C O H N N H
H N H N N
N N
Within any DNA molecule: O H
% adenine = % thymine
% cytosine = % guanine H
Chargaff’s Rule of Base Pairing H N H O N H
H N H N N
N N
Erwin Chargaff O H N
August 11, 1905-June 20, 2002 Cytosine H Guanine
Franklin’s contribution didn’t end there. site directions. To construct the model, Crick
She also discovered other important facts also built on a discovery made a few months
about the structure of DNA. Working with a earlier. In 1952, Erwin Chargaff had found that
graduate student, Raymond Gosling, she found DNA contained equal amounts of adenine and
that her x-ray diffractions confirmed that the thymine and equal amounts of guanine and
elongated form of DNA had all the characteris- cytosine. This information helped Watson
tics of a twisting helix. Maurice Wilkins, who and Crick deduce how the bases were paired:
was Franklin’s peer, was also studying DNA adenine with thymine and cytosine with
guanine.
The final double-helix model so perfectly fit the The final double-helix model so perfectly fit
experimental data that the scientific community the experimental data that the scientific com-
munity almost immediately accepted it. Wat-
almost immediately accepted it.
son, Crick, and Wilkins published their paper
structure at the time. In 1953, Wilkins saw on the structure of DNA in the prominent jour-
Franklin’s best unpublished x-ray picture of nal Nature in the same issue alongside Frank-
DNA and showed it to Watson without Frank- lin’s. In 1962, Watson, Crick, and Wilkins
lin’s knowledge. “The instant I saw the picture shared the Nobel prize in physiology or medi-
my mouth fell open,” Watson recalled in his cine. But what about Franklin? Franklin had
memoir of the discovery, The Double Helix, died of cancer in 1958, at the age of 37. Nobel
published in 1968. The sneak preview “gave prizes aren’t awarded posthumously.
several of the vital helical parameters.” Controversy over whether Franklin has been
With that clue in hand, Watson and Crick adequately recognized continues. Although Wat-
then took a crucial conceptual step and sug- son and Crick acknowledged her contribution to
gested that the molecule was made of two their research in their article in Nature, the extent
chains of nucleotides. Each formed a helix, as to which her input helped them build their DNA
Franklin had found, but they spiraled in oppo- model was revealed only much later in Watson’s
1968 book, published 10 years after Franklin’s took Franklin’s critical x-ray diffraction photos
death. For example, at the time Nature published without her knowledge or consent and showed
the papers on DNA structure, Franklin’s paper them to Watson out of jealousy or disdain.
was perceived as mere supporting evidence. But
it was her data that helped Watson, Crick, and
Wilkins clinch the structure. Some historians
“It would have been impossible to give the prize to
argue that sexist attitudes prevented her from Maurice and not to [Franklin because] she did the
receiving the acclaim she deserved before she key experimental work.” –Francis Crick
died. At the time, female scientists in the bio-
medical sciences were few and frequently con- Despite controversy, Franklin’s contribution
fronted by negative attitudes from their male to the discovery has never been completely
peers. “I’m afraid we always used to adopt—let’s ignored, and she is now recognized as having
say, a patronizing attitude towards her,” Crick been a top-notch scientist: her notebooks show
publicly commented after Watson’s book was that without her thorough scientific research
published. He added that if Franklin had lived, and original ideas, we would have had to wait
“It would have been impossible to give the prize much longer for what is still considered to be
to Maurice and not to her” because “she did the one of the most important discoveries in
key experimental work.” biology. ■
Although it was quite normal for colleagues to
share data, some have even argued that Wilkins
142 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Chapter 8 Genes to Proteins
143
Chapter 8 Genes to Proteins
Medicine
from milk
Scientists genetically modify animals to make medicine
I
n a Massachusetts barn nestled among wil- number of blood donors. Transgenic goats,
low and oak trees, rows of juglike machines however, can produce massive amounts of the
drone in a constant hum. Goats, dozens of drug in a relatively short period of time. More-
them, are being milked. But this is no ordi- over, relying on a herd of goats instead of human
nary dairy operation. This farm is among several volunteers ensures a consistent supply. And
worldwide practicing the art of “pharming”— because the animals live in a controlled envi-
using genetically modified animals to churn out
therapeutic drugs.
“This is very exciting, it is novel and has great
The first drug produced from such trans-
genic animals is already available, manufac- potential for where we can go with this new
tured by GTC Biotherapeutics, a firm based in technology.” —Bernadette Dunham
Framingham, Massachusetts. The drug con-
sists of a human protein called antithrombin ronment, there is less risk of transmitting infec-
that was extracted from transgenic goats’ milk. tions such as HIV and hepatitis to healthy people
Antithrombin is most commonly used to treat through contaminated donor blood.
patients who either inherit or acquire a defi- Because of all these advantages, some people
ciency of the antithrombin protein, which puts are predicting that transgenic animals may one
them at risk of developing dangerous blood day replace human donors as the source for
clots. therapeutic agents extracted from blood. “This
For decades, scientists had extracted anti- is ver y exciting, it is novel and has
thrombin from human blood donations. But great potential for where we can go with this
blood contains only small amounts of anti- new technology,” Bernadette Dunham, director
thrombin, and the supply depends on the of the FDA’s Center for Veterinary Medicine, told
144 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
TRANSGENIC
Refers to an organism
that carries one or the Washington Post in February 2009, when All proteins are made of the same building
more genes from a the company’s drug for antithrombin defi- blocks called amino acids. There are 20 differ-
different species. ciency was approved for market. ent amino acids in all. All amino acids have the
PROTEIN
same basic core structure, but each also has a
A macromolecule Antithrombin: From Gene to Protein unique chemical side group that distinguishes
made up of repeating Antithrombin is a protein. Recall from Chapter the amino acids from one another. Amino acids
subunits known as 2 that proteins are one of the four main macro- bond together to form linear chains. The human
amino acids, which
determine the shape molecules that make up cells. Proteins have antithrombin protein is a chain of 432 amino
and function of a myriad functions in the body: they allow our acids. Many human proteins are in this size
protein. Proteins play muscles to contract, give our hair and skin its range, but chain lengths vary from just a few to
many critical roles in
texture, and facilitate the thousands of chemi- thousands of amino acids. The longest human
living organisms.
cal reactions that occur in our cells. In fact, protein, titin, is a single chain of 34,350 amino
AMINO ACIDS proteins play a huge role in all basic cellular acids.
The building blocks of functions. Proteins can perform such a variety The sequence of amino acids in any given
proteins. There are 20
different amino acids.
of different tasks because they come in many chain makes each chain unique, and also deter-
shapes and sizes. mines how that chain ultimately folds into a
INFOGRAPHIC 8.1
Amino Acid Sequence Determines Protein Shape and Function
Linear Amino Acid Chain
Amino acids bind together in linear chains. In this linear form a chain does not yet have a specific function.
CH3
Core structure Side groups O NH2
H
S CH3 CH3 CH3 CH3 C
N
CH2 CH CH3 CH3 CH OH CH2 CH2
met leu gly val leu ala ser glu pro trp Core
structure
Functional
Chemical interactions between amino acid side groups
three-dimensional protein
and water direct three-dimensional folding. The overall
shape of the protein including the placement of its
Function A
side groups determines its ultimate function.
CH3 O NH2
H
S CH3 CH3 C CH3 CH3
N H +
CH2 CH3 CH3 CH OH CH2 CH NH
met trp gly val leu ala ser glu leu his
146 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 8.2
Chromosomes Include Gene Sequences That Code for Proteins
Chromosomes have many
genes along their length. Each
Gene: Protein:
gene carries instructions to
A section of DNA When a gene is turned “on,”
make at least one protein.
that contains a or expressed, the encoded
nucleotide sequence protein is produced.
with the instructions
to make at least
one protein.
Antithrombin
gene
Gene expression
Chromosome 1 Antithrombin
Chromosomal region containing protein
two closely-spaced genes
Because proteins play such important roles in gene inside a cell is “expressed,” we mean
the body, most drugs are either chemicals that that the cell is making the protein encoded by
interact with specific proteins, or, like anti- that gene. In other words, our genes are the
thrombin, are themselves protein molecules. master instruction manual of our bodies;
GENE Where do proteins come from? Just as cells they dictate what proteins are made, when,
A sequence of DNA make DNA out of building blocks that we, in and how many. Another way of saying this is
that contains the
information to make
part, obtain from food, cells also make proteins that genes provide our genotype, but it is the
at least one protein. using amino acid building blocks from our diet. proteins specified by those genes that, to a
But DNA and protein are not equals when it large extent, determine our physical traits, or
GENE EXPRESSION comes to their function in cells. Rather, the rela- phenotype.
The process of using
DNA instructions to tionship between the two is hierarchical, with The antithrombin gene, for example, sits on
make proteins. one directing the production of the other. chromosome 1 and holds instructions to make a
The instructions to make proteins are chain of 432 amino acids that folds into the
GENOTYPE
encoded in our DNA—our genes. A gene is a seg- antithrombin protein. When cells express the
The genetic make-up
of an organism. ment of DNA that contains instructions for antithrombin gene, it means they produce anti-
making at least one protein. Genes are particu- thrombin protein.
PHENOTYPE lar nucleotide sequences organized along the In the body, antithrombin protein prevents
The physical
attributes of an
length of chromosomes, with each chromo- blood from clotting. The protein plays a regula-
organism, including some carrying a unique set of genes. The pro- tory role by inactivating enzymes that promote
both observable and cess of synthesizing a protein from the blood clotting. In this way, antithrombin pre-
internal or non- information encoded in a gene is called gene vents blood from clotting in the wrong place and
observable traits.
expression (Infographic 8.2). When we say a causing a stroke or a heart attack.
ALLELES
Alternative versions of Antithrombin deficiency may result in
the same gene that thrombosis, a blood clot that restricts
have different blood flow. Thrombosis in blood vessels
nucleotide sequences. within the heart or lungs can kill.
148 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 8.4
Genes to Proteins: Different Alleles Influence Phenotype
Versions of a gene with different nucleotide sequences are called alleles. Alternate nucleotide
sequences change the type of protein coded for by a gene.
Gene expression
Gene expression
antithrombin gene both code for defective pro- called Biogen, it occurred to him that producing
teins, antithrombin deficiency results (Info- drugs in a mammal’s milk might be more efficient
graphic 8.4). than existing methods of large-scale protein pro-
People with inherited antithrombin deficien- duction. The mammary gland is a natural protein
cies usually take medication to thin their blood factory, he reasoned. To nourish their young, all
and prevent clots. At times when the risk of clots mammals produce proteins and secrete them
is high—during surgery, for example—they into their milk.
receive antithrombin treatment. Meade had been experimenting with getting
But it takes 50,000 blood donors to produce genes from various organisms into hamster
1 kilogram of antithrombin. A single trans- cells, which could be grown in large numbers in
genic goat can produce the same amount in the laboratory, allowing scientists to purify sig-
her milk in just one year, according to GTC nificant amounts of protein from the cells. This
Biotherapeutics. method was effective, and in fact is still used
today to express and harvest proteins of inter-
Making Transgenic Goats est. But wouldn’t it be more efficient, Meade
More than 20 years ago, when Harry Meade was wondered, to transfer a gene into a large mam-
working as a research scientist at a company mal, such as a goat, so that the gene is expressed
150 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 8.6
Making a Transgenic Goat
Hybrid gene
Gene
expression
genic organisms are also called genetically Such gene-swapping technology also has an
modified organisms (GMOs). Transgenic important application in medicine: in gene
crops such as corn and soybean usually con- therapy scientists attempt to replace a per-
tain genes for natural pesticides, which help son’s defective gene with a healthy one, an
GENETICALLY the plants fight pests and reduce the amount approach that can already treat, and in some
MODIFIED of pesticide a farmer must use. Transgenic cases cure, debilitating diseases such as severe
ORGANISM (GMO)
An organism that has animals serve many purposes; sometimes combined immunodef iciency syndrome
been genetically they are used in research to study a gene’s (SCID)—a disorder in which babies are born
altered by humans . function, other times they can be used for with deficient immune systems. Researchers
a specific commercial purpose, such as pro- hope that gene therapy might one day help
GENE THERAPY
A type of treatment ducing medicines or other marketable prod- treat several types of disorders caused by
that aims to cure ucts. Spider silk, for example, is a very strong, defective genes, such as cystic fibrosis, Hun-
disease by replacing resilient fiber that can be produced in trans- tington disease, and hemophilia.
defective genes with
genic animals or in plants that carry spider Despite the many actual and potential bene-
functional ones.
genes. fits of genetic engineering, mixing and match-
modified cousins were to escape into the envi- ment: DNA. Just as you would be forbidden to MESSENGER RNA
ronment and mate with the natural population; borrow a rare manuscript from the library, and (mRNA)
the consequences are unpredictable. would instead have to rewrite the characters in The RNA copy of an
Although the idea of genetically engineering it onto another sheet, the cell cannot take DNA original DNA sequence
made during
animals may be disquieting to some, humans out of its library—the nucleus. It must first transcription.
have been tampering with the natural evolution make a copy—the mRNA. The cell can then take
of farm animals for centuries by selectively this mRNA copy into the cytoplasm, where it is RNA POLYMERASE
The enzyme that
breeding them to have desirable traits. More- translated into a protein.
accomplishes
over, from an animal-rights point of view, trans- Let’s take a closer look at both steps. Tran- transcription. RNA
genic goats are treated no differently from goats scription begins when an enzyme called RNA polymerase copies a
farmed for their milk and meat. polymerase binds to the regulatory sequence strand of DNA into a
complementary
That said, the prospect of being able to geneti- of DNA just ahead of a gene’s coding sequence. strand of mRNA.
cally modify—even clone whole organisms—for At that site, cellular machinery unwinds the
152 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 8.7
Gene Expression: An Overview
Gene expression is the process of converting the genetic information of DNA into the sequence of a protein.
Gene expression has two main steps: transcription and translation.
C C A C A G G A G C G T
DNA sequence
mRNA
Nucleus 1. Transcription: DNA to mRNA Transcription
Transcription copies the coding sequence
of DNA into the complementary
messenger RNA (mRNA) sequence.
G G U G U C C U C G C A
Protein
2. Translation: mRNA to protein
The protein is released by the Translation occurs on a ribosome and uses the mRNA sequence
ribosome and folds into its to assemble the appropriate amino acid sequence of the protein.
final three-dimensional shape.
DNA double helix and RNA polymerase begins During translation, the ribosome “reads”
moving along one DNA strand. As it moves, the the mRNA message and assembles a chain of
RNA polymerase “reads” the DNA sequence amino acids. The ribosome acts like a factory in
and synthesizes a complementary mRNA which mRNA serves as the instruction manual
strand according to the rules of base pairing. that specifies which amino acids should be
The same rules of base pairing we discussed in joined together to form chains. Amino acids
the context of DNA apply here, with one differ- are specified by groups of three nucleotides
RIBOSOME
The cellular machinery ence: RNA nucleotides are made with the base called codons. Each codon is like a word: its
that assembles uracil (U) instead of thymine (T). So the com- letters name a particular amino acid (for exam-
proteins during the plementary base pairs are C with G and A with ple, the codon GGU specifies the amino acid
process of translation.
U (Infographic 8.8). glycine).
CODON As its moniker states, messenger RNA serves Although ribosomes are protein-assembling
A sequence of three to relay information. Once the mRNA copy is factories, they don’t house all the parts needed
mRNA nucleotides made, it leaves the nucleus and attaches to a to make proteins. Rather, they rely on a delivery
that specifies a
particular amino acid.
complex cellular machinery called the ribo- system to bring the appropriate amino acids
some. This is the start of translation. to the assembly site. The delivery system is
RNA
polymerase Antithrombin gene
1. RNA polymerase (pink circle)
binds to the regulatory sequence
just ahead of the gene’s coding
region. The DNA strands unwind,
exposing the coding sequence
Regulatory sequence Coding sequence
of the gene.
A G T A C C T
3. As the mRNA strand is
DNA nucleotides formed, it detaches from the DNA
sequence. The DNA reforms its
Growing mRNA strand double-stranded helix.
mRNA. The part that binds pieced together from a starting ANTICODON
mRNA is called the anticodon because it base- set of a mere 20 amino acids. In the same way The part of a tRNA
pairs in a complementary fashion with an that the 26 letters in the alphabet can spell hun- molecule that binds to
a complementary
mRNA codon. When the amino acid–toting dreds of thousands of words, the basic set of mRNA codon.
tRNA finds its codon match, it releases the amino acids can make hundreds of thousands
154 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 8.9
Translation: A Closer Look
In the cytoplasm, the ribosome reads the mRNA sequence
and “translates” it into a chain of amino acids to make a protein.
Ribosome
Antithrombin mRNA
1. The newly transcribed mRNA
A U G U C A U G G A C U C G U U C A U G G associates with a ribosome.
thr
aug 2. As the ribosome moves along
ser trp the mRNA, it “reads” the mRNA
tRNA
C G CA sequence in groups of three nucleo-
A UGA
T A G U A C C tides called codons. Each codon
specifies a particular amino acid,
Amino acid: which is brought to the ribosome
A U G U C A U G G A C U C G U U C A U G G
Corresponds to the by tRNA, which uses its anticodon
mRNA codon sequence to find a matching
mRNA codon.
ser trp Growing chain ser
trp thr aug
3. When the correct tRNA is in
A GU
place, the specified amino acid is
C
A G U A C C U G A G C A
C
Codon: Anticodon:
Triplet code Triplet code Antithrombin
on mRNA on tRNA protein
that
recognizes U C
a specific A
G UA 4. The finished amino acid chain
codon
detaches from the ribosome and
A U G U C A U G G A C U C G U U C A A U G folds into its three-dimensional
shape.
of proteins. The rules by which mRNA codons The Advantages of GMOs and “Pharming”
specify amino acids are known as the genetic One of the primary advantages of using trans-
code. genic animals to churn out protein drugs is that
The genetic code is universal, meaning that it scientists can produce more complex proteins
is the same in all living organisms. It is because in a mammal’s milk than they can from cell cul-
GENETIC CODE the code is universal that the mammary cells of a ture—the traditional way that scientists have
The particular amino
goat carrying the human gene for antithrombin produced many protein drugs. Because the
acids specified by
particular mRNA are able to express the gene and produce anti- mammary gland is a natural protein factory,
codons. thrombin protein in its milk (Infographic 8.10). mammalian milk already contains dozens of
Second letter
U C A G
Third letter
First letter
It is easier to scale up
medicine derived from
milk than to rely on
blood donations.
156 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
is a protein that helps blood clot. Some people “We have the potential to build an abundant
with the genetic disease hemophilia are born and controlled supply for any plasma protein,”
with clotting factor alleles that either encode says Newberry, who predicts that protein drugs
nonfunctional clotting factor protein or no clot- extracted from human blood may become a
ting factor protein at all. Consequently, if a thing of the past. “In the future, I won’t be
hemophiliac cuts himself, he must be quickly surprised if people start to think that rein-
transfused with clotting factor—otherwise he jecting blood products into other people is
may bleed to death. Doctors usually give ‘barbaric.’” ■
patients factor VIIa protein to restore normal
coagulation and prevent excessive bleeding.
Companies that sell the protein drug produce Summary
it via cell culture. But it is extremely expensive: Q Genes provide instructions to where, when, and how much of
one milligram of factor VIIa can cost up to make proteins. The process of the protein is produced.
$1,000. Fortunately, hemophiliacs don’t need using the information in genes to Q Gene expression occurs in two
much of the clotting factor to stop bleeds. But make proteins is known as gene stages, transcription and
because of the drug’s expense, they are given expression. translation, which take place in
the drug only in an emergency. Over time, how-
Q Proteins are folded chains of separate compartments in
ever, such rescue therapy, while minimizing
amino acids that make up cell eukaryotic cells.
initial cost, can be detrimental to patients’
structures and help cells to Q Transcription is the first step of
health: joints and other areas where bleeding
function properly. gene expression and copies the
typically occurs can become stiff and difficult
Q Amino acid sequences information stored in DNA into
determine the shape and mRNA. Transcription occurs in
function of a protein. the nucleus.
“I won’t be surprised if people
Q Many drugs act on proteins in Q Translation is the second step
start to think that reinjecting
the body, or are themselves of gene expression and uses the
blood products into other people proteins. information stored in mRNA to
is ‘barbaric.’ ” —Thomas Newberry Q A change in the DNA sequence
assemble a protein. Translation
of a gene can change the occurs in the cytoplasm.
corresponding amino acid Q Proteins are assembled by
to move. Transgenic animals can produce
sequence, and therefore the ribosomes with the help of tRNA.
human clotting factors in their milk in large vol-
function, of a protein. Q The genetic code is the set of
umes for about one tenth of the amount of
money it would take to produce the same pro- Q Different versions of the same rules by which DNA sequences
teins using cell culture. In fact, GTC Biothera- gene, those with different are translated into protein
peutics is working on establishing transgenic nucleotide sequences, are called sequences; the code is shared by
animals to produce two other human clotting alleles. all living organisms.
proteins: factor VIII and factor IX. In the FDA Q Every gene has two parts: a Q Through genetic engineering,
press release announcing the approval of GTC’s coding sequence and a genes from one species of
antithrombin deficiency medication, Dunham regulatory sequence. The coding organism can be inserted into the
was quoted: “I am pleased that this approval sequence determines the genome of another species of
makes possible another source of an important identity of a protein and the organism to make a transgenic
human medication.” regulatory sequence determines organism.
2. The final product of gene expression is 8. If you wanted to use genetic engineering to
a. a DNA molecule. increase the amount of antithrombin this patient
b. an RNA molecule. produces, would you modify the regulatory
c. a protein. sequence or the coding sequence? Explain your
d. a ribosome. answer.
e. an amino acid.
MAKING TRANSGENIC
j USE IT ORGANISMS
3. Heating can cause a protein to denature, or
Transgenic organisms are becomingly increasingly
unfold. What do you think would happen to a
important in agriculture and medicine.
protein’s function in this case? Explain your answer.
HINT See Infographics 8.5 and 8.6.
4. Insulin is a protein that is used therapeutically to
treat people with diabetes. In your own words,
describe the relationship between the insulin gene j KNOW IT
9. Melanin is expressed in skin cells and gives skin
and the insulin protein.
its color. If you wanted to express a different gene in
skin cells, which part of the melanin gene would you
GENE STRUCTURE use? Why? If you wanted to produce melanin in
All genes have two key parts: a regulatory sequence yeast cells, what part of the melanin gene would
and a coding sequence. To review gene structure, you use? Why?
refer to Infographics 8.4 and 8.5.
j KNOW IT j USE IT
10. Explain why scientists used the beta casein
5. The difference between two alleles of a gene is
regulatory sequence to express human antithrombin
best ascertained by
in goats’ milk.
a. examining the amount of protein produced
from each allele.
b. examining the structure of the protein
GENE EXPRESSION
Gene expression is the multistep process of
produced from each allele.
converting the information of DNA into proteins.
c. examining the amount of mRNA produced
from each allele.
HINT See Infographics 8.7–8.10.
d. examining the nucleotide sequence of each
allele.
e. examining the amount of tRNA produced j KNOW IT
from each allele. 11. For each structure or enzyme listed, indicate by
N (nucleus) or C (cytoplasm) its active location in
6. If a functional allele of antithrombin is expressed, eukaryotic cells:
a. blood clots will be more likely to form in the RNA polymerase ______
wrong place. Ribosome ______
b. blood clots will be less likely to form in the tRNA ______
wrong place. mRNA ______
158 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
12. The sequence of a strand of DNA of a gene is SCIENCE AND ETHICS
AGATACGAAACA. 15. Some people with diabetes would die without
a. Write the sequence of the complementary insulin because their bodies can no longer produce
strand of DNA. this protein. Historically, scientists purified insulin
b. Write the sequence of the mRNA that is from the pancreas of pigs. Human insulin is now
complementary to the original DNA strand. produced by inserting an artificial gene construct
c. Refer to the genetic code in Infographic 8.10 into bacteria. What are the ethical pros and cons of
to translate this short stretch of RNA. How many each type of insulin?
amino acids does it encode? What are they?
(Remember that translation always begins at a
start codon.)
j USE IT
13. A change in DNA sequence can affect gene
expression and protein function. What would be the
impact of each of the following changes? How,
specifically, would each affect protein or mRNA
structure, function, and levels?
a. a change that prevents RNA polymerase from
binding to a gene’s regulatory region
b. a change in the coding sequence that changes
the amino acid sequence of the protein
c. a change in the regulatory region that allows
transcription to occur at much higher levels
d. a combination of the changes in b and c.
Sequence Sprint
161
Milestones in Biology
Sequence Sprint
Venter and Collins race to decode the human genome
162 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
I
t started out as a bold fantasy: the entire
sequence of human DNA spelled out for sci-
entists to examine at will. Knowledge of the
human genome would be an indispensable
medical tool. Scientists could, for example, scan
the genome to hunt for genes that confer suscep-
tibility to disease, which might lead to better
treatments. It could enable
diagnostic tests that could
Some scientists found the help predict the risk of devel-
idea absurd, especially oping a genetically based dis-
given its then-estimated ease. Fields other than
$3 billion price tag. medicine would benefit, too.
Compa r i ng t he hu ma n
genome to the genomes of
other organisms, for example, might shed light
on our own evolution. The possible benefits to
science were endless.
But when an international group of scientists
met in the early 1980s and first floated the idea
of sequencing the human genome, they faced
skepticism. Some scientists found the idea
absurd, especially given its then-estimated $3
billion price tag. Others thought the potential
benefits were illusory because the technology
to sequence genes was rudimentary. Some sim-
ply deemed the task impossible.
Over the years, however, the idea gained both
scientific and political support. In 1988, Con-
gress funded both the National Institutes of
Health (NIH) and the U.S. Department of Energy
to explore the novel concept. By 1990, the col-
laborative effort to sequence the entire string of
more than 3 billion As, Gs, Cs, and Ts that make
up a human genome—the Human Genome Proj-
ect (HGP)—was officially under way.
When the project was officially launched in
1990, the NIH appointed James Watson, the co-
discoverer of the structure of DNA, to head and
coordinate it. The ambitious and mammoth
undertaking involved more than 20 institutions
spread around the globe, in China, France, Ger-
many, Japan, the United Kingdom, and other
countries, as well as in the United States.
Initially, the researchers set about sequenc-
ing every nucleotide on every chromosome that
makes up the entire genome. Automated
sequencers then available could sequence only
H
H N H O N H
H N H N N
N N
O H N
H
H
H3C O H N N H
H N H N N
N N
O H
164 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
The map of sequences grew, and as sequences ing techniques at the NIH, publicly proposed
were assigned to specific chromosomal loca- an alternative plan. He suggested breaking the
tions, it became much easier for scientists to entire genome into small fragments and
find a home for gene sequences that had already sequencing them simultaneously. Scientists
been identified. Since the information was including Venter had successfully used this
uploaded to an online database, any scientist approach on smaller, bacterial genomes. But
could view the map to see where exactly his or the human genome was much larger and con-
her gene was located and apply that information tained many repetitive sequences. Critics
to further research. But after a year, the project countered that computer software would not
wasn’t progressing as quickly as planned, and be able to piece all the sequences together
some estimated that if things kept plodding accurately. Venter’s approach—called whole
along at the same pace, the total cost could genome shotgun sequencing—would be akin to
reach more than $100 billion. trying to put a jigsaw puzzle together without
Criticism began to mount over the costs and a photo of the finished puzzle as a guide.
delays of the HGP. In 1991, Craig Venter, who Nevertheless, this approach would be faster.
had helped develop automated gene sequenc- Venter claimed that this method could find up
DNA Sequencing
to 90% of human genes within a few years. He The race was on. Collins and his colleagues
further asserted that the approach would be a stepped up the pace. Venter wasn’t the only one
bargain compared to the cost of the HGP. who had access to new automated sequencing
In 1992 Watson resigned as head of the HGP, machines and powerful computers that could
and in early 1993 NIH appointed a new head, the process large amounts of data. Publicly financed
geneticist Francis Collins. The idea of speeding scientists, too, had access to these and other
up the sequencing didn’t sit well with either new tools. Such technological advances dra-
Watson or Collins. In fact, Collins claimed pub- matically cut the amount of time it took to
licly that Venter’s idea wouldn’t work. Both men sequence each nucleotide, and cut costs, too.
argued that although it seemed feasible, it would About six months after Venter’s announce-
create sequence data that might be riddled with ment, Collins announced that the public consor-
mistakes. tium would complete sequencing the genome
Then, in 1998, Venter announced that he had by 2003—two years ahead of schedule. The con-
made an arrangement with the Perkin-Elmer sortium also planned to produce a rough draft
Corporation, which was about to unveil a new of the genome by 2001, which was about the
automated sequencing machine. Together they same time that Venter planned to finish his
would create a new company, to be called Celera draft. Collins justified his decision by stating
Genomics, that intended single-handedly to that scientists were clamoring for the data even
sequence the human genome in just three years in rough form.
for a mere $300 million—a fraction of the cost of For a few years the contest between the pri-
the publicly funded consortium vately funded Celera and the publicly funded
Collins and other leaders of the public project HGP was bitter, each side criticizing the other’s
were troubled. Congress might favor Celera’s methods. The two sides eventually agreed to
approach and stop funding the public project share the glory and appeared at a White House
altogether. Collins was also concerned that press briefing on June 26, 2000, together with
Celera was going to try to patent their sequence U.S. President Bill Clinton and British Prime
data, which would have restricted public access Minister Tony Blair to publicly announce that
to it. they had completed a rough draft of the human
166 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
genome sequence. In February 2001 both
groups published their drafts of the human
genome simultaneously in the journals Nature
and Science.
Just whose genome sequence was in fact pub-
lished? Geneticists working on the publicly
funded project had collected blood samples
from anonymous donors. The ultimate
sequence is thus a composite pieced together
from the gene sequences of several individuals.
Celera’s sequence data comes from the DNA of
Venter himself.
When the HGP was completed in 2003, the
achievement was hailed as one of the greatest
scientific accomplishments of the 20th century.
Some even consider it the greatest achievement
ever in biology. Not only did it reveal new char-
acteristics of the human genome, it also shed
light on how we differ from other organisms.
Paramedic Plants
169
Chapter 9 Cell Division and Mitosis
Paramedic Plants
Will herbs be the next cancer therapy?
I
n the late nineties, online chat rooms began But now community chat rooms were buzz-
buzzing that an herbal supplement called ing again, this time with suspicions that the
PC-SPES could shrink prostate tumors. This supplement was contaminated with toxic met-
was a “natural” approach that caused fewer als and perhaps even harmful drugs. These
side effects than conventional prostate cancer stories made their way to the California Depart-
therapy, so it was claimed. PC-SPES was intro- ment of Health Services, which decided to inves-
duced to the U.S. market in 1996, and within a tigate. The department’s analyses were
few years, as many as 10,000 men in the United shocking: in many instances, the quantity of
States with prostate cancer were taking the sup- each herb varied considerably from bottle to
plement and seeing their tumors shrivel—or so bottle. Moreover, some bottles were laced
the rumors went. with three different prescription drugs, includ-
Although some studies had shown that PC- ing an estrogen-like drug and a blood-thinner.
SPES could kill cancer cells, no one had ever The FDA—the U.S. Food and Drug Administra-
studied the supplement in men with prostate tion—issued a warning to all consumers to
cancer. Concerned that so many cancer patients stop taking PC-SPES. By late 2002, the company
were taking an unproven therapy, a group of that made PC-SPES had voluntarily taken
scientists at the National Center for Alternative the product off the market and went bankrupt
and Complementary Medicine decided to test soon after.
the herbal mixture in clinical trials. PC-SPES isn’t the only herbal supplement
To their surprise, initial studies seemed to that’s gotten into trouble with the law. Authori-
support the rumors. PC-SPES, which was mar- ties have found that many supplements are
keted as a mixture of eight herbs known in contaminated with dangerous heavy metals
China since ancient times, appeared to fight or bacteria. While contamination with prescrip-
prostate tumors. tion drugs or other substances appears to
170 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
be a rare phenomenon, investigators have found agency that certifies that a supplement actually
that the amount of active ingredient in many contains what is listed on its label or does what
supplements commonly varies from pill to pill it claims to do. More significantly, very few
and from bottle to bottle. Some melatonin pills, herbal supplements have been rigorously stud-
for example, which some people take to ward ied, and few have been shown to contain con-
off jet lag, have been found to contain very little sistent levels of active compounds from batch
melatonin, and the quantity can vary from pill to batch, or proved to prevent or treat illnesses.
to pill within the same bottle, according to a Authorities typically discover that a product
2003 study by researchers at the University of has been falsely advertised or contaminated
Colorado, Denver. only after investigating complaints from
This lack of consistency makes it difficult for consumers.
consumers to know if they are getting what they But some of this is changing. In 2004, the
are paying for. In the United States, supplements FDA put procedures in place that allow compa-
like echinacea, ginseng, and St. John’s wort nies to apply to the agency to market an herbal
aren’t stringently regulated. Although manufac- supplement almost like a pharmaceutical
turers are prohibited from making false state- drug. Not only must a company prove with
ments on their labels, there is no government clinical trial data that a supplement works, it
172 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 9.1
How Conventional Drugs Differ from Herbal Supplements
Conventional Drugs
One specific active ingredient is purified from a plant or fungus or synthesized in the laboratory
and concentrated into pill, capsule, or injectable form.
Paclitaxel
Herbal Supplements
Plants, algae, fungi, and combinations of these are used as a tea, an extract, or ground into powder and sold in capsule form.
They contain complex mixtures of many different unpurified plant molecules.
C. Wound Healing
Injury triggers cell
division to replace
damaged cells.
6h 1d 2d 7d
treat cancer. In particular, they of our tissues are of which attack cancer by inter- CELL DIVISION
are investigating whether herb- in a state of fering with a fundamental part The process by which
a cell reproduces
als combined with other drugs, constant flux. of a cell’s life: cell division. itself; cell division is
such as those used in chemo- Although we may think of our important for normal
therapy or other types of immune boosting bodies as relatively fixed structures, most of our growth, development,
treatments, may make those treatments more tissues are in a state of constant flux as cells and repair of an
organism.
effective. divide periodically to replace cells that have
174 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
CELL CYCLE reached the end of their life span. In fact, cell becomes two. A cell doesn’t simply split in half
An ordered sequence of division in our bodies begins long before we to form two new cells, however. If it did, each
stages that a cell
progresses through in are even born. During embryonic development, resulting cell would be smaller than the origi-
order to divide during its a single fertilized egg cell divides, and its nal, and with each division, each cell would
life; the stages includes daughter cells divide again and again, eventu- lose half its contents. So before a cell divides, it
preparatory phases (G1,
ally forming trillions of cells by the time a baby first makes a copy of its contents so that each
S, G2) and division phases
(mitosis and cytokinesis). is born. As we age, our tissues continually dis- new cell has the same amount of organelles,
card old cells and generate new ones in their DNA, and cytoplasm as the original cell. This
INTERPHASE place. And when we cut or injure ourselves, cells preparatory stage of the cell cycle, known as
The stage of the cell
cycle in which cells spend
in the area divide to heal the wound (Infographic interphase, is divided into separate sub-
most of their time, 9.2). phases: G1 phase, when the cell grows and pre-
preparing for cell To produce new cells, each cell passes pares to divide both its DNA and its organelles;
division. There are three through a series of stages collectively known as synthesis phase (S), when DNA is replicated;
distinct phases within
interphase (G1, S, and G2). the cell cycle. During the cell cycle, one cell and G2 phase, when the cell is ready to divide.
INFOGRAPHIC 9.3
The Cell Cycle: How Cells Reproduce
The purpose of
the cell cycle is to 1. Interphase
replicate cells, creating The preparatory phases of cell
two new daughter cells division.The cell makes a copy
that are genetically of the DNA and produces more
identical to the original organelles and cytoplasm.
parent cell. The cell cycle Each chromosome
consists of preparatory has two identical
phases collectively known sister chromatids.
Interphase
as interphase, as well as
the division phases, S Phase
mitosis and cytokinesis. DNA replication occurs.
The cell cycle G1 Phase Each chromsome is
starts here. The cell enlarges, creates replicated to produce two
additional cytoplasm, and identical sister chromatids.
begins to produce new
organelles.
G2 Phase
Mitosis and The final preparatory
Cytokinesis stage, during which the
cell prepares for division
2. Mitosis
The sister chromatids of each
chromosome are separated
from one another, setting up
the two identical nuclei of
the daughter cells.
176 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
UP CLOSE The Phases of Mitosis
Mitosis, the process of separating duplicated chromosomes, occurs in a series of phases that are part of the cell cycle.
A dividing cell passes through each of these phases in sequence. The cellular machinery that actually pulls chromosomes
apart is known as the mitotic spindle.
Interphase
• Each chromosome replicates in interphase, resulting
in two sister chromatids connected at the centromere.
• Chromosomes are loosely gathered in the nucleus.
Prophase
• Replicated chromosomes begin to coil up.
• The nuclear membrane begins to disassemble.
• Protein fibers of the mitotic spindle begin to form.
Prometaphase
• Chromosomes condense (shorten) so they are easier
to separate.
• Spindle fibers attach to chromosomes on both sides at the
centromere region.
Metaphase
Spindle • Spindle fibers from opposite ends of the cell pull
fibers on chromosomes.
• Chromosomes are aligned along the middle of the cell.
Anaphase
• Spindle fibers shorten and pull sister chromatids
to opposite ends of the cell.
Taxol interferes with the
action of spindle
fibers during
anaphase.
Telophase
• An identical set of chromosomes reaches each pole.
• Spindle fibers dissemble.
• Nuclear membrane forms around each set of chromosomes,
forming the daughter cell nuclei.
Cytokinesis
• Cell membrane pinches in to completely
surround each new daughter cell.
Interphase
• Two identical daughter cells are formed, each with
the same number of chromosomes as the parent cell.
Interphase
Irreparable damage?
G1 S
Mitosis and
Cytokinesis G2 Apoptotic cell death
irreparable damage, the checkpoints direct a round of cell division, cellular and chromo-
cell to commit suicide in a process called apop- somal defects go unrepaired while additional
tosis. Apoptosis is programmed cell death, a defects occur, which causes DNA damage to
biochemical pathway in which the cell’s DNA accumulate (Infographic 9.6).
is degraded into small pieces and the cell
breaks apart and dies. Other cells in the area Fighting Cancer
then engulf these remnants. Checkpoint mech- For many types of cancer, the first line of treat-
anisms ensure that cells divide accurately and ment is often surgery to remove the lump of CELL CYCLE
CHECKPOINT
only when necessary (Infographic 9.5). rogue cells completely. Surgery is effective for A cellular mechanism
Even with these repair mechanisms, how- certain solid tumors, but not for blood cancers, that ensures that each
ever, cells with DNA damage do occasionally or cancers that have undergone metastasis, stage of the cell cycle
manage to complete the cell cycle and divide that is, that have spread to other parts of the is completed
accurately.
because some of the damage includes injury to body. In these cases, the best option is usually
the very proteins that function as checkpoints. chemotherapy, treatment to target cancer cells APOPTOSIS
When cells accumulate enough DNA damage, circulating throughout the body. Programmed cell
death; often referred
the result is cancer. Cancer cells plow through Most drugs used in chemotherapy work by
to as cellular suicide.
the cell cycle uninhibited. Because their check- interfering with the cell cycle. Several plant-
point functions are damaged, they have no stop derived drugs do just this. Paclitaxel, a drug METASTASIS
signals. With nothing to tell them to stop, these originally extracted from the needles of Pacific The spread of cancer
cells from one location
damaged cells survive and can divide again yew trees, for example, interferes with a cell’s in the body to another.
and again, uncontrollably. And with every ability to separate sister chromatids during mito-
178 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 9.6
Cancer: When Checkpoints Fail
Cancer cells have damaged checkpoint mechanisms, which enable them to divide when they should not. This means
that DNA damage or errors in chromosome separation are passed on to daughter cells. These damaged cells also
bypass apoptosis. With each cell division, the damage is perpetuated and additional errors in DNA accumulate.
Normal
Cell Division Healthy cell
Healthy
cells divide
periodically
and correct
DNA damage
Apoptosis and mitotic
mistakes.
DNA damage
sis. Unable to properly segregate chromosomes, tion therapy (often in conjunction with
the cells fail to divide. Vinblastine, another plant- surgery and chemotherapy). In radiation ther-
derived anticancer drug—it comes from the apy, beams of high-energy electrons kill divid-
Madagascar periwinkle plant—also interferes ing cells. Such radiation severely damages
with chromosome separation during mitosis. molecules and causes rampant DNA damage.
Other cancer drugs interrupt other parts of the This DNA damage can trigger apoptosis, caus-
cell cycle. The common chemotherapeutic drug ing the cells to die. Both chemotherapy and
irinotecan, for example, inhibits an enzyme radiation therapy interfere with or kill all
that helps DNA replicate during S phase. Cells dividing cells. While most normal cells are able
treated with irinotecan are unable to copy their to repair the damage inflicted by these thera-
DNA and are thus prevented from reproducing pies, cancer cells typically have hobbled repair
RADIATION
THERAPY themselves. Other types of anticancer drugs mechanisms and can’t effectively do so, and
The use of ionizing work by inhibiting progression through the cell consequently die.
(high-energy) cycle in other ways. Although cancer remains a leading cause of
radiation to treat
If the cancer has not yet spread throughout death in Western countries, researchers have
cancer.
the body, doctors may treat a tumor with radia- developed an arsenal of chemotherapeutic
Chemotherapy Radiation
drugs to aid in the fight against this deadly dis- replace worn-out blood cells), often leading to
ease, and cancer patients have been surviving side effects such as hair loss, vomiting, bruis-
longer and longer. Cancer death rates have been ing, and susceptibility to infections. Since
slowly declining over the years; the latest healthy cells can repair DNA damage, they
research shows that deaths from all cancers aren’t as severely affected as cancer cells,
dropped 15.8% between 1991 and 2006. Part of which have dysfunctional checkpoints and
the decline in deaths is due to more effective hobbled repair mechanisms. While scientists
chemotherapeutic drugs. are trying to develop cancer therapies that tar-
The downside of both radiation and chemo- get only cancerous cells, chemotherapy and
therapy is that they can cause severe side radiation remain the mainstays of cancer ther-
effects. That’s because neither therapy is very apy today. Anything that might lessen side
specific—both radiation and chemotherapy effects without hindering a drug’s effectiveness
damage all rapidly dividing cells, including would be a boon to patients (Infographic 9.7).
healthy ones. These cancer treatments kill The herbal supplement PHY906 is meant to
healthy cells lining the intestinal tract, the cells be taken in addition to chemotherapy. So far, it
in hair follicles, and cells in bone marrow has been tested in people with colon, liver, and
(which divide rapidly throughout our lives to pancreatic cancer who are also being treated
180 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
with the chemotherapy drug irinotecan. These
initial studies suggest that PHY906 can reduce
the side effects of chemotherapy.
Although researchers aren’t sure exactly
how PHY906 works, they do have some clues.
Research in animals suggests that the herb
mixture reduces inflammation in the gut.
Because chemotherapy kills cells lining the
stomach and intestines, gut tissue becomes
inf lamed. The ability of PHY906 to calm
inflammation might account for its ability
to reduce nausea, vomiting, and diarrhea dur-
ing chemotherapy. And while PHY906 does
not by itself kill cancer cells, animal studies by
the company suggest that the supplement
enhances the effect of chemotherapy by mak-
ing cancer cells more permeable to drugs.
Cervical cancer cells dividing unchecked. (Infographic 9.8). That PHY906 can reduce side
INFOGRAPHIC 9.8
Herbal Supplements May Complement Cancer Therapy
Experiments show that the herbal supplement PHY906 can improve traditional cancer therapy. While PHY906 doesn’t appear
to kill cancer cells when used alone, it enhanced the ability of a chemotherapeutic agent called irinotecan to shrink colorectal
tumors in mice. In other words, the drug and herbal supplement worked synergistically. Since PHY906 does not directly kill
cancer, it will likely only complement existing cancer therapy regimens.
No treatment (control)
1500
PHY906 herbal supplement
Irinotecan chemotherapy
Percentage of Initial Tumor Size
500
effects from chemotherapy also raises the pos- lowed almost 30,000 smokers for 8 years,
sibility that higher doses of chemotherapy found that beta-carotene supplements actually
could be administered without a correspond- increased the risk of lung cancer in smokers.
ing increase in side effects. The same study found that vitamin E supple-
PHY906 isn’t the only herbal supplement ments appeared to have no effect in reducing
that is showing promise in cancer treatment: the risk of lung cancer in smokers. The results
some common plant ingredients may also aid were unexpected because epidemiologic stud-
the fight against cancer. For instance, scien- ies show that people who eat diets rich in vita-
tists at the University of California, Los Ange- min E and beta-carotene have a lower risk of
les, have found in laboratory experiments that developing lung cancer, suggesting a preventa-
green tea extracts, which have been popularly tive effect.
thought to be cancer-fighting agents, can in One explanation for the discrepancy, experts
fact slow down aberrant cell division and say, is that there may be other yet undiscovered
increase the likelihood that a damaged cell will cancer-fighting compounds in plants that act in
go through apoptosis. Studies on the spice tur- concert with vitamin E and beta-carotene to
meric, commonly used in Asian cooking, sug- ward off cancer. These other compounds might
gest that it can help fight cancer: in animals, work synergistically with vitamin E and beta-
turmeric has been shown to protect the liver, carotene in foods, making extracts of isolated
inhibit tumors, and reduce inflammation. A compounds ineffective. Nevertheless, such
few studies have also shown that the Chinese findings highlight the importance of eating a
herb astragalus, combined with another herb diet rich in fruits and vegetables and consulting
extracted from the berries of the glossy privet your doctor before you decide to take any
tree native to Japan and Korea, can boost the supplement.
immune system and help it fight cancer. While it’s too soon to be certain that any
But the news on supplements isn’t all good. herbal supplement will join the ranks of our
One of the largest studies to date, which fol- most valuable prescription drugs, most
182 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
In the next few years, herbs Summary
might join conventional drugs as Q Cell division is a fundamental acquire DNA damage during cell
therapeutics. feature of life, necessary for division and pass these DNA
normal growth, development, defects on to daughter cells.
experts are optimistic. After all, many of our
and repair of the body. Q Mistakes in the course of cell
most important drugs started their pharma-
ceutical life as plant extracts, so it’s reasonable Q The cell cycle is the sequence division can lead to cancer, which
to think that some of today’s herbals will even- of steps that a cell undergoes in is unregulated cell division.
tually prove useful, too. In the next few years, division. Stages of the cell cycle Q Cancer cells have lost the
herbs might join conventional drugs as thera- include interphase, mitosis, and ability to regulate cell division
peutics, according to Mary Hardy, associate cytokinesis. and reproduce uncontrollably,
director of UCLA’s Center for Dietary Supple- Q During mitosis, replicated often eventually forming a
ments Research. And with the FDA’s new initia- chromosomes segregate to tumor.
tive that offers the agency’s approval to herbal opposite poles of the dividing Q Conventional cancer
supplements that have been shown to be effec- cell; during cytokinesis, the cell treatments—chemotherapy and
tive through clinical trials, we can expect to physically divides into two radiation—kill all rapidly dividing
see greater integration of these supplements daughter cells. cells, both cancer cells and
into medical treatments in the United States. A
Q Cell cycle checkpoints ensure healthy cells.
similar procedure already is in place in Europe:
accurate progression through the Q Many drugs, including some of
Germany and the Netherlands require clinical
cell cycle; repair mechanisms at those used to treat cancer, are
evidence of an herb’s efficacy stated on its
each checkpoint can fix mistakes extracted from plants.
label, and herbal drugs are prescribed by doc-
that occur, such as DNA damage.
tors in those countries. Q Herbal supplements may
Some herbs have valid medicinal uses, says Q In the absence of proper enhance conventional cancer
Hardy, and studying them will help doctors bet- checkpoint function, cells can treatments.
ter advise their patients. “Eventually,” she says,
“herbs will be integrated into the broader medi-
cal paradigm.” ■
j USE IT e. cytokinesis
4. If a cell fails to replicate its DNA completely,
10. Liver cells and neurons rarely, if ever, divide in
what will happen?
normal circumstances. The cells lining the digestive
a. It will progress through G2 and mitosis.
tract are replaced by cell division on a regular basis.
b. It will die by apoptosis.
Explain why chemotherapy frequently causes
c. It will pause to allow DNA replication to
digestive symptoms but less frequently causes
complete.
cognitive symptoms.
d. It will stop in S phase and never progress
further through the cell cycle.
11. Your pet mouse has developed colon cancer.
e. It will stay in interphase indefinitely.
Which of the following treatments will likely be
most effective?
5. Many drugs interfere with cell division. Why
a. PHY906
shouldn’t pregnant women take these drugs?
b. irinotecan chemotherapy
c. PHY906 plus irinotecan
d. radiation therapy
CANCER AND CANCER THERAPIES e. There is no treatment for colon cancer.
When cells fail to accurately progress through the
cell cycle, cancer may arise. Cancer cells may have 12. Look at Infographic 9.8.
lost checkpoint function, or may divide even without a. Does irinotecan actually shrink tumors in the
a signal to do so. colon? Explain your answer.
b. Does PHY906 plus irinotecan shrink colon
HINT See Infographics 9.1 and 9.6–9.8. tumors? Explain your answer.
184 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
13. Why might a beta-carotene supplement not j USE IT
have the same effect on cancer as a diet with lots of 16. What would be the result if a cell completed
food rich in beta-carotene? interphase and mitosis but failed to complete
cytokinesis? (That is, how many cells would there
be, and how many chromosomes relative to the
A CLOSER LOOK AT MITOSIS AND parent cell would those cells have?)
THE CELL CYCLE
Mitosis is a critical stage of cell division. It ensures 17. Looking at Up Close: The Phases of Mitosis,
that chromosomes accurately separate into would you say that a drug that stabilizes spindle
daughter cells. fibers, preventing them from shortening, would be a
valuable chemotherapy drug? Why or why not?
HINT See Infographic 9.4 and Up Close: The
Phases of Mitosis. SCIENCE AND ETHICS
18. What are some of the risks of taking an over-
j KNOW IT the-counter herbal supplement as an alternative to
14. During which stage of the cell cycle do sister conventional cancer therapy?
chromatids separate from each other?
19. PHY906 has been tested in mice. What steps
15. During which stage of the cell cycle are sister would you take to establish its efficacy in humans
chromatids initially produced? ethically and safely?
Fighting Fate
j What You Will Be Learning
10.1 Inheriting One Mutated BRCA1 Allele
Increases the Risk of Cancer
10.2 Mistakes in DNA Replication Can Produce
Mutations
10.3 Mutations in DNA Can Alter Protein Function
and Cause Cancer
10.4 What Causes Mutations?
10.5 Mutations in Two Types of Cell Cycle Genes
Cause Most Types of Cancer
10.6 Tumors Develop in Stages as Mutations
Accumulate in a Cell
10.7 BRCA Mutation Increases the Risk of Breast
Cancer
187
Chapter 10 Genetic Mutations and Cancer
Fighting Fate
Some are genetically predisposed to cancer—but surgery
may cut their risk
L
orene Ahern wasn’t totally surprised alleles are at higher risk for breast and prostate
when she tested positive for breast can- cancers. This test, too, was positive: Ahern had
cer. “Half of me was expecting it all my a mutation in one of her copies of the BRCA1
life and part of me was saying, ‘No, this gene, which meant that she was at high risk for
won’t happen to me,’” says the 47-year-old other cancers as well. Moreover, she could have
mother of two in Twinsberg, OH. She knew that passed on this mutation to her children.
her risk of cancer might be higher than average—
her mother had died of cancer at 49. But until
“Half of me was expecting it all
the day she learned the test result, Ahern, who
took good care of herself and lived a healthy life-
my life . . . .”
style, had never fully believed she would –Lorene Ahern
develop cancer.
There was more bad news in store for Ahern. Aside from nonmelanoma skin cancer, breast
About a year after she received the diagnosis of cancer is the most common cancer to affect
breast cancer, Ahern had DNA extracted from women. Breast cancer affects nearly 200,000
her blood and tested for mutations in two genes— women in the United States a year, according to
BRCA1, located on chromosome 17, and BRCA2, a 2006 report by the U.S. Centers for Disease
located on chromosome 13 (“BRCA” stands for Control and Prevention. For most women, the
“breast cancer susceptibility”). Women who are risk of developing breast cancer ranges between
MUTATION
born with mutations in either of these two genes 12% and 15%, or 1 in every 7 women. For women A change in the
have an exceptionally high risk of developing with mutations in BRCA1 or BRCA2, however, nucleotide sequence
breast and ovarian cancers. Men with these the risk is much higher: a 40% to 80% lifetime of DNA.
188 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
risk of developing breast cancer and a 20% to do have treatment options that can drastically
50% risk of developing ovarian cancer, depend- reduce their risk of getting cancer or of having it
ing on the particular BRCA alleles they carry. recur.
The good news is that studies have shown diet
and lifestyle changes can dramatically cut a Inherited Mutations
woman’s risk of getting cancer—just quitting What is hereditary cancer? And how does it dif-
smoking cuts the risk by 30%. The bad news is fer from other forms of cancer?
that prevention is not that simple for women A woman who has hereditary breast cancer
with inherited predispositions to breast cancer— has a genetic predisposition to the disease. This
for this group, diet and lifestyle changes don’t predisposition is caused by a mutation in a gene
necessarily make a difference. “Their cancers she inherited from one or both of her parents.
just behave differently,” says Thomas Sellers, In Ahern’s case, an inherited mutation in one of
executive vice president of the H. Lee Moffitt the copies of her BRCA1 gene predisposed her
Cancer Center and Research Institute in Tampa, to cancer. The mutation causes the BRCA1 gene
Florida. Even with traditional treatment like to make a dysfunctional BRCA1 protein, which
chemotherapy and radiation, hereditary breast in its normal form helps to regulate the cell
cancers are more likely to recur in the same tis- cycle so that a cell can repair DNA damage
sue or other tissue in the body. But these women (Chapter 9).
190 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
their effects; they may change a nucleotide or
an amino acid here and there, but don’t seri-
ously affect a person’s health. And some muta-
tions are actually beneficial: a mutation that
enables the blood to carry more oxygen, for
example, might be an advantage to someone
who lives in high altitudes.
Regardless of whether a mutation is harmful
or not, a nucleotide change is significant if it
alters the amino acid sequence of the corre-
sponding protein. Because an altered amino
acid sequence can also alter the shape of the
protein, it could disable the protein and make
it unable to perform its usual job. BRCA pro-
teins produced from mutated alleles, for exam-
ple, do not perform their job as cell cycle
regulators and make cells more likely to divide
An MRI showing several Some of these mutations are so detrimental uncontrollably and become cancerous (Info-
malignant tumors in the that they aren’t compatible with life, and the graphic 10.3).
breast of a 32-year-old
woman. embryo may spontaneously abort. Others Inherited mutations are present in all the
aren’t severe enough to harm a fetus or prevent cells of the body. Moreover, such mutations are
birth, but they impair health after birth—as faithfully copied every time body cells divide.
with diseases like cystic fibrosis and Hunting- Hereditary mutations are also called germ-line
ton Disease. Some mutations are neutral in mutations because the gene changes are in
INFOGRAPHIC 10.2
Mistakes in DNA Replication Can Produce Mutations
Errors during DNA replication can lead to permanent
mutations if they are not repaired or repaired incorrectly. DNA repair at checkpoint:
C G
The old strand is G The wrong nucleotide A G Potential new allele:
replicated by the is added during a DNA is not repaired. Nucleotide
A A T
addition of new replication creating mismatch remains until this strand
C C G
nucleotides. a mutation. is replicated again.
T T A
C G
A G
A T C G C G
Original allele:
C G A G A T
DNA is repaired. Sequence is
T A A T A T
restored to original allele sequence.
T A C G C G
T A T A
Mutated sequence C G
with a nucleotide C G New allele:
mismatch A T DNA is repaired. Sequence is
C G changed to new nucleotide pair.
T A
Transcription Transcription
This mRNA has a
mRNA: nucleotide insertion
AUG CCG UCG GAU GGA ... AUG CCG UAC GGA UGG A... that shifts the
nucleotides after it
Translation Translation to the right.
Protein:
Functional Nonfunctional
protein protein This protein has an altered
In its normal form, shape, rendering it dysfunctional
this protein regulates and unable to regulate the cell
the cell cycle. cycle. Cancer may result.
the sperm and egg cells—the germ cells—and future generations through sexual reproduc-
can be passed from parent to child each tion. The result is that a single gene such as
generation. BRCA1 can have hundreds of different nucleo-
By contrast, mutations in somatic cells—the tide sequences, or alleles, in a population.
cells in the rest of the body—are not passed on
to future generations, although they can cause Ethnic Groups and Genetic Disease
disease. A person who acquires a mutation in Ahern descends from a subgroup of Jews called
a skin cell from too much sun exposure, for the “Ashkenazi”—the term generally refers to
example, will not pass this mutation on to his Jews of Eastern European descent. Ahern’s
or her children. That’s because the mutation father was born in Germany, immigrating to the
did not occur in sperm or egg cells, nor will it United States in 1939; her mother was born in
affect those cells. This mutation can, however, the United States; but Ahern’s maternal grand-
be passed by mitosis and cell division to daugh- father was born in Russia. But the history of this
ter cells of the mutated cell and cause disease Jewish subgroup extends much further back
in the affected person. This is one way nonhe- than modern Europe.
reditary cancers develop. Recent gene studies support the biblical his-
Now imagine germ-line mutations accumu- tory of Jews as descended from populations in
lating over thousands of years in a population. what is now the Middle East. The Ashkenazi
As long as a mutation does not affect a person’s Jews are a subgroup that left the Middle East and
ability to reproduce, it will be passed on to began populating parts of Europe more than
192 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
TABLE 10.1
in this ethnic group than in the general popula-
Incidence of Hereditary Diseases tion; approximately 1 in 25 Ashkenazi Jews carry
in Different Populations disease alleles for at least one of these disorders
(Table 10.1).
CARRIER RATE IN CARRIER RATE
ASHKENAZI JEWISH IN GENERAL
Ashkenazi Jews are not the only ethnic
HEREDITARY DISEASE POPULATION POPULATION group to have a higher incidence of certain
genetic diseases than occurs in the general
Tay-Sachs disease 1 in 25 1 in 250
population. For example, people from Medi-
terranean, African, and Asian countries have
Canavan disease 1 in 40 Rare/unknown
higher rates of thalassemias, blood disorders
that cause anemia. Sickle-cell anemia, another
Niemann-Pick disease, type A 1 in 90 1 in 40,000
type of hereditary anemia, is more common
Gaucher disease, type 1 1 in 14 1 in 100 among people of African descent.
Ashkenazi Jews are also more likely than the
Bloom syndrome 1 in 100 Rare/unknown general population to carry mutations in
BRCA1 and BRCA2. Some studies have found
BCRA mutation 1 in 40 1 in 350–1,000
that more than 8% of Ashkenazi women carry
Familial dysautonomia 1 in 30 Rare/unknown a mutated BRCA1 gene, compared to only 2.2%
of other women. These alleles can take the
form of changes in one DNA base pair, or in
2,000 years ago. The majority of Ashkenazis, several. In some cases, large DNA segments are
however, migrated into Europe in the 10th cen- rearranged. In mutated BRCA2 genes, a small
tury from the region of present-day Israel, set- number of additional DNA base pairs is
tling in the Rhineland, the valley of the Rhine inserted into or deleted from the gene. These
River, in Germany. mutations, or alleles, of these genes arose and
A number of historical factors have made the became prevalent over thousands of years.
Ashekenazi Jewish population more susceptible
to genetic diseases. First, they descend from a Cancer Genetics
small group of people. Second, that population Inheriting a gene that carries a predisposition to
has expanded and contracted over time. Third, a disease such as cancer doesn’t mean you will
and most important, members of the popula- automatically get the disease. Inherited predis-
tion usually marry within the community. In positions increase the risk, but they don’t defini-
other words, Ashkenazi Jews have many of the tively determine that the disease will occur. In
characteristics of an isolated population—new most cases, there are several other contributing
alleles are not frequently introduced by people factors. Cancer often occurs only when addi-
immigrating into the population. tional, nonhereditary, mutations in a cell
Consequently, Ashkenazi Jews are an exam- accumulate.
MUTAGEN ple of an ethnic group that has a more homoge- Environmental insults such as chemicals,
Any chemical or neous genetic background than the general ultraviolet light, radiation, and other factors can
physical agent that
can damage DNA by
population, and is more likely to pass on certain damage our DNA and cause it to mutate. Expo-
changing its genetic diseases to future generations. Scien- sure to ultraviolet light for example, impairs the
nucleotide sequence. tists have discovered more than 1,000 recessive DNA in our skin cells and can lead to skin can-
diseases in the general population, but most of cer. Physical or chemical agents that cause
CARCINOGEN
Any chemical agent them are rare. In Ashkenazi Jews, however, the mutations with either positive, negative, or neu-
causes cancer by prevalence of some recessive diseases is tral outcomes are known as mutagens. Chemi-
damaging DNA. increased 100-fold or more. Tay-Sachs disease, cals and other factors such as pesticides and
Carcinogens are a type
Gaucher disease, and Bloom syndrome are pollutants that can cause cancer are a class of
of mutagen.
genetic diseases that all occur more frequently mutagens known as carcinogens because
they damage DNA in a harmful way that can Mutations that cause cancer typically occur
lead to cancer (Infographic 10.4). in two categories of genes that influence the cell
cycle: proto-oncogenes and tumor suppres- PROTO-ONCOGENE
A gene that codes for
sor genes. Normal proto-oncogenes promote
Environmental insults such cell division and cell differentiation, but only
a protein that helps
cells divide normally.
as chemicals, ultraviolet light, in response to appropriate signals. But mutated
TUMOR
radiation, and other proto-oncogenes can become permanently
SUPPRESSOR GENES
factors can damage our DNA “turned on” or activated, stimulating cells to Genes that code for
divide all the time. In this state they are called proteins that monitor
and cause it to mutate. oncogenes—genes that cause cancer. In other and check cell cycle
progression. When
words, oncogenes are proto-oncogenes that
these genes mutate,
Normally our cells are able to repair such have been mutated to become overexpressed tumor suppressor
DNA damage. But very rarely a mistake may or permanently activated. Her2, a gene over- proteins lose normal
remain uncorrected; over time and with age, if expressed in certain types of breast cancer, is function.
enough mutations accumulate in the same cell, an example of a proto-oncogene.
ONCOGENE
that cell may begin to divide abnormally and Tumor suppressor genes, or tumor suppres- A mutated and
become cancerous. Such acquired somatic sors, normally pause cell division, repair dam- overactive form of a
mutations can develop throughout a person’s aged DNA, and tell cells when to die. Tumor proto-oncogene.
Oncogenes drive cells
life as he or she is exposed to carcinogenic envi- suppressor genes cause cancer when they to divide continually.
ronmental insults and as cells divide. are inactivated by mutation. “You can think of
194 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 10.5
Mutations in Two Types of Cell Cycle Genes Cause Most Types of Cancer
During the cell cycle, proteins regulate whether the cell is ready to continue to the next stage or if the cell requires additional
time to repair DNA damage before progressing. The proteins that regulate these checkpoints are made by proto-oncogenes
and tumor suppressor genes. Accumulated mutations in these types of genes cause cancer.
Proto-oncogenes signal cells to progress through Tumor suppressor genes signal cells to pause
the cell cycle at the appropriate time. Mutations in the cell cycle to fix mistakes. Mutations in these
GO STOP
these genes cause them to be overstimulated, genes cause them to be underexpressed, allowing
causing too much cell division. damaged cells to divide inappropriately.
GO Interphase
G1 S
STOP
STOP
Mitosis and
Cytokinesis G2
A B C D
Inherit BRCA1 mutation: DNA replication mistake Smoking mutates Additional mutations
A single mutation in remaining not corrected, creates an p53 gene: permit invasion, new
BRCA1 alleles causes loss of oncogene: Cells fail to correct mutations blood vessel growth,
BRCA function. DNA is not Additional mutations activate or to enter apoptosis. Mutations and spread:
efficiently repaired. Additional proto-oncogenes into are propagated through The tumor contains malignant
mutations are more likely to oncogenes. The cell divides additional cell divisions. Cells cells that invade surrounding
occur because of these more often without normal do not stop dividing even when tissues, promote new blood
uncorrected mutations. checks and cells begin to crowded. vessel growth, and spread to
pile up. both nearby and distant
locations.
accumulate enough mutations to become can- either gene raise the risk of cancers in other
cerous (Infographic 10.6). organs, too. Scientists have linked mutations
People who have inherited high-risk in both genes to a higher than average risk of
mutations start life with at least one cancer- prostate, colon, and pancreatic cancers,
pre disposing mutation, so they require among others. But the breasts and ovaries are
fewer additional mutations to get cancer. For at especially high risk of developing cancers
example, Ahern was born with a predisposing because they respond to the hormone estro-
mutation in one of her BRCA1 alleles. If a sec- gen, which causes cells in these organs to
ond mutation in one of her somatic cells dis- divide more often. In breast tissue, for exam-
ables her second BRCA1 allele, that cell and all ple, the rise in estrogen during a woman’s
its descendants will no longer be able to monthly cycle signals cells lining the milk
respond effectively to DNA damage. Conse- glands to divide to prepare to produce milk
quently, the cells of women with BRCA muta- should a woman become pregnant.
tions accumulate DNA damage at a faster rate, The BRCA genes aren’t the only ones that
which is why hereditary breast cancer often predispose women to breast cancer. Scientists
strikes women who are in their 30s and 40s— now think that genes other than BRCA cause up
much younger than women who have no to half of all hereditary breast cancers. Other
inherited predisposition to cancer. inherited mutations in tumor suppressor genes
Since BRCA genes are expressed in many cell and proto-oncogenes have been linked to vari-
types in addition to breast tissue, mutations in ous other cancers as well (Infographic 10.7).
196 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 10.7
BRCA Mutation Increases the Risk
of Breast Cancer
People with one copy of particular BRCA1 alleles (”carriers”) are
at higher risk of developing breast cancer at earlier ages.
100
BRCA mutation
Percentage of people diagnosed with breast cancer
56–87% carriers
General
80 population
60
33–50%
27–44%
40
20
7%
2% <2%
0
Mammograms (X-rays of the breast) are the best
Breast cancer Breast cancer Ovarian cancer
way to detect cancer.
by age 50 by age 70 by age 70
WHAT? HOW?
Wear sunscreen. Sunscreen helps prevent UV-induced DNA damage in skin cells.
Avoid tobacco (both smoking and chewing). Agents in tobacco can break DNA, causing mutations and many different cancers.
Avoid or reduce alcohol consumption. Excessive consumption of alcohol increases the risk of oral and breast cancers.
Maintain a healthy weight. Excessive body fat increases the risk of breast cancer in postmenopausal women.
Get screened. Screening helps detect cancers early and improves the odds of successful treatment.
WHAT? HOW?
Consider genetic counseling and testing. Genetic counseling and testing enables better-informed decisions about prevention and
treatment.
Screen early. Cancer screening at an earlier age than recommended for the general population can aid
in prevention.
Consider prophylactic surgery. Removal of tissue, mastectomy, or removal of the ovaries, for example, reduces the risk of
developing cancer.
Involve other members of the family. Genetic testing may help others in the family also make better-informed decisions.
cer. Since ovarian cells also have estrogen recep- of misinformation out there about hereditary
tors and, because of a woman’s monthly cycle, breast cancer. People still assume that diet and
divide more frequently than other tissues, ovar- lifestyle changes will cut the risk of cancer in
ian cells are also at high risk of turning cancer- people with hereditary cancer. “Those factors
ous. Ahern is also considering a mastectomy to may help, but not enough in our community,”
remove her breasts. says Friedman, who has had cancer herself.
She feels “pretty good” right now, Ahern says, Women also have options regarding prophylac-
though there was a time when she was visiting tic surgery—when to have it and how much is
online breast cancer discussion groups every necessary—that aren’t always effectively com-
evening after work and all weekend long. They municated by health professionals (Table 10.2).
not only helped her cope emotionally but also Scientists admit that surgery isn’t the most
helped to inform her about her disease and her palatable treatment. “Surgery cuts your risk
treatment options. However, this may not be the substantially, but it’s still pretty traumatic,”
best route to support for everyone. says Sellars. “It would be nice to say we’ve got
But unfortunately, according to Sue Fried- a medication you can take and you’ll have the
man, executive director of Facing Our Risk of same effect. But we just don’t have that kind of
Cancer Empowered (FORCE), there is still a lot treatment right now.” ■
198 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Lorene Ahern with her son. Her hair was just growing back after chemotherapy.
COURTESY LORENE AHERN
Summary
Q Cancer is uncontrolled cell division caused by mutations Mutations that occur in sperm or egg cells are inherited by
in DNA. offspring.
Q Mutations occur spontaneously during DNA replication. Q People with “hereditary” cancer inherit predispositions
They can also be caused by environmental triggers such as to the disease in the form of specific genetic mutations.
tobacco or UV radiation. These mutations are present in all body cells and can serve
Q Mutations in certain genes can lead to cancer if they
as the first mutation that may lead to cancer.
damage the normal function of the proteins those genes Q Women with BRCA mutations have a much higher risk of
code for. developing cancer, and at an earlier age, than women
Q Mutations in two types of genes, proto-oncogenes and
without these mutations.
tumor suppressors, cause most cancers. Q Mutations introduce new alleles into the population.
Q Multiple mutations must occur in the same cell for it to
These alleles may code for proteins that have
become cancerous. advantageous, neutral, or harmful affects on an individual.
Q Certain alleles are more common in specific ethnic
Q Mutations that occur in somatic (that is, body) cells, for
example skin or breast cells, are not inherited by offspring. groups that have been reproductively isolated.
MUTATIONS AND CANCER 6. Why does wearing sunscreen reduce cancer risk?
Cancer occurs when cells accumulate several DNA a. Sunscreen can repair damaged DNA.
mutations that enable the cells to divide b. Sunscreen can activate checkpoints in skin
uncontrollably. People with inherited cells.
predispositions to cancer develop the disease at an c. Sunscreen can reduce the chance of
earlier age than others because their cells already mutations caused by exposure to UV radiation
have one mutation that hinders their cells’ ability to present in sunlight
divide normally. d. It doesn’t; sunscreen causes mutation and
actually increases cancer risk.
e. Sunscreen can prevent cells with mutations
HINT See Infographics 10.1–10.7. from being destroyed.
j USE IT
j KNOW IT 7. Lorene Ahern was born with an inherited
1. What are some differences and some similarities predisposition to cancer. At the cellular and genetic
between tumor suppressor genes and oncogenes? level, what was she born with? At birth, were cells in
her breast genetically identical to cells in her liver?
2. What is the role of BRCA1 in normal cells? Now that she has breast cancer, are her cancer cells
genetically identical to her normal breast cells?
3. In an otherwise normal cell, what happens if one Explain your answers.
mistake is made during DNA replication?
a. Nothing; mistakes just happen. 8. What would you say to a niece if she asked you
b. A cell cycle checkpoint detects the damage how she could reduce her risk of getting breast
and pauses the cell cycle so the error can be cancer? Assume there is no family history of breast
corrected. cancer. How might each of your suggestions reduce
c. The cell will begin to divide out of control, her risk?
forming a malignant tumor.
d. A checkpoint will force the cell to carry out 9. If you wanted to change your lifestyle to reduce
apoptosis, a form of cellular suicide. your risk of developing cancer, which of the following
e. The mutation will be inherited by the behaviors would be important?
individual’s offspring. a. limiting alcohol consumption
b. wearing sunscreen
4. Which of the following can cause cancer to c. avoiding exposure to tobacco
develop and progress? d. by avoiding exposure to pesticides
a. a proto-oncogene e. all of the above
b. an oncogene
c. a tumor suppressor gene 10. Who of the following women would be most
d. a mutated tumor suppressor gene likely to benefit from genetic testing for breast
e. b and d cancer?
f. b and c a. a 25-year-old woman whose mother, aunt,
and grandmother had breast cancer
5. Someone with a BRCA1 mutation b. a healthy 75-year-old woman with no family
a. will definitely develop breast cancer. history of breast cancer
b. is at increased risk of developing breast c. a 40-year-old woman who has a cousin with
cancer. breast cancer
c. must have inherited it from her mother, d. a 55-year-old woman whose older sister was
because of the link to breast cancer. just diagnosed with breast cancer
d. will also have a mutation in BRCA2. e. All women can benefit from genetic testing
e. b and c for breast cancer.
200 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
11. People like Lorene Ahern have inherited a having annual mammograms. She has also been
mutated version of BRCA1. Why does this mutation tested for BRCA1 and BRCA2 mutations. She has a
pose a problem? Why are these people at high risk of BRCA2 mutation and is considering prophylactic
developing breast cancer when they still have a surgery. Her younger sister, Anne, doesn’t want to
functional BRCA1 allele? Describe how the protein know the results of Nellie’s genetic testing because
encoded by normal BRCA1 compares to that encoded if Nellie has a BRCA2 mutation, then there is a
by mutant alleles of BRCA1. chance that Anne could have inherited the same
mutation from their mother. Does Nellie or Nellie’s
SCIENCE AND ETHICS doctor have an obligation to tell Anne about the test
12. Nellie has a family history similar to Lorene results? What about Nellie’s older brother? Should
Ahern’s. Nellie’s mother died at an early age from he be told? There are personal and medical benefits
breast cancer, as did her maternal aunt (her and risks to consider here.
mother’s sister). Nellie is not yet 35 but has started
203
Chapter 11 Single-Gene Inheritance and Meiosis
E
mily Schaller had no idea that her with gigs scheduled in Cleveland, Chicago, and
Detroit-based band would be strum- soon, Emily hopes, New York City.
ming its way to fame one day. A few Emily may look like a typical rock ’n’ roller,
years ago she and her girlfriends were with her bleached blond hair and tattooed fore-
goofing around singing songs when someone arms; but her carefree appearance masks a seri-
floated the idea of forming a band. None of ous underlying condition. Emily has cystic
them could play guitar, bass, or drums, but that fibrosis (CF)—a genetic disease she inherited from
didn’t stop them. “We just went her parents—and each day she
out and bought a bunch of takes a cocktail of drugs and vita-
Approximately
instruments,” says Emily, who mins. CF has many symptoms,
chose to play drums. The friends
2,500 babies are the most dangerous of which is
practiced in Emily’s parents’ born with the mucus that clogs airways in the
basement. Her older brother disease every year, lungs and makes it difficult to
overheard the original mix of making CF the breathe. People with CF also can’t
punk and classic rock songs that digest food well—mucus blocks
most common
the five girls put together and the passageways through which
was so impressed he asked them fatal genetic the necessary enzymes travel to
to open for his own band on disease in the the intestines. So Emily must
New Year’s Eve. The five-girl United States. swallow enzymes before each
rock ’n’ roll band called Hellen meal to ensure that her body gets
was born. enough nutrients. She’s grown
“It’s getting really huge,” says Emily excitedly. accustomed to the schedule, but having to take
Hellen performs almost every weekend in such meticulous care of her health is hardly rou-
Detroit and is now taking its show on the road, tine for most people her age.
204 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
In 2000, Emily and her friends launched an all-girl band called Hellen. From left to right:
Katie, Charmain, Becca, Emily, and Amanda.
Approximately 2,500 babies are born with each created by genetic mutation. Tsui and Col-
the disease every year, making CF the most lins discovered that CF is caused by mutations
common fatal genetic disease in the United in a gene called CFTR, which codes for the pro-
States. In 1989, a team of scientists led by Lap tein known as the cystic fibrosis transmem-
Chee Tsui, at Toronto’s Hospital for Sick Chil- brane regulator.
dren, and Francis Collins, then at the University The discovery was a milestone. Now that they
of Michigan, discovered that the disease is knew the gene responsible, scientists could
caused by genetic mutations in a specific gene study how mutations in it make people sick.
that sits on chromosome 7. A mutation is a Because genes provide instructions for making
change in the nucleotide sequence of DNA, proteins, a change in gene sequence can change
MUTATION which creates alternative alleles of a gene. As the function or shape of a protein. In the most
A change in the we saw in Chapter 8, alleles are alternative common CF allele, three nucleotides within the
nucleotide sequence
nucleotide sequences of the same gene. Most CFTR gene are deleted. People who carry this
of DNA.
genes have not just a single allele but several, allele produce a defective CFTR protein. This
slight change wreaks havoc on victim’s bodies— CF Is Caused by Mutations in the CFTR Gene
their lungs, sweat glands, and pancreas no lon-
Cystic fibrosis (CF) is caused by a variety of mutations in the
ger function normally (Infographic 11.1). cystic fibrosis transmembrane regulator (CFTR) gene that sits on
Today, almost 20 years later, scientists under- chromosome 7. One such mutation consists of a deletion of three
consecutive nucleotides, which creates a mutant allele. Consequently,
stand the disease better, and this has led to bet-
the mRNA expressed from this gene has a missing codon and the
ter drugs and therapies to treat symptoms; resulting protein lacks an amino acid in a specific location, rendering
victims of CF are living longer than ever. But the protein nonfunctional.
despite scientific advances, there is still much to Chromosome 7
learn. One aspect of the disease that scientists Normal allele
are studying intensively is that people with iden- A
tical CF alleles vary in the course of their dis- T
C
ease—some have worse symptoms and live A
shorter lives than others. In recent years, scien- T
tists have discovered that there are other genes C
T
that contribute to a patient’s overall health—so- CFTR T
called modifier genes. That discovery is leading gene T
G
to exciting new therapies that may extend G
Emily’s life and the lives of thousands of other T
people with CF. G Normal CFTR protein
T
T
How Is CF Inherited?
When Emily’s mother, Debbie, learned that her
daughter had CF, she was shocked. She and her Chromosome 7
Mutant allele
husband, Lowell, were both healthy, and they
already had two healthy sons. How did their
daughter Emily develop a disease that neither A Three
T
Debbie nor her husband had? C
nucleotides
The answer is inheritance. Genes, which pro- A deleted in
T CF allele
vide instructions for making proteins, are the
units of inheritance, physically transmitted CFTR T
from parents to children. The particular alleles gene G C
G T
of genes you received from your parents are the T T Nonfunctional CFTR
reason you resemble your mother and father, G protein that lacks a
and possibly also an uncle or a grandparent. But T critical amino acid
T in its sequence
not every child of a couple receives the exact
same parental genes, and so children can and
do differ from their parents and from each
other.
Consider Emily’s parents. Because they are
DIPLOID
diploid organisms, each of their body cells Having two copies of
carries two copies of each chromosome—one every chromosome.
inherited from mom, the other from dad. Such same general function, the nucleotide
HOMOLOGOUS
paired chromosomes are called homologous sequence of each copy can differ. In other CHROMOSOMES
chromosomes. Because chromosomes come words, a person can carry two different alleles The two copies of each
in pairs, we have two copies of nearly every of the same gene, one of which functions dif- chromosome in a
ferently from the other. In the case of the gene diploid cell. One
gene in our body cells. Genes located on the X
chromosome in the
and Y chromosome in males do not have a sec- CFTR, a person can have one CF-associated pair is inherited from
ond copy. While the two gene copies have the allele and remain healthy if his or her other the mother, the other
is inherited from the
father.
206 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 11.2
Humans Have Two Copies of Nearly Every Gene
Human cells have 23 pairs of homologous chromosomes. One chromosome of each pair is inherited from mom, one from
dad.This makes us diploid, as virtually every cell in the body carries two copies of every gene. Each copy of each gene has
two alleles that can either be identical to each other or different. In the case of CF, carrying at least one normal allele
is enough to remain healthy.
A
T
A
C
T
A
C
T
A
C
T
T
CFTR CFTR T
T
gene gene G
T
G
G
T
G
G
T
T
G
T
Humans have 23 pairs of T
homologous chromosomes. T
PHENOTYPE chromosome has a normal allele to make up CF? Sexual reproduction is a bit like shuffling
The visible or for the defective copy (Infographic 11.2). That’s cards. Before parents pass their genes to their
measurable features why Emily’s parents, even if each of them had offspring, those genes are first mixed up
of an individual.
a CF-associated gene, could be healthy. and then the two copies of each gene are sepa-
GENOTYPE Geneticists make a distinction between a rated from each other, so that not every
The particular genetic person’s observable or measurable traits, or child receives the same combination of alleles.
makeup of an
phenotype, and his or her genes, or geno- It is the unique combination of maternal
individual.
type. As in the case of Debbie and Lowell, one and paternal alleles that come together
GAMETES cannot always determine genotype from phe- during fertilization that determines a person’s
Specialized notype. Both Debbie and Lowell have normal genotype and contributes to his or her
reproductive cells that
carry one copy of each
phenotypes, but they both also carry a disease phenotype.
chromosome (that is, allele as part of their genotype. They each To reproduce sexually, organisms must first
they are haploid). inherited one CF allele from one of their par- create sex cells called gametes. In humans,
Sperm are male ents and therefore can pass that defective these are the egg and sperm cells. Unlike
gametes; eggs are
female gametes. allele along to their children—as they did to the rest of the body’s cells, which are diploid,
Emily. gametes carry only one copy of each chromo-
HAPLOID But not all the Schaller children have the some, which makes them haploid. To become
Having only one copy
disease—Debbie and Lowell also have two haploid, the cells that form gametes go
of every chromosome.
healthy boys. Why didn’t these children inherit through a unique kind of cell division, called
The process of cell division that creates gametes is known as meiosis. Men produce
sperm, the male gametes, and women produce eggs, the female gametes.
23 23
Adult Adult
female Zygote male
(diploid) (diploid) (diploid)
46 46 46
Child
(diploid)
Mitosis
46
MEIOSIS
A specialized type of
meiosis, which halves the number of chromo- Because it unites haploid egg and sperm from cell division that
somes from 46 to 23. When a haploid sperm two people, sexual reproduction is the primary generates genetically
unique haploid
fertilizes a haploid egg, the result is a diploid reason why children don’t look and behave gametes.
zygote that now carries two copies of every exactly like one parent in particular; they inherit
gene on 46 chromosomes. In turn, this zygote alleles from both parents and consequently are ZYGOTE
A cell that is capable
will divide by mitosis to become an embryo, genetically a combination of the two.
of developing into an
which will eventually grow into a human child Besides forming haploid sex cells, meiosis adult organism. The
(Infographic 11.3). contributes to the genetic diversity of offspring zygote is formed when
Meiosis, the cell division that creates sperm in other ways as well. No two gametes produced an egg is fertilized by a
sperm.
and egg, is similar to mitotic cell division (Chap- by the same parent are identical, and that is
ter 9), except that in meiosis there are two sepa- because of two major events during meiosis EMBRYO
rate divisions. The first division separates that contribute to the huge variation we see An early stage of
homologous chromosomes; the second division among parents, children, and their siblings. The development reached
when a zygote
separates sister chromatids (Infographic 11.4). first is recombination, in which homologous undergoes cell division
to form a multicellular
structure.
208 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 11.4
Meiosis Produces Haploid Egg and Sperm
Humans produce egg and sperm
through a process of cell division Homologous
called meiosis, which takes place in the chromosome pair
ovaries and the testes. One purpose of
meiosis is to halve the chromosome
Centromere
number from 46 to 23.
Cell in testis Sister
or ovary
Cell Cycle Begins chromatids
Each chromosome is replicated.
RECOMBINATION
The stage of meiosis in
which maternal and
paternal chromosomes maternal and paternal chromosomes pair combination of maternal and paternal chro-
pair and physically up and swap genetic information. As a result mosomes is distributed into each sperm and
exchange DNA
of recombination, maternal chromosomes actu- each egg cell. This distribution occurs at the
segments.
ally contain segments (and therefore alleles) first division of meiosis (known as meiosis I),
INDEPENDENT from paternal chromosomes and vice versa. when maternal and paternal chromosomes
ASSORTMENT The second vitally important aspect of meio- line up along the midline of the cell and segre-
The principle that
alleles of different sis is independent assortment, which means gate into newly forming cells. Because mater-
genes are distributed that alleles of different genes are distributed nal and paternal chromosomes line up
independently of one independently of one another, not as a pack- randomly (sometimes on the “left,” sometimes
another during
age. Because the number of possible combina- on the “right,”), the exact combination of
meiosis.
tions of alleles is therefore huge, a unique maternal and paternal chromosomes that each
INFOGRAPHIC 11.5
Meiosis Produces Genetically Diverse Egg and Sperm
Meiosis produces haploid gametes that are genetically unique. Each egg and sperm has its own distinct combination of alleles.
The two events that create this diversity are recombination and independent assortment.
Cell at meiosis I
1. Recombination Homologous pair
Before separating at
meiosis I, the maternal Maternal Paternal
and paternal chromosomes chromosome chromosome
line up next to each other
and physically exchange
segments of DNA. Consequently,
maternal chromosomes contain
segments (and thus alleles)
from paternal chromosomes,
and vice versa. D D d d d D D d D d D d D d
D d
2. Independent Assortment
Maternal and
Maternal and paternal
a A A a A a paternal
chromosome pairs separate chromosomes
D d D d d D
according to how they have from each
randomly lined up in the cell. e E e E e E
homologous pair
Each time meiosis occurs, the line up randomly.
chromosome pairs line up
differently, and thus a different
chromosome combination is Possible allele
produced in the resulting gametes. combinations
When all 23 chromosome pairs aDe AdE ADe adE Ade aDE in the gametes
are considered, there are more
than 8 million unique chromosome
combinations possible.
210 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
membrane that allows certain ions in and out of
the cell, keeping the cell’s chemistry in balance.
But in people with CF, the channel is distorted
or dysfunctional and the mechanism goes awry.
The result is that mucus—a slippery substance
that lubricates and protects the linings of the air-
ways, digestive system, reproductive system, and
other tissues—becomes abnormally thick (Info-
graphic 11.6).
This abnormal mucus blocks ducts through-
out the body. The most problematic symptom,
however, is that thick mucus builds up in the
lungs. Patients have trouble breathing, and the
mucus provides fertile ground for bacteria and
other organisms. Over time, repeated infections
permanently damage the lungs. Suffocation
often kills CF victims as they slowly lose their
ability to breathe.
To avoid lung damage, every morning Emily
Cystic fibrosis patients
like Emily wear vibrating
dons an inflatable vest that vibrates to loosen
vests to loosen the The Schallers now understood that the dis- mucus in her lungs. During this 30-minute ther-
mucus in their lungs ease ran in both their families. But they could apy she inhales a saltwater solution and another
while inhaling a still not help Emily. “They told us she would only medication to thin her mucus, which she then
saltwater solution to
thin out the mucus. live to be about 12 years old,” Debbie recalls, coughs out periodically. To that regime she adds
adding, “We just put ourselves in the hands of two other medications three times a week to
medical professionals.” keep her lungs from becoming inflamed and to
kill off infections. But despite her best efforts,
Living with the Disease Emily has been hospitalized more frequently in
Growing up, Emily was scarcely aware of her recent years because of serious lung infections
own disability. The visits to doctors and peri- that hinder her ability to breathe.
odic stays in the hospital were just a part of life. Emily remains undaunted. “I just live each
All her teachers and friends knew that she had day at a time,” she says. She works about 30
CF. “My family and friends were all so support- hours a week at a retail shop in downtown
ive,” she says. In high school she played volley- Detroit and spends her evenings practicing
ball, basketball, and soccer, and participated in with her band, performing at concerts, playing
many walkathons to raise money for CF guitar, or hanging out with friends. While she
doesn’t plan too far ahead into the future, she
“They told us she would only live to be about 12 hopes her band’s fame and success will grow.
If the band’s following expands beyond Detroit,
years old. We just put ourselves in the hands of she hopes to tour Europe. Emily hasn’t ruled
medical professionals.” –Debbie Schaller out having a family of her own one day. Even
though Emily has CF, her children will not nec-
research. Thanks to medical progress, Emily essarily have the disease.
has outlived doctors’ original expectations by Why not? Remember that since Emily has
more than a decade. CF, her parents, Lowell and Debbie, both must
But she deals daily with the legacy of her carry disease alleles. But as neither of them
genetic inheritance. In healthy people, the has the disease, the CF alleles must be “hid-
CFTR protein acts as a channel within a cell’s den.” When one allele masks the effect of
CFTR Inhaled
channel Mucus Cilia particle
Chloride
Sodium is trapped
Lung
in the cell.
Chloride epithelial
leaves cell Sodium
the cell.
another, the hidden allele is described as homozygous recessive: she inherited one RECESSIVE ALLELE
An allele that reveals
recessive (designated by a lower-case letter, recessive CF allele from each parent, which is
itself in the phenotype
e.g., a). The normal allele, which conceals the why she has the disease. only if the organism
effect of the recessive allele, is known as the What were the chances that Debbie and Low- has two copies of that
dominant allele (designated by a capital let- ell would have a child with CF? To figure out the allele.
ter, e.g., A). Debbie and Lowell are healthy likelihood that parents will have a child with a
DOMINANT ALLELE
because they each have a dominant normal particular trait, we can plot the possibilities on An allele that can
allele that compensates for their defective a Punnett square, a tool named for the British mask the presence of
recessive CF allele. Geneticists call their geno- geneticist Reginald C. Punnett, who devised it. a recessive allele.
type heterozygous. Their two healthy sons A Punnett square matches up the possible HETEROZYGOUS
either are heterozygous like their parents, or parental gametes and shows the likelihood Having two different
have two normal alleles—that is, their geno- that particular parental alleles will combine. alleles.
type is homozygous. A genotype made up of As heterozygous individuals, Debbie and Low-
HOMOZYGOUS
two dominant alleles is known as homozygous ell each have a 50% chance of passing on their Having two identical
dominant. Emily’s genotype, however, is CF allele to a child, which means they have a alleles.
212 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
25% chance of having a child with CF and a 75% none of her children would have the disease—
PUNNETT SQUARE
A diagram used to chance of having a healthy child. The chance they would all have a heterozygous genotype
determine that a child will be a heterozygous carrier— but a normal phenotype. But as carriers they
probabilities of that is, that the child will carry the recessive could pass on the disease to their children. If she
offspring having
allele for CF but will not have the disease had children with a man who was heterozygous
particular genotypes,
given the genotypes because the allele’s effect is masked by the for the CF gene, then her children would have a
of the parents. dominant allele—is 50% (Infographic 11.7). 1 in 2, or 50%, chance of having CF.
Just as Emily’s genotype is different from her Not all recessive alleles cause disease. Physi-
CARRIER
An individual who is
parents’ genotype, Emily’s children will have cal traits such a blue eyes, for example, result
heterozygous for a different genotypes from her own. Whether or from the inheritance of two recessive alleles of
particular gene of not her children develop CF depends on the the same gene. And not all genetic diseases are
interest, and therefore father’s genotype. Since Emily is homozygous, caused by recessive alleles; some, such as the
can pass on the
recessive allele she can contribute only recessive CF alleles to neurodegenerative disorder called Huntington
without showing any her children. If Emily were to have children with disease, are determined by dominant alleles.
of its effects. a man who had two normal alleles, for example, Diseases caused by dominant alleles, however,
INFOGRAPHIC 11.7
How Recessive Traits Are Inherited
Cystic fibrosis is a recessive trait, which means that the
Normal Father
disease phenotype is caused by inheriting two recessive
(heterozygous)
alleles, as Emily has. Emily’s parents do not have CF because
they each possess one dominant allele, but do carry one
recessive CF allele, making them heterozygous carriers. To
calculate the probability that Debbie and Lowell will have a A a Cell in the testis
child with CF, we can determine the possible alleles in their
gametes and then join all possible combinations of these
sperm and egg in a Punnett square. Meiosis
Sperm
A a
AA Aa (Carrier)
A a Meiosis For heterozygous
parents such as
Normal child Affected Debbie and Lowell,
child the chance that a
Cell in a
child will be born
the ovary
with CF is 1 in 4,
Eggs Aa aa or 25%.
INFOGRAPHIC 11.8
How Dominant Traits Are Inherited
Some genetic conditions, such as Huntington disease, a degenerative neurological disease, and polydactyly, having more
than five fingers or toes per limb, are caused by dominant alleles. Plenty of common traits such as dark eyes and dimples are also
determined by dominant alleles. In these cases, inheriting one copy of the dominant allele is sufficient to display the trait.
Meiosis
T = dominant allele
t = recessive allele
Sperm
T t
Affected mother
(heterozygous) Affected Affected For a dominant trait like Huntington
Cell in child child disease, the chance that heterozygous
the ovary T parents will have a child with the
disease is 3 in 4, or 75%.
TT Tt
T t Meiosis
Affected Normal child
child
t
Eggs Tt tt
214 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
TABLE 11.1
But in recent years, scientists have learned
Inherited Genetic Conditions in Humans that there is more to the story. Researchers
have discovered other genes on different
RECESSIVE TRAITS PHENOTYPE
chromosomes that contribute to the severity
of CF symptoms. The genes so far discovered
Albinism Lack of pigment in skin, hair, and eyes
predominantly inf luence a person’s im-
mune system, which helps the body fight off
Cystic fibrosis Excess mucus in lungs, digestive tract, and liver;
increased susceptibility to infections infections.
For example, scientists have found that one
Chin cleft Indentation in chin allele of a gene called TGFB1, located on chro-
mosome 19, is associated with more severe
Sickle-cell disease Sickled red blood cells; damage to tissues
lung disease in CF patients. This gene influ-
ences a person’s immune response to infec-
Tongue rolling Ability to curl tongue into a U-shape
tion. Scientists suspect that CF patients with
Tay-Sachs disease Lipid accumulation in brain cells; mental deficiency, certain TGFB1 alleles mount a more vigorous
blindness, and death in childhood response to infections than those with other
alleles. Such a heightened immune response
DOMINANT TRAITS PHENOTYPE
can cause lung tissue to scar. So if a CF patient
also inherited this specific allele of TGFB1, his
Huntington disease Mental deterioration and uncontrollable movements;
onset at middle age or her lungs are more likely to scar in response
to infections. The impact of such modifier
Freckles Pigmented spots on skin, particularly on face and genes on the CF phenotype makes it more com-
arms
plicated to assess how disabling any particular
person’s CF disease will be—but it is not
Polydactyly More than five digits on hands or feet
impossible.
Dimples Indentation in the skin of the cheeks Parents who are heterozygous carriers of
CF, for example, have a 1 in 4, or 25%, chance
of having a child who has CF. If these two par-
testing at least six different experimental drugs ents are also heterozygous for TGFB1, then the
in humans. probability that their child will be homozygous
Through basic research, scientists continue recessive for TGFB1 is also 1 in 4 (25%). The
to learn more about the disease. Over the past chance of two independent events occurring
20 years, scientists have discovered more than together is calculated by multiplying the two
1,000 different alleles of the CFTR gene. The independent chances together. So the proba-
most common is ΔF508, which bility of being homozygous
accounts for about 70% of all CF Over the past 20 recessive for both CFTR and
alleles. This particular CF allele years, scientists TGFB1 is ¼ × ¼, or 1 in 16. This
is associated with more severe probability can also be calcu-
disease. But researchers have
have discovered lated using a Punnett square
long puzzled over why the dis- more than 1,000 (Infographic 11.9).
ease varies in two people with different alleles of Understanding how these
identical CF alleles—even two the CFTR gene. modifier genes contribute to the
people homozygous for the disease may point the way to
ΔF508 allele will vary in how their disease even more therapies. In some cases, existing
progresses. Researchers long thought that drugs may prove useful. Drugs that reduce
perhaps environmental factors such as diet, inflammation by targeting the TGFβ 1 protein,
social relationships, and exercise might be for example, may help reduce scarring in the
responsible. lungs.
INFOGRAPHIC 11.9
Tracking the Inheritance of Two Genes
People with CF differ in the severity of their disease. Some of this variability is influenced by alleles of other genes that sit on
other chromosomes. One such gene, called TGFB1, is located on chromosome 19, shown here with symbol D. We can also use
a Punnett square to follow the inheritance of two genes, as in the example below.
Meiosis
to make
sperm
AD Ad aD ad
Both parents produce four different allele combinations, with respect to these genes
as a result of independent assortment of chromosomes 7 and 19 during meiosis I.
216 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Every year Emily plays a concert to benefit CF.
HINT See Infographics 11.4 and 11.5. HINT See Infographics 11.6 to 11.9.
218 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
13. A person has a heterozygous genotype for a 16. Your friend’s mother has Huntington disease
disease gene and no disease phenotype. Does this and her mother’s mother does not have Huntington
disease have a dominant or a recessive inheritance disease. If your friend’s father does not have
pattern? Huntington disease, what is the probability that
your friend will develop Huntington disease? (Hint:
14. Women can inherit alleles of a gene called BRCA1 draw a Punnett square.)
that makes them susceptible to breast cancer. The
alleles associated with elevated cancer risk are SCIENCE AND ETHICS
dominant. Of the genotypes listed below, which has 17. Emily took a genetic test to determine which CF
the lowest genetic risk of developing breast cancer? alleles she inherited. The results revealed she has
a. BB one allele about which very little is known. Although
b. Bb genetic testing can predict whether a person will
c. bb develop CF and drugs can prolong life, for some
d. BB and Bb have less risk than bb. other genetic diseases, such as Huntington disease,
e. All have equal risk. treatment is limited and there is no cure. If you were
faced with the decision to take a genetic test,
j USE IT especially for a disease for which there is no cure,
15. Assume that Emily (who has CF) decides to have would you take the test? Why or why not?
children with a man who does not have CF and who
has no family history of CF.
a. What combination of gametes can each of
them produce?
b. Place these gametes on a Punnett square and
fill in the results of the cross.
c. On the basis of the Punnett square results,
what is the probability that they will have a child
with CF?
d. On the basis of the Punnett square results,
what is the probability that they will have a child
who is a carrier for CF?
Mendel’s Garden
221
Milestones in Biology
Mendel’s Garden
An Austrian priest lays the foundation for
modern genetics
222 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
J
ohann Gregor Mendel was an unlikely
father of genetics. He was a melancholy
Austrian priest who by all accounts suf-
fered from debilitating test-taking anxiety,
failing his teaching exam twice. Mendel never-
theless collected the first research suggesting
that each parent passes discrete “elements” to
each child that determine specific traits. These
“elements” remain intact and can be passed on
indefinitely to future generations without being
diluted. Although he couldn’t define these “ele-
ments,” in fact Mendel had discovered what
came to be called genes.
Mendel’s idea was new and radical, with
implications for how human traits were
understood. Some contem-
porary scientists in the mid-
Although he couldn’t 19th century believed that
define these “elements,” p a r e n t a l t r a i t s w e r e
in fact Mendel had blended—for example, a tall
discovered what came to mother and short father
would have a son or daughter
be called genes. of medium height. Other sci-
entists thought that a sperm
or egg contained a miniature adult waiting to be
born. But through a series of simple yet elegant
experiments conducted in a monastery garden,
Mendel revolutionized our understanding of
heredity decades before the word “genetics”
was coined.
In 1843, Mendel became a monk at the Augus-
tinian Abbey of St. Thomas in Brünn (now Brno)
in what was then the Austro-Hungarian Empire.
He studied theology and was ordained a priest
in 1847. When he failed his teaching exam (the
Augustinians were a teaching order), the abbot
at St. Thomas, who encouraged intellectual pur-
suits among the members of the abbey, sent
Mendel to the University of Vienna, where for
2 years he studied math, physics, zoology, bot-
any, and plant physiology.
Mendel returned to the monastery in 1853,
and a year later began experiments to study
hybrids—the offspring of different breeds or
The garden outside the varieties. He began by breeding mice but, as
Augustinian Abbey in Brno, Robin Marantz Henig writes in her book The
where Mendel performed his
experiments.
Monk in the Garden (2001), the local bishop
found “toying with the reproduction of
Fluid Sperm
Fluid Egg
Egg with
homonculus Offspring traits are the
result of blending these
parent substances
Sperm with
homonculus
Semen and menstrual fluid Particles from different
contained the substance that parts of the body migrate
contributes to offspring traits to the egg and sperm
224 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
disappear in one generation only to show up from another plant from entering. Once he had
again in the next, he started his breeding established true-breeding plants, he could
experiments with plants that “bred true”— then set up a cross between two different
plants with offspring that carried the same plants. What would happen if he crossed a
traits as the parents, generation after genera- green-seeded plant with one that produced
tion. Only then could he study what happened yellow seeds? Or a purple-flowered plant with
to particular traits when purebred plants of a white-flowered plant? For each cross, Mendel
one variety were mated with purebred plants painstakingly pollinated individual flowers
of another variety. from the two plants by hand. He also prevented
Pea plants can self-pollinate, which means self-pollination by removing the male repro-
that the pea flower contains both male and ductive parts from the plants to be fertilized.
female sexual organs, and a single plant can Mendel noticed that when he bred a true-
fertilize itself to produce offspring. To create breeding white-flowering plant with a true-
true-breeding plants, Mendel covered pea breeding purple-f lowering plant, the first
flowers with a small bag so that he could con- generation of offspring (the F1 generation) all
trol fertilization, manually fertilizing plants had purple flowers. That the flowers were true
with their own pollen and preventing pollen purple rather than pale purple suggested that
Mendel’s Experiments
True Bred: Self-pollinated, parents and offspring share traits
Parents ×
F1 parent
Mendel reasoned that the only
way that the F2 generation could
have a ratio of 3:1 (3 purple for every
1 white offspring) would be if the F1 F f
parents each had one purple (F) ...and contributed only one of these
and one white (f) allele... two alleles randomly to each offspring.
F f
f
When an offspring has one of each allele (Ff)
f it displays the trait of the “dominant” allele
(F), and the “recessive” allele (f) is masked.
F f f f
226 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
have been formalized into two laws. The first of
these is Mendel’s law of segregation, which
states that for any diploid organism, the two
alleles of each gene segregate separately into
gametes. That is, every gamete receives only
one of the two alleles and the specific allele that
any one gamete receives is random.
Smooth,
Smooth R Wrinkled r
Yellow parent The texture alleles and the color alleles
assort independently into each gamete.
Yellow Y Green y R r Y y The result is a random combination of
texture alleles with color alleles.
Possible
R Y R y r Y r y
Smooth, gametes
Yellow parent
R Y
r y
228 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Chapter 12 Complex Inheritance
Q & A: Genetics
j What You Will Be Learning
12.1 X and Y Chromosomes Determine Human Sex
12.2 X-linked Traits Are Inherited on X Chromosomes
12.3 Female Carriers Can Pass Disease Alleles to Their
Children
12.4 Y Chromosomes Pass Largely Unchanged from
Fathers to Sons
12.5 DNA Links Sally Hemings’s Son to Jefferson
12.6 Hair Texture Exhibits Incomplete Dominance
12.7 Human Blood Type Is a Codominant Trait
12.8 A Mismatched Blood Transfusion Causes Immune
Rejection
12.9 Human Height Is Both Polygenic and Multifactorial
12.10 Serotonin Transporter Function Is Linked to
Depression
12.11 Depression Is a Multifactorial Trait
12.12 Chromosomal Abnormalities: Aneuploidy
12.13 Amniocentesis Provides a Fetal Karyotype
229
Chapter 12 Complex Inheritance
Q & A: Genetics
Complexities of human genetics, from sex to depression
I
n Chapter 11, we saw how dominant and more complex patterns of inheritance. Although
recessive traits are inherited. Not all traits these types of inheritance differ from simple
are inherited so simply, however. Other fac- dominant and recessive patterns, they still rely
tors—including sex and the number of genes on the underlying genetic variation resulting
that influence a particular trait—can alter pat- from meiotic division.
terns of inheritance. In this chapter, we consider
230 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
SEX DETERMINATION genitalia are female. Whether a fetus produces
male or female hormones, and develops male
Q What determines a person’s or female sex organs, depend on the set of chro-
sex? mosomes it receives from its parents.
A botched circumcision in 1965 on a little Humans have 23 pairs of chromosomes; 22
A boy named Bruce Reimer in time became pairs are autosomes and 1 pair consists of
a landmark example of how nature determines the sex chromosomes, X and Y. Sons inherit
a person’s sex. Doctors at the hospital where one Y chromosome from their father and
Reimer was circumcised used an experimental one X chromosome from their mother. Daugh-
procedure that involved burning off the fore- ters inherit two X chromosomes, one each from
skin. The procedure went awry, burning most mother and father. So males are XY and females
of Bruce’s penis. With the limited surgical tech- are XX. In the absence of a Y chromosome, a
niques available at the time, his penis would fetus will develop into a female. Thus, fathers
never be completely functional again. On the determine the sex of a baby based on whether
advice of John Money, a well-known and the sperm fertilizing a mother’s egg carries an
respected doctor at Johns Hopkins University in X or a Y sex chromosome. More specifically, the
Baltimore, who had written much about the Y chromosome contains genes that masculinize
importance of environment in determining a a developing fetus (Infographic 12.1).
person’s sexual identity, Bruce’s parents Although the vast majority of men carry an
decided to have their little boy surgically turned XY chromosome pair, and the vast majority of
into a little girl and rear him as “Brenda.” women carry an XX chromosome pair, there are
But Brenda never behaved like a girl. She exceptions to this rule. Each year about 1 in
didn’t like playing with other girls and often got every 1,600 babies born in America falls into an
into fistfights at school. By the time Brenda intermediate sex category termed “intersex,”
reached puberty, her behavior became so trou- which groups people who have a “disorder of
blesome that her father broke down and told her sex development.” An intersexual person is
what had happened to her. someone whose external genitalia do not match
Brenda eventually had reconstructive surgery his or her internal sex organs—for example, a
to recreate a penis, and she changed her name person with an XX chromosome pair who has
AUTOSOMES
to David. David told his story in a book published internal ovaries but external genitalia that
Paired chromosomes
present in both males and in 2000, As Nature Made Him: The Boy Who Was
females; all chromosomes Raised as a Girl, by John Colapinto. By that time,
except the X and Y it had become increasingly clear that sexual
chromosomes.
identity is largely influenced by biology. Stud-
SEX CHROMOSOMES ies had shown that prenatal exposure to fetal
Paired chromosomes that sex hormones such as testosterone not only
differ between males and
determine whether a fetus will develop female
females, XX in females,
XY in males or male genitalia, but also that these sex hor-
mones act on a developing baby’s brain. Male
Y CHROMOSOME hormones like testosterone promote masculine
One of two sex
behaviors, whereas female hormones such as
chromosomes in humans.
The presence of a Y estrogen promote feminine behaviors.
chromosome signals the The end effect of sex hormones on a develop-
male developmental ing fetus are the sex organs—both internal ones
pathway during fetal
development. like testes and ovaries and external ones like
the penis and vulva. The external sex organs
X CHROMOSOME largely determine a person’s sex. People with
One of the two sex
male genitalia are male and people with female
chromosomes in humans.
INFOGRAPHIC 12.1
X and Y Chromosomes Determine Human Sex
Males and females differ by virtue of a pair of sex chromosomes. Females have two X chromosomes and males have a single X and
a single Y chromosome. Every person must have at least one X chromosome, but it’s the presence of a gene on the Y chromosome
that initiates male development.
X X X Y
Meiosis Meiosis
232 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
TABLE 12.1
How Many Sexes Are There?
Each of the following individuals has 22 pairs of autosomal chromosomes. Discrepancies in the
gender phenotype may result from environmental factors, hormone imbalance, or having too
many or too few sex chromosomes.
True gonadal intersex XX and/or XY Ovaries and testes Male or Female or Infertile; historically called true
ambiguous hermaphrodites
47, XYY syndrome XYY Testes Male Fertile, taller, learning and
emotional disabilities
Some people have only one sex chromosome, can also play a role in defining a person’s sex in
and others may have three sex chromosomes. terms of external genitalia (Table 12.1).
Every person must have at least one X chromo- The question of sex goes beyond a person’s
some (the only sex chromosome the mother can genitalia or genotype, however. Further, defin-
contribute). Because of errors in chromosome ing what counts as “masculine” and “femi-
segregation during meiosis, a variety of other X nine” can be even more complicated. For
and Y combinations are possible: XXY men, example, some men have characteristics that
women with only a single X chromosome, XXX we typically identify as female, such as a high
females, and XYY males. In many of these cases, voice and sparse body hair, yet they are geneti-
a person’s physical traits and genitalia reveal cally and anatomically male. And many
that they do not have the usual makeup of sex women have what are considered to be more
chromosomes, but not always. These are just a masculine features, such as angular faces and
few examples of the many chromosomal pos- more muscle as compared to body fat. Yet,
sibilities that determine sex. Environmental fac- they, correspondingly, are genetically and ana-
tors, like exposure to chemicals or abnormal tomically female. In other words, there is no
levels of hormones during sexual development, set of physical or mental characteristics that is
234 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 12.2
X-linked Traits Are Inherited on X Chromosomes
Duchenne Muscular Dystrophy (DMD) is an example of an X-linked trait. Recessive mutations of the dystrophin gene on
the X chromosome cause the disease. DMD primarily affects males because they inherit only one copy of the X chromosome
(from their mothers). Therefore, the single DMD allele they inherit determines their phenotype. Since females have two
X chromosomes, they may carry the DMD allele, but have a healthy phenotype.
X Y
Meiosis
Carrier mother
(no DMD) X has a normal
X Y dystrophin allele.
X has a DMD allele.
Normal Normal
X
daughter son
XX XY
X X Meiosis Mother does not have DMD, but passes
the DMD allele to half her sons and
Carrier Affected daughters. Only the sons have DMD.
Cell in X
daughter son
the ovary XX XY
X Y
Meiosis
Normal
mother X Y
Carrier Normal
X While most males with DMD do not
daughter son
XX XY survive long enough to have children,
X X Meiosis IF a male with DMD did have children,
none of his sons would be affected
Carrier Normal and all of his daughters would carry
Cell in X the DMD allele.
daughter son
the ovary XX XY
The following diagram, known as a pedigree, shows how an X-linked trait passes through generations.
2. Your cousin inherited his DMD 3. A grandmother who carried the DMD allele
allele from his mother (your aunt). (XX) definitely passed the DMD allele to one of
She must be a carrier (XX). Since the her daughters (your aunt). She may have passed
grandfather does not have DMD, it on to her other daughter (your mother) as well.
your aunt must have inherited her Grandfather Grandmother
DMD allele from her mother
(your grandmother).
XY XX
Males
Females
You
XX XY XX XY XX or XX XY
236 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Are these people descendants of Thomas Jefferson and Sally Hemings?
Mother Father
Duplicated X
chromosome
Duplicated Y
t t chromosome
D d D d D D
t t
D d D d D D
t t
D d D d D D
first child; descendants of Eston Hemings, different people.) The results showed that the
Sally Hemings’s son; and descendants of man descended from Eston Hemings has the
John Carr, Jefferson’s sister’s son. Since Jeffer- same Y chromosome as the descendants of Field
son’s only surviving child from his wife was Jefferson. Consequently, Thomas Jefferson
a daughter, he did not have any direct male could have fathered Eston Hemings. However,
descendants, which is why scientists tested any male Jefferson could have fathered
descendants of Jefferson’s grandfather (Info- Hemings’s son Eston (Infographic 12.5).
graphic 12.4). In fact, some historians have argued that
The study analyzed 11 short tandem repeats Thomas’s brother Randolph Jefferson fathered
(STRs) on the Y chromosome. (Recall from Eston. But other experts have argued that his-
Chapter 7 that STRs are regions of noncoding torical evidence places Thomas himself rather
DNA that show differences in the number of than Randolph under the same roof as Sally at
times a short DNA sequence is repeated among the time of her conceptions.
238 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 12.5
DNA Links Sally Hemings’s Son to Jefferson
Scientists compared DNA sequences on the Y chromosome of Sally Hemings’s and Thomas Jefferson’s
grandfather’s descendants. The DNA sequences match at the eleven different STR locations analyzed.
STR analysis:
Numbers of repeats at each STR location
STR location 1 2 3 4 5 6 7 8 9 10 11
Unrelated individual 14 12 5 11 3 10 11 13 13 13 7
For the descendants of Eston Hemings, the As for the relationship between Jefferson
DNA study was powerful vindication. They had and Sally Hemings, historians continue to
long argued that they were descended from debate whether it was consensual or forced. “I
Thomas Jefferson, but without hard evidence, was a history major,” said Jefferson Wester-
most historians disregarded their claims. “I feel inen, “And we learned not to say, ‘I feel this, I
wonderful about it,” Julia Jefferson Westerinen, a think that,’ without knowing the facts. They
Staten Island artist and Eston’s great-great-grand- had a relationship of 38 years. I would like to
daughter told the New York Times when the study think they were in love, but how would I
results were published. “I feel honored.” know?”
240 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 12.6
Hair Texture Exhibits Incomplete Dominance
Incomplete dominance means that heterozygotes display a phenotype intermediate between homozygous dominant
homozygous recessive. Hair texture is an example. There are two alleles of the gene that specify hair texture, and
curly (H) and straight (h).
Curly father
People who are homozygous
dominant (HH) express double
the amount of
wavy hair protein
and consequently
H H Cell in the testis
have curly hair.
Meiosis
Straight mother
People with straight hair H H
are homozygous recessive Wavy offspring
(hh); they don’t h Heterozygotes (Hh)
Wavy Wavy
produce any express some wavy
Hh Hh
protein that hair protein, which
h h Meiosis
makes hair makes their hair
wavy. wavy.
h Wavy Wavy
Cell in
Hh Hh
the ovary
CODOMINANCE
QWho can be a universal
blood donor?
When a person needs a blood transfusion,
A the donated blood cannot come from just
anyone. The transfused blood must match the
recipient in ways that are determined by genet-
ics. The two most important genetic attributes
are ABO blood type and Rhesus (Rh) factor.
Your blood type indicates the presence of spe-
cific molecules on the surface of your red blood Are you a universal blood donor?
cells. Your Rh status, (+) or (–), indicates the pres-
ence or absence of Rh proteins on the surface of
your red blood cells. Both ABO blood type and maternal and paternal alleles contribute
Rh factor must match between donor and recipi- equally and separately to the phenotype.
ent; mixing incompatible blood causes blood Unlike incomplete dominance in which hetero-
cells to clump, which is life threatening for peo- zygotes carry an intermediate phenotype, co-
ple receiving transfusions. domina nt traits share the limelight:
CODOMINANCE There are three basic blood type alleles: A, heterozygotes express both phenotypes.
A form of inheritance B, and O. Since we inherit one allele from each Blood type alleles A and B are codominant,
in which both alleles parent, the possible combinations of the three while O is recessive to both A and B. Conse-
contribute equally to
the phenotype. alleles are OO, AO, BO, AB, AA, and BB. Blood quently, if you have blood type A, your geno-
type is an example of codominance—both type will either be AA homozygous or AO
Blood
Transfusions: Type A Type B Type A and B No blood group
The ability to donate or markers markers markers markers
receive blood is based on
immune rejection. If two
people have the same Red blood
surface markers, then their A B AB O
cell type:
blood will be compatible.
People with type O blood
have no surface markers to
provoke an immune Genotype: AA or AO BB or BO AB OO
response in a recipient (so
O is the universal donor). Can donate Type A or AB Type B or AB Type AB Type A, B, AB,
People with type AB blood to: recipient recipient recipient or O recipient
will not recognize either
Can receive Type A or O Type B or O Type A, B, AB, or O Type O
marker as foreign, so can
from: donor donor donor donor
receive blood from any
donor.
242 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 12.8
see such a range of heights among us. When
A Mismatched Blood Transfusion many genes act together, their effects are
Causes Immune Rejection cumulative—they add up to determine, for
example, a person’s height.
If donor and recipient are not matched according to ABO blood type Height is an example of a trait that shows con-
and Rh factor, a recipient can have a life-threatening immune reaction tinuous variation in any given population. In the
to donated blood. A person with type A blood, for example, cannot United States, most people fall between 5 feet
donate blood to a person with type B blood.
and 6.2 feet tall, and women tend to be shorter
O Rh negative A Rh positive than men. This means that if one were to plot
donor donor height on a graph, the result would resemble a
Universal donor Type A Rh positive bell curve, with most people falling between
Type O Rh negative blood has A-specific
blood (“O negative”) surface markers that these two heights. This is in contrast to the dis-
has no surface are recognized and crete traits we’ve encountered, in which indi-
markers that could rejected by the viduals have one of only two or three possible
be recognized and type B positive
rejected by a recipient. phenotypes for a given trait—round or wrinkled
recipient’s immune pea plants, or AB blood type, for example. With
system.
traits that vary continuously, such as height,
there are many possible phenotypes in the pop-
ulation, and individuals can vary by as little as
half an inch. Other examples of polygenic traits
A Rh positive B Rh positive include skin color and eye color.
recipient recipient Even though height is largely determined by
genes (60% to 80%), another 20% to 40% is
determined by environmental factors such as
Normal Rejected nutrition. Why such large variation? In devel-
blood after blood after oped countries, where most people have access
transfusion transfusion
to adequate nutrition, height is more than 80%
Compatibility Rejection heritable. This means that when scientists com-
Blood flows normally and is not Blood cells are attacked by the pare the height of a person to his or her rela-
rejected by the immune system. immune system. The result is blood tives, they find that height varies only about
cell clumping and elimination. 20% among direct relatives, that is, relatives in
a direct line of descent—grandparents, parents,
Height is an example of
a trait that shows
continuous variation in
any given population.
A mating between two people with medium height (where three An individual inheriting That same
genes control height): AaBbCc × AaBbCc produces seven distinct the genotype aaBbCc individual may
phenotypes determined by the number of dominant genes inherited. falls in the 5.0 ft actually grow to
phenotype. a height of 5.3 ft
Male gametes depending upon
ABC ABc AbC aBC Abc aBc abC abc
Number of individuals
environmental
800
ABC AABBCC AABBCc AABbCC AaBBCC AABbCc AaBBCc AaBbCC AaBbCc
influences.
ABc AABBCc AABBcc AABbCc AaBBcC AABbcc AaBBcc AaBbCc AaBbcc 600
Female gametes
aBC aABBCC AaBBCc aABbCC aaBBCC aABbCc aaBBCc aaBbCC aaBbCc 400
244 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Depression cannot be explained by genetic or environmental factors alone, but
by an interaction between the two.
1. Serotonin is released by
Nerve cell one brain cell into the space
adjacent to another brain cell.
Serotonin
and short alleles that more than doubled the tease apart environmental from genetic influ-
risk of depression. ences on physical diseases like cancer, this was
Since the early 1990s, researchers have the first study to investigate this relationship in
shown that the serotonin transporter gene a mental disorder. Moreover, the findings rein-
influences the levels of serotonin present in forced the emerging view that the majority of
the spaces between brain cells in humans and mental illnesses and other complex diseases
other animals, and that low levels of serotonin cannot be explained by genetic or environ-
in these spaces is one biological hallmark of mental factors alone, but often arise from an
depression in people (Infographic 12.10). But interaction between the two. That is, mental
there are likely other factors that contribute to illnesses exhibit multifactorial inheritance
a person’s risk of depression—there are many (Infographic 12.11).
people who carry long alleles and who suffer
from depression, as well as people who carry NONDISJUNCTION
short alleles who do not, despite having gone Q Why does the risk of having
through distressing experiences.
Nevertheless, Caspi and Moffitt’s study was
a baby with Down syndrome go
one of the first to examine the combined up as a woman ages?
effects of genetic predisposition and experi- At age 25, a woman’s risk of having a baby
ence on a specific trait—psychiatrists were
A with Down syndrome is 1 in 1,250 births.
delighted. While scientists had been trying to At age 40 her risk skyrockets to 1 in 100 births.
246 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 12.11
an error in chromosome segregation, leading to a
Depression Is a Multifactorial Trait chromosomal abnormality.
A chromosomal abnormality means that a
In 2003, Terrie Moffitt and Avshalom Caspi showed that a specific allele
developing fetus carries a chromosome number
of the serotonin transporter gene—a gene that influences levels of the
signaling molecule serotonin in the brain—in combination with stressful life that differs from the usual 46. The most
events can cause depression. The gene comes in long and short versions. common abnormalities in humans are called
aneuploidies, deviations from the normal
50 number of chromosomes because single chro-
People with two
mosomes are either duplicated or deleted.
Percent of people diagnosed with depression
ANEUPLOIDY
An abnormal number In fact, as women age, the risk of
of one or more giving birth to a baby with any chro-
chromosomes (either mosomal abnormality increases.
extra or missing copies).
That’s because as a woman ages, so
NONDISJUNCTION do her eggs. All the eggs that a woman
Failure of will ever have were formed before she
chromosomes to was born, and they have been aging
separate accurately
during cell division; like the rest of the cells in her body.
nondisjunction in Until puberty, a woman’s eggs are
meiosis leads to “paused” in the middle of meiosis (at
aneuploid gametes.
meiosis I); they haven’t yet completed
TRISOMY 21 their cell division. During a menstrual
Carrying an extra copy cycle, one egg resumes meiosis and is
of chromosome 21; ovulated. In older women, when
also known as Down
syndrome.
these eggs complete meiosis and are
ovulated, they are more likely to have
Meiosis I
Nondisjunction
Meiosis II
Nondisjunction
Gametes
Nondisjunction during meiosis produces aneuploid sperm and egg cells with too few or too many chromosomes. When
aneuploid gametes are fertilized by a normal gamete, the resulting embryo has too few or too many chromosomes.
Depending on the chromosome affected, this can lead to loss of the embryo or different disorders in the baby.
are also at higher risk for other diseases and The reasons to undergo amniocentesis vary
typically don’t live beyond 50 years of age. from couple to couple. But if a test comes back
Down syndrome, as well as other chromo- positive, couples have options: they can begin
somal abnormalities, can be diagnosed by to plan for a disabled child, or make the decision
amniocentesis. This procedure is usually per- not to carry the child to term.
formed between 14 and 20 weeks of pregnancy, Although scientists have linked some of the AMNIOCENTESIS
although some medical centers may perform it most obvious birth defects to the age of a wom- A procedure that
as early as 11 weeks. The procedure is quick. A an’s eggs, recent research also shows that a removes fluid
surrounding the fetus
long, thin, hollow needle is inserted through a man’s age affects his sperm quality. Men who to obtain and analyze
woman’s abdominal wall and into her uterus. father children after age 45 are more likely to fetal cells to diagnose
Through the needle, the equivalent of 2 to 4 have children with cognitive disorders such as genetic disorders.
teaspoons of amniotic fluid, which surrounds autism, for example. Male fertility declines over
KARYOTYPE
the growing fetus, is removed. This fluid con- time, too, although much more gradually than The chromosomal
tains fetal cells that contain the fetus’s DNA. does female fertility. Research shows that the makeup of cells.
From that fluid, technicians analyze the fetal older the man, the more likely he is to produce Karyotype analysis
can be used to detect
karyotype—that is, the chromosomal make- sperm with genetic defects. ■ trisomy 21 prenatally.
up in its cells (Infographic 12.13).
248 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 12.13
Amniocentesis Provides a Fetal Karyotype
Doctors perform a procedure called amniocentesis
to obtain fetal cells and diagnose chromosomal
abnormalities such as Down syndrome. A karyotype
Amniotic fluid
analysis is done on the fetal cells to look for chromosomal
with cells from
abnormalities, in particular missing or extra chromosomes.
the fetus
Fetal karyotype:
Fetus
Uterus
(womb)
Cervix
Placenta
Summary
Q Humans have 23 pairs of chromosomes. One of these Q ABO blood type is an example of a codominant trait—
pairs is the sex chromosomes: XX in females and XY in both maternal and paternal alleles contribute equally and
males. It is the presence of the Y chromosome that separately to the phenotype.
determines maleness. Q Many traits are polygenic—that is, they are influenced by
Q Because the Y chromosome in a male does not have a the additive effects of multiple genes. Polygenic traits
homologous partner, it does not experience recombination show a normal distribution in the population.
during meiosis. The Y chromosome a son inherits from his Q In many cases, a person’s phenotype is determined by
father is essentially identical to the Y chromosome his both his or her genotype at a number of different genes as
father inherited from his father (the grandfather), a fact well as by environmental influences; this type of
that can be used to establish paternity. inheritance is described as multifactorial. Human height,
Q Some genes are located on the X chromosome; these cardiovascular disease, and depression are examples of
are known as X-linked genes. Disorders inherited on X multifactorial inheritance.
chromosomes are called X-linked disorders, and are more Q Some genetic disorders result from having a
common in males than in females. chromosome number that differs from the usual 46. Down
Q Hair type is an example of incomplete dominance, a syndrome, or trisomy 21, is caused by having an extra copy
form of inheritance in which heterozygotes have a of chromosome 21.
phenotype intermediate between homozygous dominant
and homozygous recessive.
2. Why are more males than females affected by HINT See Infographics 12.6–12.11.
X-linked recessive genetic diseases?
250 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
15. Look at Infographic 12.11. At approximately how that analysis also to tell if the fetus has inherited a
many stressful experiences does the homozygous cystic fibrosis allele from a carrier mother?
short genotype begin to influence the depression
phenotype? j USE IT
19. Which of the following can result in trisomy 21?
16. From information in this chapter, how can you a. an egg with 23 chromosomes fertilized by a
account for two people with the same genotype for sperm with 23 chromosomes
a predisposing disease allele having different b. an egg with 22 chromosomes fertilized by a
phenotypes? sperm with 23 chromosomes
c. an egg with 24 chromosomes, two of which
CHROMOSOMAL ABNORMALITIES are chromosome 21, fertilized by a sperm with 23
Improper chromosome segregation during cell chromosomes
division can lead to birth defects. d. an egg with 23 chromosomes fertilized by a
sperm with 24 chromosomes, two of which are
HINT See Infographics 12.12 and 12.13. chromosome 21
253
Chapter 13 Stem Cells and Cell Differentiation
I
n 1995, Charles Vacanti, an anesthesiologist, for an entirely new kind of transplanted organ,
and Linda Griffith-Cima, then an assistant one grown from a patient’s own cells. In 2006,
professor of chemical engineering at the Anthony Atala, director of the Wake Forest Uni-
Massachusetts Institute of Technology versity Institute for Regenerative Medicine,
(MIT), amazed the world with an unusual and
important experiment. Under the skin of a labo-
ratory mouse, they injected cow cartilage cells
into an implanted and biodegradable mold
shaped like a human ear. The result? A structure
of cartilage, shaped like a human ear, grew on
the mouse’s back. The sensational image
splashed across tabloids, and many hailed the
feat as a great scientific accomplishment—but
some likened it to creating Frankenstein’s mon-
ster. The experiment had a serious purpose,
however: the mouse’s body nurtured the ear as
it grew, and once the ear was large enough, a
surgeon could remove it and attach it to some-
one whose ear was missing. Doctors never actu-
ally transplanted the ear; the scientists merely
intended to demonstrate the possibilities of tis-
sue engineering. Lose an ear because of an acci-
dent? Doctors can grow you a new one.
Today, more than a decade later, we know Cartilage cells grow on a mouse back into the shape
that the mouse experiment helped pave the way of a human ear.
254 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
Scientists can manipulate the nucleus of a single cell to unlock its therapeutic potential.
Epithelial
tissue Bladder
Muscle
tissue Ureters
Urethra
Connective
tissue
feat a pipe dream. They knew that human tis- into the body’s natural healing processes and
sues consisted of integrated groups of different coax stem cells into healing damaged tissue.
and specialized cells that together perform a
specific function (Infographic 13.1). But control- From Ears to Bladders
ling tissues to repair organs seemed The effort to engineer human tissue for trans-
impossible. plants dates back almost 40 years and is based
More recently, researchers discovered that on the knowledge that the majority of our cells
most body tissues contain pools of stem cells— continuously die and are replaced by new cells.
immature cells that can sponta- Without such cell division, an
neously divide repeatedly and organism would neither grow nor
give rise to more specialized
Lose an ear heal. During early development,
cell types in the body. For because of an for example, a single fertilized TISSUE
An organized group of
example, stem cells found in accident? Doctors egg cell divides to begin to form different cell types
bone, heart, and brain tissues can grow you an embryo, and these cells divide that work together to
help regenerate those tissues again and again to form millions carry out a particular
a new one. function.
and organs (Infographic 13.2). of cells by the time the embryo
The discovery has fueled a becomes a fetus. As we age, the STEM CELLS
search for ways to harness the regenerative body discards old cells and generates new ones Immature cells that
potential of stem cells to treat ailing patients. In in their place. And when we cut or injure our- can divide and
differentiate into
addition to using stem cells to create organs for selves, cells in the area undergo cell division to
specialized cell types.
transplant, scientists also hope one day to tap heal the injury. Transplant science tries to
256 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 13.2
skin to grow to cover the wound. Their method
Stem Cells in Tissues Have is still used today to treat burn victims, patients
Regenerative Properties who undergo plastic surgery, and patients with
recurrent skin wounds.
Stem cells in various tissues divide to produce But the field made its largest strides in the
more stem cells and the specialized cells that late 1980s, when Joseph Vacanti of Boston’s
make up that tissue. In this way, stem cells help Children’s Hospital teamed up with Robert
keep the tissues in which they reside healthy.
Langer at MIT to engineer tissues. The pair
wanted to design synthetic biodegradable scaf-
folds that could be molded into particular
shapes—a human ear, for example—and then
coat the mold with cells that would grow into a
tissue. The scaffold would never need to be
removed—it would in time dissolve. Vacanti’s
brother, Charles, and Linda Griffith-Cima used
this technique to grow a “human” ear on a
Brain stem cells
Neural cells mouse’s back.
About the time of Joseph Vacanti and
Langer’s achievement, Anthony Atala, who had
collaborated with Joseph Vacanti and Langer,
applied some of this research on biodegradable
scaffolds to his own work on engineered blad-
Heart stem cells ders. Atala, a urologist, sought to help his
Cardiac muscle
patients whose bladders were not functioning
normally because of cancer, injury, or an inborn
defect. For about a century, doctors have treated
such patients by using pieces of their stomach or
bowel to reconstruct their bladders. But because
the procedure requires surgically removing
Bone marrow stem cells pieces of healthy tissue, it is not an ideal treat-
Blood cells ment. A better option would be to grow a piece
of new bladder tissue to repair the organ.
Although it has been possible for decades to For each patient, Atala excised a small piece
grow human skin outside the body to treat burn of muscle tissue less than half an inch wide from
victims, growing more complex organs like inside the bladder and extracted two types of
bladders has been challenging. Scientists typi- cells—muscle stem cells and urothelial stem
cally grow only one or two skin layers for cells. He then mixed these stem cells with chem-
grafting. To grow a bladder, scientists must icals that encouraged them to divide. Next he
grow several layers of tissue, including muscle placed the stem cells onto the biodegradable
and connective tissue. Moreover, the thicker scaffold, which he had sculpted to resemble a
the tissue, the more blood vessels required to human bladder. He bathed the scaffold in nutri-
nourish it. ents to encourage the cells to grow, and then
It took Atala 17 years of research to achieve placed the scaffold with nutrients and other
success. He spent the bulk of those years devis- growth factors in an incubator to simulate con-
ing a biodegradable scaffold and a mechanical ditions inside the human body. The cells went
incubator that could mimic the conditions through several cell divisions and turned into
found in the human body and grow bladder tis- the tissue layers that make up a bladder. Two
sue in three dimensions. Once he had devised months later, surgeons reconstructed the
these tools, the next step was to test the bladder patient’s bladders using the new bladder tissue
tissue in patients. (Infographic 13.3).
258 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
The treatment, so far, seems remarkably suc- react similarly to a donated organ and reject it.
cessful. Not only does the technique restore To prevent tissue rejection, transplant patients
partial to complete bladder function, it avoids must take powerful immune-suppressing
the complications of using tissues from other drugs. But because the drugs suppress the
organs—like the bowel—for bladder repair. body’s natural immune defenses, they also
“Doing bowel-for-bladder replacements in make that person vulnerable to infection. By
children really got to me. It’s one thing to put contrast, tissue grown from a person’s own
them into an adult, but putting them in a cells poses no such risk of rejection because the
child with a 70-plus life expectancy didn’t tissue is genetically related to the donor.
make sense when you knew there would be Since 2006, scientists have implanted engi-
trouble down the line,” Atala told the New York neered bladders in 10 more children with a
Times in 2006, soon after he had published congenital condition called spina bifida in
the results of transplants he performed on which the spinal cord does not completely
seven children whose repaired bladders close before birth. Often the nerves of the
were still functioning well six years after lower spine are compromised, including those
transplant. that control urination, which can lead to blad-
Atala’s technique is also safer than bladder der damage. Of the 10 children who received
tissue transplanted from a donor. Just as a food the implants, 6 had significantly improved
allergy can cause shock when the offending bladder function a year after the surgery, sci-
food is ingested, a person’s immune system can entists reported in 2009.
Anthony Atala, whose lab at Wake Forest University Institute for Regenerative Medicine
grows human organs—including bladders—from just a few human cells.
Single cell
Mitosis
Two daughter
In any person, each of
cells containing
these cells has the same
identical copies
genome. But each cell type,
Expression of of DNA Expression of be it muscle or B-cell,
muscle-specific B-cell-specific has a unique pattern of
genes genes gene expression.
260 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
TABLE 13.1
genes—that defines it as one cell type or
How Old Are You? another.
j
Take, for example, two cell types with very
Your body is younger than you think. Each kind of tissue has its own
turnover time, depending in part on the workload endured by its cells. distinct characteristics: muscle cells and B-cells
But the lens cells of the eye, the neurons of the cerebral cortex, and of the immune system. Muscle cells are long and
perhaps the muscle cells of the heart last a lifetime. slender, and allow the body to move by contract-
ing and releasing. B-cells are round with anti-
TISSUE TYPE TURNOVER RATE
body receptors protruding from their surfaces
that detect foreign objects like viruses and bac-
Epidermis (skin surface) 2 to 3 weeks
teria, thus helping the body fight off infection. A
cell’s physical shape and function are dictated
Red blood cells 120 days
by the kinds of proteins found within it. Muscle
Liver 300 to 500 days cells and B-cells each contain a different collec-
tion of proteins; the set of proteins found in
Bones More than 10 years muscle cells allow them to contract and cause
body movement, while the set of proteins found
Gut 15.9 years
in B-cells allow them to display surface recep-
Rib muscle 15.1 years
tors and fight infection. Muscle cells and B-cells
both contain the exact same DNA, which pro-
Lens of the eye Never replaced vides instructions (genes) for making every pro-
tein for every cell type in the body. But only a
Neurons of the cerebral cortex Never replaced subset of those proteins is required by each cell
type. Put another way, because each cell type
only expresses a subset of a person’s genes, each
cell type has a unique pattern of gene expres-
area where they may remain quiescent (that is, sion. As a result, each cell type produces a
nondividing) for many years until disease or unique set of proteins that distinguish one cell
injury triggers them to divide. type from another (Infographic 13.4).
To heal tissue damaged by injury or disease, When scientists discovered that each tissue
stem cells must do more than simply divide had its own stem cell type, the search began for
repeatedly. The new cells must also go through ways to coax quiescent stem cells to divide and
a process of specialization to develop into the differentiate when they otherwise would not, so
specific cell types appropriate to the tissue in that damaged organs could be repaired from
need of healing. Remember that during embry- within. This field of research is called regenera-
onic development a single cell becomes millions tive medicine.
as the embryo grows. These dividing cells even- One approach to regenerative medicine is to
tually become specialized as muscle cells, kid- use therapeutic drugs to stimulate specific stem
CELLULAR ney cells, heart cells, and more than 200 other cells in the body to grow and differentiate.
DIFFERENTIATION
cell types in the body by the time we are born. Another involves cell therapy to remove stem
The process by which
a cell specializes to This process, in which a cell develops from an cells from the body, chemically induce them to
carry out a specific immature cell type into a more specialized one, reproduce and differentiate, and then re-
role. is called cellular differentiation. Cells implant a small sample of differentiated cells
become specialized by turning some genes into a patient with a damaged tissue or organ.
DIFFERENTIAL GENE
EXPRESSION “on” and others “off,” in what’s known as dif- The differentiated cells would repair the exist-
The process by which ferential gene expression. So while every ing damaged organ inside the body (Infographic
genes are “turned on” cell in our body carries the exact same DNA, it 13.5).
(that is, expressed) in
different cell types.
is a cell’s pattern of gene expression—and The idea of transplanting cells isn’t entirely
therefore the proteins produced from those new. In fact, doctors have been treating leuke-
Chemicals
are added that stimulate Stem cells
nerve-specific gene expression. differentiate
Stem cells into nerve cells. Nerve cells
262 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
INFOGRAPHIC 13.6
Embryonic vs. Adult Stem Cells
Embryonic stem cells (ESC) come from embryos and have different characteristics than adult cells. ESCs can develop
into almost any cell type, and therefore may have a greater therapeutic potential compared to adult stem cells.
Less specialized
Embryonic stem cells:
Cells isolated from the inner cell mass of a
Zygote
Totipotent cells developing embryo are cultured to become
(fertilized egg)
embryonic stem cells. These cells can become
nearly any cell in the body when provided the
appropriate chemical signals.
Early embryo
A blastocyst-stage
Pluripotent cells embryo with Isolated
pluripotent Cultured pluripotent
pluripotent
SCs from inner embryonic stem cells
stem cells
cell mass (stored and used for
research and therapeutic
medicine)
BLASTOCYST
The stage of Embryonic Stem Cells are active during early embryonic develop-
embryonic While stem cells show great promise in regen- ment, the so-called embryonic stem cells.
development in which
the embryo is a hollow
erative medicine, there are limitations. It turns Embryonic stem cells are found in an early
ball of cells. out that not all stem cells are created equal. embryo at what’s known as the blastocyst
Researchers can Adult stem cells typically can differentiate only stage, when the embryo is mostly a hollow ball
derive embryonic stem into one or a few cell types. Such cells with of cells. Unlike adult stem cells, which differen-
cell lines during the
blastocyst stage. restricted ability to differentiate are described tiate only into certain cell types, embryonic
as multipotent and can give rise to a limited stem cells can give rise to nearly any cell type
PLURIPOTENT number of cell types. in the body. For this reason, they are referred
Describes a cell with
But there are some stem cells that can differ- to as pluripotent—they can differentiate into
the ability to
differentiate into entiate into any of the body’s cell types. Scien- most of the body’s cell types. At even earlier
nearly any cell type in tists are especially interested in stem cells that stages of embryonic development, embryonic
the body.
INFOGRAPHIC 13.7
Somatic Cell Nuclear Transfer Creates Cloned Embryonic Stem Cells
Somatic Cell Nuclear Transfer, or cloning, involves replacing the nucleus of an egg with a nucleus
from a specialized cell, creating an embryo that is genetically identical to the donor cell.
Egg Nucleus
Skin cell
(genetic material)
Enucleated egg
Nucleus removed
from egg This cell has the chemical environment
of the donated egg and the genome of
the donated skin cell.
Blastocyst-stage
embryo with the
inner cell mass If the inner cell mass of the embryo
is cultured, the cloned embryonic
skin cells are a genetic match to the
skin donor. If used for regenerative
Inner cell mass
therapy in the skin donor, they will
removed for
not be rejected.
stem cell culture
264 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
from an embryo and place them in special an’s uterus. Consequently, many people find
media that encourages them to divide. These the idea of deliberately interfering with an
cells are then stored, used in research, and embryo, regardless how it was made, ethically
could potentially be used in treatment. troubling.
Another way to obtain embryonic stem cells
is by a technique called cloning. In this method, Scientific Progress
scientists replace the nucleus of a haploid unfer- Keenly aware of the ethical challenges, the sci-
tilized human egg with the diploid nucleus entific community has been searching for other
taken from another cell, a skin cell, for example. methods to generate embryonic stem cells. In
The chemical soup inside the egg turns on spe- late 2007, scientists accomplished a feat that
cific genes in the donated nucleus to reset them could in fact make the ethical controversy obso-
to an embryonic cell state. This technique, lete. They discovered a way to create embry-
known technically as somatic cell nuclear trans- onic-like stem cells without touching an embryo.
fer (SCNT), creates a new embryo with the same James Thompson at the University of Wisconsin
genes as the donor cell. This is how Dolly, the and Shinya Yamanaka of Kyoto University in
first cloned sheep, was created in 1997 (Info- Japan independently showed that they could
graphic 13.7). turn a mature human cell—one that is already
If scientists were to implant a cloned embryo differentiated—into an “embryonic” stem cell by
into a woman’s womb, it would, in theory, adding a few genes to its genome. They called
develop into a fetus that has the same nuclear the new cells induced pluripotent stem cells
DNA as the person who donated the cells from to reflect the fact that mature cells had been
which the diploid nucleus was taken. While such genetically manipulated to become embry-
“reproductive cloning,” as it is called, is prohib- onic-like stem cells. Thompson, for example,
ited in the United States, scientists funded by took an adult skin cell and inserted four genes
nongovernmental sources are allowed to create into it—genes that are normally switched off in
cloned embryos for research—this is called skin cells. The additional genes expressed pro-
“therapeutic cloning,” to distinguish the pro- teins that were able to “de-differentiate” the
cess from reproductive cloning. Embryonic skin cell—to turn back the clock, in a sense—
stem cells created by SCNT can be extracted and return the cell to its pluripotent embry-
from the new embryo and grown in a petri dish onic state. The cell regained the ability to turn
to create a population of stem cells that are into nearly any cell type of the body. It was a
essentially genetically identical to the donor. major technological breakthrough. This prom-
Consequently, any differentiated cells derived ising technique may offer a way to create trans-
from these stem cells could be transplanted plantable cells that are genetically matched to
back into the donor without fear of an immune a patient without depending on embryos (Info-
response against the transplanted cells. graphic 13.8).
The main difficulty with both techniques is Since Thompson and Yamanaka’s discovery,
that they destroy embryos, either frozen scientists have improved on the method and
embryos from fertility clinics, or cloned developed ways to create embryonic stemlike
embryos generated in the lab. To date, most cells by adding fewer genes or even just pro-
INDUCED embryonic stem cell lines in the United States teins. Whether or not these cells will prove to
PLURIPOTENT STEM have been derived from embryos stored at fertil- have the same potential to treat disease as
CELL ity clinics and subsequently donated to embryonic stem cells created by other methods
A pluripotent stem
cell that was research. If not donated to science, these is an active area of research.
generated by extra embryos would be destroyed after a Given the unknowns, scientists continue to
manipulation of a period of time. And although SCNT embryos are pursue all avenues of research. Research on both
differentiated somatic
not intended to become a human, they may embryonic and adult stem cells, including inves-
cell.
potentially become one if implanted in a wom- tigation of ways to control their differentiation,
Skin cells Pigment Neuron cells Red blood Skeletal Tubule cells Lung cells Thyroid Pancreatic
of epidermis cells cells muscle of the kidney (alveolar cells) cells cells
is forging ahead. The first clinical trial to test While the research is promising, hurdles
whether immature nerve cells can help heal spi- remain. Scientists still have trouble identifying
nal cord injuries is already under way. Scientists and extracting adult stem cells. And even when
at Geron, a Menlo Park, Califor- they can extract or produce stem
nia, biotech company, are trans- “Even the cells, they understand little about
planting immature nerve cells how to nudge them down a par-
obtained from human embry-
dumbest stem cell ticular path to differentiation.
onic stem cells into a small is smarter than There are countless growth fac-
group of patients with recent the smartest tors and biochemical signals that
spinal cord injuries. Other neuroscientist” cue any stem cell to become a kid-
research aims to manipulate
–Evan Snyder ney cell, a muscle cell, or a heart
adult stem cells into becoming cell, for example.
totipotent by supplying them “Even the dumbest stem cell is
with specific proteins, or converting one multi- smarter than the smartest neuroscientist,” says
potent cell type into another by similar Evan Snyder, program director at the Burnham
methods. Institute for Medical Research in La Jolla, Cali-
266 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
fornia. “The cells are making stuff that we might
not be able to identify for centuries.” Summary
All the more reason, says Snyder, for scien-
Q Tissues are integrated groups different genes. Such differential
tists to pursue several methods to achieve the
of specialized cells that perform gene expression causes each cell
same goal. Anthony Atala, for one, is continuing
specific functions. type to produce different
to study how to engineer an entire bladder.
Q Stem cells are relatively
proteins and to have different
While induced pluripotent stem cells may pro-
unspecialized cells that can functions.
vide another source of cells to grow bladder tis-
sue or an entire bladder from a person’s own divide and specialize (that is, Q Adult stem cells are
cells without the need for a tissue biopsy, getting differentiate) into different cell multipotent, able to differentiate
a whole engineered organ to function normally types. into a limited number of different
once transplanted will require much more Q Adult stem cells, also known
cell types.
research, he says. To replace the organ com- as somatic stem cells, are found Q Embryonic stem cells are
pletely would require a full set of nervous con- in tissues; embryonic stem cells pluripotent, able to differentiate
nections, so that when the bladder is full it make up early embryos. into nearly any cell type in the
would send a message of urgency to the brain. body.
Q Stem cells can be used
Also, during urination the sphincter muscles
therapeutically to engineer or Q Embryonic stem cells can be
would have to relax while the wall of the bladder
regenerate tissues and organs. obtained from human embryos
contracted. To get all this working properly is an
Q Making new tissues requires
or from cloned embryos. They
immense challenge.
both cell division and cell may also be created by inducing
“Ultimately we’re depending on advances in
differentiation. Cell adult stem cells to
molecular and cell biology,” says William Wag-
differentiation is the process in “de-differentiate.”
ner of the University of Pittsburgh’s McGowan
Institute for Regenerative Medicine. “There is which an unspecialized cell Q Both adult and embryonic
still a lot that we don’t know.” becomes a specialized cell with a stem cells are being investigated
Growing a solid organ such as a kidney or unique function. as possible therapies to restore
heart would be even more complicated. Such Q All cells in any individual have
damaged tissue in humans.
organs have a very complex structure and carry the same genome but express
out very complicated bodily functions. It took
Atala 17 years of small steps before he succeeded
in engineering bladder tissue for repairs. It may
take another 17 years or even longer to engineer
an entire organ. But there is reason to be opti-
mistic, he says: “There has been lots of steady
progress.” ■
TISSUES AND CELL cells of the immune system have a protein on their
surface known as CD4 which helps in mounting an
DIFFERENTIATION
immune response. From this information, complete
Tissues are made up of a variety of specialized types
the following table.
of cells. Each cell type differentiates from an
unspecialized stem cell.
Photo-
receptor Heart
HINT See Infographics 13.1–13.4 and Table 13.1.
cells of muscle Helper
the retina fibers T cells
j KNOW IT Myosin gene
1. Does a 5-year-old child have adult stem cells in present?
his or her tissues? Explain your answer
Myosin mRNA
present?
2. Relative to one of your liver cells, one of your skin
cells Myosin protein
a. has the same genome (that is, the same present?
genetic material). Retinal gene
b. has the same function. present?
c. has a different pattern of gene expression. Retinal mRNA
d. a and c present?
e. b and c Retinal protein
present?
3. You shed dead skin cells every day. How are
CD4 gene
those cells replaced? present?
a. by mitotic division and specialization of
CD4 mRNA
embryonic stem cells
present?
b. by differentiation of neighboring neurons into
skin cells CD4 protein
c. by differentiation of red blood cells that leave present
the circulation and migrate into deeper layers of
the skin 7. Do stem cells have a larger genome than
d. by mitotic division and differentiation of skin specialized cells?
stem cells a. yes, because they need the genes found in
every cell type, whereas specialized cells need
4. The brain and spinal cord are made up of nervous only a subset of all the genes
tissue. This tissue includes neurons, cells that fire b. yes, because they express more genes than
electrical impulses and communicate information in do specialized cells
the brain. Nervous tissue also includes glial cells, cells c. no, because all cells in a person have the
that support neurons. Some glial cells enable the identical set of genes in their genome
electrical impulse to travel faster. What d. no, they have a smaller genome, because
characteristics of glial cells and neurons tell you that stem cells are equivalent to gametes (which are
they both make up nervous tissue? haploid) in that they can potentially create an
entire individual
j USE IT e. no, they have a smaller genome because stem
5. From information in Question 4, would it be cells only express a subset of genes
sufficient to replace the damaged neurons in
someone who had suffered nervous-tissue damage? STEM CELLS AND REGENERATIVE
Why or why not? MEDICINE
Stem cells can potentially repair damaged tissue.
6. Different cells have different functions: muscles The challenges are how to stimulate existing stem
contract because of the sliding action of actin and cells to divide, or how to transfer stem cells to the
myosin proteins in muscle cell fibers; a protein area of damage to promote repair.
known as retinal makes up the light detecting
photoreceptor cells in the retina of the eye; helper T HINT See Infographics 13.2 and 13.5–13.8.
268 UNIT 2: HOW DOES LIFE PERPETUATE? CELL DIVISION AND INHERITANCE
j KNOW IT 13. List and then describe some of the successes
8. List and then describe several advantages of and challenges associated with using adult stem
using one’s own cells to regenerate an organ over cells in comparison with embryonic stem cells for
receiving a transplant from an organ donor. stem cell therapy.
9. Describe at least two differences between 14. If all specialized cells have the same genes in
embryonic stem cells and somatic (that is, adult) their genomes (including stem cell genes), why did
stem cells. James Thompson have to add genes into a mature
cell in order to get it turn into a stem cell?
10. Why does the recipient of a liver transplant have
a high risk of bacterial infections? SCIENCE AND ETHICS
a. because the liver plays a critical role in the 15. If you were head of the National Institutes of
immune response Health and responsible for allocating research funds
b. because donor livers are often contaminated to different avenues of research, which line(s) of
with disease-causing bacteria stem cell research would you fund? Why?
c. because transplant recipients have to take
drugs that suppress their immune systems 16. Most people make a distinction between
d. because the surgery poses a high risk for therapeutic cloning and reproductive cloning, at
introducing bacteria into the recipient least for humans. There have been several reports of
e. because the immune system may reject the cloned pets and other animals. How does the
liver science differ between reproductive cloning and
therapeutic cloning? Do you think reproductive
j USE IT cloning should be legal or illegal?
11. Why is engineering a bladder more challenging
than engineering skin?
Bugs That
Resist Drugs
j What You Will Be Learning
14.1 The Bacterium Staphylococcus aureus
14.2 How Beta-lactam Antibiotics Work
14.3 How Bacteria Reproduce
14.4 How Bacterial Populations Acquire Genetic
Variation
14.5 An Organism’s Fitness Depends on Its
Environment
14.6 Evolution by Natural Selection
14.7 Natural Selection Occurs in Patterns
14.8 Treating and Preventing Infection by
Antibiotic-Resistant Bacteria
271
Chapter 14 Natural Selection and Adaptation
Bugs That
Resist Drugs
Drug-resistant bacteria are on the rise. Can we stop them?
I
n January 2008, sixth-grader Carlos Don, an infectious bacterium that has become wide-
active footballer and skateboarder, boarded spread in recent years and that is difficult to
a bus headed for a class trip, happy and treat with most existing antimicrobial drugs.
healthy. A month later Carlos was dead. MRSA sickens some 94,000 people in the
In April 2006, 17-year-old Rebecca Lohsen United States each year and kills almost 19,000,
was a model student at her high school; she was according to a 2007 study by Monina Klevens
on the honor roll and was a and her colleagues at the Cen-
member of the swim team. Four ters for Disease Control and Pre-
months later Rebecca was dead.
MRSA sickens vent ion (CDC). For merly,
In December 2003, Ricky some 94,000 outbreaks of MRSA were con-
Lannetti was a college senior, a people in the fined mainly to hospitals. But
star football player and all- United States since the late 1990s, growing
around athlete. A few weeks
each year and kills numbers of healthy people are
later Ricky was dead. becoming infected outside hos-
The list of surprising deaths almost 19,000. pitals. In addition, there are new
like these goes on and on. But high-risk groups that never had
contrary to what you might think, these young high rates of infection before: day care attend-
people weren’t killed in accidents, nor by vio- ees, the prison population, men who have sex
lence; they were all killed by methicillin-resis- with men, and certain ethnic groups now are
tant Staphylococcus aureus (MRSA)—an showing MRSA infections at a higher rate than
272 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
A resistant strain of Staphylococcus aureus at 4780x magnification.
the general population. Schools nationwide methicillin is no longer used to treat staph
have been reporting outbreaks and young, infections. In fact, drug-resistant strains of
healthy people are getting sick. staph are usually resistant to several different
“This is a major public health imperative,” types of antibiotics. Some people use the terms
says Robert Daum, professor of microbiology at “MRSA” and “drug-resistant staph” inter-
the University of Chicago and a member of the changeably to refer to staph strains that are
Infectious Diseases Society of America. “We resistant to the common classes of antibiotics—
need a plan of attack now.” penicillins and cephalosporins—that are used
to treat staph infections.
Staph the Microbe Staph bacteria are harmless to most people
MRSA infection is caused by the Staphylococcus who carry them. Between 30% and 40% of the
aureus bacterium—often simply called “staph.” population carries staph on their skin or in their
Although several species of staph bacteria can noses, and about 1% of the population carries
cause human disease, the medical community drug-resistant strains, according to the Centers
is especially concerned about those, such as S. for Disease Control and Prevention. If you carry
aureus, that have developed resistance to anti- staph of any strain but aren’t sick, you are “colo-
biotic drugs that once effectively killed them. nized” but not infected. Healthy people can be
“MRSA” is actually a misnomer because colonized with any staph strain, including
INFOGRAPHIC 14.1
The Bacterium Staphylococcus aureus
Staphylococcus aureus is a spherical bacterium that can cause pimples, boils,
and wound infections in healthy people. S. aureus can be passed from person
to person by direct contact with contaminated skin or by transfer of the
bacteria via contaminated objects or surfaces.
act
cont
skin
-to-
Skin
Con
tam
ina
ted
sur
fac
es
274 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
its genetic makeup. MRSA, for example, is com- developed the first antibiotics. Antibiotics are
posed of a number of unique strains of staph chemicals that either kill bacteria or slow their
bacteria, and some cause more serious disease growth by interfering with the function of
than others. In recent years there have been essential bacterial cell structures. Research in
several cases of healthy people becoming the early twentieth century had revealed that
severely ill from MRSA infection, most likely certain microorganisms, such as the fungus
because they were infected by an especially Penicillium, produce compounds that can kill
deadly strain of drug-resistant staph. bacteria. In 1928, the Scottish biologist Alexan-
Ricky Lannetti, for example, was a perfectly der Fleming isolated the antibiotic penicillin,
healthy 21-year-old football player at Lycoming although it took more than a decade of research
College in Williamsport, Pennsylvania. “He was by Fleming and others to develop it into a
strong as an ox and he ran like a deer,” says his usable drug. The 1940s saw a major search for
mother, Theresa Drew. A few days before Ricky other drugs to treat infections, and within a
died, he had come down with a bout of flu. Ricky few years scientists successfully purified more
wasn’t recovering, however, and on the morning antibiotics. Though the original antibiotics
of December 6, 2003, Drew drove her son to Wil- were derived from microorganisms, many are
liamsport Hospital. By the time he was admitted, now synthesized in the laboratory.
his blood pressure had dropped dangerously Over the decades, antibiotics have been effec-
low and his body temperature was erratic. As tive in treating most common bacterial infec-
each hour passed, his condition worsened. His tions, including staph, and have saved
lungs began to fail. Doctors tried five different thousands of lives. But soon after antibiotics
antibiotics, in vain. When his heart began to were in general use, microorganisms that could
weaken, his doctors prepared him to be flown to survive antibiotics—drug-resistant “bugs”—
the cardiac center at a bigger hospital in Philadel- began to emerge. Within the last decade drug-
phia. But it was too late. Ricky died that night. resistant bacterial strains have become much
It was only after an autopsy was performed more common. Although people infected with
that it was known what had killed him: MRSA drug-resistant bacterial strains are treatable,
that had infected Ricky’s bloodstream. Although they have fewer treatment options. And some-
doctors couldn’t be sure how Ricky contracted times—as in Ricky Lannetti’s case—existing
MRSA, they reasoned that he had inhaled it—the drugs are completely ineffective.
fact that his lungs were so damaged suggested Drug-resistant strains of staph, for example,
the lungs as the first place of infection. Since are typically resistant to an entire class of anti-
MRSA can colonize people’s noses, it can travel biotic drugs called the beta-lactams. Beta-
to their respiratory systems, where it can cause lactams include penicillin and the cephalosporin
severe damage. antibiotics, such as methicillin and cephalexin.
“Doctors tried every antibiotic imaginable, Beta-lactams are the most commonly pre-
including vancomycin,” says his father, Rick scribed class of antibiotics. They work by inter-
Lannetti. But the treatment was too late. Ricky’s fering with a bacterium’s ability to synthesize
immune system was already weak because of cell walls. A variety of non–beta-lactam classes
the flu. When he contracted MRSA at the same of antibiotics can treat MRSA infections, and
time, his body was unable to fight back as well vancomycin, an intravenous non–beta-lactam
ANTIBIOTICS as it otherwise would have. “In the end,” his drug, is the antibiotic of choice when a serious
Chemicals that either father says, “MRSA had broken every one of his or severe MRSA infection is confirmed. But even
kill bacteria or slow
their growth by organs beyond repair.” vancomycin isn’t always effective; there are now
interfering with the staph strains resistant to vancomycin, too (Info-
function of essential The Antibiotic Revolution graphic 14.2).
bacterial cell
Bacterial infections were a common cause of Ricky Lannetti did not respond to vancomy-
structures.
death before the 1940s, when scientists cin. Nor did Rebecca Lohsen, the 17-year-old
Bacterial cell
Bacterial cellwall
wall
high school swimmer. She was diagnosed with appropriate one is used. “It’s complicated and
MRSA two days after she was admitted to the depends upon the interactions between the per-
hospital for pneumonia. But antibiotics were son and the bacteria,” says Ruth Lynfield, state
ineffective in controlling the MRSA that attacked epidemiologist and medical director of the Min-
her lungs and then her heart. She died in August nesota Health Department. Personal factors
2006. include the individual’s general health and state
Twelve-year-old Carlos Don, who skate- of the immune system, and which body sites are
boarded and played football, suffered a similar infected. Bacterial factors include whether or
fate. Carlos was first diagnosed with pneumonia not the strain is making toxins or has ways to
that was likely caused by inhaling MRSA, avoid the immune system. There are treatment
although doctors did not initially identify the factors as well: whether the antibiotics used are
organism causing his lung infection. He was sent active against the strain, for instance, and
home with several different antibiotics, includ- whether the antibiotic achieves a high enough
ing vancomycin, only to return to the hospital concentration in the body site that is infected.
the next morning, his condition worsening. He The very severe and fatal cases are the “tip of
died two weeks later, on February 4, 2007, after the iceberg,” Lynfield says. Of the 94,000 inva-
his lungs, heart, and kidneys were too damaged sive MRSA infections each year in the United
to function on their own. States, the Centers for Disease Control and Pre-
Scientists don’t entirely understand all the vention estimates that about 20% are fatal. And
reasons antibiotics might not work even if the 85% of these invasive infections occur in
276 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 14.3
binary fission, a single parental cell simply rep-
How Bacteria Reproduce licates its single chromosome, grows in size,
and then splits into two daughter cells, each
Bacteria reproduce through a process called binary fission. Binary with a copy of the parental DNA. Each time
fission is a form of asexual reproduction in which a single parent cell
replicates its contents and then divides into two daughter cells. Note that DNA is replicated, however, there is a chance
each daughter cell inherits all its DNA from the single parent cell. that genetic mutations will occur, and the new
alleles will then be carried into each daughter
DNA
cell. And because bacteria reproduce much
Cell wall Cell membrane more rapidly than other organisms—one gen-
eration of bacteria can reproduce itself in as
little as 20 minutes—they accumulate muta-
tions at a relatively high rate. An entire popula-
1. Cell elongates tion of bacteria that is genetically different
and DNA is replicated. from the original cell can arise very quickly
(Infographic 14.3).
Binary
fission
An individual
S. aureus cell
A genetically diverse
S. aureus population
Mutation:
Mutations made during
DNA replication introduce new
alleles into the population.
Gene Transfer:
DNA can pass from one bacterial species to another.
A nonstaph bacterium, for example, can pass genes
to staph, and introduce genes into the staph population
that confer new traits, such as antibiotic resistance.
bacteria have developed antibiotic resistance the case of staph, populations exist in peo-
independently, several strains of genetically ple’s noses, and on other parts of their skin.
unique drug-resistant staph circulate through When a population’s environment favors
human communities at the same time (Info- some traits over others, the frequencies of the
graphic 14.4). alleles that code for those traits in the popula-
tion change over time. Take the trait for drug
How Populations Evolve resistance, for example. Bacterial populations,
While an individual bacterium—or any indi- like populations of any organism, consist of
vidual organism, from mushroom to manatee— genetically varied individuals. In an environ-
can undergo genetic changes that may give it ment free of antibiotics, individual bacteria
new traits, this doesn’t entirely explain how would have about an equal chance of reproduc-
bacterial populations such as staph develop ing, whether or not they carried a resistance
resistance to drugs. An entire population of gene. In other words, the ability to resist anti-
organisms with a new trait can arise only biotics would confer neither an advantage nor a POPULATION
when the environment favors that trait—that is, disadvantage. In the presence of an antibiotic, A group of organisms
when carrying the specific trait is advanta- however, bacteria with an allele for resistance of the same species
living together in the
geous to the organisms carrying it. A popula- survive, whereas most other bacteria die. The
same geographic area.
tion is a group of individuals of the same surviving bacteria, which are drug resistant,
species living together in the same geographic reproduce more prolifically, and more alleles EVOLUTION
area. Geographic area is relative; it could for drug resistance are passed on to future gen- Change in allele
frequencies in a
be an open prairie, or a drop of pond water. A erations. Consequently, the frequency of the population over time.
population of bacteria can exist anywhere. In resistance trait increases. This is how popula-
278 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 14.5
tions can come at a cost. An altered protein may
An Organism’s Fitness enable a bacterium to withstand an antibiotic
Depends on Its Environment assault, but at the same time it might render that
bacterium weaker in other ways; for instance, it
The term “fitness” describes how successfully an organism is able might not be able to reproduce as fast as a bac-
to reproduce in a particular environment. Fitness is determined by terium without the mutation. Consequently, in
the interaction between phenotype and environment. Antibiotic-resistant an antibiotic-free environment the bacterium
bacteria, for example, have high fitness in the presence of antibiotics.
without the resistance allele might be able to
Bacterial Reproductive fitness in Reproductive fitness in out-reproduce the drug-resistant one. On the
phenotype the absence of antibiotic the presence of antibiotic other hand, some antibiotic-resistant bacteria
have been shown to develop secondary muta-
Antibiotic- tions that render them just as fit as antibiotic-
sensitive High, medium, or low Low susceptible bacteria in an antibiotic-free
variants environment.
species that Charles Darwin observed on the that directional selection has occurred. For DIRECTIONAL
Galápagos Islands had evolved different types example, when bacterial populations evolve SELECTION
A type of natural
of beaks as adaptations to different food from populations sensitive to drugs into selection in which
sources. ones that resist drugs—that is, toward anti- organisms with
Note that evolution by natural selection biotic resistance—they are exhibiting direc- phenotypes at one
end of a spectrum are
occurs in populations, not individuals. Individ- tional selection.
favored by the
ual organisms do not experience a change in When the phenotype of the population environment.
allele frequencies over time. Therefore, indi- settles around the middle of the phenotypic
vidual organisms do not evolve (Infographic spectrum, we call this stabilizing selection. STABILIZING
SELECTION
14.6). Or, a population can also “spread out,” so
A type of natural
By studying how populations have evolved that the population shows extremes of the phe- selection in which
in the past, scientists have defined three major notypic spectrum; this pattern is known as organisms near the
patterns of natural selection. When the pre- diversifying selection. The particular pat- middle of the
phenotypic range of
dominant phenotype in the population has tern of natural selection a population follows variation are favored.
shifted in one particular direction, we say depends on the interaction of phenotypes with
280 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 14.7
Natural Selection Occurs in Patterns
Number of Bacteria
Directional selection spectrum
occurs when a single phenotype strains of bacteria.
predominates in a particular
environment. Before natural selection
After natural selection
Low High
Antibiotic Resistance
Example:
Selects for a very Human babies with very low birth
Stabilizing selection
Number of Humans
Example:
Selects for phenotypes The African finch Pyrenestes lives in
Diversifying selection at both ends of the an environment where only large,
Number of Finches
typically occurs in a “patchy” spectrum hard seeds and small, softer seeds
environment, in which are available. Birds with either large
extremes of the phenotypic or small beak sizes are selected for,
range do better than middle while medium beaks, which are
range individuals. not as
successful
at cracking
Small Large
either type
Finch Beak Size
of seed, are
selected
against.
DIVERSIFYING
SELECTION
A type of natural the environment. So, for example, in the MRSA in the Community
selection in which
absence of antibiotics, populations of staph Drug-resistant staph strains first emerged in
organisms with
phenotypes at both bacteria might have followed stabilizing or hospitals during the early 1960s. Since then,
extremes of the diversifying selection. Instead, directional hospitals have remained hot spots for staph
phenotypic range are selection led to the MRSA that killed Carlos infections. Surgical procedures create wounds
favored by the
Don, Rebecca Lohsen, and Ricky Lannetti that are vulnerable to infection, and certain
environment.
(Infographic 14.7). medications can weaken the immune system,
282 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
“I’ve been an infectious disease guy for over
20 years now and we didn’t talk about staph “We really have to be careful
necrotizing pneumonia like we do now.” It was about how we use antibiotics
likely USA300 or a related strain that killed because antibiotic use is the
Carlos Don, Rebecca Lohsen, and Ricky
biggest driver of antibiotic
Lannetti.
Even more troubling, staph is continuing to
resistance.” –Ruth Lynfield
evolve. There is evidence that when strains
that are prevalent in the community mix with
strains that are prevalent in hospitals, the risk antibiotic resistance. Undigested antibiotics
that an even more virulent staph strain will in animal manure can contaminate the envi-
emerge increases. ronment through groundwater or when
manure is used as fertilizer. In this environ-
Stopping Superbugs ment drug-resistant bacteria are more fit, and
Staph aren’t the only bacteria that can cause dis- will therefore be selected for and become more
ease or that have grown resistant to antibiotics. prevalent over time.
About 200 species of bacteria are known to “We really have to be careful about how we
cause human diseases, including Mycobacte- use antibiotics because antibiotic use is the
rium tuberculosis, Salmonella, Neisseria gonor- biggest driver of antibiotic resistance,” says
rhoeae, and Klebsiella pneumoniae. And Lynfield.
although it gets the most attention, MRSA is by Clearly, creating stronger antibiotics isn’t
no means the only superbug out in the com- the only or the best solution because bacteria
munity. It is getting harder to treat patients will ultimately adapt to those, too. Perhaps the
with severe Salmonella food poisoning caused best way to control resistance, say experts, is
by drug-resistant strains. Gonorrhea has to change practices that enable resistant
become resistant to another important group strains to thrive. Careful hygiene and preven-
of antibiotics, the fluoroquinolones. In hospi- tion of infection through vaccination are impor-
talized pneumonia patients, infections by Kleb- tant tools. It is also important that when an
siella strains that are resistant to every available antibiotic is prescribed it is taken precisely as
antibiotic are now emerging. prescribed, for the full course of treatment, no
Because the very use of antibiotics can drive matter how much better the patient may be feel-
bacterial populations to evolve resistance, ing. If bacteria are exposed to antibiotics at low
antibiotic resistance is inevitable. But humans levels or for short durations, the entire popula-
have hastened the emergence of drug-resistant tion may not be eradicated. Remaining bacteria
strains of bacteria by the haphazard use and may be resistant to the antibiotic and emerge
overuse of antibiotics. For more than 40 years, as the dominant population. And anyone
physicians have typically prescribed antibiot- taking antibiotics exposes all the bacteria in his
ics for colds, coughs, and earaches, most of or her body to the antibiotics, which may enable
which are caused by viruses that aren’t killed other drug resistant bacteria to emerge. These
by antibiotics anyway. Antibiotics are fre- drug-resistant bacteria might then be transmit-
quently overused or misused for many other ted to others.
ailments as well. At the community level, the more antibiotics
Doctors aren’t the only culprits. Agricul- that are used, the more resistance will emerge.
tural practices are also to blame. Antibiotics So doctors are heavily discouraged from pre-
used in low doses to promote growth are scribing antibiotics unnecessarily. And efforts
often given to poultry, swine, and beef. This are being made to crack down on the practice of
practice can cause food-borne pathogens such feeding livestock low levels of antibiotics (Info-
as Salmonella or Campylobacter to develop graphic 14.8).
INFOGRAPHIC 14.8
Treating and Preventing Infection by Antibiotic-Resistant Bacteria
Reduce antibiotics in
livestock feed. Wash hands frequently.
Excessive antibiotics in This is especially important
the environment create for people in close contact
continuous selective with other people.
pressure for all bacteria.
284 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Summary
Q Populations are groups of individuals of the same Q Natural selection is one cause of evolution, defined as a
species living together in the same geographic area. change in the allele frequency of a population over time.
Q Within any population, genetic variation exists among Q Individuals with higher fitness in a given environment
individuals. reproduce and pass on their alleles more frequently
Q Bacterial populations, which reproduce asexually,
than do individuals with lower fitness, resulting in
develop genetic variation by mutation and gene exchange; evolution.
populations of sexually reproducing organisms generate Q Natural selection can shift the allele frequencies in
genetic variation by meiosis and fusion of gametes as well a population in one of several patterns: directional
as by mutation. selection, diversifying selection, or stabilizing
Q Genetic variation in a population gives rise to
selection.
corresponding phenotypic variation in the population. Q Antibiotic-resistant populations of bacteria emerge by
Q Different phenotypes can affect the survival and
directional selection in the presence of antibiotics.
reproduction, or fitness, of individuals in the population. Q Over time, natural selection leads to adaptation:
Q The differential survival and reproduction of individuals
advantageous traits become more common in the
in a population over time in response to environmental population, which becomes more suited to its environment
pressure is known as natural selection. as a result.
286 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
is abundant, for example—and place it in an population of snails in your backyard will look
environment in which a different antibiotic is like? Explain your answer.
abundant, will it retain its high degree of fitness? b. Suppose you move the population of snails to
a. yes, fitness is fitness, regardless of the a new environment, one with patches of dark
environment brown pebbles and patches of yellow ground
b. yes, once a bacterium is resistant to one cover. Will individual snails mutate to change
antibiotic it is resistant to all antibiotics their color immediately? As the population
c. not necessarily; fitness depends on the ability evolves and adapts to the new environment,
of an organism to survive and reproduce, and it what do you predict will happen to the
may not do this as well in a different phenotypes in your population of snails after
environment several generations in this new environment?
d. no, what is fit in one environment will never How did this occur? Include the terms gametes,
be fit in another environment mutation, fitness, phenotype, and environmental
selective pressure in your answer.
15. If a single bacterial cell that is sensitive to an
antibiotic—for example, vancomycin—is placed in a
growth medium that contains vancomycin, it will SCIENCE AND ETHICS
die. Now consider another single bacterial cell, also 18. Your friend has had a virus-caused cold for 3
sensitive to vancomycin, that is allowed to divide for days and is still so stuffy and hoarse that he is hard
many generations to become a larger population. If to understand. He seems to be telling you that his
this population is placed into vancomycin- doctor called in a prescription for an antibiotic for
containing growth medium, some bacteria will grow. him to pickup at his pharmacy. You hope that you
Why do you see growth in this case, but not with the misunderstood him, but you realize that you heard
transferred single cell? him perfectly well.
a. Why are you dismayed to hear his story?
16. If evolution by natural selection is a change in b. Will the antibiotic help your friend’s cold?
allele frequencies in a population, then why do we c. What are the risks to your friend if he takes
detect the process of evolution by natural selection the antibiotic? (Think about what might happen
as a change in phenotype frequencies in the if he should develops a wound infection.) What
population? are the risks to you, as his friend?
17. Imagine that a genetically diverse population of 19. Your roommate has been prescribed an
garden snails occupies your backyard, in which the antibiotic for bacterial pneumonia. She is feeling
vegetation is a variety of shades of green with some better and stops taking her antibiotic before
brown patches of dry grass. finishing the prescribed dose, telling you that she
a. If birds like to eat snails, but they can see only will save them to take the next time she becomes
the snails that stand out from their background sick. What can you tell your roommate to convince
and don’t blend in, what do you think the her that this is not a good plan?
Adventures
in Evolution
289
Milestones in Biology
Adventures
in Evolution
Charles Darwin and Alfred Russel Wallace
on the trail of natural selection
290 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
I
t was the unpaid internship of a lifetime: a
5-year, around-the-world trip as a naturalist
aboard a British surveying ship. The ship’s
captain, Robert Fitzroy, wanted a travel
companion who would also collect specimens
along the way. He approached a professor at
Cambridge University, who nominated one of
his best students—a good-natured 22-year-old
bug collector named Charles Darwin. Unsure
what he wanted to do with his life but eager to
see the world, Darwin jumped at the chance to
travel on the HMS Beagle. He later said of the
trip, “The voyage of the Beagle has been by far
the most important event in my life and has
determined my whole career.”
Yet he almost didn’t go. His father, Dr. Robert
Darwin, wanted his son to become a physician,
like himself. But young Charles was more inter-
ested in spending time outdoors than studying
medicine. “You care for nothing but shooting,
dogs, and rat-catching, and you will be a dis-
grace to yourself and all your
family,” his father told him.
“The world has When Charles’s aversion to
been different ever rote memorization and queasi-
since Darwin.” ness at the sight of blood effec-
tively ruled out a career in
–Stephen Jay Gould
medicine, they agreed that
Charles would instead do the
next best thing: become an Anglican minister.
Far from furthering that goal, an impetuous sea
voyage seemed to Robert Darwin a useless dis-
traction—a “wild scheme,” he called it—and at
first he refused to let his son go. But eventually,
at the cajoling of his family, he relented. Charles
packed his bags, said goodbye to his girlfriend,
Emma, and set sail for South America. It was
December 1831.
The passage aboard the 90-foot vessel was
frequently harrowing, and Darwin suffered
debilitating bouts of seasickness, but his jour-
ney aboard the Beagle set in motion one of the
greatest revolutions in science. What he saw on
that trip planted the seeds of ideas that have
completely changed the way we view the world
and our place in it. As the evolutionary biolo-
gist Stephen Jay Gould put it, “The world has
been different ever since Darwin.”
Jean-Baptiste Lamarck
August 1, 1744–December 28, 1829
Reproduction
If a giraffe strained its neck to eat leaves from higher It would then pass this acquired trait on to its
branches, then over time it would develop a longer neck. offspring, and they would be born with long necks.
292 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
The Evolution of Darwin’s Thought
Darwin was influenced by the work of others, which informed
the way he interpreted his own research and collections.
Population
Fossil of giant land sloth (1833): Beagle voyage (1831–1836): Lyell’s work (1833):
• Buried in a sediment layer below • Darwin collected plants, animals, and • The earth’s geology is
a deposit of shells. fossils from across the globe. formed by slow-moving
• No modern-day South American • Darwin observed similarities and forces.
animals resemble this fossilized differences and attempted to explain • The earth is much older
creature. What happened to it? these characteristics. than thought at the time.
istics, while incorrect, was a popular one in mental forces operating over a vast expanse of
Darwin’s time—one that even Darwin himself time. “No vestige of a beginning, no prospect
found it hard to fully shake off in his writings. of an end,” was how James Hutton, Lyell’s men-
While at sea, Darwin had plenty of time to tor, had put it. With such thoughts percolating
read and think about the ideas then being dis- through his mind, Darwin studied the plants,
cussed in scientific circles. He read, for animals, and geology at each stop on his trip,
instance, the work of the geologist Charles collecting fossils and specimens of local flora
Lyell. Lyell’s Principles of Geology (1833) argued and fauna wherever he went.
that the earth was much older than the 6,000 While exploring the shore of Argentina in
years popularly accepted at the time (a figure August 1833, Darwin unearthed a particularly
based on a literal reading of the Bible), and that prized find: the complete fossil of a giant sloth
its geology had been shaped entirely by incre- embedded in a cliff, below a layer of
BRITISH
ISLES
CHINA
NORTH
AMERICA The Azores
JAPAN
NORTH NORTH Canary
PACIFIC OCEAN ATLANTIC OCEAN Islands
NORTH
INDIA PACIFIC OCEAN
294 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
the work of the political economist Thomas Mal- humans. Other scientists with evolutionary
thus, whose pessimistic book, An Essay on the ideas were causing quite a stir in England and
Principle of Population (1798), described how being openly ridiculed (for this reason Robert
hunger, starvation, and disease would ulti- Chambers had published his book anony-
mately limit human population growth. Dar- mously). Even sharing his theory of evolution
win realized that, for animals, such limitations by natural selection with trusted colleagues,
would lead to competition for resources that Darwin said, was “like confessing a murder.”
would put weaker individuals at a disadvan- To withstand challenges, he knew he would
tage. In these circumstances, Darwin wrote in need more detailed evidence.
his notebook, “favourable variations would And so, at age 37, Darwin began to investi-
tend to be preserved, and unfavourable ones gate closely one group of animals: barnacles,
to be destroyed.” Competition for survival and the small invertebrates that cling to ships or
reproduction among members of a species, he marine life. Darwin spent 8 years, from 1846 to
realized, would lead gradually to the species 1854, carefully analyzing the barnacles’ tiny
becoming more adapted to its surroundings. In adaptations. It was tedious work, leading Dar-
effect, the environment was “selecting” for win to write, “I hate a Barnacle as no man ever
favorable traits, much as plant and animal did before.” Yet the work proved valuable, put-
breeders selected and perpetuated desirable ting detailed meat on the bones of his skeletal
varietals—a plant with especially large fruit, for idea. “What he found in barnacles,” wrote
Janet Browne, a professor of the history of sci-
ence at Harvard and the author of Darwin’s
“One might really fancy that . . . one species had
Origin of Species: A Biography (2007), “brought
been taken and modified for different ends.” important shifts in his biological understand-
–Charles Darwin ing, strengthened his belief in evolution and
provided an essential backdrop to Origin of
instance. This idea of “natural selection” was Species.”
Darwin’s original contribution to the theory of Darwin was hard at work fleshing out his
evolution—what he called “descent with modi- idea in painstaking detail when he received a
fication.” (Darwin avoided using the term letter from a young naturalist with whom he
“evolution,” which he thought gave a mistaken had a casual acquaintance, a collector named
idea of progressive development, preferring Alfred Wallace who made a living selling rare
instead this more descriptive phrase.) Others butterflies and birds to other collectors and
had speculated at length about species museums. The envelope was postmarked from
change—most notably Robert Chambers in Ves- an island in Indonesia. Inside was a 20-page
tiges of the Natural History of Creation (1844)— manuscript describing the author’s bold new
but Darwin was the first to provide a clear idea about how species change over time,
mechanism of evolution. The philosopher of which he wanted Darwin to read and have pub-
science Daniel Dennett has called the theory of lished. Darwin, it seemed, had been scooped.
natural selection “the single best idea anyone
has ever had.” In Darwin’s Shadow
By 1844, Darwin had developed his ideas Although we often credit Charles Darwin with the
into a 200-page manuscript that he hoped discovery of evolution by natural selection, he
would be the definitive word on the subject. He was not alone in charting this intellectual terri-
did not rush his ideas about natural selection tory. Another British naturalist was also hot on
into print, however. He knew that his ideas the trail. Like Darwin, Wallace was fascinated by
would be controversial, contradicting as they natural history and had a thirst for adventure. In
did strongly held beliefs about God and the other ways, though, the two men couldn’t have
special creation of all animals, including been more different. Darwin came from a
Population
296 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
mouth of the Amazon River. There he hoped to Wallace continued his research, but in early
earn his reputation as a respectable scientist. 1858, disaster struck again: while traveling in
Wallace was an unusually keen observer of the what is now Malaysia, he contracted malaria. Not
natural world. Exploring the rain forest of the one to waste a perfectly good research opportu-
Amazon, he was struck by the distribution of nity, Wallace turned his convalescence into a
distinct yet similar-looking (“closely allied”) sabbatical. As he later recalled, “I had nothing to
species, which were often separated by a geo- do but to think over any subjects then particu-
graphic barrier, such as a canyon or river. For larly interesting me.” Acutely aware of his own
example, he noted that different species of illness, he thought about what Malthus had
sloth monkey were found on different banks of written about disease and how it kept human
the Amazon River. Over the course of his 4-year populations in check. He also ruminated on
trip, Wallace scoured the Amazon and col- Lyell’s recent discoveries, which suggested that
lected thousands of specimens. the earth was much older than previously
Wallace was on his way home to London thought. How might these forces of disease and
with his specimens in 1852 when disaster death, multiplied over time, influence the com-
struck: his ship caught fire and position of different populations,
sank. Wallace survived, but he he wondered? As his fever waned,
lost everything—his notes, “Every species inspiration struck—like “friction
sketches, journals, and all his has come into upon the specially-prepared
specimens. In spite of this catas- existence match,” he later said: in every
trophe, Wallace was unde- coincident both in generation, weaker individuals
terred. He was, as his biographer will die and those with the fittest
Michael Shermer noted in his
space and time variations will remain and repro-
book In Darwin’s Shadow (2002), with a pre-existing duce; as a result the species
“a veritable scientific and liter- closely allied will become better adapted to its
ary engine,” a man who was sin- species.” –Alfred env ironment. Wallace had
gularly devoted to his research. worked out the mechanism for
Russel Wallace
Less than 2 years later, he was evolution that was missing from
off on another collecting expe- his earlier work. He quickly wrote
dition, this time to the islands of Southeast Asia. out his idea and sent it to the one naturalist he
Wallace’s first paper, “On the Law Which thought might be able to appreciate it. Wallace’s
Has Regulated the Introduction of New Spe- paper arrived on Darwin’s doorstep on June 18,
cies,” was published in September 1855. Based 1858.
on his island work, it focused on the similar Darwin was stunned. For 20 years he had been
geographical distribution of closely allied spe- working diligently on the same idea and now it
cies. For example, he wrote, “the Galápagos seemed someone else might get credit for it. “All
Islands . . . contain little groups of plants and my originality will be smashed,” he wailed to Lyell,
animals peculiar to themselves, but most asking him what he thought he should do. Recog-
nearly allied to those of South America.” From nizing the delicacy of Darwin’s situation, Lyell and
these observations, Wallace deduced this law, other colleagues devised a plan that would clearly
as he called it: “Every species has come into establish Darwin’s intellectual precedence: they
existence coincident both in space and time would arrange to have papers by both men pre-
with a pre-existing closely allied species.” sented at a meeting of the Linnaean Society in
Wallace’s article was groundbreaking, fore- London. The meeting took place on July 1, 1858.
shadowing Darwin in a number of ways, but it The papers were dutifully read, but there was no
lacked an explanation—a mechanism—of exactly discussion or fanfare. In fact, neither of the authors
how one species might have evolved from was even present: Wallace was still traveling in
another. Malaysia and Darwin was mourning the recent
298 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Chapter 15 Nonadaptive Evolution
and Speciation
Evolution in the
Fast Lane
j What You Will Be Learning
15.1 Geographic Ranges of Manatees and
Dugongs
15.2 The Founder Effect Reduces Genetic Diversity
15.3 Bottlenecks Can Reduce Genetic Diversity
UP CLOSE Calculating Hardy-Weinberg
Equilibrium
15.4 Gene Flow between Populations Increases
Genetic Diversity
15.5 Species Are Reproductively Isolated
15.6 Physical Traits in the Order Sirenia
15.7 The Mitochondrial DNA of Florida Manatees
Lacks Genetic Diversity
15.8 Allopatric Speciation: How One Species Can
Become Many
299
Chapter 15 Nonadaptive Evolution and Speciation
Evolution in the
Fast Lane
Can Florida’s manatees cope with a rapidly
changing environment?
C
lose your eyes. Picture a world in which “If manatees weren’t air breathers it wouldn’t
you must eat, sleep, and breathe on a be much of a problem,” explains Bonde, who
highway filled with cars. Now imagine works with the U.S. Geological Survey in Gaines-
the number of cars increasing every ville. “But because they have to go to the surface
day, driving faster and faster. to get that breath of air, they’re very susceptible
“Strange as this scenario seems,” says biolo- to being struck.”
gist Robert Bonde, that’s essentially the predica- Boat-related deaths reached an all-time high
ment that Florida’s manatees face today. These in 2009, when 97 animals were killed; in 2006,
large marine mammals live in the congested 92 manatees perished in collisions. And boats
waterways of Florida’s panhandle, sharing their aren’t the only threat to the manatees. Other
habitat with an ever-increasing number of causes of death include being caught in fishing
speedboats. Frequent run-ins with boat propel- lines and crushed in locks and flood dams.
lers mean slashed backs, severed flippers, man- Every year, more than 100 manatees die from
gled tails—and even death—for the manatees, human-related causes.
whose maximum speed of 5 miles per hour is Recognizing the plight of the manatee, the
eclipsed by that of the boats whizzing by. In fact, state of Florida has created speed zones in some
boat–manatee collisions are so common that manatee habitats and restricted boat access to
researchers often use a manatee’s distinctive others. Such measures have certainly helped,
battle scars as identification. “but to completely protect the animals from
300 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
speedboats,” says Bonde, “you’d almost have to enforcement was lax, and their numbers con-
take speedboats completely out of the picture,” tinued to decline throughout the next
and people just aren’t willing to do that. century.
Manatees belong to a group of mammals Not until 1967, when the species was officially
known as sirenians, a category that also listed as “endangered,” did manatees receive
includes the manatees’ closest protection from the federal gov-
living relative, the dugong. Manatees were ernment. Today, manatees are
There are four living species of protected by both federal and
sirenian. A fifth sirenian spe-
once routinely state laws, and they are now Flor-
cies, Steller’s sea cow, was hunted for their ida’s official state marine mam-
driven to extinction by hunting meat and hide and mal. Because of these efforts, the
in the 1770s. Manatees, too, were in danger of Florida manatee population has
were once routinely hunted for
becoming extinct increased to more than 5,000
their meat and hide and were in individuals, up from only 1,000
danger of becoming extinct by
by the late 1800s. 30 years ago. While the manatee
the late 1800s. To protect the is no longer on the brink of
creatures, Florida passed legislation in 1893 extinction and its numbers are increasing, biol-
prohibiting the hunting of manatees, but ogists are still worried about the endangered
302 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
ber of alleles (for example, 50 out of 1,000, or lution. Nonadaptive evolution isn’t necessarily
NONADAPTIVE
EVOLUTION .05). Over time, several forces can change the “bad” or maladaptive. Without mutation intro-
Any change in allele frequency of each allele—that is, how common ducing variation into a population, for example,
frequency that does it is in the population. When alleles change in there would be no evolution at all. But by itself,
not by itself lead a
frequency over time, a population evolves. (As mutation does not lead to a population becom-
population to become
more adapted to its discussed in Chapter 14, that’s the definition of ing more adapted. Another such nonadaptive
environment; the evolution.) cause of evolution—one of particular relevance
causes of non- Evolutionary changes in a gene pool can have to manatees—is genetic drift, change in allele
adaptive evolution are
mutation, genetic
lasting consequences for a population—some- frequencies between generations that occurs
drift, and gene flow. times good, sometimes bad, sometimes neutral. purely by chance.
For example, changes in the gene pool can
GENETIC DRIFT result in a species becoming more adapted to its Changing by Chance
Random changes in
the allele frequency of environment—think of antibiotic-resistant bac- Genetic drift is a bit like rolling the evolutionary
a population between teria. The gene-pool-altering force that results in dice. By simple chance, some individuals just
generations; genetic adaptation is natural selection, which is dis- happen to survive and reproduce, while others
drift tends to have
cussed in Chapter 14. do not. Those that pass on their genes weren’t
more dramatic effects
in smaller populations Natural selection isn’t the only force that alters necessarily more fit or better adapted; they just
than in larger ones. allele frequencies, although it is the only one that got lucky. Because only a subset of the popula-
results in adaptation. Mutation, which introduces tion (with a subset of the total alleles) repro-
new alleles into a population, also alters allele duces, only a subset of alleles is represented in
frequencies, but since the process is random, it the next generation.
does not by itself lead to adaptation. In other Over time, genetic drift decreases the genetic
words, mutation is a type of nonadaptive evo- diversity of a population. Genetic drift tends to
INFOGRAPHIC 15.1
Geographic Ranges of Manatees and Dugongs
This map shows the geographic ranges of the four living species of manatees and dugongs.
Florida
Manatee
West African
Antillean Manatee
Manatee
Dugong
Amazonian
Manatee
Amazonian Manatee
(Trichechus inunguis)
is found in Amazonia.
West African Manatee Dugong (Dugong dugon)
(Trichechus senegalensis) resides along the coasts of
is found along the coast eastern Africa, India, Asia,
of western Africa. and northern Australia.
304 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 15.3
Bottlenecks Can Reduce Genetic Diversity
Genetic bottlenecks occur when a population loses a large proportion of its members. Bottlenecks are more consequential
when the starting population is small. In a large population, the reduced population is still likely to retain the same alleles
present in the original population (top panel). In a small population (lower panel), the loss of population members is more
likely to result in loss of alleles, and therefore a dramatic change in the allele frequency and genetic diversity of the “restored”
population.
Genetic “bottleneck” eliminates After several generations
Original population size:
a large portion of the population: in isolation:
Large:
Small:
fastest land animal. Cheetahs nearly became lation is, the more ways it has to adapt. Different
extinct 10,000 years ago, when harsh condi- alleles produce variation in inherited charac-
tions of the last ice age claimed the lives of teristics such as skin color or body shape. In
many large vertebrates on several continents. the right environment, some genetic traits can
Ultimately, a few cheetahs survived and repro- greatly enhance survival and reproduction.
duced, but the more than 12,000 individuals You can think of a gene pool as a popula-
alive today are now so genetically similar that tion’s portfolio of assets. Having a diverse array
skin grafts between unrelated individuals do of investments is a better strategy for long-term
not cause immune rejection; the animals are success than having all your money tied up in
essentially genetically identical. one kind of stock—especially if that stock loses
Why is genetic diversity important? In value in changed economic times.
essence, a diverse gene pool gives a population For example, say a population of manatees
more flexibility to survive in a changing envi- suddenly finds itself in a colder environment
ronment: the more genetically diverse a popu- (as indeed many did during the last ice age). If
Members of the Sirenia Project draw blood from a manatee for genetic studies.
306 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
diversity in the manatee population. Assessing tion of manatees and find that the frequency of
genetic diversity in populations of threatened or heterozygote individuals (Tt) is lower than
endangered species is a key part of conservation their expected frequency based on Hardy-
biology; it’s one way that biologists measure the Weinberg equilibrium. In this case, we know
genetic health of populations. If a population is that something is causing heterozygotes to
shown to have low levels of genetic diversity, become less common. This could happen if, for
which could threaten its ability to adapt to a example, natural selection were favoring
changing environment, then preventive mea- homozygotes to preferentially survive and
sures might be taken, such as attempting to rein- reproduce, which would be a type of adaptive
troduce genetic diversity and protecting habitat. evolution.
The hope is that with early intervention it may Heterozygotes can also become less com-
be possible to avoid the more serious threat of mon in a population if closely related members
irreversible damage—even extinction. of the population are mating with each other,
How do biologists measure the genetic health a phenomenon known as inbreeding.
of populations? Put another way, how can you Inbreeding is a type of nonrandom mating that
tell if a population is evolving in ways that will cause genotype frequencies to differ from
could be detrimental to its long-term success? predicted Hardy-Weinberg values. Specifically,
One way would be to measure allele frequencies inbreeding will cause homozygous individuals
in a population over generations to see if total to become more common. Because closely
HARDY-WEINBERG genetic diversity is going down. Since the related individuals are more likely to share
EQUILIBRIUM
life span of a manatee can be 70 years, however, the same alleles, the chance of two recessive
The principle that, in a
non-evolving it is not practical to wait around to witness alleles coming together during a mating is
population, both such evolution happening. A shortcut used high. When that happens, homozygous reces-
allele and genotype by population biologists is, in essence, to take a sive genotypes are created, and previously
frequencies remain
constant from one
“snapshot” of the gene pool at a given time, hidden recessive alleles start to affect
generation to the and compare it to the picture of a population phenotypes.
next. that is known not to be evolving. If these The accumulation of harmful recessive phe-
two pictures differ, then you know your popu- notypes can lower fitness (and thus fertility), a
INBREEDING
Mating between lation is evolving, and you can begin to investi- phenomenon known as inbreeding depres-
closely related gate why. sion, which can threaten a species’ long-term
individuals. Inbreeding What does a nonevolving population look survival. One species that has suffered from
does not change the
like? Allele frequencies in a nonevolving inbreeding depression is the Florida panther,
allele frequency
within a population, population behave in a predictable way: by which is actually a subspecies of puma. In the
but it does increase definition, they do not change over time. Fur- past, Florida panthers mated with puma popu-
the proportion of thermore, in a nonevolving population, geno- lations from neighboring states, where their
homozygous
individuals to
type frequencies remain unchanged from one ranges overlapped. This interbreeding—that is,
heterozygotes. generation to the next, a condition known as breeding between populations—fostered an
Hardy-Weinberg equilibrium. The Hardy- exchange of alleles that continually enriched
INBREEDING
Weinberg equilibrium provides a baseline the local populations’ genetic diversity.
DEPRESSION
The negative from which to judge if a population is evolving By the mid-20th century, however, hunting
reproductive or not; it describes the default pattern of geno- and development had squeezed the Florida pan-
consequences for a types in nonevolving populations (see Up Close: ther population into an isolated region at the
population associated
Calculating Hardy-Weinberg Equilibrium). state’s southernmost tip. By 1967, only 30 pan-
with having a high
frequency of How is Hardy-Weinberg equilibrium useful thers remained, and the U.S. Fish and Wildlife
homozygous to conservation biologists? Suppose we have a Service listed them as endangered. By 1980,
individuals possessing population of manatees with two possible the panthers showed unmistakable signs of
harmful recessive
alleles.
alleles for hide thickness, thick skin (T) and inbreeding depression—birth defects, low
thin skin (t). Let’s say we sample this popula- sperm count, missing testes, and bent tails.
How do we know if a population is evolving? To find out, we can use a mathematical formula called the
Hardy-Weinberg equation, which calculates the frequency of genotypes you would expect to find in a
nonevolving population. For a gene with one dominant and one recessive allele, p and q, this formula can
be written as:
p2 + 2pq + q2 =1
Frequency of Frequency of Frequency of
homozygous heterozygotes homozygous
dominants recessives
By definition, a population is not evolving (and is therefore in Hardy-Weinberg equilibrium) when it has
stable allele frequencies and, therefore, stable genotype frequencies from generation to generation. This
can only be achieved when all five of the following conditions are met:
In nature, no population can ever be in strict Hardy-Weinberg equilibrium, since it will never meet all five
conditions. In particular, because no real population is infinitely large, genetic drift will always occur.
In other words, all natural populations are evolving. Nevertheless, by describing the pattern of genotypes
in a nonevolving population, Hardy-Weinberg equilibrium provides a baseline from which to measure
evolution.
To see how the Hardy-Weinberg equation can be used to detect evolutionary change, consider the
following example. Say you have a population of manatees with two possible phenotypes for hide color,
gray and white. The allele for gray hide color, G, is dominant; the allele for white hide color, g, is recessive.
As every individual in the population has two alleles for the hide-color gene (one maternal and one
paternal), there are twice as many alleles as there are members of the population. So a population of 500
manatees has 1,000 alleles of the gene for hide color.
In this population, assume there are 800 G alleles, and 200 g alleles. We would then say that the
frequency of the dominant allele is 0.8 (800/1,000) and the frequency of the recessive allele is 0.2
(200/1,000). Since there are only two alleles in the population, their combined frequencies must add up
to 1. If we use p to denote the frequency of the dominant allele and q to denote the frequency of the
recessive allele, then we can say that p + q = 1.
Suppose we want to use those allele frequencies to calculate the expected frequency of white-hided (gg)
individuals in the population. If the frequency of g in the population is q, then we know from the Hardy-
Weinberg equation that the frequency of gg is q2 = (.2)(.2) = .04. Thus, in our population of manatees, 4%,
or 20 manatees, will have white hides. If we find out that the actual number of white manatees in the
population is appreciably more or less than this number, then we know that our population is evolving, and
we can begin to investigate why.
308 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Frequency of Alleles in the Parent Population:
p = frequency of G alleles in the population = 0.80
q = frequency of g alleles in the population = 0.20
p + q =1
0.80 + 0.20 =1 Frequency of Genotypes in the Parent Population:
p2 = frequency of GG genotypes in the population = 0.64 = 64%
2pq = frequency of Gg genotypes in the population = 0.32 = 32%
q2 = frequency of gg genotypes in the population = 0.04 = 4%
p2 + 2pq + q2 = 1
0.64 + 2(0.16) + 0.04 =1
GG Gg
Hardy-Weinberg also has important applications in public health. For example, the Hardy-Weinberg
equation can be used to estimate the frequency of carriers (heterozygotes) of rare recessive diseases, such
as cystic fibrosis. Since we know that the frequency of CF is approximately 1 in 3,000 Caucasian babies in
the United States, we know that the frequency of homozygous recessive individuals, q2, is 1 in 3,000 (or
0.0003). This means that the frequency of the recessive allele, q, must equal 0.018 (the square root of
0.0003). And if q = 0.018, then p = 1 − 0.018 = 0.982 (since p + q = 1). Therefore, the frequency of
heterozygotes, 2pq, is 0.035, or 3.5%. Knowing the frequency of the disease and carriers in the population
helps health workers offer genetic counseling and plan for interventions.
In response, the Fish and Wildlife Service of the reasons they don’t move much between
took active measures. In 1995, it brought in their different habitats in the West Atlantic,”
female pumas from Texas to mate with Florida’s Bowen told reporters at the University of Flor-
male panthers. The program was successful: the ida. When populations are isolated—when they
hybrid kittens—30 in all—showed none of the don’t mix—they’re stuck with the limited
symptoms of inbreeding depression. Today, amount of genetic variation that each already
more than 100 healthy panthers roam the contains, and the likelihood of inbreeding goes
swamps and grasslands of Florida. up. Moreover, the small size of their popula-
Some researchers were concerned that tions makes genetic drift more likely, com-
inbreeding might be occurring in the geographi- pounding the problem.
cally isolated Florida manatee. Despite the man- Acutely aware of the importance of genetic
atee’s ability to swim large distances, diversity to populations, Bonde and others
populations tend to stay close to protected have analyzed the genetic makeup of a number
coastal waters and rivers. “It’s very much of Florida manatees. This work has revealed
against their well-being to travel across open some good news. While the overall allelic
water,” explains conservation geneticist Brian diversity of Florida manatees is indeed rela-
Bowen, a colleague of Bonde’s who conducted tively low—as you would expect of a founder
genetic studies of manatees when he worked at population—it is not nearly as low as, for exam-
the University of Florida. ple, that of the cheetah population that went
“Out there, they are big, slow, and tasty. through a sudden bottleneck. Researchers are
They are just a big shark egg roll, and that’s one still able to find numerous subtle DNA differ-
310 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 15.4
Gene Flow Between Populations Increases Genetic Diversity
Mutation introduces new alleles into a population at low frequency. Migration and interbreeding of individuals moves
alleles between populations. DNA analysis of Florida manatee populations shows genetic diversity in nuclear DNA,
consistent with healthy gene flow between Florida populations, as shown in the example below.
Inbred, or reproductively isolated, populations Populations that mix their alleles with other
have limited diversity: populations are more diverse:
Stars denote distinct
manatee populations
Matings
between
populations
These populations have a limited genetic diversity These populations have higher levels of genetic
because they only share alleles with themselves. diversity, as there is a flow of alleles between gene
Many of these populations have a limited number pools. Each population has all possible alleles but
of the possible alleles available. carries them in different frequency.
ences among manatee individuals. Moreover, ridors that manatees use to encounter each
when researchers compare the frequency of other and mate.
genotypes in the population to those predicted
by Hardy-Weinberg equilibrium, they find no Manatees Mixing It Up, or Gene Flow
signif icant differences, suggesting that Though they don’t travel in the open ocean,
inbreeding is not occurring. manatees still manage to migrate great dis-
These results have given conservationists a tances, especially during the breeding season.
reason to be optimistic. Manatees seem to be “In the course of a year, they could go over sev-
preserving their genetic diversity. However, as eral hundred if not thousands of miles,” says
researchers are quick to point out, the contin- Bonde. Through this annual mixing and mating
GENE FLOW
ued health of the gene pool clearly hinges upon of wandering manatees, alleles are continually
The movement of
alleles from one the population’s being large enough to avoid shared between neighboring gene pools in a
population to another, loss of genetic variation through genetic drift, process known as gene flow.
which may increase which in turn depends upon reducing human- Like genetic drift, gene flow is a type of evolu-
the genetic diversity
of a population.
related deaths as well as protecting habitat. tion that does not lead to adaptation. But unlike
Especially crucial is preserving migratory cor- genetic drift, which decreases the genetic
Though they are water-living mammals, mana- species as a population of individuals whose SPECIATION
tees are actually more closely related to ele- members can interbreed and produce fertile The genetic
phants than to whales and dolphins. DNA and offspring. divergence of
populations owing to
fossil evidence shows that manatees first Members of different species cannot mate
a barrier to gene flow
evolved in freshwater regions of South America, with each other because their populations are between them,
such as the Amazon River basin, and subse- reproductively isolated. Such reproductive leading over time to
quently branched out into the Caribbean. The isolation can be caused by a number of fac- reproductive isolation
and the formation of
first group of Caribbean migrants included tors. For example, the two species may have a
new species.
those that would later evolve into the West different mating time, location, or mating rit-
312 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 15.5 ual—so, like ships that pass in the night, they
may never have the opportunity to meet. Or,
Species Are Reproductively Isolated anatomical differences between the two spe-
cies may make the physical act of mating
Species maintain their reproductive isolation in a variety of ways. impossible (Infographic 15.5). Over evolutionary
time, two closely related but reproductively
Ecological Isolation: isolated species—say, manatees and dugongs—
Different environments. will gradually become more and more dissimi-
The Arctic Fox and the Desert Fox lar as genetic differences between them
live in such different places, they
never encounter one another. accumulate.
Genetic differences can also occur and
accumulate within a single species, provided
Temporal Isolation:
some barrier to gene flow occurs between popu-
Mating behavior or fertility
at different times. lations. Once this barrier forms, the separated
The Leopard Frog mates in gene pools will evolve independently of
early spring and the Bullfrog each other. The specific alleles present in each
mates in early summer.
separated gene pool will then depend on
Behavioral Isolation: the precise balance among the four main forces
Different mating activities. of evolution acting on it: mutation, natural
The Prairie Chicken is not
selection, genetic drift, and gene flow. Eventu-
attracted to the mating display of
the Ring-necked Pheasant. ally, if enough genetic changes accumulate
between populations of the same species,
the two populations may diverge into separate
Mechanical Isolation:
Mating organs are incompatible. species, a process known as speciation. This
Plants pollinated by the is what happened among manatees.
hummingbird do not receive pollen Some manatee species are geographically as
from plants pollinated by the
well as reproductively isolated (for example, the
Black Bee.
West Indian manatee and the Amazonian mana-
Gametic Isolation: tee, which have different numbers of chromo-
Gametes cannot unite. somes, will not produce fertile offspring); and
The gametes from a dog and a
cat cannot unite to form each has evolved by natural selection to become
a zygote. adapted to a different environment. You can see
the results of natural selection in the different
Hybrid Inviability:
populations of manatees living today.
Gametes unite but viable For instance, snout shape: West Indian mana-
offspring cannot form. tees, including those living in Florida, have a
The goat and sheep can mate, pronounced bend in their snout, an adaptation
but the zygote formed does
not survive. that allows them to take better advantage of
the kinds of aquatic vegetation found in marine
Hybrid Infertility: environments, particularly the rooted plants
Viable hybrid offspring
cannot reproduce.
that grow on riverbeds. Amazonian manatees,
Zebras and horses are different by contrast, have a flatter snout, better for
species because their hybrid scooping up overhanging freshwater vegetation
offspring, zebroids, cannot make near the water’s surface. West Indian manatees
offspring of their own.
are also about twice as large as Amazonian
manatees. With all that extra padding and insu-
lation, the West Indian manatee is able to
tolerate the cooler water temperatures found
INFOGRAPHIC 15.6
Physical Traits in the Order Sirenia
All sirenia species have limited amounts of body hair and long whiskers on either side of the snout. The whiskers are
very sensitive and help the animal identify food. The upper snout of all Sirenia is split so that each side can move
independently to push food into the mouth.
314 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 15.7
The Mitochondrial DNA of Florida Manatees Lacks Genetic Diversity
Looking at the distribution of mitochondrial DNA (mtDNA) variants
in the manatee range is one way to assess genetic diversity.
Mexico Florida
Chromosome N=6 N = 23
Dominican Republic
N=6
A mitochondria’s single
Puerto Rico
chromosome carries only
N = 12
one copy of each gene.
Guyana
Manatee populations in N=7
South America carry several
different gene variants.
These populations are Colombia
more genetically diverse. N = 22
Venezuela
N=4
manatee population, which indicates that this that sense, manatee speciation resembles the
population has remained isolated from those path to speciation take by another group of ani-
populations in other parts of the Americas that mals with famously distinctive faces: the more
have different mitochondrial DNA sequences than 13 species of finches living on the Galápa-
(Infographic 15.7). gos Islands, near Ecuador, that Charles Darwin
Speciation that occurs because of geographic encountered on his voyage aboard the Beagle
or ecological separation is known as allopatry. (see Milestones in Biology: Adventures in
According to evolutionary ecologist Juliana Evolution); (Infographic 15.8).
Vianna of Andrés Bello University in Chile, that
ALLOPATRY is how the three species of manatees evolved: Left Out in the Cold?
Speciation that occurs “Manatee species diversification occurred Like all species, manatees are adapted to sur-
because of geographic mainly by isolation [that is, allopatry], followed vive in only certain environments. Their ability
or ecological barriers
to gene flow.
by local selection pressures, such as the fresh- to move into new habitats is limited by their
water adaptation of Amazonian manatees.” In range of physical adaptations, which they
PACIFIC OCEAN
Pinta
Is. S. Chino
North Seymour
Jervis (Rabida) Baltra Ecuador
Fernandina
Seed eater Santa Cruz
Pinzon
Large Ground Finch (Indefatigable) Galápagos
Isabela
Geospiza magnirostris (Albermarle) Islands
Santa Fe
Tortuga (Barrington) San Cristobal
(Chatham)
PACIFIC
Floreana OCEAN
Hood
(Charles)
(Española)
Cactus flower eater
Cactus Ground Finch N
Geospiza scandens
evolved over thousands of years. For example, Basking in these human-made hot tubs helps
as creatures of the tropics manatees cannot sur- thaw the chilled creatures. But this is at best a
vive long exposures to temperatures below 68°F short-term solution: as coal-fired power plants
(20°C). Florida generally marks the northern tip are closed or decommissioned and replaced
of their range (though during summer months with less-polluting forms of energy, Florida
manatees can sometimes be found swimming manatees will have few places to turn for
as far north as Rhode Island). warmth. Many, undoubtedly, will be left out in
Historically, during the winter months mana- the cold and die. In 2010 alone, 245 manatees
tees would congregate in the warm waters of died from cold stress.
Florida’s natural springs and shallow, sun- Whether or not manatees are able to adapt
warmed Everglades. Development has since and survive depends not only on our efforts to
blocked access to those warm areas or destroyed safeguard their habitat but also on their intrinsic
them altogether, so manatees have been forced genetic diversity. Will they make it? No one
to find alternative hot spots—for example, in the knows for sure. “But give ’em credit,” says
warm water emitted by coal-fired power plants. Bonde, “they’re in it for the fight.” ■
316 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Summary
Q From a genetic perspective, a Q Inbreeding of closely related
population is identified by the individuals may occur in small,
particular collection of alleles in isolated populations, posing a
its gene pool. threat to the health of a species.
Q Genetic diversity, as reflected Q Gene flow is the movement of
in the number of different alleles alleles between different
in a population’s gene pool, is populations of the same species,
important for the continued often resulting in increased
survival of populations, genetic diversity of a population.
especially in the face of changing Q Genetic diversity can be
environments. measured by using DNA
Q Evolution is a change in allele sequences to assess allele
frequencies in a population over frequency.
time. Evolution can be adaptive Q Hardy-Weinberg equilibrium
or nonadaptive. Mutation, describes the frequency of
genetic drift, and gene flow are genotypes in a nonevolving
nonadaptive forms of evolution. population. The Hardy-Weinberg
Q The founder effect is a type of equation can be used to detect
genetic drift in which a small evolutionary change in a
number of individuals population.
establishes a new population in a Q According to the biological
new location, with reduced species concept, species are
genetic diversity as a possible reproductively isolated
result. populations of individuals that
Q The bottleneck effect is a type can interbreed to produce fertile
of genetic drift that occurs when offspring.
the size of a population is Q Speciation can occur when
reduced, often by a natural gene pools are separated, gene
disaster, and the genetic diversity flow is restricted, and populations
of the remaining population is diverge genetically over time.
reduced.
POPULATIONS AND GENE POOLS 5. Which of the four populations in the table below
The genetic diversity of a population is reflected in would you be concerned about from a conservation
its collective bank of alleles, or gene pool. The perspective? Why would you be concerned?
amount of genetic diversity in a population has
implications for its evolution. Number Number Number Number
of of of of
Popu- individ- alleles, alleles, alleles,
HINT See Infographic 15.2 and Up Close: lation uals gene 1 gene 2 gene 3
Calculating Hardy-Weinberg Equilibrium.
1 50 1 7 5
2 1,000 1 5 7
j KNOW IT 3 50 3 2 2
1. Genetic diversity is measured in terms of allele
frequencies (the relative proportion of different 4 1,000 1 1 2
alleles in a gene pool). A population of 3,200
manatees has 4,200 dominant G alleles and 2,200 6. Phenylketonuria (PKU) is a rare, recessive
recessive g alleles. What is the frequency of g alleles genetic condition that affects approximately 1 in
in the gene pool? 15,000 babies born in the United States. (You may
have noticed on products that contain aspartame
2. Of the three populations described below, each the statement “Phenylketonurics: contains
of which has 1,000 members, which population has phenylalanine,” a warning for people with PKU that
the highest genetic diversity? Note that only one they should avoid consuming that product.)
gene is being presented, and that this gene has three Calculate the expected frequency of carriers (that is,
possible alleles: A1, A2, and a. of heterozygotes) in the U.S. population, based on
the information provided about rates of PKU among
Population A: 70% have an A1/A1 genotype, 25% U.S. births. (Remember the Hardy-Weinberg
have an A1/A2 genotype, and 5% have an A1/a equation.)
genotype.
Population B: 50% have an A1/A1 genotype, 20% 7. Assume a population of 100 individuals. Five are
have an A2/A2 genotype, 10% have an A1/A2 homozygous dominant (AA), 80 are heterozygous
genotype, 10% have an A2/a genotype, and (Aa), and 15 are homozygous recessive (aa) for the A
10% have an a/a genotype. gene. Determine p and q for this population. Now
Population C: 80% have an A1/A1 genotype and use those values for p and q and plug them into the
20% have an A1/a genotype. Hardy-Weinberg equation. Is this population in
Hardy-Weinberg equilibrium? Why or why not?
3. A starting population of bacteria has two alleles
of the TUB gene: T and t. The frequency of T is 0.8 GENETIC DRIFT
and the frequency of t is 0.2. The local environment Genetic drift can alter the allele frequency of a
undergoes an elevated temperature for many population. Genetic drift tends to lower the genetic
generations of bacterial reproduction. After 50 diversity of a population.
generations of reproduction at the elevated
temperature, the frequency of T is 0.4 and the HINT See Infographics 15.2 and 15.3.
frequency of t is 0.6. Has evolution occurred?
Explain your answer.
j KNOW IT
8. Which of the following are examples of genetic
j USE IT drift?
4. Question 2 looked at the allele frequencies of a. founder effect
populations A, B, and C. From your answer to that b. bottleneck effect
question, which population would you predict to c. inbreeding
have the greatest chance of surviving an d. a and b
environmental change? Explain your answer. e. a, b, and c
318 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
9. A bottleneck is best described as 14. How does geographic isolation contribute to
a. an expansion of a population from a small speciation events?
group of founders.
b. a small number of individuals leaving a
population. j USE IT
c. a reduction in the size of an original 15. Two populations of rodents have been physically
population followed by an expansion in its size separated by a large lake for many generations. The
as the surviving members reproduce. shore on one side of the lake is drier and has very
d. the mixing and mingling of alleles by mating different vegetation from that on the other side. The
between members of different populations. lake is drained by humans to irrigate crops, and now
e. an example of natural selection. the rodent populations are reunited. How could you
assess if they are still members of the same species?
10. A population of manatees has 12 different
alleles, A through L, of a particular gene. A drunk 16. Why is inbreeding detrimental to a population?
motorboat driver recklessly tears through the water
where the manatees live, killing 90% of them. The 17. If geographically dispersed groups all converge
surviving manatees are all homozygous for allele B. at a common location during breeding season, then
a. What is the impact of this event on the return to their home sites to bear and rear their
frequency of alleles A through L? young, what might happen to the gene pools of the
b. What type of event is this? different groups over time?
12. In humans, founder effects may occur when a 5 individuals are D/A heterozygotes
small group of founders immigrates to a new 5 individuals are A/A homozygotes
country, for example to establish a religious 5 individuals are A/B heterozygotes
community. In this situation, why might the allele 5 individuals are C/D heterozygotes
frequencies in succeeding generations remain similar 4 individuals are C/C homozygotes
to those of the founding population rather than 1 individual is an E/E homozygote.
gradually becoming more similar to the allele
frequencies of the population of the country to If five A/E heterozygotes migrate into the
which they immigrated? population, what will be the impact on the allele
frequencies of each of the five alleles?
GENE FLOW AND SPECIATION
Gene flow can alter the genetic diversity of
a population as individuals from neighboring SCIENCE AND ETHICS
populations mix and mate with the original 19. Consider the situation of Florida manatees.
population. Barriers to gene flow contribute to a. What is the difference between an
speciation. endangered and a threatened species, according
to the classification established by the U.S.
HINT See Infographics 15.5, 15.7, and 15.8. Endangered Species Act? At the present time,
what is the status of the Florida manatee?
13. The biological species concept defines a species b. For a species like the Florida panther, why is a
a. on the basis of similar physical appearance. habitat conservation approach not sufficient to
b. on the basis of close genetic relationships. ensure a healthy recovery?
c. on the basis of similar levels of genetic c. What approach could be taken to try to
diversity. restore genetic diversity to a species such as the
d. on the basis of the ability to mate and cheetah, given that all cheetahs are survivors of
produce fertile offspring. a bottleneck and are essentially genetically
e. on the basis of recognizing one another’s identical?
mating behaviors.
A Fish with
Fingers?
j What You Will Be Learning
16.1 Fossils Form Only in Certain Circumstances
16.2 Fossils Reveal Changes in Species over Time
16.3 How Fossils Are Dated
16.4 Tiktaalik, an Intermediate Fossilized
Organism
16.5 Forelimb Homology in Fish and Tetrapods
16.6 Vertebrate Animals Share a Similar Pattern
of Early Development
16.7 DNA Sequences Are Shared among Related
Organisms
321
Chapter 16 Evidence for Evolution
A Fish with
Fingers?
A transitional fossil sheds light on how evolution works
F
or 5 years, biologists Neil Shubin and fossils. Not just any rocks and fossils, but ones
Ted Daeschler spent their summers dating from 375 million years ago, when ani-
trekking through one of the most deso- mals were taking their first tentative steps on
late regions on earth. They were fossil land. For three summers, they scoured the site
hunting on the remote island of Ellesmere, in of what was once an active streambed but found
the Canadian Arctic, about 600 miles from the little of interest, mostly pieces of ancient fish.
north pole. Even in summer, Ellesmere is a for-
bidding place: a windswept, frozen desert
where sparse vegetation grows no more than a
Tiktaalik “splits the difference between something
few inches tall, where sleet and snow fall in the we think of as a fish and something we think of as a
middle of July, and where the sun never sets. limbed animal.” –Ted Daeschler
Only a handful of wild animals survive here, but
those that do make for dangerous working con- Then, in 2004, the team made a tantalizing dis-
ditions. Hungry polar bears and charging herds covery: the snout of a curious-looking creature
of muskoxen are hazards of working in the Arc- protruding from a slab of pink rock. Further
tic, says Daeschler. The team carried shotguns excavation revealed the well-preserved remains
for protection. of several flat-headed animals between 4 and 9 VERTEBRATE
Braving these conditions, the researchers feet long. In some ways, the creatures resem- An animal with a bony
or cartilaginous
drilled, chiseled, and hammered their way bled giant fish—they had fins and scales. But backbone.
through countless tons of rock looking for they also had traits that resembled those of
322 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
A model of Tiktaalik roseae, the fossil discovery that represents a critical phase in the
evolution of four-legged, land-dwelling animals.
INFOGRAPHIC 16.1
Fossils Form Only in Certain Circumstances
Not every organism that dies
forms a fossil. Organisms are
more likely to fossilize if they have 1. Organism
bony skeletons or hard shells. In dies.
addition, the organism must be
covered quickly upon death or create Organism is eaten
an imprint in special types of sediment. No or broken down by
Is the dead organism preserved quickly? aerobic microbes.
Because of this, the fossil record is not
a complete record of past life, but it No fossil forms.
has supplied an impressive body of
evidence for evolution.
Yes Yes
2a. Organism is preserved by rapid 2b. Organism is preserved by rapid burial in sediment layers.
freezing, desiccation, or burial in
amber (hardened tree sap).
Quick burial in sediment (for example,
by a mudslide or volcanic eruption)
In these cases, protects the body from rapid decay.
organisms are
preserved largely
in their original
state. Are the conditions right for fossilization of this buried organism?
Spider in amber
Yes No
324 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
The Shubin and
Daeschler expedition
looking for fossils on
Ellesmere Island. the Field Museum of Natural History, Tiktaalik
is the most compelling example yet of an ani-
mal that lived at the cusp of this important
transition. Not only does it fill a gap in our
knowledge, the discovery also provides per-
suasive evidence in support of Darwin’s great
idea. served than animals without such hard parts
(think earthworms or jellyfish) that decay
DESCENT WITH Reading the Fossil Record quickly. And conditions permitting fossilization
MODIFICATION The theory of evolution—what Darwin called are rare: the organism has to be in just the right
Darwin’s term for
evolution, combining descent with modification—draws two main place at just the right time. Still, the fossil
the ideas that all conclusions about life on earth: that all living record is remarkably rich and offers an exciting
living things are things are related, and that the different species window onto the past. Paleontologists, scien-
related and that
we see today have emerged over time as a result tists who study ancient life, have uncovered
organisms have
changed over time. of natural selection operating over millions of hundreds of thousands of fossils throughout the
years. Many lines of evidence support this the- world, from many evolutionary time periods
FOSSILS ory (remember that “theory” in science means (Infographic 16.1).
The preserved remains
it is considered to be an established fact). The When fossils are arranged in order of age,
or impressions of
once-living organisms. most direct evidence of evolution comes from they provide a tangible history of life on earth.
fossils, the preserved remains or impressions Because not all organisms are preserved, the
FOSSIL RECORD of once-living organisms. Fossils are like “snap- fossil record is not a complete record of past life.
An assemblage of
fossils arranged in shots” of past life, capturing particular moments Nevertheless, it is extensive enough to show the
order of age, providing in time. overall arc of life, and provides compelling evi-
evidence of changes in They are formed in a number of ways: an ani- dence in support of Darwin’s theory. For exam-
species over time.
mal or plant may be frozen in ice, trapped in ple, if all organisms have descended from a
PALEONTOLOGIST amber, or buried in a thick layer of mud. Rapid single common ancestor billions of years ago as
A scientist who decay is thereby prevented and the organism’s the theory of evolution concludes they did, then
studies ancient life by shape is preserved. Not all organisms are we would expect the fossil record to show an
means of the fossil
equally likely to form fossils, though: animals ordered succession of evolutionary stages as
record.
with bones or shells are more likely to be pre- organisms evolved and diversified. And, indeed,
326 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 16.2
Fossils Reveal Changes in Species over Time
The fossil record of horses supports the theory of descent with modification.
Forelimb fossils are similar to one another, but show changes
over time from the earliest horse ancestors to modern-day horses,
One Toe
as species diverged from a common ancestor.
In the fossil record we can observe over time
a reduction in toe number, as the central toe
became dominant, allowing horses to move
more rapidly in new prairie-like environments.
0 Equus
Modern Horse Hippidium and
other genera One Toe
5 Styohipparion
Nannipus
Hipparion Neohipparion
10
Calippus
Megahippus
Sinohippus Archaeohippus
15
25
Parahippus
Three Toes
30
35
Miohippus
40
Paleotherium
Epihippus Four Toes
Propalaeotherium
45
Pachynolophus
Orohippus
50
512 mya
Rock layers formed
from volcanic eruptions
520 mya
can be directly dated
Fossils can be dated relative
using radiometric
to one another. Fossils
dating. Fossils found in
found in sediment layers
these layers are the
that are deeper in the
same age as the dated
earth are generally older
rock. In this example,
than those found in layers
fossil B is 510 million 3. Paleontologists uncover
closer to the earth’s surface.
years old. Tiktaalik fossils and
In this example, fossil C is Fossil C
older than fossil B. determine their age.
545 mya
Older layers
take long for their patience to be rewarded: “Lit- older they are. Using a combination of both
erally inches,” Daeschler says, from where methods, scientists have determined that the
they’d been excavating before, they hit pay dirt. rocks where Tiktaalik was found are 375 mil-
The researchers determined that the fossils lion years old, which means Tiktaalik is that old
they found were 375 million years old—just the as well (Infographic 16.3).
right age to show transitional features—but how
did they know? Fossils are at least as old as the Setting the Stage for Life on Land
rocks that encase them. Since some types of The geologic time period that Shubin and
rocks can be dated directly by a method known Daeschler are interested in is known as the
as radiometric dating (described in Chapter 17), Devonian—roughly 400–350 million years
it is possible to determine the age of fossils ago. Great transformations were occurring dur-
embedded within them. If fossils are found ing the Devonian: jawed fishes, sharks, land
RELATIVE DATING
sandwiched in rock layers that cannot be plants, and insects all diversified in this period. Determining the age
directly dated, they can be dated indirectly by Because sea levels were high worldwide, and of a fossil from its
their position with respect to rocks or fossils of much of the land lay submerged under water, position relative to
layers of rock or fossils
known age, a technique called relative dating. the Devonian period has been called the age of
of known age.
Generally speaking, the deeper the fossils, the fishes.
328 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Back then, what is now the Canadian Arctic tinction. First appearing in the fossil record
had a warm, wet climate and a landscape veined about 400 million years ago, lobe-finned fish
by shallow, meandering streams. Early in the have sturdy fins with bony supports that resem-
Devonian period there was little plant growth, ble primitive limb bones.
and the world would have looked fairly brown Lobe-finned fish are thought to have evolved
and empty. By the middle of the Devonian, if in shallow streams, where rich plant material
you were standing on the bank of a stream you lured small fish and other creatures close to the
would have seen some of the first land plants, water’s edge. The lobe-finned fish likely used
the first forests, as well as the first inverte- their strong fins to touch the bottom of the
brates—spiderlike creatures and millipedes, streambed while maneuvering to catch prey. As
for example—crawling on land. Still, there Daeschler explains, it was the unique ecological
would have been no land-dwelling vertebrates opportunity afforded by shallow streams that
at this time: nothing with bony limbs, nothing enabled the lobe-finned fish to start developing
with a backbone or skull. features that were adaptive in shallow water. But
By the late Devonian, things were changing lobe-finned fish were still very far from being
quickly. By then, says Daeschler, “you had a true tetrapods. Tiktaalik, on the other hand, is
green flood plain, a green world.” It was this inching closer: “It looks like a fish in that it has
green world—a rich and productive ecosystem, scales and fins,” says Shubin, “but when you
with energy-rich leaf litter flowing into shallow look inside the skeleton you see how special it
streams—that set the stage for the move of ver- really is.”
tebrates onto land.
The physical challenges of living on land are The Fish That Did Pushups
very different from those in water. Water is Shubin and Daeschler were lucky: the fossils
dense and difficult to move through, but fish they found were so well preserved that they
glide smoothly through water thanks to a sleek were able to study Tiktaalik’s skeletal anatomy
shape, a muscular body, and flexible fins. By in detail, even seeing how the bones interacted
contrast, animals that walk on land have to cope and where muscles attached. From these fossil
with gravity. Air doesn’t support animals as they bones, they determined that Tiktaalik was a
move, so the bodies of land animals need a stur- predatory fish with sharp teeth, scales, and
dier structure. Animals on land can also dry fins. In addition to these fishy attributes, it had
out, which is dangerous for them because cells a flat skull reminiscent of a crocodile head and
need water to function. And, of course, taking a flexible neck (in other words, the skull was
in oxygen is different in land and in water. not rigidly fixed to the shoulders as it is in most
Of the many features that distinguish land fishes). To Shubin and Daeschler, the neck was
animals from fish, biologists have singled out one of the most surprising finds. Having a flex-
one as a key evolutionary milestone: no living ible neck meant that Tiktaalik could swivel its
fish has true limbs, that is, bony appendages head independently of its body, perhaps
INVERTEBRATE with wrists, ankles, and digits. Instead, they enabling it to catch a glimpse of predators
An animal without a have webbed fins. In most fishes, the fin bones sneaking up on it from behind or to hunt its
backbone.
are thin and splayed like the rays of a fan. These own prey. It also had the full-fledged ribs of a
TETRAPOD so-called ray-finned fishes include the familiar modern land animal, sturdy enough to sup-
An organism with four modern-day perch, trout, and bass. By contrast, port the animal’s trunk out of water even
true limbs, that is,
amphibians, birds, most reptiles, and mammals against the force of gravity.
bony appendages
with jointed wrists, all have two pairs of limbs, defining them as tet- But it is Tiktaalik’s fins that have made it
ankles, and digits—i.e., rapods (from the Greek for “four-footed”). famous. While possessing many features of a
mammals, While having limbs is a key feature distin- lobe-finned fish, Tiktaalik appears also to have
amphibians, birds, and
guishing tetrapods from fish, one small group of had a jointed wrist and fingerlike bones. From
reptiles.
fish—the lobe-finned fish—seems to blur this dis- the fossil pieces, Shubin and Daeschler were
able to create a model of how the bones would proved adaptive and were thus retained in the
have moved relative to one another, and they descendants of the organisms who first devel-
are now modeling these movements digitally. oped them. Then, when there was an opportu-
The models show that the bones and joints
were strong enough to support the body and
worked like those of the earliest known tetra- “This is a fish that can live in the shallows or even
pods—the early amphibians. “This animal was make short excursions onto land.” –Neil Shubin
able to hold its fin below its body, bend the fin
out toward what we think of as a wrist, and
bend the elbow,” explains Daeschler. In other nity to take advantage of a tantalizing new
words, it was a fish that could do a push-up. habitat—the land—the amphibious creatures
With this hybrid anatomy, Tiktaalik was not already had the skeletal “toolkit.”
galloping on land, of course. It probably lived For all its amphibian-like adaptations, Tiktaa-
most of the time in water, but Shubin and lik is still a fish because its limbs lack the true
Daeschler suspect that Tiktaalik may have jointed fingers and toes that define tetrapods.
used its supportive fins to pull itself out of the But it’s by far the most tetrapod-like of all the
water for brief periods. “This is a fish that can fishes so far discovered. Scientists have jok-
live in the shallows or even make short excur- ingly referred to it as a “fishapod” (Infographic
sions onto land,” says Shubin. The ability to 16.4).
crawl onto land would certainly have been a use- And that’s what makes Tiktaalik such an
ful trait in the Devonian, when open water was important find: it embodies a previously
a brutal fish-eat-fish world, whereas land was a unknown midpoint between fish and tetra-
predator-free paradise, full of nourishing bugs. pods. Such intermediate, or transitional, fos-
There was, of course, no forethought involved sils document important steps in the evolution
in this process. Fish did not develop limbs for of life on earth. They help biologists under-
the purpose of walking on land. Rather, limbs stand how groups of organisms evolved,
first evolved in shallow water, where they through natural selection, from one form into
330 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
another. And they confirm that Darwin’s the- relative positions?” To Darwin, this uncanny
HOMOLOGY
Anatomical, genetic, ory of descent with modification—which pre- similarity was evidence that all these organ-
or developmental dicts such intermediate forms—is correct. isms were related—that they share a common
similarity among ancestor in the ancient past.
organisms due to
A Fin Is a Paw Is an Arm Is a Wing The fact that all tetrapods share the same
common ancestry.
In On the Origin of Species, Darwin asked, forelimb bones, arranged in the same order, is
“What can be more curious than that the hand an example of homology—a similarity due to
of a man, formed for grasping, that of a mole common ancestry. Before Darwin, comparative
for digging, the leg of the horse, the paddle of anatomists had identified many such similari-
the porpoise, and the wing of the bat, should ties in anatomy; what they lacked was a satisfac-
all be constructed on the same pattern, and tory explanation for why such similarity should
should include similar bones, in the same exist. Darwin provided that explanation:
INFOGRAPHIC 16.4
Tiktaalik, an Intermediate Fossilized Organism
Tiktaalik possesses adaptations of both
fish and tetrapods. For all its amphibian-like Tetrapod-like Traits: for Life on Land
characteristics, Tiktaalik is still technically a fish
because its limbs lack true jointed fingers and
toes, a defining feature of tetrapods.
Acanthostega
Early tetrapod species
Head is long Neck is mobile, not
and flat. fused to shoulder.
Pectoral fins are weight-bearing Ribs are long and sturdy
with distinct, jointed wrist and to support the body on
fingerlike bones. land.
Eusthenopteron
Lobe-finned fish
INFOGRAPHIC 16.5
Forelimb Homology in Fish and Tetrapods
The number, order, and underlying structure of the forelimb bones are similar in all the groups illustrated below. The differences
in the relative width, length, and strength of each bone contribute to the specialized function of each forelimb. This anatomical
homology is strong evidence that these organisms all shared a common ancestor at some time in the distant past. The variations in
bone shape and function reflect evolutionary adaptations to different environments.
Fish: Tetrapods:
Manipulation
of objects
Weight-bearing on land/Flying
332 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 16.6
Vertebrate Animals Share a Similar Pattern of Early Development
We can identify homologous structures by tracing their embryological development. Some of our middle ear bones, for example,
are homologous with the jaw bones of reptiles and bones supporting gills in fish. We know this because all of these structures
develop from the pharyngeal pouches that appear in all vertebrate embryos early in development. This developmental homology is
strong evidence that all vertebrate animals are related by common ancestry. Genetic changes over time have introduced modifications
in later stages that give rise to distinct species with vast physical differences.
Early Embryos:
Human Cat Fish Snake Chick
Pharyngeal
pouches Early-stage embryos
of related organisms
share common
Post-anal tail structures.
Late Development:
Later in development,
these structures take
on species-specific
shape and function.
slightly altered bones, making them longer or ferent? Similar embryological structures are
thinner, for instance. When these modified further evidence that all vertebrates shared a
bones are helpful to an organism’s survival and common ancestor.
reproduction, the advantageous traits are Development helps us solve other evolution-
passed on to the next generation, and popula- ary conundrums as well, such as why reptiles
tions emerge that have these adaptations. This like snakes don’t have legs like other tetrapods.
“descent with modification” (Darwin’s phrase In fact, snake embryos do possess the begin-
nings of limbs, but these limb “buds” remain
rudimentary and do not develop into full-
“This is not just some archaic, weird branch of
fledged limbs (although you can still see stubby
evolution; this is our branch of evolution.” hindlimbs in some species of snake today). Such
—Neil Shubin vestigial structures, which serve no apparent
function in an organism, are strong evidence for
again) results in diverse organisms sharing com- evolution: these “useless” features are inherited
mon—homologous—structures and putting from an ancestor in whom they did serve a
them to different uses. function.
We can see homology not only in adult anat- Zooming in even further, to the molecular
VESTIGIAL omy, but in early development as well. Take a level, we find still more examples of homology—
STRUCTURES
look at early embryos of vertebrate animals as yet more evidence of common ancestry. Scien-
A structure inherited
from an ancestor that diverse as humans, fish, and chickens and you’ll tists have known since the 1960s that DNA is the
no longer serves a see that they all look remarkably similar (Info- molecule of heredity, and that it is shared by all
clear function in the graphic 16.6). Why should the embryonic stage living organisms on earth. Every molecule of
organism that
possesses it.
of a human resemble the embryonic stage of a DNA—whether from fish, maple tree, bacterium,
fish when the adults of each species look so dif- or human—is made of the same four nucleotides
Common ancestor of
chimpanzees and humans,
≈5–7 mya.
Common ancestor of
mice, chimpanzees, and
humans, ≈60–100 mya.
Common ancestor of
*Data presented for the CFTR region. pufferfish, mice, chimpanzees,
From Green et al., Nature 2003, and humans, ≈420 mya.
424:788–793.
(A, C, T, and G), and all organisms use the infor- DNA and Descent
mation encoded by those nucleotides to make While all living organisms share DNA and the
proteins in the same basic way, using the univer- genetic code, no two species will share the exact
sal genetic code (discussed in Chapter 8). Why same sequence of DNA nucleotides. That’s
should all living things use the same system of because (as described in Chapter 10) errors in
decoding genetic information? The best explana- DNA replication and other mutations are con-
tion is that this system was the one used by the tinually introducing variation into DNA
ancient ancestor of all living organisms, passed sequences (and the proteins they encode). Over
on to all of its descendants, and preserved time, neutral and advantageous mutations will
throughout billions of years of evolution. tend to be preserved, while harmful mutations
334 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
will tend to be selected against and eliminated. and can serve as a check on conclusions derived
In addition, much of our DNA is noncoding. from the fossil record or anatomy. As well, DNA
Because mutations in noncoding DNA have no is deepening our knowledge of how limbs
effect on an organism, they accumulate over evolved. Scientists have discovered that even
time. As mutations are passed on to descen- species that are only very distantly related share
dants, the number of sequence differences some of the same genes. Animals as seemingly
between the ancestor and its descendants different as humans and fruit flies, for example,
grows—slowly in the case of sequences coding use some of the very same genes to get their
for critical proteins whose structures are well heads on straight and their limbs in the right
adapted to their functions, and more rapidly in place. Learning how these genes work and how
the case of noncoding DNA. Closely related spe- changes in their DNA sequences can produce
cies will therefore have fewer DNA sequence dif- large-scale changes in body plan or limb struc-
ferences than species that are more distantly ture is a hot area of biology right now, familiarly
related. known as “evo-devo.”
For example, when scientists looked at one
specific region of DNA—the cystic fibrosis trans- Filling in the Gaps
membrane region, which contains both coding Asked what he thinks is most interesting about
and noncoding regions—they discovered that the discovery of Tiktaalik, Ted Daeschler
human DNA in this region is 99% identical to homes in on what he sees as a popular miscon-
chimpanzee DNA. The fact that the DNA of the ception about the fossil record—that it’s
two species is nearly identical reflects the fact “spotty” and “chaotic.” But that’s simply not
that humans and chimps share a common true, he says. Despite the fact that it does not
ancestor that lived relatively recently—just 5–7 record all past life, the fossil record is still “very
million years ago. By contrast, human DNA is good”—so good, in fact, that you can use it to
only 40% identical to the DNA of a mouse at this make and test predictions. You can, for exam-
same region, which makes sense given that ple, look at the fossil record of fish and tetra-
humans and mice share a common ancestor pods and—suspecting on the basis of anatomy
that lived between 60 and 100 million years ago. that the two groups are related—hypothesize
Even less sequence identity would be seen that an intermediate-looking animal must have
between a human and a toad, whose common existed at some point. Then you can go look for
ancestor—a lobed-finned fish— lived roughly 375 it. Daeschler refers to this process as “filling in
million years ago. The more distantly related the gaps,” and it’s exactly what he and Neil
two species are, the more sequence differences Shubin did with Tiktaalik. They knew, based on
in DNA sequences you will see. In essence, DNA the existing fossil record, when such a creature
serves as a kind of molecular clock: each addi- was likely to have existed, so then it was just a
tional sequence difference is like a tick of the question of where to look for it.
clock, showing the amount of time that has For Shubin and Daeschler, Tiktaalik is excit-
elapsed since the two species’ common ances- ing mostly because it shows that our under-
tor (Infographic 16.7). standing of evolution is correct: “It confirms
When combined with evidence from the fos- that we have a very good understanding of
sil record, anatomy, and development, molecu- the framework of the history of life,” says
lar data become a powerf ul tool for Daeschler. “We predicted something like Tik-
understanding evolution. As we’ll see in Chap- taalik, and sure enough, with a little time and
ter 17, DNA evidence is often a more reliable clue effort, we found it.” ■
to common ancestry than physical appearance,
336 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Chapter 16 Test Your Knowledge
2. Which of the following is most likely to leave a HINT See Infographics 16.4 and 16.5.
fossil?
a. a jellyfish j KNOW IT
b. a worm 6. Which of the following features of Tiktaalik is
c. a wolf not shared with other bony fishes?
d. a sea sponge (an organism that lacks a a. scales
skeleton) b. teeth
e. All of the above are equally likely to leave a c. a mobile neck
fossil. d. fins
e. none of the above
3. What can the fossil shown below tell us about
the structure and lifestyle of the organism that left 7. Tiktaalik fossils have both fishlike and tetrapod-
it? Describe your observations. like characteristics. Which characteristics are related
to supporting the body out of the water?
j USE IT
8. Tiktaalik fossils are described as “intermediate”
or “transitional” fossils. What does this mean? Why
are transitional organisms so significant in the
history of life?
j KNOW IT
15. You have three sequences of a given gene from
three different organisms. How could you determine
how closely the three organisms are related to one
another?
338 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Chapter 17 Life on Earth
Q & A: Evolution
j What You Will Be Learning
17.1 Unstable Elements Undergo Radioactive
Decay
17.2 Radioactive Decay Is Used to Date Some
Rock Types
17.3 Geologic Timeline of the Earth
17.4 The Geographic Distribution of Species
Reflects Their Evolutionary History
17.5 Movement of the Earth’s Plates Influences
Climate and Biogeography
17.6 How Many Species Are There?
17.7 Classification of Species
17.8 How to Read an Evolutionary Tree
17.9 DNA Defines Three Domains of Life: Bacteria,
Archaea, Eukarya
339
Chapter 17 Life on Earth
Q & A: Evolution
The history, classification, and phylogeny of life on earth
T
he modern theory of evolution draws result of genetic change. We can use evidence
two main conclusions about life on from geology, chemistry, paleontology, bio-
earth: that all living things are related, geography, comparative anatomy, and genetics
and that the different species we see to reconstruct the details of that evolutionary
today have emerged over millions of years as a history.
340 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
GEOLOGY
Q How old is the earth, and
how do we know?
When the Apollo 11 astronauts Neil Arm-
A strong and Buzz Aldrin returned to earth
from their historic 1969 moon walk, they car-
ried with them a cargo of lunar rock chipped
from the moon’s surface. Embedded within
these hunks of shimmering anorthosite lay
clues to the earliest history of our solar system,
including the planet we call home.
According to the nebular hypothesis, the The Genesis Rock, a sample of lunar crust from about
planetary objects in our solar system are the the time the moon was formed, was retrieved by
result of a single event: the collapse of a swirling Apollo 15 astronauts James Irwin and David Scott.
solar nebula, which formed both the sun and
the planets out of cosmic dust. Since all the plan-
ets were formed at roughly the same time, we that the age of the earth—and of the solar sys-
can date the age of the solar system by dating tem more generally—is 4.54 billion years, give
any planetary object within it. Of the many or take a few million years.
moon rocks obtained over the course of the six How are such rocks, extraterrestrial or
Apollo missions, the oldest have been calcu- earthly, dated? The most important method is
lated to be some 4.4 to 4.5 billion years old, radiometric dating, in which the amount of
which means that the earth is at least that old radioactivity present in a rock is used as a kind
as well. of geologic clock. When rocks form, the miner-
Why go to the moon to date the earth? With als in them contain a certain amount of radio-
the exception of a few meteorite battle scars, active isotopes—atoms of elements such as
the moon’s surface has remained uranium-238, potassium-40,
A visitor looks at a
largely intact over the course of and rubidium-87—that are
display in the Hall of Scientists estimate unstable and decay into other
Biodiversity at the its existence. In contrast, the
American Museum earth is a swirling ball of molten that the age of the atoms.
of Natural History in
lava that continuously churns earth—and of the Radioactive isotopes decay
New York City.
and digests its rocky outer crust. solar system more by releasing high-energy par-
Because of this perpetual churn- generally—is 4.54 ticles from the nucleus, a
ing, it is difficult to find original, change that causes one ele-
RADIOMETRIC
undisturbed rocks from earth’s
billion years. ment literally to transform into
DATING
The use of radioactive earliest period. The oldest another. For example, an atom
isotopes as a measure known intact piece of earth’s land surface, the of the radioactive isotope uranium-238 decays
for determining the Acasta Gneiss in a remote region of northern in a stepwise fashion into a stable atom of
age of a rock or fossil.
Canada, dates from 3.9 billion years ago. Some lead-206. The time it takes for half the isotope in
RADIOACTIVE of these ancient rocks contain minerals as old a sample to break down is called its half-life.
ISOTOPE
as 4.1 to 4.2 billion years. Different radioactive elements decay at differ-
An unstable form of
an element that While these values do not establish an abso- ent rates. Uranium-238 has a half-life of 4.5 bil-
decays into another lute age of the earth, they do provide a lower lion years, whereas potassium-40 has a half-life
element by radiation, limit: the earth is at least as old as the materials of 1.3 billion years. The half-life of carbon-14
that is, by emitting
energetic particles. that make it up. From these earth minerals and (which is used to date once-living, organic
moon rocks, as well as material from meteor- remains rather than rocks) is relatively short: it
HALF-LIFE
The time it takes for ites that have fallen to earth, scientists estimate decays to nitrogen-14 in just 5,730 years.
one-half of a
substance to decay.
CHAPTER 17: LIFE ON EARTH 341
INFOGRAPHIC 17.1
Unstable Elements Undergo Radioactive Decay
Radioactive isotopes are unstable versions of elements that undergo a process of radioactive decay, whereby they
emit energy and are converted to another element.
Uranium-238
Newly formed rock Same rock, Same rock, Lead-206
some time later later still
The half-life of uranium-238 is 4.5 billion years, meaning that it takes that long
for half the amount of uranium in a sample to decay to lead-206. Over time, rock
containing uranium-238 will have less radioactive uranium and more lead-206.
Because the isotopes decay at a known rate, ing the Grand Canyon in Arizona. Most fossils
they can be used to determine the age of the are found in sedimentary rocks.
materials in which they’re found (Infographic Rocks can also form suddenly as erupting vol-
17.1). canoes spew lava and ash over an area. When
As wind and water washed over rocks this molten debris cools and hardens, it forms
throughout earth’s history, they stripped off, or what is called igneous rock (“igneous” is from
eroded, particles and carried them to other the Latin word for “fire”) . Radiometric dating is
places. Sometimes the deposited particles were performed on igneous rocks. When the rocks
compressed over many years into new rock lay- form, the radioactive clock is set to zero; no
ers by water or by additional particles. Such products of radioactive decay are present. Over
rock, called sedimentary rock, can be seen in time, more and more radioactive decay will
the distinctive striations, or stripes, marking occur, and more and more stable product will
successive layers of sandstone and limestone be present. By measuring the ratio of a radioac-
found in former riverbanks like those surround- tive isotope to stable product present in a layer
342 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 17.2
Radioactive Decay Is Used to Date Some Rock Types
Some rock types, like those created during volcanic eruptions,
Volcanic eruptions
contain radioactive minerals that can be used to determine
deposit rock and ash
the age of the rock. Because the element uranium-238 decays to
that is 100% uranium-238 :
lead at a constant rate, the age of rock layers containing these
0% lead.
minerals can be calculated by measuring the ratio of uranium-238
to lead-206 in the mineral sample.
Percent Uranium-238
1.3 billion years ago, a
100%
volcanic eruption deposited
1.3 billion year old rock has decayed
this layer of rock and ash.
85% to 85% uranium-238 : 15% lead.
75%
2.4 billion year old rock has decayed
2.4 billion years ago, a 65% to 65% uranium-238 : 35% lead.
volcanic eruption deposited
this layer of ash. 50%
Constant rate of
uranium-238
decay.
25%
of igneous rock, scientists can calculate its age did. Where did this life come from? How did it
(Infographic 17.2). Sedimentary rocks, on the start? The precise details of the transition from
other hand, cannot be dated by radiometric nonliving to living are lost in the mists of time.
methods because they are made up of particles We can now only hypothesize how that transi-
from rocks of various ages. tion might have occurred.
Dating rocks by radioactive isotopes is quite Scientists have offered a number of hypoth-
precise and can be confirmed by a number of eses to explain how life began on earth, includ-
methods. For example, minerals taken from lay- ing the idea that it arrived here fully formed on
ers of rock in Saskatchewan, Canada, were an asteroid or meteorite from outer space. Oth-
dated by three methods: the potassium-argon ers hypothesize that life emerged in stages over
method yielded an age of 72.5 million years; the time, as inorganic chemicals combined into suc-
uranium-lead method, an age of 72.4 million cessively more-complex molecules, including
years; and the rubidium-strontium method, an ones that were capable of self-replicating—that
age of 72.54 million years. is, of copying themselves. A landmark experi-
ment lending support to this hypothesis was
BIOCHEMISTRY performed by University of Chicago chemist
Harold Urey and his 23-year-old graduate stu-
Q When and how did life begin? dent Stanley Miller in 1953.
At some point in the earth’s distant past, Urey and Miller hypothesized that they
A life did not exist. Then, at a later point, it could synthesize organic molecules—the
Land
plants Amphibians
Land
arthropods
3,500 million years ago 2,000 580 540 530 500 438 400 367 360
First
Life in Water
MASS EXTINCTION
MASS EXTINCTION
multicellular Cambrian
organisms explosion
First Placoderm
Trilobite
vertebrates
Oldest First Pteraspis
prokaryote eukaryotes Coiled
microfossil Nautiloid Nautiloid
Archean Proterozoic Cambrian Ordovician Silurian Devonian
344 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
PALEONTOLOGY surface cooled down about 3.8 billion years
Q What was life like millions of ago—to a balmy 45°C to 85°C (113°F to 185°F)—
could it support life.
years ago? The oldest known fossils date from some 3.5
Humans weren’t around millions of billion years ago, when earth’s climate was very
A years ago, so we have no cave paintings different from what it is today. The atmosphere
or other records to help us picture what life lacked substantial oxygen (O2), churning instead
on earth was like. Most of what we know about with ammonia, methane, and hydrogen. In this
past life on earth comes from fossils—the oxygenless world, the only organisms that could
preserved remains of once- thrive were unicellular prokary-
liv ing organisms, such as The oldest known otes that used these other gases
Tiktaalik, which is discussed in as a fuel source. Only with the
fossils date from
Chapter 16. emergence and proliferation of
While each fossil find is a trea-
some 3.5 billion u n icellu la r photosy nt het ic
sure, any single specimen years ago. organisms, between 3.0 to 2.5
reveals only a tiny slice of geo- billion years ago, did oxygen
logic history. What paleontologists really want begin to accumulate in the atmosphere, open-
to understand is how each fossil fits into the ing the door for more-complex eukaryotic
larger story told by the fossil record. By dating organisms to evolve.
the rock layers, or strata, near where fossils are The first multicellular, eukaryotic organisms
buried, scientists can determine when different to make use of this oxygen were green algae,
organisms lived on the earth. Combined with which appeared 1.2 billion years ago. Soft-
knowledge from geology, chemistry, and biol- bodied aquatic animals followed, about 600
ogy, the fossil record has enabled scientists to million years ago, but it is only from 545 million
construct a geologic timeline of life on earth years ago, during the Cambrian period, that we
(Infographic 17.3). see fossil evidence of a truly diverse animal
The geologic timeline shows that during the world. During the Cambrian explosion, as this
4.6 billion years or so that the earth has been event is known, ocean life swelled with a mind-
around, its geography and climate have gone boggling array of strange-looking creatures,
through dramatic changes. For the first few mil- including Opabinia, an organism with five eyes
lion years or so it was a molten ball of lava con- and a snout resembling a vacuum-cleaner
tinually bombarded by meteorites. Not until the hose, discovered in fossils from this period.
MASS EXTINCTION
MASS EXTINCTION
MASS EXTINCTION
Pteranodon Bats
Winged Bee
Coelurosauravus Birds Early
insects
(Gliding reptile) primates Homo
Dimetrodon Flowering habilis
Reptiles plants
Mammals Grasslands
Tyrannosaurus rex
350 270 248 220 208 205 140 75 65 60 50 2
MASS EXTINCTION
MASS EXTINCTION
MASS EXTINCTION
Turtle
Mesosaurus Primitive
Mosasaur whale
Fish
Crab
Diplocaulus
Cretaceous 144 Dinosaurs diversify. Cone-bearing plants dominate, while flowering plants
take over in many habitats. Era ends in mass extinction of dinosaurs.
Silurian 439 Seedless plants, primitive insects, and soft-bodied animals appear on land.
The first organisms to colonize land were resources opened up for the survivors, who
primitive plants, appearing roughly 450 mil- spread and diversified in a phenomenon
lion years ago. By 350 million years ago, forests known as adaptive radiation. Among these
of seedless plants covered the globe. were reptiles, who thrived in the hot, dry
EXTINCTION
Then, 290 million years ago, life was drasti- climate of the Triassic period. The most
The elimination of all
cally cut down: roughly 95% of living species famous group of reptiles, the dinosaurs, domi- individuals in a
were suddenly extinguished in a mass die- nated the land for nearly 200 million years, species; extinction
off known as the Permian extinction. The until they died out in another mass extinction may occur over time or
in a sudden mass die-
extinction wasn’t bad for all organisms, at the end of the Cretaceous period, 65 million off.
though; some f lourished as space and years ago.
346 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
BIOGEOGRAPHY
Penguins live primarily in Antarctica. The earliest penguin fossils were found near New Zealand
and date from a time when New Zealand was physically close to Antarctica. Penguins were
able to distribute widely in the southern hemisphere with the movement of the tectonic plates.
isolated from each other, as if on different life- persuasive evidence that the two species share
boats cast out to sea. Because the animals we a recent common ancestor. But common
know today as penguins and polar bears ancestry is not the only reason that two species
evolved from their ancestors after the split of might appear similar. Even species that are not
the northern and southern landmasses, they closely related may share similar adaptations as
are found today at different ends of the earth a result of independent episodes of natural
(Infographic 17.5). selection, a phenomenon called convergent
evolution.
SYSTEMATICS Cold-dwelling fish provide a good example. CONVERGENT
In the frigid waters of the Antarctic Ocean, fish EVOLUTION
Q Are creatures that look alike have a unique adaptation that keeps them from The process by which
always closely related? becoming ice cubes: their blood is pumped full organisms that are
not closely related
Polar bears share many traits with their of “antifreeze.” Fish antifreeze is actually mol-
A brown-bear cousins—both species are ecules called glycoproteins that lower the tem-
evolve similar
adaptations as a
recognizable as bears despite obvious differ- perature at which body fluids would otherwise result of independent
episodes of natural
ences in color. The fact that polar bears resem- freeze by surrounding tiny ice crystals and
selection.
ble brown bears in important respects is keeping them from growing. Arctic fish, at the
348 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
earth’s other pole, also have antifreeze proteins, the same functional results. Sometimes similar
but the genes that code for them are different. environmental challenges will favor the same
adaptations time and time again.
INFOGRAPHIC 17.5
Movement of the Earth’s Plates Influences Climate and Biogeography
Earth’s landmasses are on plates
that float on earth’s upper mantle
and crust. Over geologic time, these
plates have moved with respect The movement of the plates
0
to one another, affecting caused changes in the
the climate as well as the environments of the isolated
Cenozoic
135 Laurasia
Over time, the plates shifted to
Mesozoic
Animals - Fungi
Invertebrates 72,000
1,272,000
Animals - Plants
Vertebrates 270,000
Total Classified Species: 52,000 Protists Bacteria and Archaea
Approximately 1.8 million 80,000 4,000
Estimated Species on Earth:
5–30 million
forests. But as the wide range of the estimate photosynthesize, whether or not they have
implies, it’s hard to put an exact number on the four legs and fur.
number of species on earth—there are simply By studying the many similarities and differ-
too many to count. Moreover, new species are ences among organisms, taxonomists have come
continually being discovered. In 2007, for exam- up with a system for sorting organisms into a
ple, scientists identified 11 new species of plants series of eight progressively narrower categories:
and animals in a remote part of Vietnam. And a domain, kingdom, phylum, class, order, family,
recent study by researchers at Arizona State genus, species. As you move down the list, from
University found that 17,000 new eukaryotic domain to species, the categories get increasingly TAXONOMY
species were discovered in 2006 alone, more exclusive, until finally only one member is The process of
identifying, naming,
than half of them insects (Infographic 17.6). included. The genus and species names provide
and classifying
With so many species out there, how do sci- the scientific name for every living organism. organisms on the
entists keep track of them all? The process by Because the scientific name is in Latin, it can be basis of shared traits.
which scientists systematically identify, name, easily recognized in many languages.
VERTEBRATES
and classify organisms is called taxonomy. Take humans, for example. Humans are Animals with a rigid
(Taxonomy is part of the broader study of sys- eukaryotes, members of the domain Eukarya. backbone.
tematics, or the study of biological diversity of They are also animals, members of the kingdom
MAMMALS
life on earth.) Animalia. Within the animal kingdom, they
Members of the class
Taxonomy is an attempt to impose a human belong to the phylum Chordata, a group that Mammalia; all
sense of order on this vast array of species, cat- includes the vertebrates, animals with a rigid members of this class
egorizing them on the basis of features they backbone. Further, humans are mammals, have mammary
glands and a fur-
have in common, such as whether their cells members of the class Mammalia; they share
covered body.
are eukaryotic or prokaryotic, whether they with all members of this class mammary
350 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
glands and a body that is covered with fur. Our scientific name—made up of our genus and
Humans belong to the Primate order, which species names—is Homo sapiens (“wise man”)
also includes monkeys, apes, and lemurs. And (Infographic 17.7).
humans are members of the Hominidae family, Classification would seem to be a simple
and so are closely related to their fellow homi- matter—just observe, measure, and sort. But
nids: chimpanzees, gorillas, and orangutans. deciding which category an organism belongs
INFOGRAPHIC 17.7
Classification of Species
Organisms are classified into groups that are increasingly exclusive. In the broadest category (Animal Kingdom), all animals
are included. Closely related organisms are grouped based on morphological, nutritional, and genetic characteristics. There
are far fewer organisms in an order than in a phylum.
Kingdom Kingdom
Animals Animals
Phylum Phylum
Chordata Chordata
Class Class
Mammalia Mammalia
Order Order
Primates Carnivora
Family Family
Hominidae Mustelidae
Genus Genus
Homo Martes
Species Species
Homo sapiens Martes pennanti
Branch: Process
of natural selection Node: This is the last
leading to new species common ancestor of
or groups of species the organisms above
this point in the tree
e (in this case, dinosaurs
m
Ti and birds).
in can sometimes be tricky, as the example of Phylogenetic trees can be drawn in a number
convergent evolution has shown. Sometimes, to of ways, but most have certain features in com-
properly classify organisms, scientists have to mon. At the base, or root, is the common ances-
look a little deeper. tor shared by all organisms on the tree. Over
time, and with different selective pressures, dif-
CLASSIFICATION AND PHYLOGENY ferent groups of organisms diverged from that
common ancestor and from one another, lead-
Q Is a crocodile more closely ing to separate branches on the tree. The points
related to a bird or to a lizard? on the tree at which these branch points occur
The fact that all land vertebrates have four are called nodes. A node represents the com-
A limbs and the same forelimb bones indi- mon ancestor shared by all organisms on the
cates that they all share a common ancestor. But branch above that node. At the very tips of the PHYLOGENY
how precisely are they related? In other words, branches we find the most recent organisms in The evolutionary
who’s more closely related to whom? Scientists that lineage, including living organisms and history of a group of
organisms.
want not only to categorize organisms, but also organisms that became extinct. We can thus
to have those categories reflect phylogeny, the establish relationships between living organ- PHYLOGENETIC
actual evolutionary history of the organisms. isms (at the tips of the branches) based on the TREE
Biologists represent this history visually using ancestors they share. The more recently two A branching tree of
relationships showing
a diagram called a phylogenetic tree, which groups share a common ancestor, the more
common ancestry.
is similar in some respects to a family tree. closely they are related (Infographic 17.8).
352 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
A phylogenetic tree is a visual representation gene that is found in all living organisms, such
of the best hypothesis we currently have for how as the ribosomal RNA (rRNA) genes.
species are related. The evidence for a phyloge- Sometimes the new genetic information
netic tree comes from many sources, including yields surprises. Modern genetic evidence
the fossil record, physical traits, and shared shows, for example, that crocodiles are more
DNA sequences. For many years, biologists closely related to birds than they are to lizards,
relied solely on observable physical or behav- appearances notwithstanding. Genetics, you
ioral features to construct evolutionary trees. might say, is shaking the evolutionary tree.
But with the genetic revolution, it’s become
An early version of the common to include DNA evidence. Typically,
tree of life drawn in 1866 researchers compare sequence differences in a CLASSIFICATION AND PHYLOGENY
by E. H. P. A. Haeckel
Q How many branches does
the tree of life have?
Since each living species sits on its own
A branch in a phylogenetic tree, the com-
plete tree of life has as many branches as there
are species in the world. Today’s species are like
thin twigs in the upper branches of an enor-
mous tree. Closer to the bottom of the tree,
nearer to the ancient trunk, however, we find
significant forks. Just how many forks there are
at the bottom of the tree is a question that has
been debated for decades.
Before the 18th century, biologists divided liv-
ing things into just two main categories: animals
and plants. This classification was based on
whether an organism moved around and ate or
did not move around and eat. By the mid-19th cen-
tury, use of the microscope had revealed a whole
new world of microscopic organisms, and so a
third branch was added to life’s tree: protists.
By the 1960s, taxonomists realized that even
three such branches did not fully capture the
diversity of life; many organisms—such as fungi—
didn’t fit neatly into any of these groups, and so
another classification scheme was proposed.
This one grouped all living organisms into five
large kingdoms on the basis of how they looked
(both anatomically and microscopically) and
how they obtained their food. The five kingdoms
were Animalia, Plantae, Fungi, Protista, and
Monera. Protista comprised mostly single-cell
eukaryotic organisms (such as the amoeba), and
Monera included all prokaryotic organisms
(such as bacteria).
Yet even this revised classification scheme
eventually had to be overhauled as more infor-
Gram Methanococcus
Halophiles
positives Plants
Proteobacteria
T. celer
Ciliates
Cyanobacteria Thermoproteus
Flagellates
Planctomyces
Pyrodicticum
Trichomonads
Bacteroides
Cytophaga
Microsporidia
Thermotoga Diplomonads
Aquifex
Common Ancestor
mation became available. In the 1970s, genetic points in the trunk of the evolutionary tree.
DOMAIN
studies by Carl Woese revealed that, on the The original kingdom Monera is now divided The highest category
basis of on genetic relatedness, not all prokary- into two domains, Archaea and Bacteria. in the modern system
otes could be lumped together; likewise, pro- Within the domain Eukarya, Animalia, Plan- of classification; there
are three domains—
tists were too genetically diverse to be put in tae, and Fungi remain recognized kingdoms,
Bacteria, Archaea, and
one category. Consequently, scientists now but the protists (former members of the king- Eukarya.
group organisms into one of three large dom Protista) are dispersed across the domains
domains—Bacteria, Archaea, and Eukarya— of life, on the basis of DNA evidence (Infographic
which represent three fundamental branch 17.9). ■
354 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Summary
Q The age of the earth and its study of which is known as
rock layers can be determined by biogeography.
measuring the amount of Q Convergent evolution is the
radioactive isotopes present in evolution of similar adaptations
certain types of rocks, a method in response to similar
known as radiometric dating. environmental challenges in
Q Life on earth may have groups of organisms that are not
emerged in stages, as inorganic closely related.
molecules combined to form Q Life is astoundingly diverse.
organic ones in the primordial Current estimates of the total
soup, and as these were number of species on earth range
incorporated into lipid bubbles to anywhere from 5 to 30 million, of
form cells. which 1.8 million have been
Q Using geological evidence and formally described.
the fossil record, paleontologists Q Biologists sort organisms into
have been able to construct a a series of nested categories
geologic timeline of life on earth. based on shared anatomical and
Q Earth’s history can be divided genetic features: domain,
into important eras and periods. kingdom, phylum, class, order,
Dinosaurs, for example, lived family, genus, species.
primarily from 250 to 65 million Q The scientific name of an
years ago, during the Mesozoic organism is given by its genus
era, from the Triassic through the and species names (for humans
Cretaceous periods. it is Homo sapiens).
Q The history of life on earth is Q Both physical evidence and
marked by repeated extinctions genetic evidence are used to
and adaptive radiations, a understand evolutionary history,
phenomenon of intermittent or phylogeny. Branching trees of
rather than steady change common ancestry are used to
known as punctuated represent that history visually.
equilibrium.
Q On the basis of DNA evidence,
Q Ancient movement of earth’s all living organisms can be
major landmasses affected classified into one of three
the eventual distribution of domains: Bacteria, Archaea, or
species around the globe, the Eukarya.
356 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
CLASSIFICATION AND 17. Which number on the tree below shows the
most recent common ancestor of humans and corn?
PHYLOGENY
Categorizing the many species on earth and Protozoan Ciliate
understanding how they are related is a challenging
task, made easier by genetic information.
Corn
HINT See Infographics 17.6–17.9.
2.
j KNOW IT
13. Which of the following is not a domain of life? 3.
a. Animalia
b. Eukarya Human
1.
c. Bacteria 4.
d. Archaea
e. Plantae Cow
f. Neither a nor e is a domain of life.
14. Put the following terms in order, from most Plasmodium (Malaria)
inclusive (1) to least inclusive (5).
domain _____ a. 1
species _____ b. 2
kingdom _____ c. 3
genus _____ d. 4
phylum _____ e. Humans and corn do not share any ancestors.
j USE IT
16. Why was the classification of the kingdom
Monera split into two domains? What are these two
domains?
Lost City
j What You Will Be Learning
18.1 Lost City Hosts Unique Microscopic Life
18.2 Investigating Life in Lost City
18.3 Prokaryotic Cells Are Small and Lack
Organelles
18.4 Prokaryotes Are Abundant and Diverse
18.5 Bacteria and Archaea, Life’s Prokaryotic
Domains
18.6 Exploring Bacterial Diversity
18.7 Exploring Archaeal Diversity
18.8 Energy from the Earth Fuels Life at Lost City
359
Chapter 18 Prokaryotic Diversity
Lost City
Scientists probe life’s origins in an undersea world
of extreme-loving microbes
G
retchen Früh-Green’s heart had never The next day, the mission’s chief scientist,
beat so fast. Hunkered in the control Deborah Kelley and two members of the team
room of the research ship Atlantis, she dove in a submersible to the site, which lies at
was monitoring live video streaming a depth of 2,600 feet on an undersea mountain
up to the ship from a camera swimming 2,100 in the middle of the Atlantic Ocean. There,
feet below. Strange white shapes began to they found a dense “cityscape” of rocky spires,
appear in the blackness of her stretching across roughly six
screen. As the camera panned, A dense football fields of dark seafloor. It
an underwater landscape of was an uncharted world no one
“cityscape” of
ghostly white towers suddenly had known existed. Kelley
came into focus. The huge lime- rocky spires, Lost named the undersea world Lost
stone structures, which resem- City stretches City. The tallest tower, measur-
bled the stalagmites found in across a distance ing 200 feet, she dubbed Posei-
caves, loomed above an other- of roughly six don, after the Greek god of the
wise empty seaf loor. Früh- sea.
Green, a geologist with the
football fields of Subsequent research has
Institute for Mineralogy and dark seafloor. shown that each tower is a type of
Petrology in Zurich, Switzer- underwater chimney, or spring,
land, knew immediately that she was looking known as a hydrothermal vent. As rocks from
at something special, and raced to tell her col- the earth’s crust come in contact with seawater,
leagues. “It was really quite exciting,” she said. they react chemically, giving off a steady stream
“It was late at night and kind of woke us all up.” of heat and combustible gas that seeps out of
360 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
each vent. The resulting fluid is highly caustic, team of scientists who are exploring Lost City’s
with a pH of 9–11—similar to that of drain mysteries.
cleaner—and temperatures as hot as 90°C An extreme and seemingly inhospitable envi-
(194°F). ronment, the towers of Lost City are nonethe-
Though deep-sea hydrothermal vents had less home to a surprising number of life forms,
been discovered before, the ones at Lost City some of them unlike any seen anywhere else on
were unique in their chemistry and in the type earth. Most prevalent are dense layers of unicel-
of life they support. Nothing like them had ever lular microbes that coat the towers, inside and
been seen. “Rarely does something like this out. Microbial life exists pretty much every-
come along that drives home how much we still where on earth—in frozen glaciers, in radioac-
have to learn about our own planet,” said Kelley, tive dirt, in the intestines of animals—yet the
an oceanographer at the University of Washing- microbes at Lost City have earned the fascina-
ton in Seattle, who now leads the international tion of scientists.
North America
Lost City
Mid-Atlantic Africa
Ridge
362 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 18.1
50 people—scientists and researchers, pilots,
Lost City Hosts Unique Microscopic Life engineers, and ship crew—works around the
clock to orchestrate dives and obtain specimens
The hydrothermal vents of Lost City are huge rock chimneys. Scalding for research. A stable of sophisticated robotic
fluid with an extremely basic pH flows out of the tops of these chimneys.
assistants aids the effort.
Temperatures cool farther down each tower and are cooler yet at their bases.
The towering size and range of temperatures within a single Lost City spire Researchers dive to the site in Alvin, a tiny
mean it can host a variety of unique microbial communities. three-person submersible craft. Each trip to
the murky depths takes about 30 minutes and
Lost City microbes
is a risky descent into dark, uncharted waters.
This isn’t flat seafloor, after all; the Lost City
towers are like tall buildings, some as high
as 18 stories. Members of the team compare
the journey to flying through New York City
in a helicopter at night with no lights. It’s
well worth the effort, though: “All the time
you’re looking at something that nobody’s ever
looked at before, and that’s really cool,” says
Unique microorganisms live on Brazelton.
and in the carbonate chimneys in Upon reaching their destination, the research-
the hot, high-pressure, basic ers begin the work of collecting specimens,
environment at Lost City. using a pair of remotely operated mechanical
vehicles, Jason and Hercules. Both Hercules and
Jason have robotic arms that are used to collect
rock samples. But that’s easier said than done:
Exploring the Deep think of the arcade game in which you try to grab
Since Lost City was first discovered in 2000, a toy with a shaky mechanical claw. Now imag-
researchers have organized three exploratory ine doing that under water, remotely, while
trips to the site. During each of these month- strong ocean currents blow your claw around.
long expeditions, a team of more than The chalky limestone prizes can also be quite
Collecting Samples:
Various types of life are collected from the surface of the Lost City spires and surrounding fluid. Collection is painstakingly completed
with the use of robotic claws and suction devices that move samples into collection boxes for transport to the surface.
Processing Microbes:
Once Lost City microbe samples arrive in the laboratory on board Atlantis they are
processed so that each organism can be grown in a laboratory culture and then identified.
364 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Jason, a remotely operated mechanical assistant
used on the exploratory trips to Lost City.
What prokaryotes lack in size they make up As their numbers testify, prokaryotes are an
for in numbers. There are more prokaryotes in extraordinarily successful product of evolution.
a handful of dirt than there are plants and ani- From fossil evidence, we know that prokaryotes
mals in a rain forest. More prokaryotic organ- were the first colonizers of our planet, and for
isms live on and in you right now than there are nearly 2 billion years were its only life form. Hav-
human cells in your body. At Lost City, up to 1 ing first evolved nearly 4 billion years ago, pro-
billion such prokaryotic organisms inhabit karyotic organisms have had plenty of time to
each gram of chimney rock, forming mucus- adapt to a wide range of environments, includ-
like biofilms several centimeters thick. It looks ing many that would kill most eukaryotes. In
like the chimneys got sneezed on, says fact, prokaryotes are almost endlessly adaptive
Brazelton. and can thrive just about anywhere. At another
INFOGRAPHIC 18.3
Prokaryotic Cells Are Small and Lack Organelles
Prokaryotic cells are much smaller than eukaryotic cells and
do not have the same internal organization. Prokaryotic cells
lack organelles, instead carrying out all cellular functions in
one central space. The single, circular DNA molecule
floats freely in the cytoplasm.
Prokaryotes are about
the size of a eukaryotic
Prokaryotic Organisms: mitochondrion…
• Typically single cells
• No organelles
• Single, circular DNA molecule
not contained in a nucleus
Ribosomes
Chromosome
INFOGRAPHIC 18.4
Prokaryotes Are Abundant and Diverse
Even in seemingly inhospitable environments, there can be large numbers and many different types of prokaryotic microorganisms.
Environment: freezing, Environment: high-salt, Environment: no oxygen, moist, Environment: dry, high-pressure,
high-pressure, low-nutrient, low-nutrient strict 37˚C low-nutrient
low-oxygen Organism trait: photosynthetic Organism trait: metabolize sugars Organism trait: metabolize coal
366 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 18.5
Bacteria and Archaea, Life’s Prokaryotic Domains
Two of the domains of life, Bacteria and Archaea, have prokaryotic cells, but they each have distinct evolutionary histories,
with Archaea being genetically closer to Eukarya than to Bacteria. The genetic differences between Bacteria and Archaea
translate into a variety of structural and functional adaptations.
Thermotoga
Diplomonads
Aquifex
Common Ancestor
it’s the archaea that are most interesting to For many years all prokaryotes were lumped
researchers. That’s because the archaea are together into one large group—the kingdom
doing things that even bacteria can’t do. Monera—a classification based largely on their cell
At Lost City, bacterial populations congregate structure. Then, in the late 1970s, Carl Woese and
on the outsides of the vents, where temperatures his colleagues at the University of Illinois made the
are relatively mild and where oxygen is present surprising discovery that not all prokaryotic organ-
in the seawater. Archaea, by contrast, are found isms are genetically similar enough to be classified
only inside the vents, where temperatures are as a single group. His work established an entirely
hottest and where there is no oxygen. So far, just new branch of prokaryotic organisms, the Archaea.
two species of archaea have been detected in this While most archaea don’t look that different from
environment. “The conditions are so extreme bacteria under the microscope—both are unicel-
that they’re the only thing that has been able to lular prokaryotes—genetically they are as different
survive,” says Brazelton. Because of their prefer- from bacteria as humans are. In other words, they
ence for such extreme environments, archaea represent a distinct evolutionary domain of life.
have been nicknamed “extremophiles.” Together, the domains Bacteria and Archaea rep-
As intriguing as these extreme-loving organisms resent a very large slice of the total diversity of life
are, however, they weren’t even recognized as a on earth—they are two of life’s three domains (Info-
distinct evolutionary group until quite recently. graphic 18.5).
Bacteria can feed on more than just sunlight rium that lives and feeds inside the light organs
SYMBIOSIS
and carbon dioxide. Certain autotrophic bacte- of certain species of squid. The glow-in-the- A relationship in which
ria, including those living at Lost City, can dark Vibrio creates light beneath the squid and two different
obtain energy directly from geological sources helps obscure the shadow that the squid might organisms live
together, often
such as inorganic gases pouring out of hydro- cast on a moonlit night, making it less notice- interdependently.
thermal vents—making them among the few able to its prey as it hunts.
368 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 18.6
Exploring Bacterial Diversity
Bacteria live in every imaginable place on earth and have a diverse array of lifestyles. Within this domain,
subgroups can be established based on shared evolutionary history, as reflected by genetic relationships.
Symbiosis Pathogen
Fermentation Flagella
Archaea Eukarya
Unfortunately, not all bacteria are beneficial harm their hosts. Such toxins can either be
to the host. While the vast majority of bacteria part of the bacterial cell itself or secreted
PATHOGEN do not cause human disease, some do. Bacteria by the bacterium. For example, the bacterium
A disease-causing and other organisms that cause disease are Staphylococcus aureus secretes a potent toxin
agent, usually an
organism. known as pathogens. Many pathogenic bacte- that causes severe gastrointestinal discom-
ria cause disease by producing toxins that fort in its host (as anyone who has had food
Streptococcus mutans, for example, produces a Some archaea are halophiles, or “salt lov- ARCHAEA
capsule that allows it to adhere to teeth, where ers,” and prefer a home saturated in salt, which One of the two
it forms the plaque that can lead to cavities. would shrivel most other living things. Their domains of
prokaryotic life; the
For all their impressive diversity and abun- presence is detectable by the colorful pigments
other is Bacteria.
dance, bacteria are far from the totality of pro- they produce—bright reds, yellows, and pur-
370 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
ples—as seen in salt ponds in San Francisco Bay ancient forms of metabolism on earth. Scien-
(Infographic 18.7). tists who study the origin of life believe that
Archaea’s affinity for such extreme environ- the first organisms were likely autotrophs
ments is suggestive of their evolutionarily that obtained their carbon from carbon diox-
ancient roots. The early earth was a lot warmer ide, using hydrogen as an energy source and
than it is now, and it’s long been a question how emitting methane as a by-product—in other
living things could withstand the heat that pre- words, doing exactly what certain archaea do
vailed. If the archaea at Lost City are any indi- today.
cation, they would have done just fine. More recently, scientists studying Lost City
In addition, some researchers suspect that have suggested that the archaea found there
methanogenesis may be among the most may be able to survive by consuming rather
INFOGRAPHIC 18.7
Exploring Archaeal Diversity
Archaea are sometimes known as “extremophiles.”
They live in diverse environments, often with very Methanogens
harsh conditions. Like the Bacteria, the Archaea
can be subgrouped according to genetic
relationships.
Methanopyrus kandleri—
Lives in ocean hydrothermal
Halophiles vents. Produces methane
as a by-product of its
energy-converting
metabolic pathways.
Halobacterium—
Lives in places with
high salt concentrations,
such as the San Francisco
Bay evaporation ponds.
Hyperthermophile
Sulfolobus—
Grows at extremely
high temperatures
Archaea Eukarya
(80°–100°C), as in
Grand Prismatic
Spring (Volcanic), Bacteria
Yellowstone
National Park.
Hydrogen gas
H2
Carbon in
rock and water
Heterotrophic Archaea
Methane
CH4 Anaerobic Archaea
“Eat” Methane
Mantle Some heterotrophic
rock Methane archaea get energy by
CH4 consuming methane in the
absence of oxygen.
Abiotic Synthesis of
Carbon Molecules Hydrogen gas
Methane and other simple organic H2
molecules are formed spontaneously
from carbon in the rock and
hydrogen gas.
372 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
necessary to assemble living things come from? is at least 1.5 million years old. And geological
Lost City provides an important clue. reactions like those at Lost City were likely more
The hydrothermal vents at Lost City are common and more widespread during earth’s
driven by a geochemical process called serpen- early history than they are today. Back then,
tinization, which occurs any time a particular rocks from the interior of the earth—the man-
type of rock from the earth’s mantle comes in tle—were much closer to the surface than they
contact with seawater. The reaction generates a are now, which means their reaction with sea-
lot of heat, releases hydrogen gas, and—when water would have been more common. A jour-
this hydrogen reacts with carbon from rocks or ney to Lost City is thus like a journey back in
seawater—produces hydrocarbons such as time, to earth’s primordial past.
methane and simple organic molecules. All this Lost City may even provide a clue to life
happens completely abiotically—that is, without beyond earth. The rocks that cause serpentini-
the help of living things. Such an environment zation are quite common in the solar system.
would have been an ideal place for life to begin, They are all over the surface of Mars, for exam-
says Brazelton. “You have energy and organic ple, and researchers suspect that the chemical
compounds and liquid water all in a warm spot reaction might be occurring right now beneath
. . . that’s a great place where you might imagine the surface of Mars, where recent evidence sug-
life could have got started.” gests that methane is being produced. NASA is
therefore extremely interested in Lost City as a
“You have energy and organic compounds and way to understand potential life on Mars (Chap-
ter 2).
liquid water all in a warm spot . . . that’s a great Ironically, scientists know more about the
place where you might imagine life could have got surface of Mars than they do about the ocean
started.” –Bill Brazelton floor of our own planet. Ocean covers 70% of
earth’s surface, yet much of it remains unex-
Lost City may also help to explain the chicken- plored. If Lost City is any indication, many sci-
and-egg problem posed by the origin of life: entific treasures await the patient explorer.
organic molecules are needed to build living “[Lost City] is a good example of what we really
things, but living things are generally the source don’t know and what there is to still discover on
of organic molecules. So which came first, the the sea floor”, says geologist Früh-Green.
chicken or the egg? “I think a big clue to the If life on earth did begin at hydrothermal
chicken-and-egg problem is that you don’t need vents like those at Lost City, then it could mean
life to make organic compounds,” says Brazel- that these extreme-loving prokaryotes are the
ton. “We are studying environments right now descendants of the most ancient form of life on
where the organic compounds are literally earth. For nearly 2 billion years, these earliest
pouring out of these chimneys, and they’re prokaryotic organisms reined supreme, with no
being made without the help of life” (Infographic challengers. Not until photosynthetic prokary-
18.8). otes evolved, some 2.5 billion years ago, did
Many microbiologists would agree that deep- they meet their match. Then, in an instant, geo-
sea vents like Lost City likely represent some of logically speaking, life on our planet underwent
the oldest habitats for microbial life on earth. a radical and unprecedented change: 2 billion
Radiometric dating of the rock layers indicates years ago, one of these early prokaryotes
that Lost City’s vents have been pumping strong engulfed another and the two cells began a sym-
for at least 100,000 years, and likely much lon- biotic relationship. That was the birth of the first
ger: Lost City sits on a layer of earth’s crust that eukaryote. ■
374 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Chapter 18 Test Your Knowledge
j USE IT
4. Why were the bacteria and archaea originally LIFE AT LOST CITY
grouped together? The hydrothermal vents at Lost City are an extreme
environment that may resemble the conditions of
5. When first discovered, the archaea were called the early earth. By studying life at Lost City, we can
“archaeabacteria.” Why do you suppose this was? test hypotheses about the earliest living organisms
What are the strengths and weaknesses of this on earth.
earlier term?
HINT See Infographics 18.1, 18.2, and 18.8.
BACTERIAL AND ARCHAEAL
DIVERSITY j KNOW IT
Both bacteria and archaea have prokaryotic cells 13. List the features that make Lost City a
but are distinguished by a number of genetic particularly harsh environment. For each feature,
differences and unique adaptations. give a brief explanation of why that environment is
inhospitable for many organisms.
HINT See Infographics 18.4, 18.6, and 18.7.
14. If you were a prokaryotic organism and wanted
j KNOW IT to be successful at Lost City, what energy source
6. The term prokaryotic refers to must you be able to use?
a. a type of cell structure. a. sunlight
b. a domain of life. b. oxygen
c. a group with a shared evolutionary history. c. hydrogen gas
d. a type of bacteria. d. electricity
e. a type of archaea. e. None of the above is available at Lost City.
376 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Chapter 19 Eukaryotic Diversity
377
Chapter 19 Eukaryotic Diversity
O
n a chilly January afternoon in 2008, first crate was opened. With a flash of whiskers
a crowd of eager onlookers gathered and brown fur, a weasel-like animal bolted from
at a snowy campground in Washing- the box and made a break for the forest. The
ton State to watch natural history fisher was finally home.
being made. The stars of the show were a trio of “There were lots of oooohs and aaaahhs
rarely seen animals inside small wooden crates. and clapping and cheering,” recalls Jeffrey
As photographers craned for a good look and Lewis of the Washington Department of Fish
schoolchildren held their breath, the door to the and Wildlife, who helped coordinate the
The release of these fishers, imported from British Columbia, Canada, are part of a coordinated effort to
bring the species back to Washington State.
378 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
release of the fishers into the They are the first of 90 fishers
Washington forest that day. Olympic National scheduled to be released over 3
It was a long-awaited home- Park is a years into their new home:
coming. Once plentiful in the microcosm of the Olympic National Park.
state, fishers have been hunted A nearly 1-million-acre plot of
planet’s eukaryotic
and trapped nearly to extinc- wilderness occupying the north-
tion; they have not been seen in diversity. west corner of the state, Olym-
Washington since the early pic National Park is attractive to
EUKARYOTE twentieth century. The animal was named a more than just fishers. It is home to a mind-
Any organism of the Washington State endangered species in 1998, boggling array of different species, in numbers
domain Eukarya;
after a careful investigation failed to find any uncommon in most other parks. “It’s got amaz-
eukaryotic cells are
characterized by evidence of a local population. The three ani- ing biological diversity in a very compressed
the presence of a mals released that afternoon—two females and area,” says Patti Happe, who is Wildlife Branch
membrane-enclosed one male—were imported from British Colum- Chief at the park and helped orchestrate the
nucleus and
organelles.
bia, Canada, and are part of a coordinated fisher release. Among this biodiversity are a
effort to bring fishers back to Washington. seemingly endless variety of eukaryotes—the
Plants
Bacteria Archaea
Methanosarcina
Green Methanobacterium
filamentous Ciliates
Spirochetes bacteria Halophiles
Gram Methanococcus
positives T. celer
Slime molds
Proteobacteria
Thermoproteus Flagellates
Cyanobacteria
Pyrodicticum
Planctomyces Protists
Trichomonads
Bacteroides
Cytophaga
Thermotoga
Microsporidia
Aquifex
Diplomonads
Common Ancestor
plants, animals, fungi, and unicellular protists During the last ice age, approximately 20,000
making up one of the three main branches of years ago, the Olympic Peninsula was isolated
life (Infographic 19.1). by glaciers and largely separated from the rest
Visitors to the park can find some of the world’s of what is now the United States. Today, it is sur-
oldest and tallest Douglas fir and Sitka spruce rounded by saltwater on three sides, and is
trees, the country’s largest herd of Roosevelt essentially an ecological island, distinctive in its
elk, and a number of eukaryotic species found geography and topography.
here and nowhere else, including the Olympic Far from being a single landscape, however,
marmot, the Olympic pocket gopher, and the Olympic National Park is more like three parks
Olympic torrent salamander. A designated in one: a glacier-topped mountain region
UNESCO Biosphere Reserve and a World Heri- with flowering subalpine meadows, valleys of
tage Site, Olympic National Park is a microcosm temperate rain forest coursing with fresh-
of the planet’s eukaryotic diversity, and biolo- water rivers and lakes, and nearly 60 miles of
gists are eager to protect it. jagged Pacific coastline. Central to the park’s
“National parks are here to serve as our ecology is the towering presence of Mount
national treasures, where we preserve and pro- Olympus, a giant landmass that traps warm
tect both our cultural and our natural heritage air blowing in from the Pacific, making the
for future generations,” says Happe. “Really western slope one of the wettest spots in
what we’re doing is wise stewardship of our the United States: it’s doused in 12 feet of rain
nation’s resources.” each year. Taken all together, the park is a
mosaic of physical, geographic, and climatic
A Green World conditions providing numerous habitats for the
Olympic’s unique collection of wildlife reflects many species of eukaryotes that live here (Info-
the geological history and ecology of the region. graphic 19.2).
380 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Each segment of the park is marked by its dis- level, a plant is a multicellular eukaryote that
PLANT
A multicellular tinct form of vegetation, or plant life. Within the possesses cells with cell walls and carries out
eukaryote that has low-elevation rain forests, for example, stands photosynthesis. Land plants such as those
cell walls, carries out of giant Sitka spruce and Douglas fir trees form found in Olympic first evolved from water-
photosynthesis, and is
a thick canopy of green, steadily dripping mois- dwelling algae about 450 million years ago,
adapted to living on
land. ture. In dense forest understory, 300 feet below when life on earth was confined primarily to
the canopy, plants form a junglelike tangle, the seas. As plants radiated and diversified on
BRYOPHYTE growing on and in other plants: nearly every log land, they evolved a number of adaptations
A nonvascular plant
that does not produce
and tree trunk is coated with a shaggy carpet of that made them increasingly independent of
seeds. mosses, ferns, and lichens (a partnership water.
between a fungus and a photosynthetic organ- The earliest plants to make the transition
ism), while hanging plants drape branches like from water to land were small, seedless plants
luxurious scarves with long ground-reaching called bryophytes. Bryophytes lack roots and
stems. tissue for transporting water and nutrients
In all this variety, what exactly defines a throughout their bodies, and therefore can
plant, scientifically speaking? At the most basic grow only in damp environments, where they
INFOGRAPHIC 19.2
The Landscape of Olympic National Park
Olympic National Park has an enormous diversity of physical, geological, and climatic
conditions, all of which contribute to the huge biological diversity in the park.
Olympic
National Park
WASHINGTON
Hart Lake
Old Growth Forest A variety of lakes provides a type of
The Olympic National Park temperate aquatic habitat for living organisms.
rain forest has tremendous plant diversity,
providing habitat and resources for other
living organisms.
Cones Flowers
Seeds
Vascular
Common Green
Alga Ancestor
can easily absorb water. One of the wettest phytes, ferns do not produce seeds. Yet unlike
places on earth, the Olympic rain forest is a those vertically challenged relatives, ferns can
soggy paradise for bryophytes, such as mosses stand upright and grow tall, thanks to the vas-
and liverworts, which appear as squat, spongy cular tissue that keeps stems rigid and trans-
mats. ports water and nutrients from one end of the
The rain forest is also home to many vascu- plant to the other. At one time, ferns ruled the
lar plants—those with specialized tissues for plant world, spreading their massive fronds VASCULAR PLANT
transporting nutrients and water through the across the entire landscape in the Carbonifer- A plant with tissues
plant body. The first true vascular plants were ous period. But their reign was short lived. that transport water
and nutrients through
ferns, such as the hip-high sword ferns that Soon, another kind of plant evolved to chal-
the plant body.
cover a good portion of the forest. Like bryo- lenge the ferns’ dominance—those with seeds.
382 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Seed plants first emerged about 360 million arranged in threes, white flowers, and white
GYMNOSPERM
A seed-bearing plant years ago, during the late Devonian period. A berries, but it secretes a powerful toxin that
with “naked” seeds seed, which envelopes a plant’s embryo, is an causes a painful rash in unsuspecting admirers
typically held in cones. ideal package for withstanding harsh conditions who get too close. Its popular name is poison
and traveling to a location where it can grow oak.
ANGIOSPERM
A seed-bearing into a new plant. Seed plants were so successful
flowering plant with that they quickly came to dominate forests by A Forest for Fishers (and More)
seeds typically the time of the dinosaurs in the Mesozoic era. With its dense population of trees more than
contained within a
fruit.
Today, more than 90% of all living plants are 200 years old, Olympic National Park is an espe-
seed plants. Plants with largely exposed seeds, cially good home for the tree-loving fisher (Mar-
as in a pinecone, are known as gymnosperms— tes pennanti). “Because the park is 95%
spruce, pine, redwood, fir, and other conifers, wilderness area, little of it has been logged,
for example. (“Gymnos” is Greek for “naked,” and it contains great expanses of older forest,
so the name literally means “naked seeds.”) which provide the large trees, snags, and logs
Angiosperms are flowering plants with seeds that fishers need,” says Lewis. Fishers rest in
contained in a fruit—an apple, say, or an acorn nooks within the trees, and females use tree
(“angio” is from the Greek for “vessel” or “con- cavities as dens in which to birth and nurse
tainer”). Olympic National Park is home to their kits. The somewhat shy fishers are also
many species of angiosperms, including oaks, attracted to places with dense canopy cover,
maples, huckleberry bushes, and willows, as woody debris, and understory vegetation, all
well as hundreds of species of flowers (Info- of which provide plentiful hiding places. Many
graphic 19.3). of the tree species found here make for prime
One species of angiosperm in the park, Toxi- fisher habitat, including western Hemlock,
codendron diversilobum, is quite versatile, Sitka spruce, and Pacific silver fir, which also
growing as a vine stretching up the sides of provide a reliable food source for seed- and
trees or as bushes hugging trails near water. It insect-eating mammals that fishers stalk as
looks attractive, with shiny green leaves prey, such as squirrels, mice, and shrews.
INFOGRAPHIC 19.4
Evolution of Animal Diversity
All animals have descended from an ancestral protist. Many features
can be used to classify animals, including body symmetry, type of The arthropods are The chordates are
body support, and the presence or absence of a spinal cord and backbone. the most successful the only group that
In addition, genetic sequencing and the study of embryonic development animal group. includes vertebrates.
have informed this phylogenetic tree.
Backbone
No Radial
symmetry symmetry
Bilateral
symmetry
384 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
mals to have populated the oceans. All other
animals have defined tissues and fall into one of
two broad categories based on the type of body
symmetry they possess.
Animals such as jellyfish and coral exhibit
radial symmetry, meaning that they’re
shaped like a pizza—circular, with no clear left
and right sides. All other animals—everything
from worms and insects to fishers and
humans—exhibit bilateral symmetry: if you
cut them down the middle you’d produce clear
The banana slug, one of the forest’s most voracious
left and right halves that are mirror images of inhabitants, is distasteful to predators.
each other.
Bilateral symmetry has become as prevalent
as it is in the animal kingdom because it is a use- Sliding quietly amid leaf litter on forest trails
ful adaptation for seeking out food, stalking are many specimens of the Pacific coast’s best
prey, and avoiding predators. For instance, known mollusk, the brightly colored banana
bilaterally symmetrical animals have eyes on slug (perhaps the only mollusk to serve as a
both sides of their face, enabling them to look university mascot, as it does for the University
straight ahead. In the fisher’s case, such bilat- of California at Santa Cruz). A squishy yellow
eral symmetry aids in its ability to climb down creature that can grow nearly to the size of its
RADIAL SYMMETRY
The pattern exhibited trees head first in search of prey. namesake fruit, the banana slug is one of the
by a body plan that is Fishers are vertebrates, meaning they are forest’s most voracious inhabitants, eating its
circular, with no clear animals with a backbone. A fisher’s backbone way through just about everything in its path,
left and right sides.
is made of bony vertebrae, a feature they share from animal carcasses and droppings to mush-
BILATERAL with most other vertebrates. (A few verte- rooms, lichens, and leaves—including those of
SYMMETRY brates, primarily sharks and several other fish, poison oak. This mollusk is so successful in the
The pattern exhibited
have backbones made of cartilage.) While ver- forest in part because it is distasteful to would-
by a body plan with
clear right and left tebrates are some of the most easily recognized be predators, who know by its unmistakable
halves that are mirror animals—including humans—they represent color to avoid eating it.
images of each other. but a sliver of the total animal world (note they Slugs—and their shelled cousins, the snails—
are found on only one branch of the animal are often considered garden pests. Yet by digest-
VERTEBRATE
An animal with a bony tree, the chordates). In fact, most animals lack ing dead plant material, these mollusks help
or cartilaginous a backbone and are therefore called inverte- recycle nutrients. And with their calcium-rich
backbone. brates. While invertebrates are often lumped shells, snails provide this valuable mineral to
INVERTEBRATE
together on the basis of what they lack, the the creatures that feast on them, such as rodents
An animal lacking a division of the animal world into those with and birds. Some humans find mollusks a tasty
backbone. and those without backbones makes about as treat as well: if you have enjoyed clams, oysters,
much sense as dividing the world into sponges or squid, then you have eaten some aquatic vari-
MOLLUSK
A soft-bodied and nonsponges—it camouflages a lot of differ- eties of mollusk.
invertebrate, generally ences, and obscures the fact that most ani- Move a rock while you’re pitching your tent
with a hard shell mals—an astounding 95%—are invertebrates. or digging a hole in the ground and you’ll likely
(which may be tiny,
Olympic National Park hosts a squirming, uncover numerous squirmy annelids, or seg-
internal, or absent in
some mollusks). wriggling, buzzing swarm of invertebrates. If mented worms. Annelids such as earthworms
you were hiking or camping in the park, you perform a critical ecological service by creat-
ANNELID would easily encounter invertebrates from sev- ing passageways in the soil as they move
A segmented worm,
such as an earthworm.
eral major phyla—some more welcome than oth- around. The passageways allow air and water
ers, perhaps. to enter the soil, which is important for plants
386 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Fishers themselves have few natural preda- For example, in some parts of their range,
tors. They are occasionally killed by cougars, fishers are one of the few natural predators of
coyotes, and eagles, but by far their biggest foe porcupines. A healthy fisher presence in a forest
are humans, especially fur traders who trap and helps keep the porcupine population under con-
kill the animals for their soft pelts. Fishers were trol and prevents what would quickly become a
also an unintended target of a massive predator prickly problem for the trees that the porcupines
control program in Washington State that eat and the loggers who cut them for lumber.
sought to reduce the number of wolves and cou- Restoring fishers to the ecosystem is therefore
gars in state forests. The unsuspecting fishers necessary to keep the natural web of the envi-
ate the poison bait and perished. ronment intact. Exactly what effect the reintro-
Because humans are largely responsible for duced fishers are having in Olympic, researchers
the decline of the fisher in Washington, many can’t say for certain. “I’m sure that it’s having
conservationists believe it is our duty to help repercussions in the ecosystem, it’s just that we
undo that damage. There is an ecological, as well can’t interview the squirrels and the rabbits to
as a moral, rationale for such action. “When you find out what they think of all this,” says Happe.
start getting up into the mammalian species, Besides the fisher, Olympic is home to many
going up the phylogenetic tree,” says wildlife other vertebrates, including other mammals—
manager Happe, “there’s fewer species, but one cougar, black-tailed deer, mountain goat, black
animal has a big effect on the ecosystem.” That bear, river otter, and Douglas squirrel, for exam-
is especially true of predators, such as the fisher, ple, as well as hundreds of species of fish, amphib-
that act as a natural population control on other ians, birds, and reptiles. These various vertebrates
species. are easily recognized by the unique adaptations
388 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 19.5
Fungi, the Decomposers
Fungi are a diverse group of organisms with a variety of reproductive strategies. However, all fungi share the way
that they obtain their nutrition: they all secrete digestive enzymes onto their food, then absorb the digested products.
Yeast
• Single-cell fungi
• Contribute to tasty food and
beverages when they ferment
sugars
• Many live symbiotically with
plants and animals
Mushrooms
• Hyphae form mycelia in soil and trees
Spores are
• Fruiting bodies emerge from mycelia
reproductive
as part of the reproductive strategy
structures
• Decay leaf litter and dead organisms
• Source of food for other animals
Molds
• Many form mycelia—mats of strands
called hyphae
• Hyphae spread throughout the soil,
decaying leaf litter and dead organisms
• Many associate with plant roots, supplying
and receiving nutrients
Mushroom
Hyphae fruiting body
making up
a mycelium
organisms, but since they are unicellular they Despite their diversity, protists do share some
are not technically animals. Some protist spe- common traits. They are all susceptible to drying
cies have long filamentous bodies resembling out, so they are typically found in wet environ-
fungi, but they are no more related to fungi ments: lakes, oceans, ponds, moist soils, and living
than animals are. In fact, genetic evidence hosts. Many disease-causing protists, for example,
shows that protists do not form a cohesive evo- must spread directly from host to host because oth-
lutionary group; some may be as distinct from erwise they would dry out. This explains why
ALGA (PLURAL: each other as plants are from animals. Still a trichomoniasis, a sexually transmitted infection
ALGAE) work in progress, our understanding of these caused by the protist Trichomonas vaginalis, can
A uni- or multicellular diverse organisms is likely to evolve in coming be spread only by direct sexual contact.
photosynthetic
protist. years as we continue to learn more about them Other protists live in the gastrointestinal sys-
Infographic 19.6). tems of animals such as beavers and can be found
River and lake water is Aquatic environments Dog vomit slime mold Algae float in lakes and
teeming with unicellular contain a diversity of grows on the ground in rivers, performing
protists that feed other unicellular organisms that wooded areas. Slime photosynthesis, like
organisms (for example, carry out photosynthesis, molds are decomposers, plants. Many algae form
algae), as heterotrophic similar to plants. Some like fungi, but may also filamentous strands of
animals do. have a whiplike flagellum eat other organisms (for cells, similar to many
that allows them to example, bacteria) as fungi.
move, a characteristic food, similar to
of animals. heterotrophic animals.
390 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 19.7
The First Eukaryotes Were Products of Endosymbiosis
All eukaryotes are characterized by the
presence of a membrane-enclosed nucleus Common
and organelles. While the origin of the nucleus is ancestor
not yet completely understood, there is good
evidence that mitochondria and chloroplasts
arose by the engulfment of ancient prokaryotes
by the earliest eukaryotes.
Endosymbiosis
Endosymbiosis
Ancestral
photosynthetic
eukaryan
Chloroplast Mitochondrion
Mitochondrion
Photosynthetic Nonphotosynthetic
Eukarya Eukarya
Summary
Q Rain forests are sites of great biological diversity, as Q Vertebrates (animals with a backbone) are members of
measured by the number and variety of different species the phylum Chordata. Common vertebrates include
present. mammals such as the fisher, as well as amphibians,
Q The domain Eukarya encompasses all eukaryotic
reptiles, birds, and fish.
organisms—plants, animals, fungi, and the many types of Q Fungi are decomposers, acquiring their nutrition
protists. and energy by breaking down dead organic matter and
Q Plants are multicellular eukaryotes that carry out
absorbing the results. There are unicellular and
photosynthesis. All plants have cells with cell walls, but multicellular fungi.
not all have a vascular system, not all produce seeds, and Q Protists are a diverse group of mostly unicellular
not all produce flowers. eukaryotic organisms that do not cluster on a single branch
Q Plants can be subdivided into groups, including the
of the evolutionary tree. They include photosynthetic
bryophytes, ferns, gymnosperms, and angiosperms, on the plantlike algae and animal-like parasites.
basis of their terrestrial adaptations. Q All eukaryotes are descendants of a unicellular protist
Q Animals are multicellular eukaryotic heterotrophs that
that first emerged some 2 billion years ago as the result of
obtain nutrients by ingestion. endosymbiosis.
392 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Chapter 19 Test Your Knowledge
HINT See Infographic 19.6. 14. Which of the following statement(s) is/are true
about both cockroaches and lobsters?
j KNOW IT a. They are invertebrate insects with bilateral
6. Which group of plants was the first to live on symmetry.
land? Why do we find these plants only in particular b. They are mollusks with an exoskeleton.
environments (after all, if they were first, shouldn’t c. They are arthropods with segmented bodies
they have spread everywhere by now)? and no symmetry.
d. They are arthropods with an exoskeleton.
7. A major difference between a fern and a moss is
e. They are mollusks with a segmented body.
a. the presence of seeds.
b. the presence of flowers.
c. the presence of cones.
j USE IT
15. Many characteristics are used to classify
d. the presence of a vascular system.
animals. Why do we need to use so many different
e. the ability to carry out photosynthesis.
characteristics? Consider the following five animals:
j USE IT woodpecker, human, wasp, ant, and fisher; and the
following three characteristics: ability to fly, two-
8. What is an advantage of having seeds? (Think
about spreading to new locations and whether or legged, bearing feathers
not reproduction relies on water.) a. Which of the five animals could be grouped by
each characteristic?
9. What type of seed plant is likely to rely on hungry b. Would this grouping reflect their real
animals to spread its seeds? Explain your answer. taxonomic relationship?
j USE IT southwest/es/mexicanwolf/.
a. Why might it be important to reintroduce
19. A very early classification scheme placed the
species into their native habitats? Answer first in
fungi together with the plants. Why do you think
general terms, then specifically for the Mexican
fungi were grouped with plants? What features
gray wolf.
distinguish them from plants?
b. What factors could impede the success of
such reintroductions? Again, answer in general
A PLETHORA OF PROTISTS terms first, then specifically for the Mexican gray
Protists are a diverse group of primarily unicellular wolf.
eukaryotic organisms that are considered together
only because they do not sort neatly into any other 25. Many species reintroductions are being carried
single evolutionary category. out across the United States. Do some research to
learn about at least one such effort. For the species
HINT See Infographics 19.8 and 19.9. you research, address the following questions:
a. What caused it to be lost from its native
j KNOW IT habitat?
20. What do members of the informal group known b. Is its reintroduction important?
as protists have in common? c. Are there are controversies about its
a. nothing reintroduction?
b. They are all eukaryotic. d. What made you interested in this particular
c. They all carry out photosynthesis. species and its reintroduction? Is it an
d. They are all human parasites. “attractive” species? Is it being reintroduced
e. They are all decomposers. near where you live?
394 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Chapter 20 Human Evolution
What Is Race?
j What You Will Be Learning
20.1 How Do We Define Race?
20.2 Melanin Influences Skin Color
20.3 Folate and Vitamin D Are Necessary for
Reproductive Health
20.4 Human Skin Color Correlates with UV Light
Intensity
20.5 Modern Human Populations Are Ancestors
of “Eve”
20.6 Mitochondrial DNA Is Inherited from
Mothers
20.7 Out of Africa: Human Migration
20.8 Traits of Modern Humans Reflect
Evolutionary History
20.9 Natural Selection Influences Human
Evolution
20.10 The Evolution of Skin Color
Chapter 20 Human Evolution
What Is Race?
Science redefines the meaning of racial categories
W
hen Barack Obama was elected in includes African, Chinese, Dutch, and Thai fore-
2008, he was hailed as America’s bears; Halle Berry was born to a white mother
first black president. When Tiger and a black father. So what does the term “black”
Woods won the Masters Golf Tour- mean?
nament in 1997, he was lauded as the first black Historically, racial categories were employed
man to win. When Halle Berry won an Oscar in primarily by one group to maintain power over
2001 for best actress, she was commended as another and to justify forms of oppression,
the first black woman to win in that category. including slavery. In the United States, racial cat-
Why was skin color so significant? A 250-year egories were reinforced by laws such as the “one
history of slavery and racial discrimination in drop” rule adopted by several states in the
the United States has left a bitter legacy. Almost 1920s, which held that any American with one
150 years after slavery was legally abolished in drop of African blood was to be considered
the United States, people of color are still under- black. People then continued to use these cate-
represented in positions of power and prestige. gories and their connotations to justify racial
Although the reasons for this underrepresenta- discrimination and, in some places, racial
tion are complex, the recognition of the achieve- segregation.
ments of Obama, Woods, and Berry was Though social and political attitudes have
important because it signaled a major change: changed, people continue to invoke racial cat-
barriers to social advancement were beginning egories like “black” or “white” for various rea-
to come down. sons, including simple physical description.
To shoehorn any of these three people into a Regardless of the reason, it is increasingly clear
simple racial category, however, is misleading: that from a biological perspective racial catego-
Barack Obama was born to a white mother and ries are meaningless. Research on the evolution
an African father; Tiger Woods’s background of humans increasingly shows that race is a
396 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
social, not a biological, category. Groups of peo- the evolution and migration of our earliest
ple can and do share similar physical character- ancestors. Humans are a recent species, first
istics, such as skin color and other features, but walking the earth a mere 200,000 years ago.
all humans are members of a single biological The physical differences we see among people
species, Homo sapiens. The only thing that skin today have all emerged in the very recent past.
color might accurately identify is the geograph- And while the physical differences between,
ical location where a person’s ancestors lived say, an African from Senegal and a European
(Infographic 20.1). from Sweden may appear large, biologically
speaking such differences are actually quite
small. In fact, genetic studies comparing
Humans are a recent species, first walking the regions of the human genome from person to
earth a mere 200,000 years ago. person show that each person’s DNA is 99.9%
identical to any other unrelated person. Never-
Why is there so much variation in human theless, this difference holds clues that help
skin tone? And how did the geographical varia- explain how our varying skin tones and other
tion come about? The answers lie in physical traits evolved.
Genetics?
History?
RACE Cultural
What defines it? traditions?
398 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
The Evolution of Skin Color advantage to having light or dark skin in differ-
MELANIN
Pigment produced by More than a decade ago, Jablonski and her hus- ent environments?
a specific type of skin band, George Chaplin, a geographic informa- She found her first clue in a 1978 study show-
cell that gives skin its tion systems specialist, set out to understand ing that an hour of intense sunlight can halve
color.
why human populations had evolved varying the level of an important vitamin known as
FOLATE skin tones. Skin tone largely reflects the amount folate in light-skinned people. Folate, also
A B vitamin also of melanin present in the skin; people natu- called folic acid, is an essential nutrient, neces-
known as folic acid, rally produce different levels of melanin, sary for basic bodily processes like DNA repli-
folate is an essential
nutrient, necessary for resulting in different skin tones. Skin also cation and cell division.
basic bodily processes responds to sunlight by producing more mela- Then, at a seminar, Jablonski learned that low
such as DNA nin and becoming darker temporarily (Info- folate levels can cause severe birth defects such
replication and cell as spina bifida, in which the spinal column does
graphic 20.2).
division.
In general, skin tone correlates with geogra- not close, and anencephaly, the absence at birth
phy: people from northern climates tend to be of all or most of the brain. She subsequently
fair and those from areas close to the equator came across three case studies that linked such
tend to have dark skin. Jablonski wanted to birth defects to the mothers’ visits to tanning
understand this, so she searched the scientific studios, where the women would have been
literature. Might there be an evolutionary exposed to ultraviolet light. She also learned
INFOGRAPHIC 20.2
Melanin Influences Skin Color
Melanocytes are a type of cell located in the epidermis, the outermost
layer of skin. Melanocytes make the pigment melanin, and deposit it into Skin epidermis
other cells in the skin. A person’s skin color depends largely on the amount
and type of melanin that his or her skin melanocytes produce. Sunlight can
also temporarily increase the amount of melanin in a person’s skin.
Epidermis
Melanin
Dermis
Fatty
tissue
Sweat
gland
Follicle Melanocytes
Oil gland
Blood vessels
Melanocyte
Human skin produces vitamin D when exposed to UV rays in sunlight. We can also get vitamin D from some foods such as
vitamin D - fortified milk, fish, cheese, butter, and fortified cereals. Sufficient vitamin D permits absorption of calcium and
phosphate in the small intestine and enhances bone mineralization, among other tasks in the body.
Skin color
Vitamin D deficiency:
Vitamin D is produced in
skin exposed to UV light . Risks for pregnant women: Risks for children:
Sunlight
People with
dark skin are
UVB rays Vitamin D
more vulnerable • Premature birth
Vitamin D • Preeclampsia — • Rickets disease —
to insufficient elevated blood abnormal bone
Vitamin D
vitamin D pressure formation from
Vitamin D production. • Reduced bone calcium deficiency.
density in pelvis • Multiple sclerosis
that folate is necessary for sperm to develop the body’s folate stores from UV light have
normally. driven the evolution of darker skin shades? The
Taken together, the results of Jablonski’s lit- supporting evidence was compelling. But then
erature search suggested that people with light what was the advantage of having light skin at
skin are more vulnerable to folate destruction all, as many populations today do? And why are
than are darker-skinned people—presumably there geographical differences?
because melanin absorbs and dissipates damag- Jablonski’s work built on a hypothesis first
ing UV light as heat. Could the need to protect proposed in the 1960s by biochemist W. Farns-
400 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
worth Loomis, who suggested that vitamin D dark and light skin are linked to levels of global
VITAMIN D
A fat-soluble vitamin might play a role in the evolution of skin color. sunlight. They now had a complete hypothesis:
required to maintain a Unlike folate, which is destroyed by excess sun- light skin evolved because in sun-poor parts of
healthy immune light, the production of vitamin D requires ultra- the world it helped the body produce vitamin D,
system and to build
violet light. Vitamin D is crucial for good while dark skin evolved because it helped pro-
healthy bones and
teeth. The human health: it helps the body absorb calcium and tect the body’s folate stores in people who lived
body produces deposit it in bones. During pregnancy women in sunny climates. The body’s need to balance
vitamin D when skin is need extra vitamin D to nourish the growing levels of these two important nutrients explains
exposed to UV light.
embryo. In addition, since vitamin D is so why there is so much variation in skin tone
important for healthy bone growth, too little around the globe (Infographic 20.4).
might also cause bone distortion, and a dis- Since the publication of Jablonski and Chap-
torted pelvis would make it difficult for a in’s work, many other scientists have tested
woman to bear children (Infographic 20.3). their hypothesis, and it is now the most widely
In 2000, Jablonski and Chaplin published a
study in the Journal of Human Evolution that com-
pared data on skin color in indigenous popula- The body’s need to balance levels
tions from more than 50 countries to levels of of vitamin D and folate explains
global ultraviolet light. They found a clear cor- why there is so much variation in
relation: the weaker the ultraviolet light, the
skin tone around the globe.
fairer the skin, a compelling suggestion that both
INFOGRAPHIC 20.4
Human Skin Color Correlates with UV Light Intensity
Nina Jablonski and George Chaplin used NASA satellite measurements of UVB intensity to predict the amount of skin pigment
that would best block harmful UV rays yet still enable the body to produce sufficient vitamin D in populations around the globe.
Their predictions closely match actual skin color variations around the world.
402 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
INFOGRAPHIC 20.5
Modern Human Populations Are Ancestors of “Eve”
Many women of Eve’s generation left descendants, but the mtDNA data suggest that Eve’s descendants are the ones who
successfully migrated out of Africa and went on to become the modern human populations across the globe we know today.
Mitochondrial DNA is DNA located in the than nuclear DNA. A mother with a mutation in
mitochondria in all our cells. Unlike nuclear her mtDNA will pass it to all her children, and
DNA, which is inherited from both parents in her daughters will pass it to their children in
most multicellular organisms (including turn. Because these mutations pass down with-
humans and other animals), and which under- out being combined and rearranged with pater-
goes recombination during meiosis, mtDNA nal mitochondrial DNA, mtDNA is a powerful
passes from mothers to offspring essentially tool by which to track human ancestry back
unchanged. That’s because sperm do not con- through hundreds of generations.
To conduct the Eve study, Wilson and his col-
All humans can trace their ancestry back to a single leagues collected mtDNA from 147 contempo-
woman who lived in eastern Africa some 200,000 rary individuals from Africa, Asia, Australia,
to 150,000 years ago. Europe, and New Guinea. On the basis of the
mtDNA sequence patterns, the researchers cre-
tribute their mitochondria to the newly formed ated an evolutionary tree. Branches of the tree
zygote (Infographic 20.6). from all five areas could be traced back to Eve.
Like nuclear DNA, mtDNA mutates at a fairly However, the tree had two major evolutionary
regular rate, although it appears to mutate faster branches: one that included the ancestors of
404 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Becoming Human common ancestor that lived 13 million years
HOMINID
Any living or extinct A number of lines of evidence peg Eve as the likely ago. Of the living primates, humans and chim-
member of the family common ancestor of all humans living today. panzees are the most closely related, although
Hominidae, the great However, she represents merely one branch on it has been more than 6 million years since their
apes—humans,
the evolutionary tree that includes our species; shared ancestor lived. During those 6 million
orangutans,
chimpanzees, and this tree has several other branches representing years, both humans and chimps have under-
gorillas other hominid species that came before her gone a tremendous amount of evolutionary
(Infographic 20.8). A hominid is any member of change, which is why living humans look and
the biological family Hominidae, which behave so differently from chimps—or any other
includes living and extinct humans and apes. primate species living today.
Humans and apes are grouped together Scientists haven’t yet discovered fossil
because the fossil evidence shows that modern remains of the last common ancestor between
humans and present-day apes evolved from a chimps and humans. However, in October 2009
INFOGRAPHIC 20.7
Out of Africa: Human Migration
Genetic evidence suggests that the earliest modern humans originated and evolved for thousands of
years in Africa before a group of them and their descendants migrated to the other continents.
Bering Strait
land bridge
“Eve”
150,000–
200,000 40,000–60,000 years ago
years ago
13,000 years ago
1
Paranthropus Paranthropus
robustus boisei
Homo habilis
2
Australopithecus
Millions of years ago
garhi
Paranthropus
3 aethiopicus
Australopithecus
africanus
4 Australopithecus afarensis
6 Common ancestor
the first analyses of fossil remains of a 4.4-mil- H. sapiens to develop complex language. Ardi
lion-year-old hominid, Ardipithecus ramidus, helped scientists discover that the ability to walk
nicknamed Ardi, were published. Ardi’s upright evolved first. Ardi had a small brain, sug-
remains are among the oldest hominid fossils gesting that it could not use complex language.
so far discovered and, as such, give tantalizing By studying Ardi’s bones, scientists also know
clues to early human origins. that it could maneuver on all fours in trees, but
Among the defining characteristics of Homo it could also walk upright without dragging its
sapiens are the ability to walk upright and a big knuckles.
brain. An upright gait meant the hands were free The fossil record after Ardi has also helped
to make and use tools. A big brain enabled show us some of the major milestones in human
406 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
evolution. For example, artifacts found at vari- tinually introduces new alleles into the popula-
ous archeological sites indicate that simple tool tion. Some of these alleles can be negative or
use began approximately 2.6 million years ago, harmful, as in the case of hereditary cancer or
most likely when our hominid ancestors began cystic fibrosis. But new alleles can also be benign
eating meat from large animals. The first tool- or even beneficial. Indeed, sometimes alleles can
users were members of the genus Australopithe- be so positive and confer such a survival advan-
cus. This genus walked upright and appears to tage that they become more common in succeed-
have lost the ability to live in trees, as evidenced ing generations and can eventually become fixed
by the lack of an opposable big toe, which had in a population (Infographic 20.9).
helped the early hominids grip branches. Sometimes alleles that are harmful in one
Another milestone was the ability to use and environmental context may be beneficial in
control fire, which appeared about 800,000 another. For example, the recessive allele
years ago. Artifacts such as clay shards found responsible for cystic fibrosis (CF) can cause this
at various fossil sites show that Homo erectus serious disease when it occurs in homozygotes,
was likely the first species able to control fire. who have two copies of the allele. However,
Fire use enabled Homo erectus to cook meat research has suggested that being heterozygous
and bone marrow, to stay warm, and probably for CF—that is, having only one CF allele—may
to fight off predators. have reduced the severity of diarrhea caused by
Finally, at some point between 800,000 and cholera or some other infection. Consequently,
200,000 years ago, hominid brain size began carrying a CF allele provided an advantage dur-
to expand rapidly. Geological studies show that ing epidemics. This would help explain why the
this was also a time of rapid and dramatic cli- CF allele became relatively common.
mate change. Scientists hypothesize that a Skin color is another example of a trait that
larger brain would have enabled better com- likely conferred an advantage to humans and
munication and problem-solving, which would underwent natural selection at some point in
have been very useful as our hominid ances- human history. Otherwise, dark or light skin
tors had to cope with climate change. This was color wouldn’t be so common among specific
also around the time that anatomically mod- populations. In fact, the dark skin of those Homo
ern humans like Eve and our own species, sapiens who evolved in Africa was probably an
Homo sapiens, appeared. early adaptation; it is likely that before evolv-
ing dark skin, our earliest ancestors had light
Selection for Skin Color skin, just as chimpanzees do today.
That anatomically modern humans evolved in Fossil and genetic evidence suggests that
Africa suggests that the first humans likely had about 2 million years ago hominids became
dark skin. But then how might varying skin tones “bipedal striders, long distance walkers and
have later developed? Nina Jablonski’s research possibly even runners,” according to Nina
has revealed that environmental factors likely Jablonski. But to sustain such activities, they
played a role in the evolution of different skin needed an effective cooling system, a feat they
tones. Environment alone doesn’t cause evolu- could have accomplished only by losing exces-
tion, however. Rather, the environment acts on sive body hair and gaining more sweat glands.
traits, or phenotypes, increasing or decreasing In contrast, hairy chimpanzees, our closest liv-
the frequency of alleles in a population by natu- ing animal relatives, can sustain only short
ral selection. Where did these alleles come from? bouts of activity without getting overheated.
Recall that each time a cell replicates, muta- “It’s like sweating in a wool blanket,” Jablonski
tions—errors in replication—can occur. If these explains. “After that blanket gets saturated,
mutations occur in germ cells during meiosis you can’t lose very much heat.”
(Chapter 10), they will permanently change the At some point, some factor—food scarcity, per-
genome of the next generation. This process con- haps—forced ancient hominids out of the forests
and into the open savannahs to hunt for food. Evidence to support this hypothesis comes
Hominids with less hair and more sweat glands from genetics. In 2004, Alan Rogers and his
were likely better hunters because they could colleagues studied a gene that influences skin
sustain long bouts of activity without getting shade. They discovered that more than a mil-
overheated. Like modern-day chimpanzees, lion years ago, an allele that contributes to dark
these hominids likely had fair skin under their skin became fixed—that is, its frequency
hair. Without hair to protect their light skin, they approached 100%—in the African population.
were exposed to the intense African sun. And, “This is critical,” Jablonski says. “It shows that
scientists hypothesize, exposure to the sun darkly pigmented skin became extremely
would have reduced their folate levels and thus important to us” around the time that homi-
their fitness in the sun-drenched environment. nids became more humanlike.
Any of these ancient hominids that carried The allele for darker skin was such an advan-
an allele or developed or inherited a mutation tage in terms of survival and reproduction that
that increased their ability to produce more hominids with darker skin left more offspring
melanin would have been able to spend more than their lighter-skinned relatives. Though
time in the sun without the detrimental effects. some hominids were certainly born with rare
Darker coloration would have protected their mutations that gave them light skin, they
skin, and consequently their folate levels, from weren’t able to survive and reproduce in great
the sun, enabling these prehistoric humans to enough numbers for the trait to persist in the
hunt and travel in the open fields. population. The allele for darker skin eventu-
408 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
ally increased in the population until it reached Scientists also know that these skin color
100%. genes have been favored by specific environ-
Populations that migrated north, away from ments because they carry genetic signatures
the African sun, however, faced a different of natural selection. To study whether natural
environment. Folate was not as easily selection favored any particular trait, scientists
destroyed in this lower-UV-light typically look at the amount of
environment. But the high lev- sequence variation that exists in
els of melanin present in dark “Skin tone is one a gene of interest. Less variation
skin were a disadvantage; they of the best than average means that there
prevented bodies from produc- examples of was some environmental pres-
ing enough vitamin D. In this
human evolution.” sure that selected the alleles for
low-UV-light environment, fair that trait to be conserved over
skin allowed the body to soak –Mark Stoneking time.
up more ultraviolet light and Indeed, skin-color genes show
produce essential vitamin D. In these environ- this very pattern—they show less sequence vari-
ments fair-skinned people thus were more fit ation than genes for other traits. Consequently,
and left more descendants than dark-skinned we know that the amount of melanin in the skin
people. Consequently, the frequency of light represents a compromise, or evolutionary
skin in northern climates increased with each trade-off, most likely between the need to pro-
generation. tect folate levels from excess sunlight and the
Genetic studies show that the frequency of need to absorb sunlight to make vitamin D—and
alleles for light skin increased and swept the way the trade-off was resolved depended on
through populations as they migrated north— the environment (Infographic 20.10). Skin color
most likely more than once. The fact that light is thus a proxy for the geographic origin of our
skin in people from Northwestern Europe and ancestors, but not much else.
light skin in people from Eastern Asia is deter- Throughout human history, the lines between
mined by at least three different genes suggests what we have come to call races have been fluid.
that mutations for light skin arose indepen- Genetic studies show that hardly any population
dently and spread through those two popula- is pure in the way that many have thought. As
tions separately. people moved around the globe, they settled and
There are a number of other hypotheses for often bore children with people they met along
the evolution of skin tone, but of all of them, the way, introducing their alleles into the local
the folate-vitamin D hypothesis has the most gene pool. The particular environment people
evidence supporting it and is consequently encountered favored some traits over others, and
“the most reasonable,” says Mark Stoneking of that is why populations that live in similar envi-
the Max Planck Institute for Evolutionary ronments share similar features.
Anthropology in Leipzig, Germany. In fact, Though people tend to create racial group-
Stoneking says, “skin tone is one of the best ings based on obvious physical characteristics,
examples of human evolution.” It’s an example such features can be shared with other groups,
in which we can see that genes have definite says Jablonski. Not all Africans have equally
phenotypic effects on skin pigmentation and dark skin and not all Europeans are fair-skinned,
for which scientists can also see that the trait for example. And as humans travel more, settle
was selected, he explains. in different areas, and intermarry, Jablonski
There are at least a dozen different genes that says, “racial categories will get messier and
interact to determine skin color, maybe more messier.” Perhaps the concept of race itself in
than 100 genes in total, says Stoneking. The time will disappear. ■
dozen or so that have been identified are the
ones that are known to have very strong effects.
Summary
Q Physical features shared by people within populations Q Fossil evidence shows that humans and apes descended
reflect adaptations to specific environments. from a common ancestor and that walking upright
Q Alleles can be harmful, beneficial, or neutral in their
preceded development of a big brain. There were many
effect on survival and reproduction. species that could walk upright before Homo sapiens
appeared.
Q Skin color most likely evolved in response to
environmental UV levels, an example of human Q Mitochondrial DNA evidence shows that modern-day
adaptation by natural selection. Alleles for darker skin humans first emerged in Africa, approximately 200,000
conferred an advantage in sunnier environments, while years ago, and subsequently spread to other continents.
alleles for lighter skin conferred an advantage in regions Q Humans evolved from apelike primate ancestors who
that receive weak sunlight. likely had fair skin. Darker skin emerged in tandem with
Q Skin color represents an evolutionary trade-off between
loss of body hair as our hominid ancestors ventured into
the need for vitamin D, which requires adequate sunlight the hot savannah.
for its production, and the need for folate, which is Q Biologically distinct human races do not exist. All
destroyed by too much sunlight. humans are members of the same biological species.
410 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Chapter 20 Test Your Knowledge
THE EVOLUTION OF SKIN COLOR c. The hair of chimpanzees protects their light
Skin color most likely evolved in response to skin from UV light.
environmental UV levels, and represents an d. Chimpanzees require much higher levels of
evolutionary trade-off between a need for vitamin D vitamin D than humans do.
and folate. e. Chimpanzees use a light-colored pigment as
their UV protection.
HINT See Infographics 20.1 to 20.4, 20.9, and
20.11. EARLY HUMAN ORIGINS
Fossil and mtDNA evidence suggests that humans
j KNOW IT and apes evolved from a single ancestor, likely in
1. In the course of human evolution, which of the Africa.
following environmental factors likely influenced
whether populations had mostly light-skinned HINT See Infographics 20.5 to 20.8, and 20.10.
individuals or mostly dark-skinned individuals?
a. average annual temperature j KNOW IT
b. average annual rainfall 6. Why is mtDNA a useful tool in the study of
c. levels of UV light human evolution?
d. the vitamin D content of the typical diet
e. mitochondrial DNA inheritance 7. According to the “out of Africa” hypothesis of
human origins and migration, which group of people
2. As hypothesized by Jablonski and Chaplin, should show the highest level of genetic diversity?
darker skin is advantageous in __________ UV a. Africans
environments because darker skin ___________. b. Europeans
a. high-; reduces Vitamin D production c. Asians
b. high-; protects folate from degradation d. South Americans
c. high-; increases the rate of folate synthesis e. Australians
d. low-; allows more vitamin D to be produced
e. low-; allows more folate to be produced j USE IT
8. Of the following traits that are associated with
j USE IT being human, which evolved most recently?
3. If folate is not destroyed by UV radiation, predict a. upright walking
the skin color you might find in each of the following b. ability to control fire
populations. Explain your answers. c. social communication
a. populations living at the equator d. tool use
b. populations living in Greenland e. big brain
4. Which of the following would help darker- 9. Rank the levels of genetic diversity you would
skinned people who live in low-UV environments expect to find within the four populations listed in
remain healthy? Question 7 from highest to lowest. Justify your
a. folate supplementation ranking.
b. sunscreen
c. reduced production of melanin 10. Why would individual Australopithicines who
d. vitamin D supplementation could make and use tools have had a selective
e. calcium supplements advantage (that is, higher fitness) over individuals
who could not make or use tools?
5. Our closest primate relatives, chimpanzees,
have light-colored skin yet live in tropical (high-UV) 11. Ardi was partially arboreal (that is, the species
environments. How would the Jablonski-Chaplin could live in trees). The ability to move around in
hypothesis explain this observation? trees was facilitated by an opposable big toe that
a. Chimpanzees don’t need folate for successful would help grip branches. Once ancient hominids
reproduction. moved permanently to a grounded lifestyle, would
b. Chimpanzees are not susceptible to skin there have been any selective pressure to maintain
cancer. an opposable big toe? Explain your answer.
412 UNIT 3: HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY
Chapter 21 Population Ecology
On the Tracks of
Wolves and Moose
j What You Will Be Learning
21.1 Ecology of Isle Royale
21.2 Distribution Patterns Influence Population
Sampling Methods
21.3 Population Distribution Patterns
21.4 Population Growth and Carrying Capacity
21.5 Population Cycles of Predator and Prey
21.6 Patterns of Population Growth
21.7 Moose and Wolf Health Is Monitored Using a
Variety of Data
21.8 Abiotic and Biotic Influences on Population
Growth
21.9 Warming Climate Influences Moose and
Wolf Population Size
413
Chapter 21 Population Ecology
On the Tracks of
Wolves and Moose
Ecologists are learning big lessons from a small island
“
Teeth, hooves, blood, bruises, adrenalin, Lake Superior. A 200-square-mile slice of road-
exhaustion. Romeo killed a moose. Very less wilderness that is accessible only by boat
likely, this is the first moose he’d ever and seaplane, Isle Royale may seem an unlikely
killed. He’d seen his parents, the alpha place for a scientific laboratory, but that’s
pair of Chippewa Harbor Pack, do it many times. exactly what it is for Vucetich and his col-
He would have even helped his parents kill leagues. Every summer, and for a few weeks
moose. He’d wounded moose a couple of times every winter, they investigate the island’s
this winter, but never killed one. His pride packs of gray wolves (Canis lupis) and the herd
heightened because he killed this moose with of moose (Alces alces) that are their lifeblood.
the help of a girlfriend. By early morning they Begun in 1958, the Isle Royale wolf and
slept with full bellies while a dozen ravens cel- moose study is the longest-running predator-
ebrated the accomplishment with a feast of their prey study in the world. For more than
own.” fifty years, researchers have studied how these
That’s an entry, made on February 20, 2010, two island inhabitants have interacted and
in biologist John Vucetich’s field journal, co-existed. They are motivated by a simple
ECOLOGY
describing the exploits of a young gray wolf goal: “to observe and understand the dynamic The study of the
(Canis lupis) researchers have named Romeo. f luctuations of Isle Royale’s wolves and interactions between
For almost 20 years, Vucetich has been shad- moose, in the hope that such knowledge organisms, and
owing wolves like Romeo and his kin on Isle between organisms
will inspire a new, flourishing relationship
and their nonliving
Royale, a remote island about 15 miles off the with nature.” And the mission may finally be environment
Canadian shore in the northwest corner of paying off.
Individual wolves cluster 2010 Wolf Pack Territories and Kill Locations
together in packs,
making them easier
to spot, track,
and count. Middle Pack
Loners or Duos
Chippewa
Harbor Pack
in defined spaces a few feet away from each ulation is greater than the death rate, the popu-
other are a good example (Infographic 21.3). lation grows; when the death rate is greater
than the birth rate, the population declines;
Population Boom and Bust and when the two rates are equal, the result is
Moose have not always roamed Isle Royale. The zero population growth.
first antlered settlers likely arrived around In many populations, immigration and emi-
1900, when a few especially hardy individuals gration make substantial contributions to popu- GROWTH RATE
swam across the 15-mile-wide channel from lation growth. But because the moose and The difference
Canada. With an abundant food supply and no wolves of Isle Royale are isolated, and individu- between the birth rate
natural predators on the island, the moose pop- als neither come to nor go from the island on a and the death rate of
a given population;
ulation exploded, growing from a handful of regular basis, their population growth rates are also known as the rate
individuals around the turn of the century to due only to births and deaths. of natural increase
more than a thousand by 1920. Ecologists describe two general types of pop-
EXPONENTIAL
This rapid increase reflected the population’s ulation growth. The rapid and unrestricted
GROWTH
high growth rate, a rate defined as the birth increase of a population growing at a constant The unrestricted
rate minus the death rate. Because it denotes rate is called exponential growth. When a growth of a
the simple balance between birth and death, population is growing exponentially, it population increasing
at a constant growth
the growth rate is also known as the rate of increases by a certain fixed percentage every rate
natural increase. When the birth rate of a pop- generation. Thus, instead of a constant number
of individuals being added at each generation— 207. If the population continued to grow expo-
say, the population going from 100 to 120 to 140 nentially, it would quickly get out of control, not
to 160—the increase is more like credit card unlike a credit card bill you don’t pay on time.
interest, with each increase added to the princi- Such unrestricted growth is rarely if ever
pal (the population) before the percentage is found unchecked in nature. As populations
applied. And so, with an exponential growth increase in numbers, various environmental
rate of 20%, that population would increase at factors such as food availability and access to
each generation from 100 to 120 to 144 to 173 to habitat limit an organism’s ability to reproduce.
INFOGRAPHIC 21.3
Population Distribution Patterns
Different organisms have different distribution patterns. There are three main types,
but few organisms in nature fall into strictly one category.
Individuals are equally likely to be High-density clumps are separated Individuals maximize space between
anywhere within the area. by areas of low abundance. them by being uniformly spaced.
INFOGRAPHIC 21.4
Population Growth and Carrying Capacity
A population growing at a constant growth rate without checks will grow exponentially.
As the population reaches its carrying capacity, the growth rate will slow and eventually remain at or near zero.
Logistic growth:
Population growth is limited by
environmental factors, such as
available food sources, disease,
and access to natural resources.
Time
Moose
45 wolf population
is moose. Wolf
goes down…
populations grow
30 and diminish in
response to the
15 availability of this
food resource.
measured by the
0.6 width of each tree
ring. One ring
0.4 represents the
amount of growth in
…resulting in
0.2 1 year: the wider
slower tree growth.
the ring, the more
0 growth in that year.
1960 1965 1970 1975 1980 1985 1990
a large wolf population and vigorous tree ing on them, which in turn indicates that more
growth. When wolves are plentiful, they keep wolves have been keeping the moose popula-
the moose population in check. Because trees tion in check.
are the primary food source for moose, they Wolves affect tree growth in another, indi-
grow more when fewer moose are eating them. rect, way as well. Because the wolves don’t
It’s therefore possible to follow the rise and fall always consume the entire carcass of a moose
of the wolf population by monitoring the state of they kill, the remains decay and fertilize the
the forest. ground where they lie, enriching the soil with
One way ecologists can determine forest nutrients for plant growth. In fact, researchers
growth and health is to count and measure the have found that nitrogen levels are between 25%
width of tree rings, which reflect how much and 50% higher in these hot spots compared to
trees have grown season by season. They also controls. This work shows that predators—in this
measure how tall the trees are. Taller and bigger case, wolves—are an important component of a
trees mean that fewer moose have been forag- balanced and healthy ecosystem, and “illus-
INFOGRAPHIC 21.9
Warming Climate Influences Moose and Wolf Population Size
One moose may be home to tens Ticks cause moose to lose their hair,
of thousands of ticks at a time. their appetite, and a good deal of blood.
Ticks make moose weak and vulnerable Moose weakened by ticks are easier
to predation and starvation. So, while …the moose population for wolves to catch. After an initial
ticks have been increasing… has been decreasing. population increase in response to
an abundance of moose, the wolf
population begins to suffer (2007)
as the moose population continues
its decline.
80 1,200 30
Population size
% Hair loss
Population size
60
800 20
40
400 10
20
Ticks Moose Wolves
0 0 0
2001 2003 2005 2007 2001 2003 2005 2007 2001 2003 2005 2007
in the early 1970s, when it seemed on the verge ers will need to consider when debating whether
of extinction. and how to intervene.
The wolves’ latest plight poses an ethical If only one value mattered, Vucetich notes, it
dilemma: should scientists intervene on their would be easier to make a decision, but here the
behalf—say, by importing wolves from another values are often competing. The dilemma is a
population to reintroduce genetic diversity—or familiar one to conservation biologists. Accord-
let nature take its course? It’s a question that ing to Vucetich, these competing values show
Vucetich thinks about a lot. The answer, he says, up in varying degrees in almost any manage-
will require balancing a number of competing ment question that we have in any part of the
values—not just the value of individual animals, world. They represent, he says, “this grand
but the values of population and ecosystem question of How should humans relate to
health in addition to the values of scientific nature?” To this question, there are no easy or
knowledge and the value of wilderness. Without obvious answers. Nevertheless, he believes it is
wolves, for example, would the moose popula- important for people to debate and discuss
tion once again explode and decimate the these issues—not just scientists and experts, but
island’s forest? Would healthier wolves be able lay people, too, because “every citizen has a
to completely overwhelm moose, and drive stake in this question of how we relate to
them to extinction on the island? These are the nature.” ■
sorts of difficult questions that wildlife manag-
What’s Happening
to Honey Bees?
j What You Will Be Learning
22.1 Bees Are Keystone Species
22.2 Commercial Crops Require Bees
22.3 Flowering Plant Reproduction Relies on
Pollinators
22.4 Energy Flows Up a Food Chain
22.5 A Honey Bee Food Web
22.6 Organisms Live Together in Symbioses
22.7 Pollinators Have Different Ecological Niches
22.8 Bees Compete for Resources
22.9 What is Causing Colony Collapse Disorder?
431
Chapter 22 Community Ecology
What’s Happening
to Honey Bees?
A mysterious ailment threatens to unravel the
human food chain
D
ave Hackenberg has been keeping “I literally got down on my hands and knees
bees for more than 40 years. Every and looked between the stones for dead bees,”
spring, as flowering plants start to says Hackenberg, but the beekeeper found
bloom, he trucks bees from his home none. “I was kind of speechless. And people
in central Pennsylvania to farms around the know I’m not speechless.”
country, where they help farmers pollinate local Hackenberg’s was the first reported case of
crops—everything from California almonds to what has since become known as colony col-
Florida melons. In November 2006, as he had lapse disorder, or CCD. But Hackenberg was not
done for years, Hackenberg brought his buzzing alone. Surveys conducted in 2007 and 2008 by
cargo to his winter base in central Florida. When the U.S. Department of Agriculture and the Api-
he dropped them off, his 400 healthy hives were ary Inspectors of America found that one quar-
“boiling over” with bees. Three weeks later, ter of all beekeepers across the United States
when he returned to check on them, the bees had suffered similar unexplained devastation,
had essentially vanished; only 40 healthy hives losing anywhere from 30% to 90% of their
remained. colonies.
Mysteriously, there were no dead bees lying Since that first case, some 3 million honey
in or near the hives. Nor were there any signs of bee colonies across the United States have
intruders who might have destroyed the hives reportedly been wiped out, with American bee-
in search of honey. The bees were simply gone. keepers losing an average of 30% to 40% of their
It was, as Hackenberg said, a bee ghost town. colonies every year from 2007 through 2010. To
INFOGRAPHIC 22.2
Commercial Crops Require Bees
Many of the crops that we rely on for food, fuel and Bee hives are placed in the field. Bees
fiber rely on bees for their pollination and reproduction. leave the hive in search of nectar and
pollen, which they use to make food
for themselves and their hive.
Value attributed to honeybees Percentage of crop pollinated by…
(in millions, 2000 estimates) Honeybees Other insects Other
Alfalfa, hay & seed $4,654.2
Apples 1,352.3
Almonds 959.2
Citrus 834.1
Cotton (lint & seed) 857.7
Soybeans 824.5
Onions 661.7
Broccoli 435.4
Carrots 420.7
Sunflower 409.9
Cantaloupe/honeydew 350.9
Other fruits & nuts 1,633.4
Other vegetables/melons 1,099.2
Other field crops 70.4
Total 14,564
Besides insects, other means of pollination include birds, wind, and rainwater.
Bees gather nectar from blossoms.
Source: Compiled by CRS using values reported in R.A. Morse and N.W. Calderone. During this process, they transfer
The Value of Honeybees as Pollinators of U.S. Crops in 2000, March 2000. Cornell University.
pollen between flowers.
Filaments Anthers
Ovary
organ, called a stamen, consists of a stemlike A Critical Link in the Food Chain
filament topped with a pollen-saturated By helping plants reproduce, bees not only help
anther. When a bee lands on or brushes against sustain human food production, they also STAMEN
an anther during her pursuit of nectar and pol- maintain the integrity and productivity of The male reproductive
len, her furry body picks up pollen grains. many natural communities. Without these structure of a flower,
made up of a filament
As the bee continues to forage, she carries the miniature matchmakers, many flowering plants and an anther.
pollen to the female reproductive organ of the would become extinct, and many birds and
flower—the pistil. The pistil is mammals would go hungry. PISTIL
topped with a sticky “landing As keystone The female
That’s because, as keystone
reproductive structure
pad” called a stigma. When a species, bees play species, bees play a crucial role of a flower, made up
bee lands on the stigma, pollen
a crucial role in the in food chains—the linked of a stigma, style, and
ovary.
grains are deposited, and from sequences of feeding relation-
there travel down a tubelike food chain. ships in a community. SEED
style into the ovary, where they Take the little-known south- The embryo of a plant,
fertilize the eggs. A fertilized egg will eventu- eastern blueberry bee (Habropoda laboriosa), together with a
ally develop into an embryo-containing seed, which feeds mainly on the flowers of blueberry starting supply of
food, all encased in a
while the surrounding ovary eventually plants. This speedy pollinator will visit 50,000 protective covering
becomes the fruit (Infographic 22.3). blueberry flowers over the course of a few
TROPHIC LEVELS
Feeding levels, based
on positions in a food
chain.
1% 9%
90% of energy is lost
to metabolism, heat,
Consumers like mice and hawks obtain
Hawk – Carnivore and waste between
energy by feeding on other organisms.
each trophic level.
10% 90%
Mouse – Herbivore
100%
Producers like blueberry bushes
obtain energy from the sun. 10% of the total energy from
Blueberry Bush – Producer one organism is passed to the
next organism in the chain.
makes it to the level above it; at each step, cient than meat-eating: the same amount of a
much of this energy is lost from the chain (Info- crop can feed many more vegetarians than
graphic 22.4). meat-eaters who eat the animals that eat the
When a deer feeds on a blueberry bush, crop.)
for example, most of the energy in the blueber- While it’s helpful to think of the food chain as
ries is either burned as fuel (in aerobic respira- a stepwise series, the food-chain concept is an
tion) and given off as heat, or passed through oversimplification. Many organisms are omni-
the deer as indigestible plant fiber. Only a vores (that is, they eat both plants and animals)
very small portion (about 10%) of the energy and so occupy more than one position in the
stored in the blueberries goes to putting weight chain. The result is a complex, intertwined food
on the deer. web—like the one that links bees to the food on
This is the main reason why top carnivores your breakfast table. This food web includes
like coyotes, hawks, and wolves are scarce on not just the fruits and vegetables that bees pol- FOOD WEB
earth, and why there are no predators of these linate directly, but the animals that eat bee- A complex
creatures: there’s simply not enough energy left pollinated crops such as alfalfa and provide us interconnection of
feeding relationships
in the chain to sustain more of them. (It’s also with meat and dairy products (Infographic in a community.
why vegetarianism is more energetically effi- 22.5).
INFOGRAPHIC 22.5
A Honey Bee Food Web
The intersection of multiple food chains
in a community results in a complex
food web. Individual organisms in the food
web have multiple important roles that keep
the community healthy.
Mutualistic bacteria
Varroa mite
Bees can’t survive without the flowers, which vanEngelsdorp, and others has shown that lev-
provide food, and plants depend on the bees to els of mite infections in collapsing colonies are
help them reproduce. Honey bees have other no higher than they had been in previous years.
mutualistic symbioses, as well, including with Moreover, a mite infestation does not explain
bacteria that live safely inside the bees and the most curious aspect of the condition: the
benefit their hosts by helping them combat sudden disappearance of entire colonies.
disease. Honey bees are a colonial species: they
A third type of symbiotic relationship is com- live in hives of thousands of individuals, in
mensalism, a relationship in which one spe- which worker bees collectively support all the
cies benefits while the other is unaffected or juvenile larvae. In collapsing colonies, the
unharmed—bees living in a hollowed-out oak worker bees (all female) abandon the hive. With
COMMENSALISM
tree, for example (Infographic 22.6). no workers to help larvae reach maturity, the A type of symbiotic
As devastating as the parasitic varroa mite colony dies. relationship in which
infestation has been, it is unlikely to be the sole According to vanEngelsdorp, the worker bees one member benefits
or even primary factor responsible for the most are likely practicing something called “altruistic and the other is
unharmed.
recent colony collapses. Research by apiarist suicide.” “The worker bee knows she’s sick,” he
Hummingbirds
prefer sweet nectar
from deep, tubular
flowers.
honey bees are finding it harder and harder to Different pollinators generally have different
obtain a nutritious diet. niches, owing to their varying sizes and prefer-
ences for different f lower types. Bees, for
Competing for Resources instance, are attracted to brightly colored blos-
When European settlers first brought the West- soms—those with yellow, blue, and purple pet-
ern honey bee to the United States in the 1600s, als, for example, but not red. Butterflies, by
the bees quickly spread from managed colonies contrast, are commonly attracted to red flowers
into the wild, in some cases displacing native bee that are large and easy to land on. Moth-polli-
species. Honey bees have been so successful at nated flowers tend to have pale or white petals NICHE
colonizing new habitats because they are largely with no distinctive color pattern but with strong The space,
environmental
generalists when it comes to flower choice. fragrance (Infographic 22.7).
conditions, and
Though they tend to visit a single species of When two or more species rely on the same resources that a
flower on each foraging trip, honey bees may limited resources—that is, when their niches species needs in order
visit more than 100 species of flowers within a overlap—the result is competition. Competition to survive and
reproduce.
single geographic region over the course of a tends to limit the size of competing populations
season. In warm climates, they are active year and may even drive one out. In theory, no two COMPETITIVE
round, and tend to feed throughout the day and species can successfully coexist in identical EXCLUSION
start foraging earlier in the morning than many niches in a community because one would even- PRINCIPLE
The concept that
native bee species. In other words, honey bees tually out-compete the other—a concept when two species
have a broad ecological niche—the space, envi- described by the competitive exclusion prin- compete for resources
ronmental conditions, and resources (includ- ciple. In reality, however, very few species in an identical niche,
one is inevitably
ing other living species) that a species needs in share exactly the same niche, so different
driven to extinction.
order to survive and reproduce. species may find a competitive balance by
Honey Bee in the Coal Mine? edges that neonics are “highly toxic to honey
Honey bees aren’t the only pollinator in peril. bees.” As of 2008, both France and Germany
According to a report published in 2007 by the had banned the use of neonicotinoid products
National Research Council, the number and after severe bee losses occurred in those coun-
abundance of pollinator species have declined tries, but the ban does not seem to have pre-
greatly over the last several years. In fact, sev- vented further die-offs.
eral bumblebee species are becoming or have Although researchers have not yet been able
become extinct in North America. The concern to prove that neonics are playing a role in CCD—
among researchers and beekeepers is that “the jury is still out,” says Frazier—beekeepers
honey bees may be the “canary in the coal like Hackenberg are understandably cautious
mine,” forecasting what’s in store for other pol- about what pesticides they will allow their colo-
linators. “It’s not only the honey bees that are in nies to be exposed to (Infographic 22.9).
trouble,” says Hackenberg. “All the beneficial Because it may involve a complex combina-
insects are in a bad situation.” tion of triggers, there is no easy remedy to CCD.
What’s ailing these insects? In addition to a It may require making fundamental changes to
shrinking and fragmented habitat, a disquieting our beekeeping and agricultural practices. In
possibility is that they are being poisoned by pes- particular, we could break up fields of monocul-
ticides. Penn State researcher Frazier and her col-
leagues have looked at pollen and wax from
beehives and found large amounts of many differ-
ent kinds of pesticides, some of which are A more bee-friendly
awareness is emerging.
approaching toxic levels for the bees. “Pesticides
are definitely in the mix and we think they are
definitely a player in the stresses that bees are
experiencing,” says Frazier.
Of particular concern to beekeepers is a class
of pesticides known as neonicotinoids, or neon-
ics for short. Neonics are an artificial form of
nicotine used in commercial agriculture. (Nico-
tine, made by tobacco plants, is a natural deter-
rent to plant-eating insects.) Research has
shown that neonics can impair honey bees’ abil-
ity to find and return to their hives, and the U.S.
Environmental Protection Agency acknowl-
Pesticides
The pesticides sprayed on crops can
make their way into pollen particles.
The amounts measured in pollen have
reached toxic levels, which may be
A healthy bee colony is full of busy adult bees. affecting the health of the bees that
eat the pollen.
Likely
causes
Nosema ceranae parasite
This intestinal parasite prevents bees
from processing food properly which
can weaken and kill bees.
tures with varied bee-friendly plants: red clover, meadow,” for example, or becoming a bee-
foxglove, and bee balm, for example. We could keeper oneself.
also use pesticides sparingly and avoid spraying In addition, says bee expert Frazier, “people
at times of day when bees are actively foraging. need to take more time to understand where
While these individual steps would certainly their food comes from, what it takes to produce
help matters, apiarist Dennis vanEngelsdorp food and have this incredible supply of food
diagnoses a more systemic problem. In his esti- available to us.”
mation, we suffer from NDD—“nature deficit While the fate of the honey bees remains
disorder.” To help bees, he says, we need also to uncertain, there are signs that a more bee-
cure ourselves. As treatment, he prescribes friendly awareness is beginning to emerge,
reconnecting to nature in a more immediate thanks in part to the concerns raised by CCD.
and local way—“having a meadow or living by a Häagen-Dazs, the ice-cream maker, has recently
The Heat Is On
j What You Will Be Learning
23.1 Vermont Maple Syrup: A Thing of the Past?
23.2 Rising Temperatures Affect Plant Behavior
23.3 Maple Tree Range Is Affected by Increasing
Temperature
UP CLOSE Biomes
23.4 The Greenhouse Effect
23.5 The Earth’s Surface Temperature Is Rising With
Carbon Dioxide Levels
23.6 Rising Temperatures Mean Widespread
Ecosystem Change
23.7 Arctic Temperatures Are Rising Fast
23.8 Arctic Sea Ice Is Melting
UP CLOSE Chemical Cycles: Nitrogen and Phosphorus
23.9 The Carbon Cycle
23.10 Measuring Atmospheric Carbon Dioxide Levels
23.11 Anthropogenic Production of Greenhouse
Gases
Chapter 23 Ecosystem Ecology
The Heat Is On
From migrating maples to shrinking sea ice, signs of a
warming planet
F
or more than two centuries, Burr Morse isn’t the only one to notice the shift.
Morse’s family has collected sap from Sugar farmers across New England have noted
Vermont’s maple trees and boiled it to the changes in temperature and are leery about
sweetened perfection. If you pour their long-term effects.
maple syrup over your breakfast pancakes or Warmer winters in New England could have a
eat maple-cured ham, you’ve likely enjoyed the large economic impact on the region. As
results of their careful craft, or that of other Ver-
mont sugar farmers. About one in four trees in
the state of Vermont is a sugar maple (Acer sac-
charum), and each year the state produces
between half a million and a million gallons of
syrup, making Vermont the number one maple
syrup producer in the United States. Yet what
has been a proud family tradition and the eco-
nomic lifeblood for generations of sugar farm-
ers could very well be in jeopardy.
“In the last 20 years we have had a number of
bad seasons and most of those I would attribute
to temperature that is a little too warm,” says
Morse. “For maple sugaring to work right, the
nights have to freeze down into the mid 20s, and
the days have to thaw up into the 40s. And the
nights for those 20 years, it seemed, were not
quite getting cold enough.”
INFOGRAPHIC 23.1
Vermont Maple Syrup: A Thing of the Past?
The amount of maple syrup produced in Vermont has been declining, in part because of a shortening of the maple syrup
season in Vermont. Meanwhile, Canadian production has been increasing because of increased marketing, government
subsidies, improved technologies, and, likely, climate change.
6,500
Canada
5,000
Total U.S.
Vermont and
4,500 Vermont
total U.S. Canadian
4,000 production has production has
U.S. Gallons (× 1,000)
significantly significantly
3,500 decreased. increased.
3,000
2,500
2,000
1,500
1,000
500
0
1915 1920 1925 1930 1935 1940 1945 1950 1955 1960 1965 1970 1975 1980 1985 1990 1995 2000
Year
Source: New England Regional Assessment, Barrett Rock and Shannon Spencer.
30
Earlier Later
20
10
0
–36 –33 –30 –27 –24 –21 –18 –15 –12 –9 –6 –3 0 3 6 9 12 15 18 21
Change in First Flowering Date (days)
Rapid Changes in Flowering Time in British Plants. A. H. Fitter and R. S. R. Fitter (2002) Science, Vol 296, p. 1689–1691.
air. Because the biotic and abiotic parts of an the daily fluctuation in temperature,” explains
ecosystem can and do change, ecosystems are ecologist Perkins. “Small changes in the day-to-
not static entities but dynamic systems. And day temperature pattern will have large conse-
because the parts of an ecosystem are so inter- quences on sap flow.”
connected, a small change in one part of an Historically, trees have been tapped in early
ecosystem can have a domino effect. March when the sap began to flow; the sap was
No one knows this better than sugar farmers. then collected for the next 6 weeks. But about 10
“The flow of sap from maple trees during the years ago, Perkins started getting calls from
spring season is controlled almost entirely by sugar producers saying that they were tapping
INFOGRAPHIC 23.3
Maple Tree Range Is Affected by Increasing Temperature
Models including 25 environmental parameters predict the rapid disappearance of the sugar maple, Acer saccharum, from
the United States with even small increases in temperature. As the ideal environmental niche for this tree migrates north
into Canada, so does the tree population.
+0.5° C +1.0° C
1 23 46 69 92 115 138
UP-CLOSE Biomes
Tropical Forest:
Tropical forests are biomes
characterized by warm temperatures
and sufficient rainfall to support the
growth of trees. Tropical forests may
be deciduous or evergreen, depending
Desert: on the presence or absence of a
A biome characterized by extreme dry season.
dryness. Cold deserts experience cold
winters and hot summers, while hot Grassland:
deserts are uniformly warm throughout A biome characterized by perennial
the year. grasses and other nonwoody plants.
In North America, the prairies are
examples of grasslands.
Coniferous Forest:
A biome characterized by Aquatic: Marine
evergreen trees, with long and cold This biome covers about three-fourths
winters and only short summers. of the earth and includes the oceans,
coral reefs, and estuaries.
Tundra:
A biome that occurs in the Arctic and Aquatic: Freshwater
mountain regions. Tundra is characterized A biome characterized by having a
by low-growing vegetation and a layer of low salt concentration. Freshwater
permafrost (frozen all year long) very biomes include ponds and lakes,
close to the surface of the soil. rivers and streams, and wetlands.
0.8
Temperature Change
Temperature has increased
0.6
Temperature Change °F
–0.2
–0.4
–0.6
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
2000
380
CO2 Parts per Million by Volume (PPMV)
300
280
260
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
2000
absorbed by the ocean and more of the relatively “whack-a-mole”–like breathing holes in the ice
warm ocean is exposed to air, raising the air tem- and are nabbed by bears. Yet the size of this fro-
perature even more. It’s a positive feedback loop, zen habitat has been shrinking, greatly reducing
which means that as additional ice is lost, tem- the bears’ ability to obtain food.
peratures will rise at an accelerated pace. Moreover, over the past few decades the ice
According to the extensive Arctic Climate has been breaking up earlier and earlier in
Impact Assessment, the result of 4 years’ work spring. The sea ice in Hudson Bay, Canada, for
by more than 300 scientists around the world example, now breaks up nearly 3 weeks earlier
published in 2004, Arctic temperatures are pro- than it did in the 1970s. In the absence of unbro-
jected to rise by an additional 4°–7°C (7°–13°F) ken summer sea ice, the polar bears are stuck
over the next 100 years (Infographic 23.7). on land (where there are no seals), or are forced
Warming temperatures could spell disaster to swim long distances to reach sea ice. Some,
for species that call the Arctic their home. Polar exhausted by the journey, drown. Those that do
bears, for example, spend most of the year survive have fewer opportunities to hunt. Cana-
roaming the Arctic on large swaths of floating dian polar bears now weigh on average 55
sea ice that blanket a good portion of the Arctic pounds less than they did 30 years ago, seri-
Ocean from September through March. The ously compromising their reproductive ability.
massive mammals use the sea ice to hunt for Scientists have monitored sea ice on a daily
seals, which periodically pop up through basis by satellite since 1979. Over the past three
Temperature is increasing
faster at the earth’s poles
than at its equator.
–3.5 –2.5 –1.5 –1.0 –0.6 –0.2 0.2 0.6 1.0 1.5 2.5 3.5
INFOGRAPHIC 23.8
Arctic Sea Ice Is Melting
Rising temperatures have caused the polar ice cap to melt and break apart earlier in the season. The reduction in the
extent of summer sea ice is threatening the survival of polar bears, which require the sea ice to hunt for seals.
NORTH
POLE
Since 1979, more than 20% of the polar ice cap has melted away.
120
Days
Nitrogen atoms cycle between different chemical and biochemical compounds as they move from organisms to the soil, water,
and air and back to organisms. A variety of natural processes as well as some human activities contribute to the transformation
and movement of nitrogen through the ecosystem.
Nitrogen
fertilizer
Proteins in plants
Assimilation of
and animals
ammonium (NH4+)
by plants
Denitrifying Assimilation
bacteria by plants
Nitrogen
fixation
Nitrogen-fixing
bacteria in root
nodules of legumes
Nitrates
(NO3–) Decomposers
Nitrogen-fixing
bacteria in soil
Nitrifying
bacteria
Nitrogen fixation
Ammonium
(NH4+)
Phosphorus cycles primarily through soil, water, and organisms. It is not a major component of gases in the atmosphere.
Phosphorus is generally added to an ecosystem by the weathering of rocks, although human activities can also add phosphorus
compounds to soil and water. When taken up by organisms, it is incorporated into organic molecules, then released back to the
environment by the process of decomposition.
Uplifting
Weathering
of rock
of rock
Phosphates
Fertilizer and in rock
detergents
Phosphates
in organic
compounds Animals
Plants
Dead organic
Phosphates in matter
Phosphates in soil
solution (inorganic)
Decomposition Decomposers
in soil
Precipitated
Rock
(solid) phosphates
CO2 produced from CO2 produced from CO2 removed through Net CO2 released into the
human activity: + natural processes: – photosynthesis: = atmosphere each year:
7.9 200 203 4.9
(Measurements made in billions of tons)
Atmospheric
CO2
Photosynthesis
Plant Storage in
Deforestation respiration land plants
Oceanic
photosynthesis
and respiration
Burning fossil fuels Human/animal
respiration
Fossilized carbon
For the most part, the amount of carbon Air bubbles trapped in ice cores from the
present in the atmosphere as carbon dioxide glacial ice of Greenland—an indirect measure
has remained fairly constant. But since the late of carbon dioxide in the atmosphere—show
1700s, with the rise of industry and the internal relatively constant amounts of CO2 until 300
combustion engine, people have begun to alter years ago. Since direct measurement of atmo-
the carbon cycle, adding increasing amounts spheric CO2 began late in the 19th century, its
of CO2 to the atmosphere. concentration has increased about 35% (Info-
Before the industrial revolution, the carbon graphic 23.10).
trapped in fossil fuels was not easily accessible, Virtually all climate scientists agree that
and therefore it wasn’t cycling as part of the greenhouse gases emitted by human activi-
carbon cycle. But modern drilling and mining ties—primarily driving gasoline-powered cars
methods have unlocked the deep reserves of and burning coal to generate electricity—have
this ancient planetary energy. The CO2 released caused most of the global rise in temperature
when humans burn fossil fuels is the largest observed over the past 50 years. In 2001, an
source of the carbon being added to the atmo- international group of scientists and policy-
sphere by humans and is a major contributor makers known as the Intergovernmental Panel
to the enhanced greenhouse effect. on Climate Change concluded that the global
400
Levels from 1958 to the present
390 show seasonal fluctuations
Concentration (PPMV)
380 due to higher levels of
370 photosynthesis in the summer
360 and a rapid, long-term climb.
350
340
330
320
310
300
Mauna Loa Research Station 1958 1968 1978 1988 1998 2008
290
270
CO2 (PPMV)
250
230
390
Some ice cores contain layers of
Together, these
ice from hundreds of thousands
data provide a Historical levels of CO2 (<300 ppm) of years ago, and can be used to
complete picture 370
measured in ice cores never approached measure historical levels of CO2.
of atmospheric present-day levels (nearly 400 ppm) These measurements show that
CO2 (PPMV)
CO2 levels 350 measured both at Mauna Loa and CO2 levels cycle in patterns that
over time: in ice cores. correlate with major ice ages.
330
310
290
270
Year 1000 1200 1400 1600 1800 2000
Using ________________________
___________for energy converts
organic carbon to CO2
Most organisms, including plants, animals,
and decomposers perform _________________,
producing CO2 from organic food.
15. Decomposers ________ CO2 by the process of b. archives of the Manua Loa observatory (to
_________. examine 1750 records)
a. emit; photosynthesis c. tree-ring analysis (to look for evidence of
b. take up; photosynthesis extreme fires)
c. emit; cellular respiration d. ice cores from ice formed in 1750
d. take up; cellular respiration
e. store; cellular respiration SCIENCE AND ETHICS
19. Visit an online carbon footprint or carbon
j USE IT emissions calculator (for example, http://www.epa.
16. How is ice useful in measuring atmospheric gov/climatechange/emissions/ind_calculator.html)
levels of CO2? and calculate your total carbon emissions.
a. What is your largest source of emissions?
17. Explain how each of the following contributes to b. What steps can you take to decrease your
an elevation of levels of greenhouse gases: carbon emissions?
a. large-scale slash-and-burn agriculture c. Explain how line-drying (that is, air-drying)
b. driving gasoline-fueled cars your laundry rather than drying it in the dryer
c. producing cattle for beef and dairy products can decrease your carbon emissions.
d. rice production
20. Using the carbon footprint calculator, design a
18. Which of the following data would you use to low-carbon footprint menu for 1 day. Explain the
determine the levels of atmospheric CO2 in 1750? basis for your food choices. Do you think that a low-
Justify your choice, including an explanation of why carbon menu would be different in different parts of
the other alternatives would not be as effective. the country? Why or why not?
a. historical weather records of daily
temperatures
Eco-Metropolis
j What You Will Be Learning
24.1 Human Population Growth
24.2 The Human Ecological Footprint
24.3 Countries Differ in Their Ecological Footprint
24.4 The Human Ecological Footprint Is Greater
Than Earth’s Biocapacity
24.5 Fossil Fuels Are Non-Renewable
24.6 Eco-Cities: Sustainable by Design
24.7 Renewable Resources Reduce Our
Ecological Footprint
24.8 Water Is a Renewable Resource
24.9 Depletion of Fresh Water By a Growing
Population
24.10 Water Availability Is Not Equally Distributed
24.11 Species Loss Increases as Human
Population Grows
24.12 What You Can Do To Live More Sustainably
471
Chapter 24 Sustainability
Eco-Metropolis
Designing the city of the future
B
umper-to-bumper traffic, a noxious Agriculture will be entirely organic and local.
cloud of gray smog, towering skyscrap- All trash will be recycled, composted, or used to
ers that seem to be straight out of the generate electricity. Vehicles will be powered
futuristic movie Blade Runner: wel- entirely by renewable energy. In short, Dongtan
come to Shanghai, China’s largest city. With a will be a model of sustainability for the rest of
population of 19 million and growing, it’s not the world to emulate.
exactly a place you’d call environmentally
friendly. But just 15 miles from this concrete
Cities occupy just 2% of the terrestrial surface area
jungle, on the island of Chongming at the
mouth of the Yangtze River, something unprec- of the earth and have only half the world’s
edentedly green is in the works: the world’s population, yet they consume more than 75% of its
first eco-metropolis built completely from natural resources.
scratch. About three-fourths the geographic
size of Manhattan, the eco-city known as Dong- Many urban planners and environmentalists
tan will be an urban oasis of green-roofed would agree that it’s a model the planet badly
buildings, tree-lined streets, and pedestrian- needs. According to the United Nations, cities
friendly neighborhoods—the polar opposite of occupy just 2% of the terrestrial surface area of
its dystopian neighbor. the earth and have only half the world’s popula- SUSTAINABILITY
The use of the earth’s
More than just a nice place to live, Dongtan is tion, yet they consume more than 75% of its natu- resources in a way
being designed to incorporate lessons of cut- ral resources. The reason for this imbalance? Our that will not
ting-edge ecological science. According to its cities are flawed in their very design, say urban permanently destroy
or deplete them; living
designers, Dongtan will be entirely self-suffi- planners—built as if natural resources like land
within the limits of the
cient in food, water, and energy. It will produce and water were unlimited, and waste was some- earth’s biocapacity.
no net carbon emissions and zero pollution. thing that would magically disappear.
NATURAL
RESOURCES
Raw materials that
are obtained from the
earth and are
An aerial view of Dongtan. considered valuable
even in their relatively
unmodified, natural
form.
(now that its design is complete), and the city’s INFOGRAPHIC 24.1
future prospects now rest with the Chinese gov-
ernment. But even if it remains just a twinkle in Human Population Growth
an architect’s eye, Dongtan will have already
achieved something important, shining a city- Since the advent of agriculture, the human population has been
following an exponential growth pattern, and is approaching
size spotlight on one of the most pressing issues
7 billion people. Some estimates predict that the human population
facing humanity today.
will number 9 billion by 2050.
Population in Billions
1974 4
since 1950, thanks in large part to antibiotics
and other advances in public health that have 1960 3
4
allowed people to live longer. And each hour 1930
2
more than 10,000 new people are added to the
1800 1850
planet—roughly 3 per second, or 90 million per 1 3
year. By 2050, demographers estimate, we’ll hit
0
the 9 billion mark. The human population is 1800 1820 1840 1860 1880 1900 1920 1940 1960 1980 2000 2007 2
growing exponentially (Infographic 24.1).
As the human population grows, so does our Industrial Revolution begins
Bubonic plague 1
environmental impact. Ecologists measure that
Agriculture (“black death”)
impact with a tool known as the ecological
footprint, which calculates the amount of 0
land and water area a population requires to –10,000 –8000 –6000 –4000 –2000 0 2007
supply the resources it consumes and to absorb Year
the wastes it generates. Humans require a vari-
How do
you live?
Grazing and
Built-Up Land: Crop Land:
Stored Carbon: Once was Requires a lot of Fishing Grounds:
Photosynthetic biologically Forest Land: land, water, and Depletion of wild
organisms and fossil productive, now is Cut for consumer other resources like stock or resources
fuel consumption space we live on. products. fertilizer. used in farming.
What
natural
resources
does it
require?
ety of natural resources to live: farmland to styles, the ecological footprint puts a number on
grow crops or raise cattle, gasoline to power our environmental impact (Infographic 24.2).
cars, oxygen to fill our lungs, to name just a Ecological footprints are expressed in units
few. All these resources come, directly or indi- called global hectares, with 1 global hectare
GLOBAL HECTARE rectly, from the earth. representing the biological productivity (both
The unit of In addition to providing us with natural the resource-providing and waste-absorbing
measurement of the
ecological footprint, resources, the earth also acts like a sponge, capacity) of an average hectare of land. A hec-
representing the absorbing our wastes: the carbon dioxide we tare is 10,000 square meters—about the size of
biological productivity emit, for example, and the garbage we produce. a soccer field. As of 2006, the global average
of an average hectare
By quantifying the amount of biologically pro- ecological footprint was 2.6 global hectares
of land.
ductive earth area it takes to sustain our life- per person per year. In other words, it takes
doesn’t sound like very much,” says Head, “but North America Middle East and
it means that China … needs to find about 90 Central Asia
Europe EU
million hectares of new land every year for all 10 Europe Non-EU Asia Pacific
the resources needed to support the growth Latin America and Africa
Global Hectares per Person
INFOGRAPHIC 24.4
The Human Ecological Footprint Is
Greater Than Earth’s Biocapacity
When comparing our biological demand, or ecological footprint, with the earth’s biocapacity, it is
clear that our footprint has been exceeding biocapacity since the mid-1980s. Our greatest demand
relates to energy use, indicated by our large carbon footprint.
Earth’s Biocapacity =
1.0
1 planet earth
0.5
NONRENEWABLE
RESOURCES 0.0
Natural resources that 1961 1971 1981 1991 2001 2007
cannot be replaced.
WWF Living Planet Report, 2010
INFOGRAPHIC 24.5
Fossil Fuels Are Non-Renewable
Most of the natural resources we use to supply our energy needs are non-renewable. Coal, oil, and natural gas are
fossil fuels that take millions of years to form as organic material is compressed by layers of sedimentary rock.
While plentiful today, and relatively cheap to obtain, fossil fuels come with significant environmental and human costs.
Canada, can ride on a light rail transit system that superficial aesthetics, such as the decorative
obtains all its power from wind turbines. Outside ornamentation of buildings, and are instead
London, England, the community of 100 resi- concentrating on what architects call perfor-
dences known as BedZED satisfies all its energy mance-based design.
needs from renewable sources such as solar pan- Focusing on performance and efficiency
els and locally grown firewood. Apartments in means rethinking the way cities work from the
Stockholm, Sweden, come equipped with stoves ground up—starting with transportation. “[T]the
that burn gas extracted from organic waste gen- essential character of a city’s land use comes
erated in the community. In San Diego, garbage down to how it manages its transportation,” write
trucks run on methane gas captured from decay- Peter Newman and Jeff Kenworthy in their book
ing garbage in landfills, while residents of Ver- Sustainability and Cities: Overcoming Automobile
mont can purchase “cow power”—energy Dependence. When it comes to sustainability,
obtained from cow manure—from their local util- car-based transportation is just about the worst
ity company. The residents of Vienna and Paris thing that can happen to a city. Yet in many mod-
bike freely around the city on municipally owned ern cities, such as Los Angeles and Houston,
bicycles, greatly lowering their footprint. people have few alternatives to driving.
Not so in the eco-city. To eliminate the need
for cars in Dongtan, all residential neighbor-
The plan is for Dongtan to support 80,000 people hoods will be within 7 minutes’ walking dis-
by 2020, and 500,000 people by 2050. tance of public transportation, which will
provide easy access to schools, hospitals, and
But a whole city that is entirely self-sufficient businesses. Solar-powered water taxis and
in terms of energy and environmentally neutral hydrogen fuel cell buses will provide the pri-
in terms of carbon emissions and pollution? It mary means of public transport. Bicycle paths
sounds too good to be true. and pedestrian walkways will crisscross the
city. Cars will not be banned in the city, but car
Sustainable by Design parks placed outside Dongtan will encourage
The plan is for Dongtan to support 80,000 peo- leaving them behind. Curbing car culture will
ple by 2020, and 500,000 people by 2050—the greatly reduce Dongtan’s energyconsumption.
latter being about the population of central The city will also be built in such a way that
Atlanta. And yet, Dongtan’s per capita ecologi- less energy is required to heat and cool it. Con-
cal footprint will be a fraction of Atlanta’s: 2.6 ventional cities are essentially “heat islands”—on
global hectares for a Dongtan resident versus 13 average, 1°C (1.8°F) warmer than the countryside
for an Atlantan. during the day, and up to 6°C (10.8°F) warmer at
How will Dongtan achieve a lower footprint? night. That’s because concrete and asphalt
For one, the designers are not at all focused on absorb solar radiation. On a hot summer day, air
Plant trees along streets to The green roof at Chicago City Hall
Concrete Heat Islands
cool cement neighborhoods. cuts air-conditioning costs.
Heat is generated, raising energy consumption
required to cool buildings. Fresh rainwater is
polluted as it runs off into drains.
conditioning can consume more energy in a city able resources—those that can be naturally
than any other single activity. replenished as long as the rate of consumption
One very simple way to beat the heat is to is not greater than the rate of replacement.
plant more trees. Trees cool cities by providing Wind turbines and solar panels, for example,
shade. They also intercept solar radiation that will provide the bulk of electricity. In addition,
would otherwise generate heat if it were a combined heat and power plant will turn bio-
absorbed by concrete or asphalt. In the eco-city, mass such as leftover rice husks—the region has
tree-lined streets, rooftop gardens, and green plenty—into valuable energy for human use.
roofs will all temper the heat-island effect. Heat given off during the process will in turn
The buildings themselves will be con- be piped into homes and businesses. Even
structed differently in Dongtan, with walls and human waste won’t go to waste: treated sew-
windows designed to provide natural insula- age will be composted to fertilize crops. With
tion and ventilation. To discourage the overuse such measures, designers estimate that Dong- RENEWABLE
of electricity, easy-to-read meters placed in tan will use 65% less energy than a conven- RESOURCES
Natural resources that
obvious locations inside homes and offices will tional city of the same size (Infographic 24.6). are replenished after
allow residents to see how much they use. Cost While cities get a bad rap for being resource use as long as the rate
will be commensurate with usage. hogs, they do have a key advantage over more- of consumption does
not exceed the rate of
Most important, Dongtan will generate all of spread-out ways of living—they operate as econ-
replacement.
its electricity and heat entirely from renew- omies of scale. In other words, the density of
Dump trucks fill their tanks with Batch reactors digest human
Waste
methane waste collected waste to use for fertilizer.
Cities produce tons of solid waste per day, which
from landfils.
ends up in landfills. Sewers work to capacity to
remove human waste in high-density populations.
Housing, work, and schools are Tree-lined streets cool the air Public transportation is by fuel-cell
within walking or biking distance and shade buildings, reducing bus or solar-powered water taxi, both
of one another. Paths encourage electricity demand for air of which minimize pollution and use
pedestrian traffic. conditioning. renewable energy.
people makes possible a more efficient and part of the solution rather than part of the
affordable utilization of resources, which is ulti- problem.
mately more sustainable. For instance, a public
transportation system that transports tens of Moving Forward
thousands of people who might otherwise be Construction of Dongtan was supposed to begin
driving gas-guzzling cars can reduce the carbon in 2007, with the first phase of development—
footprint significantly. including arrival of the city’s first 10,000 resi-
New York is a good example. The average dents—completed by 2010, in time for the
New Yorker who takes the subway 1 mile to work Shanghai Expo. That didn’t happen. Develop-
uses much less fossil fuel energy than a subur- ment has stalled, and it’s unclear whether the
banite who commutes 10 miles to work in a car. ambitious plans will ever be fully realized. Crit-
In fact, according to David Owen, author of ics of Dongtan have long held that the city was a
Green Metropolis: Why Living Smaller, Living utopian fantasy, more useful as a public rela-
Closer, and Driving Less are the Keys to Sustain- tions ploy than a place to live.
ability, New Yorkers have the smallest per cap- Peter Head of Arup emphatically challenges
ita carbon footprint in the United States, a that view. While the future of Dongtan itself is
statistic that has even led some commentators uncertain, he says China has plans to make the
to refer to New York as the Big Green Apple. whole of Chongming an eco-island, using speci-
The solution to the problems of urbanism, fications developed for Dongtan. “In many
then, is not to de-urbanize, but to make cities ways, all of the ideas and thinking [are] alive and
Solar: 0.07% of World’s Energy Why Don’t We Use It More? Environmental Impact:
Solar power is currently much more expensive to Solar energy traps energy from the sun and converts
produce than non-renewable options. Producing it into electricity and heat with little impact on the
solar panels involves using toxic chemicals, and the environment. As nothing is burned to make the
resulting waste must be properly disposed of. electricity there are zero polluting emissions from
this process.
Wind power is currently much more expensive to Wind energy is used to turn wind turbines, producing
produce than non-renewable options. Wind generators electricity with little impact on the environment. In
take up space, either on land or in the water, and must the absence of combustion, no pollutants are
be located in windy areas. Some people don’t want a released to the environment. Bird species may be
visible wind farm near their homes. affected as turbines encroach on their air space.
INFOGRAPHIC 24.8
Water Is a Renewable Resource
Fresh water is a valuable resource. In addition to its role in keeping us hydrated, it irrigates crops, sustains fisheries, and
provides recreational opportunities. Although water is “used,” it is not “used up”: it is ultimately returned to the global
ecosystem as it evaporates to the atmosphere, flows into rivers or streams, or enters underground aquifers.
Precipitation
Cloud formation
Groundwater
Water storage
Underground
Groundwater in oceans
Aquifer flows into rivers,
lakes, and oceans.
0 0
1900 1920 1940 1960 1980 2000
Year
Source: Making Every Drop Count, Scientific American, Feb. 2001.
water to produce a kilogram of corn but more on the planet. Agriculture, industry, and cities
than 15 times that much to produce a kilogram all play a role here. Runoff from streets carries
of beef. pollutants such as motor oil and sewage; fertil-
One striking example of the consequences of izers, pesticides, and toxic chemicals leach from
increased water use can be seen in the Colorado fields and factories. These substances can even-
River, which is often so depleted that in dry peri- tually reach aquifers, rivers, and oceans, con-
ods it fails to reach the Gulf of California, a sign taminating the water that both humans and
that water is being withdrawn from this resource wildlife depend on.
faster than it is being replenished (Infographic Some countries experience water scarcity
24.9). more acutely than others. That’s because the
Though water is renewable, pollution shrinks geographic distribution of freshwater does not
the total amount of available clean freshwater match the distribution of the world’s popula-
INFOGRAPHIC 24.10
Water Availability Is Not Equally Distributed
Fresh water is not evenly distributed across the globe, and its availability does not always follow international borders. In addition,
access to even a sufficient water supply may be limited by economic, social, and political circumstances, such as war and ethnic
conflict. As the human population continues to grow, and access to clean fresh water continues to decline, these problems are likely to
intensify, particularly in areas with existing scarcities of water.
60,000 8,000
Species Extinction and Human Population
7,000
50,000
6,000
Population Numbers
Extinction Numbers
40,000
5,000
expanded into areas once occupied only by wild tually reach an upper limit, at which point lack
creatures (Infographic 24.11). of resources and available space will curb
Common sense tells us that the human popu- growth.
lation cannot continue to grow unchecked What that precise limit is remains up for
indefinitely—otherwise, within a few hundred debate. The United Nations has estimated that
years people would cover every square foot of the earth’s carrying capacity (Chapter 21) is
the globe and many other species would be long between 7 and 13 billion people; other research-
gone. Experience with other species also tells us ers put the number much higher. Why is it diffi-
that the size of the human population will even- cult to pin down an exact figure? In part because
INFOGRAPHIC 24.12
What You Can Do to Live More Sustainably
Take Action Why? Your Impact!
The average U.S. household uses over 22,000 If only 1,000 of us install faucet aerators ($2 –
Reduce Home gallons of water per year for showers and $5) and efficient showerheads (<$20), we can
Water Use baths. Water is almost always heated, save nearly 8 million gallons of water and
resulting in increased fossil fuel consumption prevent over 450,000 pounds of carbon dioxide
and greenhouse emissions. emissions each year!
Install Electricity production is the largest source By replacing just four standard bulbs with CFLs,
Compact of greenhouse gas emissions in the United you can prevent the emission of 5000 pounds
Fluorescent States, and lighting accounts for about of carbon dioxide and reduce your electricity bill
Lightbulbs 25 percent of American electricity by more than $100 over the lives of those bulbs.
(CFLs) consumption.
Feedlot beef is particularly wasteful. Eat more veggies. More of the energy in plants
Producing one pound of feedlot beef in will go directly to you if it doesn’t have to pass
Eat Less
California, for example, requires five pounds through a cow first. Plant food goes farther to
Feedlot Beef
of grain and over 2,400 gallons of irrigation support you than it does to raise feedlot beef.
water.
Reduce Electronics use energy even when they are When you plug your electronics into a power
Vampire turned off! This standby “vampire energy” cord that you turn off each night, you will save
Energy accounts for 5 to 8 percent of a single the equivalent of one month’s electric bill
Waste family’s home electricity use per year. each year.
Drive Less and With less than 5% of the world’s population, Driving smaller vehicles and those with more
Invest in Fuel America consumes a quarter of the world’s fuel efficiency cuts carbon dioxide emissions
Economy oil and emits a quarter of the greenhouse and reduces dependence on non-renewable
gases, largely from automobiles. fossil fuels.
75% of our trash can be recycled. The U.S. Recycling one aluminum can saves enough
Recycle population discards each year enough glass energy to run a TV for 3 hours. To produce each
bottles and jars to fill 12 giant skyscrapers. week’s Sunday newspapers, 500,000 trees are
Recycling materials uses fewer non- cut down. Recycling a single run of the Sunday
renewable resources, saves energy, results in New York Times would save 75,000 trees.
less air and water pollution, and creates Taking reusable bags to do your weekly grocery
more jobs than making new materials. trip reduces our demand for petroleum for
plastic bags.
j KNOW IT e. b and c
1. From what you’ve read in this chapter, explain
8. Mark each of the following natural resources as
some of the advances that have permitted the
renewable (R) or nonrenewable (N):
human population to grow exponentially.
Freshwater _____
Coal _____
2. Describe an ecological footprint.
Codfish populations in the North Atlantic _____
Wind ____
3. From your understanding of an ecological
Sunlight _____
footprint and what you read in this chapter, which of
the following places likely has a population with the
9. If oil is formed from fossilized remains of once-
greatest ecological footprint?
living organisms, and if organisms keep dying, why is
a. Dongtan, China
oil considered to be a nonrenewable resource?
b. a rural village in China
c. Calgary, Canada
d. Houston, Texas j USE IT
e. New York, New York 10. The renewability of some resources can depend
on human choices and activities. List some such
493
not increase in size, but only replicate. Viruses do not relatively warm ocean water at night. In contrast, the
obtain or use energy on their own. Unlike living desert sand is made primarily of silicon dioxide, which
organisms, viruses are not made up of cells. cannot absorb nearly as much heat during the day as can
11. Life would be likely, but there is not sufficient evidence to water, and rapidly cools at night.
conclude that life is present. There are nonliving (abiotic) 21. b
means of producing glucose from carbon dioxide and 22. Answers will vary. Some considerations if Martian dirt
water. samples are brought to earth are disease; competition
12. a: Sterols and triglycerides differ both in structure and in with native species (the invasive species effect); ecological
function. Sterols are composed of four carbon rings and effects, public fear. If an earth life form is released on
function as color-producing pigments, hormones, or Mars, effects may be destruction of the Martian
components of membranes (such as the cell membrane). environment and competition with Martian life forms if
Triglycerides are composed of three fatty acids covalently any are present, and possible extinction of those Martian
linked to the molecule glycerol. Triglycerides commonly life forms. Ethical implications include effects on religious
function as energy storage molecules which in animals views, cultural effects, the possibility of creating a disease-
also serve to thermally insulate the organism from the causing organism, and possible medical breakthroughs.
environment. b: Phospholipids and triglycerides both
have a glycerol backbone to which two fatty acids are Chapter 3
attached. The difference is that in the third position either 1. Cell theory posits that the fundamental units of life are
a third fatty acid is attached (triglycerides) or a cells. All living organisms are made up of one or more
phosphoryl-containing group (containing oxygen and the cells. Cells arise only from other living cells.
element phosphate) is attached (phospholipids). Because
2. d
of this difference in structure, these molecules have
different chemical properties and biological functions. 3. prokaryotic cells and eukaryotic cells
13. Olive oil is made up of triglycerides, which are nonpolar 4. a: No. According to cell theory, neither viruses nor prions
molecules that are hydrophobic (“water-fearing”). Salt is (the protein aggregates that cause mad-cow disease) are
made up of Na+ and Cl- ions that are charged and interact considered to be living organisms. b: No. Nonliving agents
with the polar ends of water molecules. Therefore salt is can cause disease.
considered hydrophilic. 5. All living organisms contain genetic instructions in the
14. e form of DNA. All living organisms also synthesize the four
classes of biological molecules (proteins, carbohydrates,
15. aqueous. a: The solvent is water. b: The solute is sugar.
lipids, and nucleic acids). Additionally, all known living
Additionally, both coffee and tea contain many other
organisms have a cell membrane and ribosomes.
organic molecules that become dissolved in the water
when tea or coffee is brewed. These molecules are 6. e
produced by the tea leaves or coffee bean, and are 7. c
extracted and dissolved into the hot water when brewed. 8. a: Both involve the movement of a solute moving down a
16. c concentration gradient (that is, moving from a higher
17. a concentration to lower concentration). In both cases,
additional energy is not required. b: Both facilitated
18. Hydrogen bonds and ionic bonds are both electrostatic
diffusion and active transport require the function of a
attractions between charged atoms of two different
protein embedded in a membrane. However, the solute is
molecules. Both are noncovalent interactions. Hydrogen
moving in the opposite direction (relative to its
bonds are between partially charged atoms (usually atoms
concentration gradient) in these two cases.
of a water molecule), whereas ionic bonds are between
ions, which have fully positive or negative charges. 9. Facilitated diffusion is necessary for molecules that
cannot cross the phospholipid bilayer easily by
19. Oil does not dissolve in the aqueous vinegar because the
themselves. Generally this is true of larger molecules and
oil is hydrophobic. Water molecules are strongly attracted
charged molecules. Small, nonpolar molecules, such as
to one another (via hydrogen bonds) but not to the oil.
molecular oxygen (O2) can pass freely through
Water excludes the oil in favor of interacting with itself or
membranes, whereas polar molecules (like water) cannot.
other hydrophilic molecules. Because salt is hydrophilic, it
will dissolve in the vinegar but not in the oil. The ions in 10. c
salt will remain together in oil because they are attracted 11. Although the bacterial cell wall protects bacteria cells
more strongly to each other (by ionic interactions) than to from lysis by keeping the cell from swelling, water can still
the nonpolar triglycerides that make up the oil. In the escape from a cell placed in an environment that is high in
vinegar, the ions that make up salt will become dissolved salt. Because the concentration of salt outside the cell is
because they are attracted to the polar water molecules. high, the concentration of water is low. Water rushes out
20. Liquid water can absorb and store large amounts of heat of the bacteria cell toward the lower concentration. As a
without evaporating and lose large amounts of heat before result, bacterial cells shrink and die through desiccation.
freezing. Therefore, seaside towns are buffered against Some bacteria are more tolerant to high salt
changes in temperature because heat is absorbed by the concentrations than others.
ocean during the day and is transferred to the air from the 12. b
494 ANSWERS
13. d antibiotics. For this reason, antibiotics should be used
14. e only when they are necessary to treat a bacterially caused
disease.
15. a: A mitochondrion (plural: mitochondria) is a rod-shaped
organelle, approximately the size of some bacteria.
Chapter 4
Mitochondria are thought to have arisen by
endosymbiosis, in which a bacterium is engulfed within 1. c
another, larger cell. They are bound by a double 2. catabolic
membrane of two phospholipid bilayers. Mitochondria 3. c
are considered the powerhouse of the cell; many of the
4. e
reactions that extract energy from nutrients are housed
within the mitochondria. b: The nucleus is a spherical 5. b
membrane-bound organelle, bound by a double 6. c
membrane composed of two lipid bilayers called the 7. a
nuclear envelope. The nucleus houses the DNA of the cell. 8. A meal heavy in starch and fiber would cause less of a
c: The endoplasmic reticulum (ER) is a network of single- spike in blood sugar than a meal of only starch.
membrane-bound tubes, actually an outgrowth of the
9. A diet rich in fiber will result in lower blood-glucose levels
outer layer of the nuclear envelope. The ER acts as a
because the body cannot break the covalent chemical
transport system within the cell. Proteins synthesized by
bonds holding the glucose monomers in fiber together.
ribosomes that coat part of the ER (the rough ER) are
Therefore, it cannot be digested and only serves to slow
transported to other parts of the cell, often by first passing
the breakdown and absorption of other sugars. Fiber also
to the Golgi apparatus. d: The chloroplast is a membrane-
has additional health benefits beyond controlling blood-
bound organelle found in plants and other photosynthetic
sugar levels.
eukaryotes; also believed to have arisen from bacteria
(again, by endosymbiosis). Reactions that capture energy 10. Because phospholipids are part of the cell membranes of
from light are housed within the chloroplast, including the both plants and animals, they can be directly acquired by
protein chlorophyll, which is responsible for the green consuming any food that contains cells, which includes all
color of plant tissues. meats, vegetables, and fruits. However, phospholipids are
not typically acquired directly from the diet in this way,
16. No. If you took an antibiotic that stopped bacterial
but are “constructed” by anabolic reactions from fatty
reproduction, there would be no need for the bacteria to
acids and other molecules. Fats and oils are the dietary
synthesize more peptidoglycan. So penicillin would not
sources of fatty acids.
be able to interfere with new peptidoglycan production,
as none would be synthesized in this situation. 11. Insulin causes cells of the body to take up glucose from
the blood. Therefore, for a type I diabetic, who does not
17. Assuming that the concentration of solutes in the solution
produce insulin naturally, insulin will be most effective if
is the same as that inside the cell, then the cells will not
taken with, immediately before, or immediately after a
burst, despite having weakened cell walls, because the
meal, when blood-glucose levels are the highest or are
osmotic pressure will not change—there will be no net
rising. Blood-glucose levels steadily decline between
movement of water into or out of the bacterial cells.
meals.
18. It is more challenging because both fungi and humans are
12. a: calcium; b: calcium, vitamin D; c: vitamin C, very small
eukaryotic organisms. Therefore the cell components of a
amounts of calcium (not significant as a dietary source); d:
fungal cell are much more similar to those of human than
vitamin C, calcium; e: vitamin D, very small amounts of
are those of bacteria. It is much harder to find a chemical
calcium (not significant as a dietary source). None of the
that will selectively kill fungal cells without causing harm
foods listed contains all three of these nutrients
to human cells.
13. e
19. Muscles and nervous tissues are much more metabolically
active than other tissues. Thinking and moving take a lot 14. Both cofactors and coenzymes are accessory molecules
of energy. These tissues expend more energy and thus that enzymes use to accomplish their function. All
require more mitochondrial activity to produce energy. coenzymes are cofactors, but not all cofactors are
Tissues such as skin can rely more on alternative, but less coenzymes. A coenzyme is a cofactor that is an organic
effective, mechanisms for cellular energy production molecule. Most vitamins are organic molecules that are
(which will be discussed later in the text). consumed and are either coenzymes themselves or are
converted into coenzymes.
20. Answers may vary. Physicians might explain that
15. b
antibiotics will not have any effect on the viruses that
cause flu or the common cold. Additionally, a physician 16. c
might point out that using antibiotics decreases their 17. The shape of the active site is very important in both the
effectiveness because of the development of antibiotic- function of an enzyme and in specifying the substrates
resistant bacterial strains, which can be fatal. Because of upon which the enzyme can act. Depending on how the
the use of antibiotics over the past 60 years, there are shape of the active site is altered, the enzyme could act on
now strains of the bacterium Staphylococcus aureus (and different substrates, the enzyme could be completely
of other bacteria) that are resistant to all available nonfunctional, or (less likely) there could be no effect at
ANSWERS 495
all. Generally, however, most enzymes are highly evolved Chapter 5
and delicately tuned molecular machines, and so most
1. b
changes will result in a complete loss of enzyme activity.
2. a
18. High fever can cause the enzymes of the body to
malfunction. This is the main danger of hyperthermia, in 3. Algae appear green because the chlorophyll within algae
which the body becomes overheated. However, this same absorbs red and blue wavelengths and reflects the green
mechanism is believed to be the reason why fever is a wavelengths of sunlight. Our eyes perceive the reflected
common response by the body to infection: the increased green wavelengths.
body temperature causes the enzymes in bacteria or other 4. c
infectious organisms to malfunction, slowing their growth 5. Photosynthetic algae obtain energy by using sunlight to
and aiding their removal from the body. create sugars by photosynthesis. The energy stored in
19. Osteoporosis is a disorder characterized by the thinning of these sugars can be used by the algae to carry out
the bones through loss of bone density. It is common with essential life processes. Animals are not able to use the
increasing age and more common in women than in men. sun’s energy directly. Instead, to obtain energy animals
Diet and exercise can both help to reduce the effects of eat plants or other organisms that have eaten plants. The
osteoporosis. energy the animals use ultimately comes from the sun.
Exercise reduces risk by stimulating bone growth. Dietary 6. oxygen (O); carbon dioxide (I); photons (I); glucose (O);
calcium reduces risk by preventing calcium from being water (I)
reabsorbed from bone when it is needed elsewhere by the
7. Increasing carbon dioxide levels should increase
body. Dietary vitamin D regulates calcium metabolism
photosynthesis because carbon dioxide is an input for the
and prevents bone loss due to calcium reabsorption.
reaction. If forests become immersed in water the plants
Dietary vitamin C is required for new bone deposition.
will not be healthy because they are not adapted to living
20. Vitamin D is important for regulating calcium levels in in water; thus this aspect of climate change will produce a
the body, and vitamin D deficiency can lead to loss of negative effect.
bone mass. Vitamin D is not found in many foods and is
8. Lipids harvested from algae are more “useful” because
mainly synthesized in the skin. A critical reaction in this
there are fewer steps required before the lipids can be
synthesis requires UV light (from sunlight). Typically
used. To produce fuel from carbohydrates found in plants
only a few minutes in intense summer sunlight are
the plants need to be broken down and fermented to
necessary, but during the winter, or at latitudes far from
produce ethanol. A lot of energy is lost in these processing
the equator, the sunlight is not intense enough to
steps.
adequately produce vitamin D. Vitamin D deficiency is a
growing concern in the United States and around the 9. c
world. 10. c
21. a: Perhaps the primary advantage to a nutritionally 11. You should eat the algae directly to gain the most energy.
engineered diet is that it requires little time to prepare, If you feed the algae to a cow first, the cow will use some
and may involve consuming foods that are less expensive of the energy, and thus the burger made from the cow will
than whole-food alternatives. Additionally, with such a contain less of the energy from the algae.
diet it can be easier to keep track of both macro- and 12. a
micronutrient consumption because the exact amounts of
13. g
each of these components in the food is known. Finally,
such a diet could allow people with certain dietary 14. Biodiesel from algae requires the transfer of energy from
restrictions such as food allergies to consume foods rich sunlight to organic molecules (including oils). There is one
in nutrients that would otherwise be rare in their major energy transfer (sun to organic molecule). Lipids
restricted diet. Disadvantages include the possibility that from animals are only produced by the animal after the
people do not understand enough about nutrition to animal has eaten a plant or another animal that ate a
adequately construct diets in this way. Certain plant. There are more steps between sunlight and animal
micronutrients that are found only in unprocessed food lipids than between sunlight and algal lipids, and some
may provide health benefits that are not yet appreciated, energy is lost at each step.
and therefore would not be included in the engineered 15. One major advantage of growing algae in enclosed tubes is
diet. b: Engineered diets provide a particular advantage to that the conditions can be controlled to maximize oil
those individuals for whom it is especially important to production. Disadvantages are the need for providing
control diet. sufficient CO2 for photosynthesis and the cost of
22. Answers may vary. Responses should consider what maintaining an elaborate growing system.
evidence is necessary to make such a claim, and whether 16. Algae may be the perfect solution to the food versus fuel
it is worth delaying the release of a potentially helpful debate. Algae can be grown on land that is not suitable for
food alternative to wait for extensive scientific studies to crops, like the desert, and algae is not a major human
be done. Another important factor to consider might be food source and therefore algae production does not
whether the studies that demonstrated the ability of this compete with food production. A conflicting factor is that
particular fiber to reduce blood-sugar levels have been algae still require water for growth, but much less than a
repeated with type I diabetics. crop would require.
496 ANSWERS
Chapter 6 molecule in a process called glycolysis. Following
glycolysis, each carbon atom originally found in the
1. d
glucose molecule is converted to CO2 in the citric acid
2. d cycle. Electrons removed from glucose during this
3. Her BMI would be ∼27, which would make her overweight process are transferred to the electron transport chain,
according to the CDC. by which they are eventually transferred to oxygen to
4. e form water (along with two hydrogen atoms). The energy
from the electrons transported in this way is captured by
5. a
the cell as ATP. The entire process produces ∼36 ATP
6. Your lifestyle would need to be modified to compensate from each glucose molecule. In the absence of oxygen,
for the additional Calories, regardless of the type of food aerobic respiration is not possible. Cells utilize
eaten. Ultimately, the only ways to avoid weight gain are fermentation to acquire a small amount of ATP, but only
either to reduce Calories eaten from other food sources or two ATP per glucose molecule are produced by
to increase the number of Calories burned, preferably by fermentation.
additional exercise.
16. c
7. a: 884g; b: 3,536 Calories (assuming perfect aerobic
17. A common hypothesis is that by eating longer meals, the
metabolism); c: 442g; d: She will run for 2.91 hours at this
French eat more slowly, and therefore allow time for
pace and burn an estimated 2,575 Calories in that amount
stomach to signal the brain to quit eating. Often we do not
of time. Again assuming perfect aerobic metabolism, it
realize that we are full until several minutes, or dozens of
will take her 4 hours at this pace to burn through her
minutes, after eating. Therefore, by eating quickly, we
glycogen stores. She can run 36 miles in this time at this
may consume far more food than is necessary to feel full.
pace, which is well beyond the 26.2 required to complete
Because of this difference, longer meal times may result in
a marathon. e: Her body will need to extract energy from
the French eating less food (and fewer Calories) at every
another fuel source. Fat (from adipose tissue) and protein
meal.
(from muscle) are the next sources, in that order.
However, it is important to note that in cases of complete 18. Answers may vary. See the discussion in “The culture of
carbohydrate starvation (such as this one), protein from eating” section of the text.
muscle will still be broken down to provide glucose (blood 19. Answers may vary. They should be accompanied by a
sugar) to the brain. This happens because humans are justification of how a particular intervention might result
incapable of making glucose from fats. This process of in reduced obesity. Examples: (1) Taxing high-fat foods
protein wasting continues until the brain adjusts to might encourage people to purchase foods that contain
another energy source (ketone bodies), which can be higher amounts of carbohydrates and proteins.
produced from fats. Theoretically these foods might be lower in Calories, given
8. Many possible reasons have been suggested, among them the lower energy density of these other nutrients. (2)
smaller portions, less energy-rich but nutrient-poor foods, Financial incentives might encourage people to exercise
longer meal times, less snacking, and greater self-control more, thereby increasing total Calories burned. (3) Fruits
at meal times. and vegetables, particularly vegetables, are high in
nutrients but relatively low in Calories. Encouraging their
9. c
consumption might decrease overall Calorie consumption
10. d in the American public. (4) Providing incentives to
11. e teachers to encourage teaching about nutrition might
12. b increase awareness of nutrition and its effect. The idea is
that those who understand the dangers of poor nutrition
13. See Infographic 6.10. The carbon atom (in CO2) will be
and/or obesity will be motivated to change eating and
taken up into the spinach leaf, into the plant tissue, into
exercise habits.
the plant cell cytoplasm, and eventually into the
chloroplast. There it will be converted, along with water
Chapter 7
(H2O), into carbohydrate (glucose). This glucose may be
used to construct the plant cell wall (fiber) or stored for 1. e
later use by the plant (starch). If it is stored as starch, then 2. c
when it is consumed by a human, the glucose will be 3. b
broken down again into CO2 by glycolysis and the citric
4. (1) The two original strands of the DNA molecules are
acid cycle. Thus, the carbon atom will have come full
separated by means of heat. (2) The enzyme DNA
circle. (If the glucose had been converted to fiber, other
polymerase “reads” each template strand and adds
organisms, particularly fungi and bacteria, will also break
complementary nucleotides to make a new strand.
down the fiber to glucose and then to CO2, so the atom of
carbon can always return to CO2.). 5. Step 1. The strands separate:
ATCGGCTAGCTACGGCTATTTACGGCATAT
14. a
15. In the presence of oxygen, aerobic respiration is the TAGCCGATCGATGCCGATAAATGCCGTATA
preferred method by which glucose is utilized by most Step 2. DNA polymerase adds complementary
cells. The process involves catabolism of the glucose nucleotides, forming two new double helices:.
ANSWERS 497
ATCGGCTAGCTACGGCTATTTACGGCATAT diseases, enabling insurance companies with access to
TAGCCGATCGATGCCGATAAATGCCGTATA this information to discriminate against those individuals.
This is particularly troubling because the markers indicate
ATCGGCTAGCTACGGCTATTTACGGCATAT
a correlation and not a definitive likelihood of developing
TAGCCGATCGATGCCGATAAATGCCGTATA
the disease.
6. a: F; b: T; c: F; d: F; e: T
7. Statement b in Question 6 is true because DNA is the
Chapter 8
molecule of heredity that is passed from parents to
offspring. Statement e in Question 6 is true because all 1. A protein’s function is determined by the shape, which is
body fluids, including saliva, contain DNA that can be determined by the interaction of the amino acids that
used for DNA evidence. Unfortunately, in the case of Roy make up the protein—specifically, the order of the amino
Brown, the technicians were not able to extract enough acids and how their side chains interact.
DNA from the bite marks for PCR. 2. c
8. Statement a in Question 6 should be, “G pairs with C and 3. The protein will not be able to function because the heat
A pairs with T.” Statement c in Question 6 should be, will cause the protein shape to change and shape is critical
“DNA consists of coding sequences, which encode for function.
information to produce proteins, and noncoding 4. The insulin gene is made up of DNA nucleotides that
sequences, which regulate when coding regions are provide information about how to make the insulin
turned on or off.” Statement d in Question 6 should be, protein. The insulin gene is transcribed into mRNA in the
“The number of STR repeats on your maternal nucleus; then the mRNA is transported into the cytoplasm
chromosome can be different from the number of STR and translated into insulin protein.
repeats on your paternal chromosome.” 5. d
9. a 6. e
10. d 7. The problem is likely in the regulatory sequence because
11. d the patient has reduced levels of normal antithrombin.
12. Lane B The regulatory sequence controls how much mRNA is
13. a: Suspect B’s profile matches the profile from the blood made and therefore how much protein is made.
collected at the crime scene for all of the markers tested. Alternatively, the patient could carry one allele with
b: Suspect A is most likely unrelated to the victim since changes in the coding sequence that make a nonfunctional
they share very few STR bands. Suspect B is likely either protein. The patient would still have low levels of
the victim’s parent or child since they share at least one functional protein made from the allele with the normal
band at each of the markers tested. coding sequence.
14. d 8. To increase the level of antithrombin, the regulatory
sequence should be modified. The regulatory sequence
15. c
controls the timing and location of transcription of
16. AMELY and AMELX antithrombin. The amount of mRNA made is directly
17. For AMELY: If the perpetrator is female, you would expect related to the protein produced.
no bands, and if the perpetrator is male, you would 9. To express a gene in skin cells, combine the regulatory
expect one band. For AMELX: If the perpetrator is female, sequence from the melanin gene with the coding
you would expect two bands or one thick band if the sequence of the gene of interest. The regulatory sequence
repeat is the same length on both X chromosomes. If the of melanin is specific to skin cells, so the gene of interest
perpetrator is male, you would expect only one band. will only be produced there. To express melanin in yeast
18. a. cells, use the regulatory sequence from a yeast gene and
the coding sequence from melanin. The coding sequence
is necessary to produce the correct melanin protein.
10. The beta casein regulatory sequence was used to express
antithrombin in milk because the beta casein gene is
expressed only in the mammary glands. This was
important to ensure that the goats were not harmed by
the production of antithrombin.
11. RNA polymerase (N); ribosome (C); tRNA (C); mRNA (C)
(mRNA is transcribed in the nucleus and transported to
b: Lane M1 identifies the father of the child. the cytoplasm for transcription, so it is active and carries
19. The advantages of having a DNA bank include clearing out its main function in the cytoplasm.)
individuals who have been wrongly convicted and helping 12. a: The complementary DNA strand is TCTATGCTTTGT. b:
to identify suspects in unsolved cases. Banking DNA could The complementary mRNA strand is UCUAUGCUUUGU. c:
be problematic, depending on who has access to the The mRNA sequence contains four amino acids—Ser, Met,
information and how it is used. For example, people’s Leu, Cys—but only three will be translated into protein.
DNA markers can indicate their susceptibility to certain Met is the start codon where translation will occur, so Ser
498 ANSWERS
will not be translated. The final protein will include three intestinal tract), and hair loss (by interfering with cell
amino acids: Met, Leu, Cys. division in hair follicles).
13. a: If RNA polymerase cannot bind to the regulatory region, 8. a
the gene will not be transcribed; thus neither mRNA nor 9. c
protein will be produced. b: A change in the coding 10. Chemotherapy targets actively dividing cells like the lining
sequence will not have an effect on transcription of the of the digestive tract. When these cells are killed, side
mRNA. Depending on the change in the sequence, the effects such as nausea may occur. Cognitive symptoms are
protein structure and levels could be unchanged if the not a side effect because neurons rarely (if ever) divide
change were to an amino acid with similar properties; or and so are not affected.
the protein could become nonfunctional because the new
amino acid causes the protein to be shaped differently. A 11. c
third possibility is that the change will create a stop codon 12. a: Irinotecan slows the growth of the tumor—the rate of cell
in the middle of the protein, creating a truncated, division—by interfering with cell division. Thus the tumor
nonfunctional protein. c: A change in the regulatory region grows more slowly in the presence of irinotecan than in the
that increases transcription will increase the amount of absence of chemotherapy. b: PHY906 plus irinotecan slows
mRNA and protein that is produced. The function and the growth of the tumor more than irinotecan alone, as can
structure of the protein will be normal. d: The change to be seen in the graph by the very limited growth of the
the regulatory region will increase the level of transcription tumor in the presence of both irinotecan and PHY906.
creating higher levels of mRNA. The change to the coding PHY906 enhances the effect of irinotecan.
region may result in a nonfunctional protein resulting from 13. Eating whole foods that are rich in beta-carotene may
changes in the shape of the protein. The combination of have more benefits than a beta-carotene supplement
these changes will lead to an increase in nonfunctional because there may be interactions between beta-carotene
protein which the cell will degrade; and the phenotype will and other molecules in the whole food that will make the
be similar to that observed if the protein is not produced. beta-carotene more potent.
14. a: proline (Pro); b: proline (Pro); c: leucine (Leu) 14. anaphase
15. The benefit of producing insulin in either pigs or bacteria 15. interphase (S phase)
is that more diabetics are able to live a long and healthy 16. If a cell does not complete cytokinesis there will be one
life because of the greater availability of insulin. The cell with twice the number of chromosomes relative to the
ethical question is whether or not we should modify parent.
organisms to produce unnatural proteins. One might
17. A drug interfering with spindle fiber shortening would be an
argue that producing insulin in pig pancreas or bacteria is
effective cancer drug because anaphase cannot occur if the
invasive and will harm the pig or bacteria. On the other
spindle fibers cannot shorten. Disrupting anaphase will lead
hand, these human-insulin-producing animals were
to apoptosis and therefore slow the growth of the tumor.
produced for the purpose, so harming the pig or bacteria
for production of insulin is serving the greater good. In 18. Over-the-counter herbal supplements are not regulated by
some ways it is easier to accept using bacteria to produce the FDA and may have varying amounts of the effective
insulin: there are millions of bacteria, they have a short compound. Additionally, these supplements may contain
life cycle and rapid regeneration, and we can’t see a single other, potentially harmful, compounds.
bacterium with the naked eye. 19. Establishing the efficacy of PHY906 in humans will
require a clinical study. The study should include cancer
patients that are given chemotherapy alone or
Chapter 9 chemotherapy with PHY906. The patients should be
1. e closely monitored and allowed to stop taking PHY906 if
2. c negative effects occur at any point in the study. The
patients should be informed of all possible risks before
3. Embryonic development, wound healing, and
being asked to agree to participate in the study.
replacement of blood cells all require mitosis to create
more cells.
Chapter 10
4. c
1. Mutations in both tumor suppressor genes and in
5. Pregnant women should not take drugs that interfere with oncogenes increase the risk of developing cancer. Tumor
cell division because the cells of the developing embryo suppressor genes cause cancer when the proteins the
are rapidly undergoing cell division. If a woman were to genes code for become nonfunctional; oncogenes cause
take these drugs, the developing embryo would cease to cancer when the proteins become permanently activated,
grow and would die or have major defects. or “turned on.” Both types of genes play important roles
6. b in cell division and its regulation. Tumor suppressors
7. Chemotherapy interferes with cell division to kill cancer typically signal the cell to pause cell division in order to
cells. However, the drugs target any actively dividing cells fix errors; oncogenes tend to promote cell division.
such as intestinal cells, blood cells, and hair follicles. The 2. BRCA1 is a tumor suppressor gene that produces a DNA
side effects of killing these cells may include nausea and repair protein that helps detect and repair mutations.
diarrhea (by interfering with normal cell division in the
ANSWERS 499
3. b 6. c
4. e 7. f
5. b 8. Maternal Paternal
6. c
7. At birth, all of Lorene Ahern’s cells—including her breast
cells and her liver cells—were genetically identical and
carried a mutation in one of her two BRCA1 alleles. For
cancer to develop, some of her breast cells must have
accumulated additional genetic mutations, which would D D d
make these cells genetically different from her normal
breast cells.
Each haploid gamete could contain one of the following
8. If there is no family history of breast cancer it is unlikely that chromosomes:
the niece has a mutation in BRCA1. Therefore, she should be
able to reduce her risk of developing cancer by adopting
lifestyle changes like not smoking, using sunscreen, and
minimizing exposure to carcinogens, which will decrease
her chance of accumulating cancer-causing mutations.
9. e D d D d
10. a
11. The normal BRCA1 protein acts as a tumor suppressor to
9. Since meiosis halves the total number of chromosomes, 41
halt cell division and promote DNA repair. This means
unpaired chromosomes would be present in one of the
that it will take only one additional mutation in BRCA1 (in
alien’s gametes.
the other allele) for them to lose all BRCA1 function.
Nonfunctional alleles of BRCA1 encode proteins that do 10. Mitosis starts with a diploid cell and produces two
not act properly to detect and repair damaged DNA. genetically identical diploid cells. Meiosis also starts with
a diploid cell but, because of recombination, results in the
12. There are many possible answers, as well are concerns
formation of four haploid cells containing new genetic
about privacy. Nellie’s doctor might advise Nellie to tell
combinations of alleles.
both her sister, Anne, and her brother that she carries the
BRCA2 mutation, but ultimately it is up to the sister to 11. If meiosis I is skipped, there would be no recombination.
decide whether or not she wants to be tested for the The 46 replicated chromosomes would each separate
mutation. Anne may not want to live with the burden of their chromatids during meiosis II, resulting in gametes
knowing that she has a higher risk but not a guarantee of with 46 chromosomes (instead of 23).
developing breast cancer. A counselor might suggest that 12. b
Anne be tested because there is evidence to suggest that 13. recessive inheritance pattern
there are treatment options available to carriers of the 14. c
mutation, including prophylactic surgery. The brother
15. a: All of Emily’s gametes will carry the allele that is
should also be advised since men with mutations in
associated with CF (a). The man’s gametes will all carry
BRCA2 are also at higher risk for developing breast and
the allele that is wildtype (A).
prostate cancers. Another consideration is that their
children’s risk is affected if a parent carries the mutation. b:
A A
Chapter 11 a Aa Aa
1. 46 (23 pairs) a Aa Aa
2. 23 c: 0%
3. A person with CF is homozygous recessive at the CFTR d: 100%
gene and carries two of the CF-associated alleles in all of
16. Since Huntington disease is a dominant disorder, the
his or her lung cells. A heterozygous carrier for CF has
friend has a 50% probability of developing it, as shown in
one CF-associated allele and one normal allele at the CFTR
the Punnett square below:
gene. Someone who is homozygous dominant carries two
of the normal alleles at the CFTR gene. t t
4. a: A heterozygous genotype will have a normal phenotype T Tt Tt
(like Emily’s parents). b: A homozygous dominant
genotype will have a normal phenotype. c: A homozygous t tt tt
recessive genotype will have cystic fibrosis. 17. If you take a genetic test for a disease for which there is no
5. Two individuals with different phenotypes may have cure, you do so knowing you would not be able to
different mutations at the CFTR gene or different alleles in undergo treatment to improve your prognosis; thus, even
other modifier genes that may affect the severity of the if you are presently asymptomatic, you may become
disease. anxious about developing the disease. Knowing if you will
500 ANSWERS
develop a disease may affect your choices about having depression. Similarly, if depression were based entirely on
children; it may help ongoing research; and may be environment, then all people who experience four or
helpful knowledge for your doctor in monitoring your more stressful events should have a high propensity for
overall health. depression.
15. From these data, the probability of people with two short
Chapter 12 alleles becoming depressed increases after three or more
1. c stressful life events.
2. Males have only one X chromosome, whereas females 16. Phenotype is the result of both genotype and environment.
have two X chromosomes. Recessive traits occur when Even if two people have the same genotype for a
only recessive alleles are present. Males have only one predisposing allele, their environments may be different
allele of each X-linked gene because they have one X and thus change their probability of developing the disease.
chromosome; therefore, if they have the recessive allele 17. a: 23 chromosomes (human egg); b: 23 chromosomes
they will develop the recessive genetic disease. Females (human sperm); c: 46 chromosomes (zygote)
are less likely to be affected because their recessive allele
18. Genotypes cannot be deduced from karyotype analysis.
can be masked by a dominant allele.
Karyotype analysis is used to determine the number of
3. If a male has an X-linked recessive disease he cannot pass chromosomes present.
it to his son because the father must pass the Y
19. c and d
chromosome to his son. The X chromosome in males will
always come from the mother. 20. Research supports a correlation between some of the
most obvious birth defects and the age of a woman’s eggs,
4. c
but there are findings that the age of the male can also
5. a: XX, female; b: XXY, male; c: XY, male; d: X, female influence the frequency of cognitive disorders. It is more
6. a: The brother and son of a female will not have identical likely that the egg cells will include chromosomal
Y chromosomes because the Y chromosome is inherited abnormalities.
from the father. The exception is if the brother is the son’s 21. Factors for considering genetic counseling include age,
father. b: The brother and son of a male will have family history, and medical history. The value of having
essentially identical Y chromosomes because the Y this information is to be better prepared to support a child
chromosome is inherited from the father. The two regardless of his or her abilities.
brothers will have received essentially the same Y
chromosome from their father and then pass that Y Chapter 13
chromosome to their sons.
1. A five-year-old child does have adult stem cells. The
7. a: DMD is X-linked recessive. 50% of the sons will have “adult” stem cells are somatic cells that are still able to
DMD and 0% of the daughters will have DMD. b: Rickets is divide to regenerate specific cell types.
X-linked dominant. 50% of the sons will have rickets and
2. a
100% of the daughters will have rickets.
3. d
8. There are many genes that contribute to the phenotype of
height, so it is a polygenic trait. 4. Tissues are made up of different specialized cell types that
work together. Neurons and glial cells are different cell
9. d
types that work together to allow the firing of electrical
10. Polygenic inheritance is primarily due to the influence of impulses.
effects from multiple genes. Multifactorial inheritance
5. It would not be sufficient to replace only the neurons as
includes an interaction with the environment.
the nervous tissue is made up of neurons and glial cells,
11. Incomplete dominance describes traits in which and glial cells help the neurons with sending rapid signals.
heterozygous individuals have an intermediate phenotype
6.
between that of the homozygous dominant and
homozygous recessive phenotypes. Traits that are Photoreceptor Heart
codominant produce heterozygotes that display both the cells of the muscle Helper
dominant and recessive phenotypes. retina fibers T cells
12. The only possible recipient for an A+ donor is type A+. The Myosin gene present? X X X
possible donors to an A+ recipient are type A+, type A–,
type O+, and type O–. Myosin mRNA present? X
13. Environment influences overall height. The two women Myosin protein present? X
may have had different diets while they were growing. Retinal gene present? X X X
14. The hypothesis that genes and environment influence
Retinal mRNA present? X
phenotype is supported by the significantly higher
number of people diagnosed with depression who have Retinal protein present? X
two copies of the short allele and have had four or more CD4 gene present? X X X
stressful life experiences. If depression were controlled
CD4 mRNA present? X
only by the number of short alleles, then all people with
short alleles would have the same propensity for CD4 protein present X
ANSWERS 501
7. c 3. c
8. Advantages of using one’s own cells include the following: 4. MRSA can be passed from person to person by direct skin
There is no need to wait for a donor match because the contact or touching contaminated surfaces. If the bacteria
cells will come from the recipient. Cells will not be can find their way into a wound, they can get into the
rejected by the recipient’s immune system: the cells come body and cause an infection. Athletes with cuts or scrapes
from the recipient so the immune system will recognize can get MRSA from contact with other people or
them as self. The recipient will not have to be on immune- contaminated objects (for example, towels).
suppressant medication, which can lead to other illness: 5. Once I confirmed that the infection is really caused by a
the cells come from the recipient so the immune system MRSA strain (methicillin-resistant—also resistant to other
will recognize them as self. beta-lactam antibiotics such as penicillin), I would try
9. Embryonic stem cells can differentiate into almost any cell non-beta-lactam antibiotics. If these were not successful,
type and are found in early embryos. Adult stem cells are then I would consider prescribing vancomycin as this
more limited as to the types of cells they can differentiate antibiotic is reserved for severe MRSA infections that don’t
into; they are found in tissues. respond to other types of antibiotics. I would recommend
10. c that the teammates increase their hand washing, decrease
11. It is more challenging to engineer a bladder because there contact when possible, and that the locker room be
are several types of cells (including muscle cells and nerve thoroughly cleaned to cut down the frequency that the
cells) that are required to make the organ, whereas skin is other players will come in contact with MRSA.
made up only of skin cells. 6. Beta-lactam antibiotics work by interfering with the
12. a: heart muscle; b: none; c: pancreas; d: neurons bacteria’s ability to synthesize cell walls. Our eukaryotic
cells are not affected because there is no cell wall in
13. Embryonic stem cells have a wider utility than adult stem
animal cells.
cells in that embryonic stem cells can differentiate into
almost any other cell type. These cells do not have an 7. c
identity, so there is the promise that they could be put into 8. d
a patient’s body to stimulate regeneration in the damaged 9. “Fitness” describes the ability of an individual to survive
tissue. Adult stem cells are useful for a narrow range of cell and reproduce in a given environment. An organism that
types that are similar to the adult stem cell. For example, has a higher fitness will be able to reproduce and pass its
blood stem cells can make other blood cells, but could not genes to the next generation at a higher frequency than a
make a liver cell. Embryonic stem cells are derived from less fit individual.
early embryo cells and thus there are ethical concerns with 10. a
using this cell type. Adult stem cells come from tissues and
11. c
so there is less controversy about using them.
12. Asexual reproduction occurs when an organism replicates
14. The genes that were inserted functioned to
its own genome and divides into two daughter cells. The
de-differentiate the cells back to an embryonic state. The
daughter cells are a copy of the mother cell. The daughter
genes had to be added into the cell because the
cells could be different from the mother or the other
endogenous genes had been shut off during development.
daughter cell if mutations occur during replication.
15. There are many possible opinions: one is to choose to
13. Evolution is the result of change in allele frequency over
allocate funds to all types of stem cells because each type
generations (time). Bacteria evolve at a high rate because
will serve a unique purpose. Additionally, this field is
the generation time is minutes or hours compared to
relatively new and it is important to continue exploring all
years for other organisms.
research avenues for the best solutions. Funding should
also be allocated to those researching the ethical 14. c
questions related to this research so that we don’t cross a 15. Some of the cells from the population will grow because
line that can’t be undone. during replication their DNA has accumulated mutations
The technologies to create cloned embryos for that make them resistant to vancomycin.
“reproductive” or “therapeutic” cloning do not differ 16. The genotype determines the phenotype, so if the
except that in reproductive cloning the embryo is genotype frequency is changed then the phenotype
implanted into a woman’s uterus. There are many opinions frequency will change.
and also regulations regarding reproductive cloning of 17. a: The snails will be greenish in color to blend in with the
humans. Many people think that reproductive cloning of grass. The snails that do not blend into their surroundings
humans should be illegal because they are concerned that have a higher probability of being eaten by birds and
the humans born from this process would not have the therefore cannot pass their genes to the next generation.
same rights as humans born from traditional means. b: Individual snails will not be able to mutate to change
their color in response to the environmental selective
Chapter 14 pressure. Snails that are brown will be selected for and
1. a will reproduce, resulting in more brown snails. The green
2. Colonization means the bacteria are carried on or in the snails will have a low fitness in this environment because
body without causing disease; infections are associated they will stand out and have a higher probability of being
with disease. eaten before they reproduce. Over time the color
502 ANSWERS
phenotypes will shift to brown because these snails have a definition of evolution). Genetic drift differs from natural
higher fitness in this environment and thus will reproduce selection in that genetic drift does not necessarily lead to
more, leaving their brown alleles in the next generation of adaptation, since the changes in allele frequencies are not
snails. The new color phenotype is the result of random due to selection for a particular beneficial trait but rather
mutation and recombination, leading to changes in the are due to random events.
genome that are passed to the gametes and resulting in 12. In this example, the descendant population’s allele
the brown phenotype. frequencies might remain similar to the founder’s because
18. a: It is troublesome to hear this story because antibiotics the descendants are more likely to mate with other
will not kill the virus and the increase in antibiotics in the members of this same population rather than with
environment will increase the chance that bacteria in the members of the population around them.
environment will become resistant. b: No. c: The risk to 13. d
the friend is that bacteria in the friend’s body are being
14. Geographic isolation prevents gene flow. Due to natural
exposed to the antibiotic and a few bacteria in his body
selection or genetic drift, allele frequencies of the two
may be resistant to that antibiotic. Those resistant
separated populations will diverge over time. Without
bacteria will continue to replicate, leaving him with a
being able to exchange genetic material, the two
population of bacteria that are resistant to that antibiotic.
populations may eventually experience changes in allele
If those bacteria should infect his bloodstream (for
frequencies and evolve traits which prevent successful
example, through a break in the skin), that infection will
mating, and thus will have speciated.
be hard to treat (as the bacteria are already resistant to at
least one class of antibiotic). The risk to the community is 15. According to the biological species concept, these
that if those bacteria should be transferred to others, they populations are still the same species if they can mate and
could cause an antibiotic-resistant infection in those produce fertile offspring. You would need to observe
affected. mating between members of the previously separated
populations and then follow their progeny to see if they
are fertile—that is, if they can mate and produce offspring.
Chapter 15 16. Inbreeding is detrimental because it decreases the
1. 0.34 number of heterozygotes in a population, increasing the
2. b proportion of individuals which are homozygous for
3. Yes, evolution has occurred. The genetic definition of recessive alleles. Many recessive alleles are mutations that
evolution is a change in the allele frequencies within a are detrimental but which do not confer a phenotype in
population. heterozygous individuals because the nonmutated gene is
4. Population B would be the most likely to survive a sudden a dominant allele; however, in a homozygous recessive
environmental change, because it has the greatest allele individual, these traits are expressed, usually with
and genotype diversity. This diversity increases the extremely negative consequences including decreased
chances that some individuals will be better adapted to fitness, fertility, or viability (that is, the trait is lethal). This
survive changes in their environment. phenomenon is called inbreeding depression.
5. Populations 1 and 4 are the most threatened. Population 1 17. Over time the gene pools of these groups would converge,
has both a low total size and a single gene for which there becoming more similar to one another.
is only one allele in the population. However, population 1 18. A and E frequencies will increase; all other frequencies
has good genetic diversity with regard to the other two will decrease.
genes being studied. Population 4 has the least genetic 19. a: Answers will vary depending on date and sources used.
diversity of all the populations but has a 20-fold higher In general, endangered species are at risk for becoming
total population. Either of these populations could be of extinct, whereas threatened species are at risk for
great concern to conservationists. becoming endangered in the near future. b: Because the
6. If PKU occurs in 1 in 15,000 people, then q2 is 1/15,000, genetic diversity of the population has already been
and q is the square root of 1/15,000 (= 0.008). Therefore reduced, and further habit preservation will not restore
p = 1 _ q (= 0.992), therefore the carrier frequency = 2 × p × genetic diversity in the short term. Other interventions are
q (= 0.016, or 1.6% of the population). necessary to create gene flow and restore genetic
7. p = 0.45, q = 0.55; predicted frequency of homozygous diversity, such as the introduction of pumas from another
dominant (AA) is 20.25%, actual percentage is 5%; the area as described in the text. c: There are a number of
population is not in Hardy-Weinberg equilibrium. possible answers, which include but are not limited to:
genetic testing to identify any individuals with new alleles
8. d
followed by intentional breeding of those individuals to
9. c increase rare allele frequencies; attempts to breed
10. a: The frequency of alleles A through L has changed cheetahs with other closely related cats in the hope that
drastically. A–L but not B frequencies are reduced to zero. some combinations may produce fertile offspring; genetic
B frequency is now 1.0. b: This is an example of a engineering to introduce new traits artificially; separation
bottleneck effect. of the species into multiple distinct environments in the
11. Genetic drift is an example of evolution because genetic hope that each new founder population will evolve new
drift changes the frequency of alleles in a population (the traits distinct to that environment.
ANSWERS 503
Chapter 16 12. Middle ear bones in humans; gills in fish
1. the shallowest layers (those closest to the surface) 13. The presence of five digits indicates that having five digits
2. c may have provided an evolutionary advantage to the
ancestors of both otters and humans. Both humans and
3. This fossilized skeleton appears to be most similar to otters have evolved to utilize fine motor movements of
extant (that is, currently living) bony fish. Specific their hands or paws. It is likely that having five digits may
characteristics noted could include the presence of have improved motor skills, providing a reproductive
dorsal, pectoral, pelvic, and tail fins, which are all clearly advantage that is reflected in the complexity that is the
visible and are useful for swimming, indicating the human hand. Because otters are known to use their paws
organism likely lived in the water. Additionally, the for grasping and, in simple tool use, using stones to crack
connected skull and shoulder bones indicate protected open shellfish, we might predict that otters will continue
gills, again indicating that this is a marine organism to evolve paws that are more and more functionally
related to bony fish. The presence of teeth and large complex. Because humans and otters share an ancient
mouth indicate that this organism was likely predatory. ancestor, both humans and otters use the homologous
4. No. The hypothesis that these sea cucumbers existed does bones in their hands and paws.
not predict that their fossils should be present in the fossil
14. It depends on the stage of development at which the
record, as organisms which had only soft-tissues (such as
embryos are observed. At early stages of development,
a sea cucumber) rarely produce fossils.
both human and chicken embryos have post-anal tails, so
5. The barnacles are at least as old as the oysters, which are the presence of a tail at that stage cannot be used to
at least as old as the surrounding rock, which is dated at distinguish the two. Later, the post-anal tail disappears in
100 million years. Fossils must be at least as old as the the human embryo.
surrounding rock which encased them. Likewise,
15. By comparing the three sequences to one another in a
organisms found to coexist in the fossil record must have
pairwise fashion. By counting the number of differences
lived at approximately the same time.
between each pair of sequences, a quantitative measure
6. c of similarity (% similarity) can be established. The more
7. elongated bony ribs and weight-bearing pectoral fins that similar the sequences (the higher the % similarity
include ankles between them), the more likely it is that they are closely
8. Transitional fossils represent midpoints between two related. Sequence evidence from a single gene is often
groups of organisms. Often they are extinct organisms combined with evidence from other genes to establish
that represent a transitional form between the ancestors relationships between organisms. DNA sequence data is
of two groups of extant (that is, currently living) just one means by which to determine such relationships.
organisms. In this case, Tiktaalik represents a transitional Comparisons of morphological traits, such as the arm
form between bony fish and amphibians (or all tetrapods). bones, are another way to gather evidence to establish
Often transitional fossils help scientists understand how such relationships.
organisms changed morphologically over time. 16. With only a few rare exceptions, the genetic code is
9. See Infographic 16.4. The first real tetrapod would likely universal for all living organisms known on this planet.
have more distinguishable hindlimbs that would be Therefore, the same piece of DNA encodes the exact same
capable of supporting weight, rather than pelvic fins. This amino acids in bacteria as it does in humans.
would likely be the defining characteristic of the first 17. The two proteins differ in the specific amino acid
tetrapod and would be the primary difference sequence that makes them up. This is encoded by the
distinguishing it from Tiktaalik. Given the trends observed specific nucleotide sequence of the gene. Although
in the Tiktaalik fossil, you might also expect the tetrapod the code is the same, the specific sequence of nucleotides
fossil to also have longer and thicker ribs, a less defined or differs between distantly related organisms. Because
smaller gill slit, longer neck, more developed fore-limbs the more closely related two organisms are, the more
with more defined digits (“fingers”). similar their gene sequences will be, it is possible to
10. The land represented a new ecological niche into which determine relationships from the similarities between
life could expand, but this does not mean that the oceans these genes.
and freshwater environments are not places in which life 18. Answers will vary. Considerations may include the
could thrive. Fish were already well adapted to surviving importance of protecting important scientific finds, the
and proliferating in these marine environments, and role of government in such protection, and the extent to
therefore descendents of those ancient fish exist today. which the government may act to protect such finds at the
11. The skeletal anatomy of a chicken wing and a human arm cost of limiting personal freedom. There are many things
are very similar. All major bones are present and in the which people do not have a right to collect because the act
same locations relative to other bones. The primary of collecting, trading or selling such items causes harm to
difference is found in the fine bones that make up the others or the environment, and therefore there are bans
digits. In the human hand, these bones are longer, more on the collection and trade of pelts, tusks, teeth, horns,
numerous, and arranged in a way that allows independent feathers, or other animal parts of protected species.
movement, an important feature in human evolution Likewise, visitors to many protected geological sites are
required to elegantly manipulate objects. prohibited from taking rocks or other items.
504 ANSWERS
Chapter 17 16. Monera was divided because DNA evidence showed that it
was made up of two distinct groups of organisms. These
1. They are all radioisotopes that decay at steady and
were later separated into the current domains of Bacteria
predictable rates, changing into other elements.
and Archaea.
2. You would use uranium-238 because it has the longest
17. c
half-life (4.5 billion years). Other isotopes with shorter
half-lives will be barely detectable in a sample that is 18. Answers will vary. For instance, because organisms are
extremely old, having long ago decayed to levels that are related, we can study possible cancer treatments in yeast
below detectable limits. or mice to determine if these treatments interfere with,
for example, cell division in these organisms. If they do,
3. (1) the first prokaryotes (∼3.0 billion years ago), (2) an
they may also stop the division of cancerous cells in
increase in oxygen in the atmosphere (∼2.5 billion years
humans. If we understand the evolutionary adaptations of
ago), (3) the first multicellular eukaryotes (∼1.2 billion
organisms to their environments, we may be able to
years ago), (4) the Cambrian explosion (545 million years
identify organisms that will do well in habitats that have
ago) (5) the first animals (∼540 million years ago), (6) the
been degraded by human activities, or that will do well in
Permian extinction (248 million years ago), (7) the
environments that are changing as the result of global
extinction of dinosaurs (∼65 million years ago)
climate change.
4. a: approximately 4.5 billion years old; b: approximately
half
Chapter 18
5. ∼9 billion years old
1. c
6. Many of the ancestors of these organisms may have been
evolving for a long time without appearing in the fossil 2. The fundamental difference between the two groups is
record because not all organisms leave fossils behind. that prokaryotes lack internal membrane-bound
The sudden appearance of numerous organisms in organelles. The lack of a nucleus enclosing the
the fossil record of the Cambrian explosion may be chromosomal DNA is the defining characteristic of a
largely due to the development of shells and other hard- prokaryotic organism.
body parts, which are more likely to leave behind 3. d
a fossil. 4. They were originally grouped together because of their
7. Amphibians were certainly present. Early reptiles and similar size and morphology. Both are prokaryotic
sharks might also be found in these layers. organisms.
8. No. They may indeed be closely related, but similar 5. “Archaebacteria” literally means “ancient bacteria.” The
morphology does not necessarily indicate homology. name was originally used because archaea were then seen
The two organisms may share common characteristics as a particular sort of bacteria, one that might be very old.
because of convergent evolution rather than homology. The strength of this term is that it emphasizes the
9. See Infographic 17.5. The continents were then generally structural similarity of archaea to bacteria; the great
closer together than they are now. Since that time, weakness of this term is that it implies that archaea are a
because of plate tectonics—the movements of independent subset of bacteria. We now understand this to not be the
continental plates in the earth’s mantle or crust—the case—bacteria and archaea are separate but related groups
continents have largely drifted apart. One major exception of organisms.
is the Indian continent, which has since collided with the 6. a
Asian continent, forming the Himalayan mountain range. 7. e
As landmasses moved and separated, so did the 8. c
organisms that lived on those landmasses.
9. No. Many archaea live in environments that are difficult to
10. The two species may look alike because they have evolved replicate in the lab. Therefore, there are many archaea
similar traits independently because they are adapting to that scientists are unable to culture, but they are
similar environments (the desert climate). This is an nonetheless present in the environment.
example of convergent evolution.
10. No. Bacteria and archaea generally look similar, and
11. They would have migrated to both the north and south therefore DNA sequence evidence is usually used to
polar regions, in which case both penguins and polar distinguish between these two groups of prokaryotes.
bears would be found at both regions today.
11. These processes are important because they convert CO2
12. Bats are mammals and hence share a common ancestor and N2 gases into forms that humans can use.
with all mammals. This common ancestor is not thought
12. No. N. gonorrhoeae use pili to attach to human cells and
to have possessed any structures homologous to insect
evade host defenses. Without the pili, N. gonorrhoeae
wings that could have been inherited. Therefore, it is
would not be a very effective pathogen.
more likely that bat wings evolved separately. This is
another example of convergent evolution. 13. High temperatures: Most organisms cannot survive
outside a narrow temperature range. Temperatures
13. f
outside this range lead to protein denaturation and
14. domain, kingdom, phylum, genus, species membrane instability, resulting in cell death. High
15. d pressure: Most organisms are evolved to live within a
ANSWERS 505
specific pressure range. The high pressures found at the mountains, temperate rain forest, lakes, rivers, and the
bottom of the ocean would crush many other organisms. Pacific coastline.
Alkalinity: Most organisms are evolved to live within a 2. The domain Eukarya encompasses all eukaryotic
specific pH range. The high pH (basic) conditions at Lost organisms, including plants, animals, fungi, and protists,
City would kill most other organisms. Toxic gases: Many which contain membrane-bound organelles.
other organisms have not evolved the ability to tolerate 3. Both the fisher and the Douglas fir are eukaryotes and
the high concentrations of certain toxic gases found at inhabit the low-elevation rain forests of the Olympic
Lost City. National Park.
14. c 4. a: One would expect less diversity in Lake Michigan
15. Their presence supports the idea that these compounds because there is less variation in habitat and Lake
can be produced abiotically (that is, without life). This Michigan has been subjected to repeated glaciations,
supports the idea that the molecules that make up living decreasing the time for evolution of new species. b: One
organisms could have been produced by the harsh would expect less diversity in the Sonoran Desert in
conditions present on the early earth. The organisms that Arizona because the climate limits the diversity of
live inside the vents may be more similar to the first organisms to those that can survive in a dry habitat. There
organisms on earth than any other extant organisms on are fewer protists and bryophytes because these
the planet. organisms must avoid drying out. c: One would expect
16. It might modify the hypothesis that life may have started less diversity in the prairies of Kansas because there are
at specifically this type of thermal vent; however, if no fewer trees, so there are fewer potential habitats.
methane was produced abiotically at this particular vent, 5. A fungicide would kill the fungi, which are critical for
that does not establish that methane cannot be produced decomposition. The lack of fungi would lead to an
at thermal vents or abiotically in other ways. accumulation of nonliving organic matter and there would
17. No. You would not expect to find photosynthetic be fewer nutrients available for other eukaryotes.
organisms at Lost City because there is no appreciable 6. The first group of plants to live on land was the
sunlight at that depth. bryophytes, which lack roots and tissue for transporting
18. Because of the harsh conditions present at the vents, it nutrients and water. The lack of a vascular system limits
seems unlikely that the scientists working there might these plants to damp environments. So even though they
contaminate the area with surface organisms that would were first, they don’t have all the adaptations necessary to
be able to survive and compete with the natural microbes. live in a variety of terrestrial habitats.
However, microbial life is so diverse and unpredictable 7. d
that such contamination is certainly possible. Should such 8. The evolution of seeds allowed plants to survive harsh
microbes survive, they might out-compete natural conditions and spread to new locations. Seeds are
organisms (as an invasive species) and could disrupt or protected within cones or fruit, and can be spread
totally destroy the current ecosystem. This could lead to relatively easily.
the extinction of a species, and so this threat should be
taken seriously by the scientists studying the vents. 9. A hungry animal is more likely to disperse the seeds of an
angiosperm than a gymnosperm since the seeds are
19. Answers will vary. There are countless examples of how enclosed in fruit, a tasty treat for a hungry animal.
breakthroughs in basic science (that is, science for the
sake of understanding the world, rather than for a specific 10. Ferns were the first true vascular plants. They were able
purpose, such as treating a disease) have led to to grow taller and overran the landscape during the
breakthroughs which benefit human society. By studying Carboniferous period. Since then, vascular plants such as
the thermal vents, scientists hope to better understand trees have dominated many landscapes.
the diversity of life on earth and its origins. The vents have 11. b
already led to changes in our understanding of evolution 12. c
and the mechanisms by which organisms harness energy 13. Both the fisher and the human are predators and have a
on earth. For example, this ecosystem is one of the only backbone, mammary glands, and hair on their bodies.
known ecosystems that does not ultimately rely on the
14. d
energy of the sun, as photosynthetic organisms do not
make up the base of this ecosystem’s food chain. 15. a: Using flight as a criterion, woodpecker and wasp would
be grouped together and the nonflying group would
include human, ant, and fisher. The “two-legged” group
Chapter 19 includes human and woodpecker; the “more-than-two-
1. Olympic National Park contains many species not found legged” group includes wasp, ant, and fisher. The only
anywhere else, like the Olympic torrent salamander and animal having feathers is the woodpecker; the
the Olympic gopher, because of the park’s isolation and “nonfeather” group includes human, wasp, ant, and
topography. The park is an ecological island with fisher. b: These groupings do not accurately reflect the
saltwater on three sides and during the last ice age was taxonomic relationship since, for example, wasps and
separated from the rest of the United States. A large ants are arthropods and woodpecker, human, and fisher
diversity of animals is able to survive in the various are chordates. Thus, it is necessary to use molecular
habitats found in the park, which include glacier-topped biology and multiple characteristics to characterize the
506 ANSWERS
relationship between organisms correctly. c: Wasps and pets, livestock, or humans, may affect military
ants share characteristics of arthropods, including activity in the area, and may decrease prey of interest
segmented bodies with jointed appendages and a hard to hunters.
exoskeleton, and characteristics of insects, including three 25. Answers will vary depending on locality.
pairs of jointed legs and a three-part body consisting of
head, thorax, and abdomen. The human and fisher are
grouped together on the basis of the presence of an Chapter 20
endoskeleton, the production of milk, and the presence of 1. c
hair.
2. b
16. All arthropods have an exoskeleton for protection from
3. Folate is normally destroyed by UV light, and darker skin
predators, to prevent them from drying out, and to
evolved as a mechanism to maintain folate. a: If this were
support movement. Some arthropods, like spiders, have
no longer true, and folate levels were unaffected by UV
evolved the ability to produce venom for protection and
light, levels of melanin would likely decrease in
predation. Beetles have been extraordinarily successful
populations living at the equator because the role of UV
because of the development of wings and specialized
light in producing vitamin D would be beneficial. b: There
mouthparts. Wings allow beetles to escape predators and
would be no change expected in this population. The
to access habitats and remote food sources. Ants have
levels of UV are low in this environment, so there is no
evolved complex social behavior that allows them to
pressure for dark skin to protect folate, and light skin
coordinate the behavior of the group.
allows vitamin D production.
17. a: Fungi are heterotrophs and cannot carry out
4. d
photosynthesis. b: Fungi do not ingest their food—they
perform external digestion instead. c: Fungi digest food by 5. c
secreting enzymes onto their food, which break down 6. Mitochondrial DNA is inherited solely from the mother.
molecules into smaller organic compounds that can be Mitochondrial DNA mutates at a fairly regular rate. A
absorbed by the fungi. mother with a DNA mutation in her mitochondrial DNA
18. c will pass it down to all her children, and her daughters
will pass it to all their children. Because these mutations
19. Both fungi and plants are eukaryotes containing cell walls.
are passed on intact, without recombination, mtDNA is a
Neither are mobile. The key difference between the two is
useful tool to track human ancestry back through
how they obtain their nutrients. Plants are autotrophs,
generations.
producing their own food through photosynthesis; fungi
are heterotrophs, obtaining their nutrients by 7. a
decomposing organic matter. 8. e
20. b 9. See Infographic 20.7. Africans have the highest levels of
21. f genetic diversity, as they are the descendants of the most
22. Protists are no longer considered a separate kingdom ancient populations. The next highest levels would be
because protists do not form a cohesive evolutionary expected in Asian populations (the migration from Africa
group: some members undergo photosynthesis like to Asia took place ∼67,000 years ago), followed by
plants, other members eat other organisms like animals, Europeans (∼40,000 years ago) and then South
and still other members are decomposers like fungi. Americans (13,000 years ago).
Genetic information will be the most useful basis for 10. Tools would have aided in hunting and food preparation,
creating new taxonomic “homes” for the protists. allowing Australopithecines to have better nutrition and
23. If the protist is living in a freshwater environment, water less risk of starving to death.
will enter it by osmosis, decreasing the concentration of 11. If there were another benefit to having an opposable big
solutes in the protist and potentially causing the protist to toe (faster movement, better walking stance) it would
swell and burst. The contractile vacuole prevents this have been maintained by selection, and the number of
from happening by removing some of the excess water. individuals with this feature would increase. Since
24. a: The Mexican gray wolf is an endangered species, so its humans no longer have an opposable big toe, there must
reintroduction may prevent them from becoming extinct. not have been a benefit to this feature and it was lost from
In addition, there may be benefits for the habitat by the population.
reintroducing wolves. For example, the wolves may 12. a: If there was better hunting or mate selection on the
perform a necessary evolutionary function by removing ground, an early hominid in a forested environment might
unfit individuals from the prey population. b: The have moved to the upright walking position and lost an
reintroduction of species may negatively affect the opposable big toe. In grassland, where there is nothing to
habitat and other human activities. Negative effects climb, the arboreal traits would confer no selective
on the environment include changes in other species advantage. b: Other traits that might be favored in a
that may increase the likelihood of certain diseases in forested environment include the ability to see well in
the area or alter the biodiversity of the area. With the low-light conditions (for example, under a dark canopy of
Mexican gray wolf, some of the considerations relating leaves) and a good sense of balance (necessary to walk on
to humans include concern that the wolves may attack branches).
ANSWERS 507
13 & 14. Answers will vary. Students should address race as a On the other hand, if a herbivore has a strong preference
construct that is often produced by looking at genetics, for a particular type of vegetation, then that vegetation
physical traits, geography, history, and cultural traditions. would be present in the scat at a higher proportion than
the proportion of the plant in the local environment,
Chapter 21 suggesting that the herbivore is eating that plant
1. A population is a group of organisms living in a particular preferentially.
geographic region. A community is all the organisms 9. c and d
(species) in a geographic area. Communities differ from 10. Carrying capacity is the maximum number of individuals
populations in that they include interactions between that an environment can support given its space and
populations of different species. resources. At carrying capacity the population will level
2. e off, fluctuating slightly but maintaining a relatively
3. Scat (feces) reveals information about the organism that constant size around the carrying capacity.
produced it. Studying scat samples can elucidate what an 11. Because the parasite passes from fish to fish through the
organism has been eating, as well as providing a source of water, but can’t survive for long periods of time alone in
the organism’s DNA. DNA analysis can be used to identify the water, the parasite will have the biggest impact at a high
individuals, as well as to look for genetic diseases and the fish density. This is because at high density, the fish will be
effects of inbreeding. crowded, and so the parasite will likely find new host in a
4. c. short amount of time. At low population density, it might
5. Ecology is the study of organisms, interactions between take a parasite a long time to encounter a new host, and it
organisms, and between organisms and the nonliving may die before reaching a new host. A hot summer and
components of the environment. Ecologists look at (1) the drought may cause a lake to start to dry up (or at least lose
way individual organisms respond to the environment a lot of its volume). This would leave less volume for the
(temperature, pH, light, etc.); (2) how a population of same number of fish, thereby increasing their population
organisms grows, breeds, and changes genetically over density, and permitting greater opportunities for density-
time; (3) how populations interact with each other—such dependent factors to affect the population.
as the effect of predators or symbiosis between 12. a: Abiotic. Hot summer temperatures increase the ticks on
populations; (4) how elements like rain, disease, fire, etc., moose and also may weaken the health of the moose,
affect communities and populations. eventually causing death, decreasing the size of the moose
6. You could travel and track the squirrels by their tracks population, and affecting the size of the wolf pack in
and count them at their nests, but this would be very time subsequent years. b: Biotic. Ticks weaken the health of the
consuming. Alternatively, you could set up a series of moose, eventually causing death, decreasing the size of
square plots that represent 20%-25% of the nature the moose population, and affecting the size of the wolf
preserve. You could then count the number of squirrels in pack in subsequent years. c: Biotic. The lack of trees
that area, and extrapolate to find an estimate of how many would mean a lack of food for the moose, which would
squirrels are likely to inhabit the whole nature preserve. weaken the health of the moose, eventually causing death,
These approaches could also be used to determine the decreasing the size of the moose population, and affecting
population size of maple trees, but since the trees do not the size of the wolf pack in subsequent years. d: Biotic.
move, they could be counted more individually more The illness in the wolves would make them less able to
easily than squirrels. hunt the moose or result in fewer wolves in the
7. The populations of moose and wolves are linked—the population. This will allow the moose population to grow.
moose provide virtually all of the wolf’s food. By knowing e: Abiotic. Deep snowfall is likely to trap the moose,
the changes to the size of the moose herd, researchers making it easier for the wolves to catch and kill. This will
would be able to predict changes to the size of the wolf cause death, decrease the size of the moose population,
pack. It is important to know the moose’s cause of death and affect the size of the wolf pack in subsequent years.
because if other (nonwolf ) factors are causing the moose 13. a: The introduction of a new herbivore will cause a
to die, researchers would have to take that additional decrease in the population of trees on Isle Royale. This is
factor into consideration when assessing the future moose because the new herbivore and the moose will both be
population size as well the wolf population size. For eating the trees. b: The moose population will decline
example, if researchers find that many moose are dying with the introduction of a new herbivore that is not
because of tick infestation or starvation, then the moose preyed on by wolves. This is because there will now be
population will be affected independently of wolf competition for food between the organisms, and some
predation, and this in turn will affect the wolf population. moose will die from starvation. c: The wolf population will
8. Scat (feces) reveals information about the organism that decrease as the moose population decreases after the
produced it. Studying scat samples can reveal what an introduction of the herbivore. However, if the wolves can
organism has been eating. If the scat from a particular prey on the new herbivore, the wolf population may
type of herbivore has a variety of vegetation in it in increase, because of this new food source.
approximately the same proportion as vegetation in the 14. If the population of moose remains stable on the island,
local environment, we could infer that those herbivores the wolf population could be influenced by factors such as
tend to eat what is available, without a strong preference. weather, disease, and genetic inbreeding.
508 ANSWERS
15. a: Population R (10,000) would add more individuals at Unfortunately, this strategy tends to backfire, in that the
the end of the first year. This is because 5% of 10,000 is introduced parasite has unintended negative
500 individuals added to the population,whereas 5% of consequences on other species.
100 (the size of population Q) is an increase of only 5
individuals. Chapter 22
b: After 5 years the size of each population would be: 1. A population is a group of organisms of the same species
that live in the same area and can mate with one another
Year Population Q Population R and produce fertile offspring. A community consists of
0 100 10,000 populations that interact and are connected by their
actions. Communities contain more than one species.
1 105 10,500
2. Keystone species are those that are very important to a
2 110 11,025 community because of their central role in supporting all
3 116 11,576 the species in the community.
4 121 12,155 3. d
5 127 12,763 4. a
5. There are many possible answers. An example:
c: If the populations reached carrying capacity at year 3, Phytoplankton are a keystone species in the ocean,
the level of resources would stop them from growing any providing food for many organisms in the ocean and
larger. The populations would then remain very close to producing a large amount of oxygen (via photosynthesis)
the carrying capacity (with minor fluctuations above and that is essential for life on earth.
below the carrying capacity). The larger population would 6. Those suffering from pollen allergies are most likely
level off at approximately 11,576 individuals, which would allergic to pollen that is wind-carried because that pollen
remain its size in subsequent years. is in the air and can be inhaled.
16. a: Answers will vary. Some people may value the wolves 7. b
when they are at remote locations, but less so when they
8. f
are near (and potential predators of ) pets and herds of
cattle or flocks of chickens. b: A number of strategies 9. The answer to Question 8 provides an example. A bear is
could be considered. (1) Introduction of wolves from part of a terrestrial food chain. The bear eats blueberries,
another population would not only increase the number which are pollinated by bees. Humans and birds also eat
of wolves but also provide new alleles to increase the blueberries. Those birds in turn can be eaten by predatory
genetic diversity in the inbred population of wolves. birds, such as hawks. The bear can also “cross over” to an
(2) Wolf pups could be protected in a refuge where they aquatic food chain and eat salmon. Those salmon eat
would be fed and have adequate shelter in a cold winter organisms lower on the food chain, for instance algae.
to increase their survival rate. Once the wolf pups were 10. The energy stored in the grain is released as the cow
judged to be healthy and strong, they could be released digests the grain. Energy is used in digestion and some
to the pack. If more wolf pups survived each year, that energy is lost to heat. Energy is also used to sustain the
would increase the size of the population (although it life of the cow. When the meat of a cow is eaten it contains
wouldn’t help with the problem of inbreeding). less energy than the grain because much of the energy
(3) Instead of introducing both male and female wolves stored in the grain has been lost or used.
from another population, only females could be 11. The herbivore eats only producers (plants). Herbivores
introduced. This would increase the number of mates for receive ∼10% of the energy that is stored in the producer;
males and contribute to increasing the genetic diversity of the rest is burned as fuel or given off as heat. The top
the population. carnivore would eat only meat, and depending on the size
17. If the carp are eating huge amounts of algae, there will be of the food chain would have access to 1% or less than 1%
fewer algae for other organisms that rely on algae as their of the energy. This is because at each level up the food
major food source. Many of these organisms will be other chain an organism can extract only 10% of the energy in
fish, whose populations will suffer as a result. If these fish the level below.
are commercial or recreational sport fish, the fishing Producer (100%) → herbivore (10%) → carnivore 1 (1%) →
industry will be negatively affected. Furthermore, if the carnivore 2 (> 1%)
carp are seriously devastating the algae population (much 12. Bees are attracted to flowers with yellow, blue, or purple
as the moose can do to the tree population on Isle petals; other nectar-seeking organisms are attracted to
Royale), there may be local impacts on CO2 levels. other colors of flowers. Bees and other pollinators have
Photosynthetic algae take up CO2 as they photosynthesize, also coevolved with some plants in such a way that the
and this helps mitigate climate change caused by elevated shape of the flower and the shape of the bee fit together to
levels of CO2. Management strategies are certainly maximize pollen pick-up and release and provide the bee
challenging. One is to essentially try to overfish the Asian with abundant nectar and pollen. Although bees and
carp, rewarding the capture and removal of the carp. other pollinators both feed on nectar, they do not try to
Another (and riskier) strategy might be to introduce a feed on the same flowers and thus are not in direct
parasite that will attack the carp but not native fish. competition.
ANSWERS 509
13. d Chapter 23
14. Although mussels and barnacles are both filter feeders, 1. f
they might be able to coexist because the sizes of their 2. Species discussed in this chapter that might be affected by
filters are different. The mussel may be able to eat larger global climate change include maple trees, seahorses,
organisms than the barnacles, so there is not competition turtles, fish, yellow-bellied marmots, the Arctic fox, the
for the same food. red fox, and polar bears.
15. The number and diversity of bees in the area would likely 3. a, b, and c.
decrease drastically because corn is wind pollinated and 4. The coniferous forest biome is characterized principally
does not make nectar or have flowers flowers to the bees. by evergreen trees.
The bees would have to leave the area in search of a food
5. Temperate deciduous forest—eastern North America;
source.
tropical forest—Central America and northern South
16. b America; tundra—northern North America
17. The relationship between bees and the bacteria that live 6. Melting sea ice does not cause sea levels to rise. However,
within them can be characterized as mutualistic when ice caps melt, they cause sea levels to rise, thus
symbiosis. The bacteria get nutrients and a safe place to putting low-lying areas at risk of flooding.
live from the bees, and the bees benefit from the bacteria 7. a: Smaller leaves would decrease the surface area that can
because the bacteria help the bees to defend themselves lose water to the environment, and that means that less
from disease. water would be lost by evaporation. Less surface area also
18. Researchers studying colony collapse disorder (CCD) means a decreased ability to take up CO2 from the
noticed that the bees were very sick and seemed to have environment. However, given that increased global
weakened immune systems. The virus IAPV was a good temperatures are caused by increased CO2 levels, smaller
candidate for causing weakened immune response, and it leaves might not be a negative factor. Overall this could be
was found in 96% of the hives with CCD. However, further a useful adaptation for the increased temperatures. b:
research showed that not all colonies that are infected More pores on each leaf would increase the amount of
with IAPV have CCD, so there must be another factor water lost because there would be more exposed area
causing CCD. A second hypothesis was that the parasitic from which to lose water. Having more pores would also
varroa mite was feeding on the bees’ blood, causing a increase the amount of CO2 that could be taken into the
weakened immune system and making them more plant and used for photosynthesis. Overall the loss of
susceptible to disease. However, research has shown that water would be more detrimental to the plant than the
the levels of mite infection in colonies with CCD are no increased CO2, so this would not be a useful adaptation to
higher than the levels seen in previous years when CCD global climate change. c: Thicker, waxier bark would serve
was not a problem. to maintain water in the trunk of the plant, since water
won’t evaporate out of these surfaces. This waxy layer
19. The relationship between E. coli and humans is a
would not affect CO2 uptake since this tissue is not
symbiosis. Most of the time E. coli is beneficial to humans
photosynthetic. Similarly, thicker and waxier bark would
because these bacteria can prevent other pathogenic
be harder for insects to munch on, so this feature would
bacteria from colonizing (competition), and some types
be protective in the face of migrating populations of plant-
of E. coli can produce vitamin K12. E. coli benefits from
eating insects. Overall this would be an effective adaptation
living in the human intestine because of the available
for global climate change.
nutrients and environment that is conducive to
growth. 8. People in northern climates could contract new and
This type of relationship is called mutualism. Some different diseases if insects that carry diseases expand
strains of E. coli are parasitic: the bacteria get nutrients their ranges northward because of global climate change.
and a place to live and the humans get sick. 9. b
20. Point out the importance of bees in helping plants to 10. b
reproduce. These plants are used as food sources by 11. a
humans or by other animals which humans eat. Without 12. In the greenhouse effect, the heat trapped by greenhouse
the bees the plants would not be fertilized and no seeds gases raises the temperature of the atmosphere and in
would form. turn raises the temperature of the surface of the earth.
21. Planting a single crop over a wide area decreases the Without the greenhouse effect, the temperature on
number of pollinators that can be supported because earth would be –18°C; we could not survive at that
there will be competition for the common resource. Also, temperature.
there might not be enough variety in food sources for the 13. The evidence that increasing levels of greenhouse gases
pollinators to maintain a healthy diet. Similarly, a single (particularly CO2) are responsible for global climate
crop will flower (and produce pollen and nectar) all at change includes these points: (1) Carbon dioxide
once, creating a situation of feast at the time of flowering concentrations are higher than they have been in 700,000
and famine for the rest of the year. These periods of years. (2) Since direct measurement of atmospheric
famine can cause the loss of pollinator species, affecting carbon dioxide began in the late 19th century, its
many other crops. concentration has increased ∼35%. Figure 23.5 shows
510 ANSWERS
how CO2 levels increased with temperatures over the last the electricity), which can be mitigated by replacing worn-
1,000 years. Both temperature and CO2 stayed relatively out appliances with energy-efficient versions, line-drying
level until the start of the industrial revolution, when CO2 laundry rather than using a dryer, and turning off and
levels increased. unplugging electrical devices when they are not in use.
Data from the past 50+ years showing that the level of 20. Answers will vary. These actions would contribute to a
solar radiation had increased over the entire planet would low-carbon footprint menu: (1) purchasing locally grown
support the hypothesis. Also supportive would be a graph food, thus reducing the consumption of fossil fuels
and data analysis that show a correlation between required to transport food long distances from the site of
increased levels of solar radiation and the increasing production to the site of consumption (different parts of
temperatures of the planet. the country would rely on different foods, depending on
14. Using fossil fuels for energy converts organic carbon to what is produced locally; (2) eating foods that do not
CO2. Most organisms, including plants, animals and require cooking, to reduce use of electricity or gas); (3)
decomposers, perform respiration, producing CO2 from using a solar oven rather than a gas or electric oven to
organic food. CO2 is released to the atmosphere. CO2 is cook food
absorbed by the photosynthetic organisms in the ocean.
Plants perform photosynthesis, fixing CO2 into organic Chapter 24
molecules. Coal and oil are fossil fuels that trap carbon in 1. Some advances discussed in the chapter are the
the earth. development of agriculture and the use of antibiotics
15. c and other advances in public health.
16. Surface ice is not useful, but ice cores provide a way to 2. An ecological footprint is a tool used to calculate how
measure atmospheric conditions from the distant past. much of the earth’s resources a population’s lifestyle
Cylinders of ice can be extracted from glaciers, and the requires. It calculates how much biologically productive
composition of gas bubbles within them can be analyzed. land and water area a human population needs to
This analysis reveals the atmospheric conditions of produce the resources it consumes and to absorb the
thousands of years ago, when those bubbles were initially waste it produces.
trapped in the ice. 3. d
17. a: Large-scale slash and burn agriculture releases carbon 4. The factors contributing to the ecological footprint of
that was stored in trees directly to the atmosphere as each area are healthy food, energy for mobility and heat,
carbon dioxide. Additionally, as the land does not fiber for paper, clothing and shelter, fresh air and clean
generally support long-term crop production, the overall water.
levels of photosynthesis (which removes CO2 from the
atmosphere) are reduced relative to those of the original City Footprint Factors Contributing to Footprint
forest. b: Driving gasoline-fueled cars (in fact, burning Dongtan, Relatively low Designed to be sustainable: no cars
any fossil fuel) releases carbon (as CO2) that had been China are necessary because everything is
stored for a very long time in the earth. This carbon is within walking distance; energy is
essentially “new” carbon being introduced into the derived from solar and wind sources;
buildings are designed to remain cool
atmosphere, adding to the amount of carbon already
without reliance on air conditioning;
cycling. c: Cattle raised for beef and dairy products
extensive recycling to minimize waste
have methane-producing microbes in their guts that help and pollution.
them digest food, but the cattle release large amounts of
Rural village Relatively low Less developed, therefore less use of
methane gas as flatulence. Methane is a potent
in China fossil fuels for cars; food is produced
greenhouse gas. d: Rice production also releases locally, reducing transportation costs.
methane gas into the environment. Methane is a potent
Calgary, Relatively high Calgary is considering its ecological
greenhouse gas.
Canada footprint in development decisions, and
18. d. Ice cores that contain ice formed in 1750 would be the residents can use a light rail system that
most effective way to determine the CO2 concentration at is powered through the use of wind
that time. The Mauna Loa observatory has been turbines. Thus its footprint is probably
smaller than would be expected for a
continuously monitoring and collecting data related to
developed city in North America.
atmospheric change only since the 1950s—it would not
have data from 1750. Neither tree rings nor historical Houston, Relatively high Large area and highways necessitate
Texas travel by automobile, increasing fossil
records would give accurate values from which to
fuel use. Hot summers require high use
determine CO2 levels but could provide clues to the
of electricity for air conditioning; city
weather in 1750. acts as a heat trap.
19. Answers will vary. Considerations include: emissions from New York Relativity low As noted in the chapter, the high
automobiles, which could be mitigated by using public population density and relatively small
transportation, carpooling, or cycling or walking on a area in New York allows New Yorkers to
regular basis; the use of household electrical products use public transportation, rather than
(which often rely on coal-fired electrical plants to generate driving cars for their daily commutes.
ANSWERS 511
5. The addition of 20 families will increase the population of reduce the use of fossil-fuel-powered cars), save energy,
the town. If the children remain in the town and raise decrease CO2 production, and reduce air pollution. b: If
families, the town’s population will likely continue to the buildings have green roofs, they have vegetation to
increase in the future. Generally speaking, urban absorb and filter rainwater, and provide growing space for
populations have a higher footprint than rural food. This measure would save energy needed to bring
populations. As the new condominiums are on the food into the city from farms and recycles water and help
outskirts of the town, the families will need to drive into keep buildings cool. b: Solar panels are mounted
town for school, work, and shopping. If each family has throughout a city would provide renewable energy with
two cars, this represents 40 new vehicles, more than what little pollution or waste.
was likely used on the farm. Similarly, 20 families will 13. Waste in the form of methane collected from landfills can
produce a variety of waste that will likely be in excess of be used to power dump trucks; batch reactors can digest
that generated by farming a crop. There are now 20 human waste to use as fertilizer.
households to be heated and cooled rather than the
14. Examples: reducing home water use would help maintain
original farmhouse. It is thus likely that this population
water availability; installing compact fluorescent
will use more energy and generate more waste than the
lightbulbs would help save electricity and decrease the
farm, thereby enlarging the ecological footprint.
amount of CO2 released into the atmosphere; eating less
6. The developer could use solar or wind power to replace meat—meat takes a great deal of grain and water to
traditional fossil fuels for energy sources. The developer produce, affecting energy consumption; unplug
could also take into consideration public transportation electronics not in use would reduce vampire energy flow—
and provide alternatives to driving, as well as making energy flow from devices that are turned off; driving less
housing, workplaces, and school within walking and would reduce fossil fuel burning and CO2 emissions;
biking distance. recycling would reduce the amount of waste produced.
7. e 15. Cities in the desert must draw water from underground
8. freshwater (R); coal (NR); codfish populations in the North aquifers or rely on water from rivers. As the desert is
Atlantic (R); wind (R); sunlight (R) typically hot (especially in the summer), the energetic
9. Coal, oil, and natural gas are fossil fuels that take millions costs of home cooling in the summer are substantial: a
of years to form from organic material in dead organisms great deal of electricity is required to cool homes in the
and therefore these resources are not renewable on a summer. Many southwestern cities are spread out,
useful timescale. creating a demand for fossil fuels.
10. Renewable resources like food and water may not have 16. When water is taken out of the river to irrigate crops,
the time to renew themselves when the population is water levels beyond this point will be much lower. This
growing so quickly and demand for them exceeds the means that there is less water in the river (or reservoirs)
space available to grow and harvest them. For example, at for fishing, boating, and swimming. On the other hand,
one point the North Atlantic codfish industry was in the water is being used to irrigate crops that represent
danger of collapsing because of high demand and food for the population. In addition to negative impacts
overfishing—taking cod faster than they could reproduce on recreation downstream, the withdrawal of water for
was making the cod a renewable resource. Governments irrigation means that there is not enough water in the
chose to limit the catch of cod, and the numbers of cod river to support an endangered species of minnow. This
are gradually increasing. Similarly, while water is puts human needs (irrigation of crops) in direct conflict
technically renewable, we can choose how to use water, with the needs of another species. Different people will
and how to maintain clean water for drinking, even at the have different opinions about this issue.
expense of recreation. And while we are unlikely to run 17. In general, the United States has a much higher footprint
out of wind or sunlight, we can make choices to make than Bangladesh, primarily because the United States is a
these resources more accessible. For example, we can highly developed country. As countries develop, their
agree to look at perhaps unattractive wind farms for the footprints increase. This will lead to an overall increase in
sake of taking advantage of this resource. the global footprint. As the global footprint increases, the
11. Answers will vary, depending on locale. Challenges might number of people that the earth can support will decrease
be space (solar panels and wind mills) and the expense of (that is, carrying capacity will decrease). Different people
new technology. will have different opinions about whether or not this is a
12. a: Schools and shops located near residences will increase shared responsibility—whether or not developed countries
walking, biking, or the use of public transportation. These should reduce their footprints to accommodate the
measures would decrease use of fossil fuels (because they development of other countries.
512 ANSWERS
Glossary
abiotic Refers to nonliving components of the environment anticodon The part of a tRNA molecule that binds to a
such as temperature and precipitation. complementary mRNA codon.
acid A substance that increases the hydrogen ion apoptosis Programmed cell death; often referred to as
concentration of solutions, making them more acidic. cellular suicide.
activation energy The energy required for a chemical aquifer Underground layers of porous rock from which
reaction to proceed. Enzymes accelerate reactions by water can be drawn.
reducing their activation energy. archaea One of the two domains of prokaryotic life, the
active site The part of the enzyme that binds to substrates. other is Bacteria.
active transport The energy-requiring process by which arthropod An invertebrate having a segmented body, a hard
solutes are pumped from an area of lower concentration to an exoskeleton, and jointed appendages.
area of higher concentration with the help of transport atom The smallest unit of an element that cannot be
proteins. chemically broken down into smaller units.
adaptation The response of a population to environmental autosomes Paired chromosomes present in both males and
pressure, so that advantageous traits become more common females; all chromosomes except the X and Y chromosomes.
in the population over time. autotrophs Organisms such as plants, algae, and certain
adaptive radiation The spreading and diversification of bacteria that capture the energy of sunlight by
organisms that occur when they colonize a new habitat. photosynthesis.
adenosine triphosphate (ATP) The molecule that cells use
to power energy-requiring functions; the cell’s energy bacteria One of the two domains of prokaryotic life; the
“currency.” other is Archaea.
adult stem cells (somatic stem cells) Stem cells located in base A substance that reduces the hydrogen ion
tissues that help maintain and regenerate those tissues. concentration of solutions, making them more basic.
aerobic respiration A series of reactions that occurs in the bilateral symmetry The pattern exhibited by a body plan
presence of oxygen and converts energy stored in food into with clear right and left halves that are mirror images of each
ATP. other
alga (plural: algae) A uni- or multicellular photosynthetic binary fission A type of asexual reproduction in which one
protist. parental cell divides into two.
alleles Alternative versions of the same gene that have biocapacity The amount of the earth’s biologically
different nucleotide sequences. productive area—cropland, pasture, forest, and fisheries—that
is available to provide resources to support life.
allele frequency The relative proportion of an allele in a
population. biogeography The study of how organisms are distributed
in geographical space.
allopatry Speciation that occurs because of geographic or
ecological barriers to gene flow. biological species concept The definition of a species as a
population whose members can interbreed to produce fertile
amino acids The building blocks of proteins. There are 20
offspring.
different amino acids found in proteins.
biome A large geographic area defined by its characteristic
amniocentesis A procedure that removes fluid surrounding
plant life, which in turn is determined by temperature and
a fetus to obtain and analyze fetal cells to diagnose genetic
levels of moisture.
disorders.
biotic Refers to living components of the environment.
anabolic reaction Any chemical reaction that combines
simple molecules to build more-complex molecules. blastocyst The stage of embryonic development in which
the embryo is a hollow ball of cells. Researchers can derive
anecdotal evidence An informal observation that has not
embryonic stem cell lines from cells of a blastocyst stage
been systematically tested.
embryo.
aneuploidy An abnormal number of one or more body mass index (BMI) An estimate of body fat based on
chromosomes (either extra or missing copies). height and weight.
angiosperm A seed-bearing flowering plant with seeds bottleneck effect A type of genetic drift that occurs when a
typically contained within a fruit. population is suddenly reduced to a small number of
animal A eukaryotic, usually multicellular, organism that individuals, and alleles are lost from the population as a
obtains nutrients by ingesting other organisms or molecules result.
produced by other organisms. bryophyte A nonvascular plant that does not produce seeds.
annelid A segmented worm, such as an earthworm.
antibiotic A chemical that can slow or stop the growth of calorie The amount of energy required to raise the
bacteria; many antibiotics are produced by living organisms. temperature of 1 gram of water by 1o Celsius.
513
Calorie 1,000 calories or 1 kilocalorie (kcal); the capital “C” chloroplast The organelle in plant and algal cells that is the
in “Calorie” indicates “kilocalorie.” The Calorie is the site of photosynthesis.
common unit of energy used in food nutrition labels. chromosome A single, large DNA molecule wrapped around
cancer A disease of unregulated cell division: cells divide proteins. Chromosomes are located in the nuclei of most
inappropriately and accumulate, in some instances forming a eukaryotic cells.
tumor. citric acid cycle A set of reactions that takes place in
capsule A sticky coating surrounding some bacterial cells mitochondria and helps extract energy (in the form of high-
used to adhere to surfaces. energy electrons) from food; the second step of aerobic
carbohydrate An organic molecule made up of one or more respiration.
sugars. A one-sugar carbohydrate is called a monosaccharide; coding regions Sequences of DNA that serve as instructions
a carbohydrate with multiple linked sugars is called a for making proteins.
polysaccharide. coding sequence The part of a gene that specifies the amino
carbon cycle The movement of carbon atoms between acid sequence of a protein. Coding sequences determine the
organic and inorganic molecules in the environment. identity, shape, and function of proteins.
carbon fixation The conversion of inorganic carbon (for codominance A form of inheritance in which both alleles
example, CO2) into organic forms (for example, sugars). contribute equally to the phenotype.
carbon footprint A measure of the total greenhouse gases codon A sequence of three mRNA nucleotides that specifies a
we produce by our activities. particular amino acid.
carcinogen Any chemical agent that causes cancer. Many coenzyme A small organic molecule, such as a vitamin,
carcinogens are mutagens. required for enzyme activity.
carrier An individual who is heterozygous for a particular cofactor An inorganic substance, such as a metal ion,
gene of interest, and therefore can pass on the recessive allele required for enzyme activity.
without showing any of its effects. commensalism A type of symbiotic relationship in which
carrying capacity The maximum population size that a one member benefits and the other is unharmed.
given environment or habitat can support, given its food community A group of interacting populations of different
supply and other natural resources. species living together in the same area.
catabolic reaction Any chemical reaction that breaks down competitive exclusion principle The concept that when
complex molecules into simpler molecules. two species compete for resources in an identical niche, one
cell The basic structural unit of living organisms. is inevitably driven to extinction.
cell cycle An ordered sequence of stages that a cell complementary Two strands of DNA are said to be
progresses through in order to divide during its life; the stages complementary in that A always pairs with T, and G always
includes preparatory phases (G1, S, G2) and division phases pairs with C.
(mitosis and cytokinesis). complex carbohydrate (polysaccharide) A carbohydrate
cell cycle checkpoint A cellular mechanism that ensures made of many simple sugars linked together, that is, a
that each stage of the cell cycle is completed accurately. polymer of monosaccharides; examples are starch and
cell division The process by which a cell reproduces itself; glycogen.
cell division is important for normal growth, development, consumers Heterotrophs that eat other organisms or the
and repair of an organism. organic molecules produced by organisms to obtain energy.
cell membrane A phospholipid bilayer with embedded control group The group in an experiment that experiences
proteins that forms the boundary of all cells. no experimental intervention or manipulation.
cell theory The concept that all living organisms are made of convergent evolution The process by which organisms that
cells and that cells are formed by the reproduction of existing are not closely related evolve similar adaptations as a result of
cells. independent episodes of natural selection.
cell wall A rigid structure enclosing the cell membrane of correlation A consistent relationship between two variables.
some cells that helps the cell maintain its shape. covalent bond A strong chemical bond resulting from the
cellular differentiation The process by which a cell sharing of a pair of electrons between two atoms.
specializes to carry out a specific role. cytokinesis The physical division of a cell into two daughter
centromere The specialized region of a chromosome where cells.
the sister chromatids are joined. This site is critical for proper cytoplasm The gelatinous, aqueous interior of all cells.
alignment and separation of sister chromatids during mitosis.
cytoskeleton A network of protein fibers in eukaryotic cells
chemotherapy The treatment of disease, specifically cancer, that provides structure and facilitates cell movement.
by the use of chemicals.
chlorophyll The pigment present in the green parts of plants decomposer An organism such as a fungus or bacterium
that absorbs photons of light energy during the light reactions that digests and uses the organic molecules in dead organisms
of photosynthesis. as sources of nutrients and energy.
514 GLOSSARY
density-dependent factor A factor whose influence on electron transport A process that takes place in
population size and growth depends on the number and mitochondria and produces the bulk of ATP during aerobic
crowding of individuals in the population (for example, respiration; the third step of aerobic respiration.
predation). element A chemically pure substance that cannot be
density-independent factor A factor that can influence chemically broken down; each element is made up of and
population size and growth, regardless of the numbers and defined by a single type of atom.
crowding within a population (for example, weather). embryo An early stage of development reached when a zygote
deoxyribonucleic acid (DNA) The molecule of heredity, undergoes cell division to form a multicellular structure.
common to all life forms, that is passed from parents to embryonic stem cells Stem cells that make up an early
offspring. embryo, which can differentiate into nearly every cell in the
dependent variable The measured result of an experiment, body.
analyzed in both the experimental and control groups. endoplasmic reticulum A membrane-enclosed series of
descent with modification Darwin’s term for evolution, passages in eukaryotic cells in which proteins and lipids are
combining the ideas that all living things are related and that synthesized.
organisms have changed over time. endoskeleton A solid internal skeleton found in many
diabetes A disease characterized by abnormally high blood- animals, including humans.
sugar levels. endosymbiosis The theory that free-living prokaryotic cells
differential gene expression The process by which engulfed other free-living prokaryotic cells billions of years
different genes are “turned on” (that is, expressed) in ago, forming eukaryotic organelles such as mitochondria and
different cell types. chloroplasts.
diploid Having two copies of every chromosome. energy The ability to do work. Cellular work includes
processes such as building complex molecules and moving
directional selection A type of natural selection in which
substances in and out of the cell.
organisms with phenotypes at one end of a spectrum are
favored by the environment. enzyme A protein that speeds up the rate of a chemical
reaction.
distribution pattern The way that organisms are distributed
in geographic space, depending on resources and interactions epidemiology The study of patterns of disease in
with other members of the population. populations, including risk factors.
essential amino acids Eight amino acids the human body
diversifying selection A type of natural selection in which
cannot synthesize and must obtain from food.
organisms with phenotypes at both extremes of the
phenotypic range are favored by the environment. essential nutrient A substance that cannot be synthesized
by the body and must be obtained preassembled from the
DNA polymerase An enzyme that “reads” the sequence of a
diet; certain amino acids and fatty acids, vitamins, and
DNA strand and helps to add complementary nucleotides to
minerals are essential nutrients.
form a new strand during DNA replication.
eukaryote Any organism of the domain Eukarya; eukaryotic
DNA profile A visual representation of a person’s unique
cells are characterized by the presence of a membrane-
DNA sequence.
enclosed nucleus and organelles.
DNA replication The natural process by which cells make an evolution Change in allele frequencies in a population over
identical copy of a DNA molecule. time.
domain The highest category in the modern system of exoskeleton A hard external skeleton covering the body of
classification; there are three domains—Bacteria, Archaea, many animals, such as arthropods.
and Eukarya.
experiment A carefully designed test, the results of which
dominant allele An allele that can mask the presence of a will either support or rule out a hypothesis.
recessive allele.
experimental group The group in an experiment that
double helix The spiral structure formed by two strands of experiences the experimental intervention or manipulation.
DNA nucleotides bound together.
exponential growth The unrestricted growth of a
population growing at a constant growth rate.
ecology The study of the interactions between organisms,
extinction The elimination of all individuals in a species;
and between organisms and their environment.
extinction may occur over time or in a sudden mass die-off.
ecological footprint A measure of how much land and
water area is required to supply the resources a person or facilitated diffusion The process by which large or
population consumes and to absorb the wastes they produce. hydrophilic solutes move across a membrane from an area of
ecosystem The living and nonliving components of an higher concentration to an area of lower concentration with
environment, including the communities of organisms present the help of transport proteins.
and the physical environment with which they interact. falsifiable Describes a hypothesis that can be ruled out by
electron A negatively charged subatomic particle with data that show that the hypothesis does not explain the
negligible mass. observation.
GLOSSARY 515
fermentation A series of chemical reactions that takes place genotype The genetic makeup of an organism.
in the absence of oxygen and converts some of the energy global hectare The unit of measurement of the ecological
stored in food into ATP. Fermentation produces far less ATP footprint, representing the biological productivity of an
than does aerobic respiration. average hectare of land.
fiber A complex plant carbohydrate that is not digestible by global warming An increase in the earth’s average
humans. temperature.
fitness The relative ability of an organism to survive and glycogen A complex animal carbohydrate made of linked
reproduce in a particular environment. chains of glucose molecules; a source of stored energy.
flagella (singular: flagellum) Whiplike appendages glycolysis A series of reactions that breaks down sugar into
extending from the surface of some bacteria, used in smaller units; glycolysis takes place in the cytoplasm and is
movement of the cell. the first step of both aerobic respiration and fermentation.
folate A B vitamin also known as folic acid. Folate is an Golgi apparatus An organelle made up of stacked
essential nutrient, necessary for basic bodily processes such membrane-enclosed discs that packages proteins and
as DNA replication and cell division. prepares them for transport.
food chain A linked series of feeding relationships in a Gram-negative Refers to bacteria with a cell wall that
community in which organisms further up the chain feed on includes a thin layer of peptidoglycan surrounded by an outer
ones below. lipid membrane that does not retain the Gram stain.
food web A complex interconnection of feeding Gram-positive Refers to bacteria with a cell wall that
relationships in a community. includes a thick layer of peptidoglycan that retains the Gram
fossils The preserved remains or impressions of once-living stain.
organisms. greenhouse effect The normal process by which heat is
fossil fuel Carbon-rich energy source, such as coal, radiated from earth’s surface and trapped by gases in the
petroleum, or natural gas, formed from the compressed, atmosphere, helping to maintain the earth at a temperature
fossilized remains of once-living organisms. that can support life.
fossil record An assemblage of fossils arranged in order of greenhouse gas Any of the gases in earth’s atmosphere that
age, providing evidence of changes in species over time. absorb heat radiated from the earth’s surface and contribute
fungus (plural: fungi) A single-cell or multicellular to the greenhouse effect; for instance, carbon dioxide and
eukaryotic organism that obtains nutrients by secreting methane.
digestive enzymes onto organic matter and absorbing the growth rate The difference between the birth rate and the
digested product. death rate of a given population; also known as the rate of
natural increase
gametes Specialized reproductive cells that carry one copy gymnosperm A seed-bearing plant with “naked” seeds
of each chromosome (that is, they are haploid). Sperm are typically held in cones.
male gametes; eggs are female gametes.
gel electrophoresis A laboratory technique that separates habitat The physical environment where an organism lives
fragments of DNA by size. and to which it is adapted.
gene A sequence of DNA that contains the information to half-life The time it takes for one-half of a substance to
make at least one protein. decay.
gene expression The process of using DNA instructions to haploid Having only one copy of every chromosome.
make proteins. Hardy-Weinberg equilibrium The principle that, in a
gene flow The movement of alleles from one population to nonevolving population, both allele and genotype frequencies
another, which may increase the genetic diversity of a remain constant from one generation to the next.
population. heat The kinetic energy generated by random movements of
gene pool The total collection of alleles in a population. molecules or atoms.
gene therapy A type of treatment that aims to cure disease herbivory Predation on plants, which may or may not kill
by replacing defective genes with functional ones. the plant.
genetically modified organism (GMO) An organism that heterotrophs Organisms, such as humans and other
has been genetically altered by humans. animals, that obtain energy by eating other organisms or
genetic code The particular amino acids specified by molecules produced by other organisms.
particular mRNA codons. heterozygous Having two different alleles of a given gene.
genetic drift Random changes in the allele frequency of a homeostasis The maintenance of a relatively constant
population between generations; genetic drift tends to have internal environment.
more dramatic effects in smaller populations than in larger homologous chromosomes The two copies of each
ones. chromosome in a diploid cell. One chromosome in the pair is
genome One complete set of genetic instructions encoded in inherited from the mother, the other is inherited from the
the DNA of an organism. father.
516 GLOSSARY
homology Anatomical, genetic, or developmental similarity light energy The energy of the electromagnetic spectrum of
among organisms due to common ancestry. radiation.
hominid Any living or extinct member of the family lipids Organic molecules that generally repel water.
Hominidae, the great apes—humans, orangutans, logistic growth A pattern of growth that starts off fast and
chimpanzees, and gorillas. then levels off as the population reaches the carrying capacity
homozygous Having two identical alleles of a given gene. of the environment.
hydrogen bond A weak electrical attraction between a lysosome An organelle in eukaryotic cells filled with
partially positive hydrogen atom and another atom with a enzymes that can degrade worn-out cellular structures.
partial negative charge.
hydrophobic “Water-fearing”; hydrophobic molecules will macromolecules Large organic molecules that make up
not dissolve in water. living organisms; they include carbohydrates, proteins, and
nucleic acids.
hydrophilic “Water-loving”; hydrophilic molecules dissolve
in water. macronutrients Nutrients, including proteins,
carbohydrates, and fats, that organisms must ingest in large
hypha (plural: hyphae) A long, threadlike structure
amounts to maintain health.
through which fungi absorb nutrients.
mammals Members of the class Mammalia; all members of
hypothesis A testable and falsifiable explanation for a
this class have mammary glands and a fur-covered body.
scientific observation or question.
matter Anything that takes up space and has mass.
inbreeding Mating between closely related individuals. meiosis A specialized type of cell division that generates
Inbreeding does not change the allele frequency within a genetically unique haploid gametes.
population, but it does increase the proportion of melanin A pigment, produced by a specific type of skin cell,
homozygous individuals to heterozygotes. that gives skin color.
inbreeding depression The negative reproductive messenger RNA (mRNA) The RNA copy of an original DNA
consequences for a population associated with having a high sequence formed during transcription.
frequency of homozygous individuals possessing harmful metabolism All the chemical reactions taking place in the
recessive alleles. cells of a living organism that allow it to obtain and use
incomplete dominance A form of inheritance in which energy, including breaking down food molecules and building
heterozygotes have a phenotype that is intermediate between new molecules.
homozygous dominant and homozygous recessive. metastasis The spread of cancer cells from one location in
independent assortment The principle that alleles of the body to another.
different genes are distributed independently of one another micronutrients Nutrients, including vitamins and minerals,
during meiosis. that organisms must ingest in small amounts to maintain
independent variable The variable, or factor, being health.
deliberately changed in the experimental group. mineral An inorganic chemical element required by
induced pluripotent stem cell A pluripotent stem cell that organisms for normal growth, reproduction, and tissue
was generated by manipulation of a differentiated somatic cell maintenance; examples are calcium, iron, potassium, and
inorganic molecule A molecule that lacks a carbon-based zinc.
backbone and C–H bonds. mitochondria Membrane-bound organelles responsible for
insect A six-legged arthropod with three body segments: important energy-conversion reactions in eukaryotes.
head, thorax, and abdomen. mitochondrial DNA (mtDNA) The DNA in mitochondria
insulin A hormone secreted by the pancreas that regulates that is inherited solely from the mother.
blood sugar. mitosis The segregation and separation of duplicated
interphase The stage of the cell cycle in which cells spend chromosomes during cell division.
most of their time, preparing for cell division. There are three molecule Atoms linked by covalent bonds.
distinct phases within interphase (G1, S, and G2). mollusk A soft-bodied invertebrate, generally with a hard
invertebrate An animal lacking a backbone. shell (which may be tiny, internal, or absent in some
ion An electrically charged atom, the charge resulting from mollusks).
the loss or gain of electrons. monomer One chemical subunit of a polymer.
ionic bond A strong electrical attraction between oppositely monosaccharide The building block, or monomer, of a
charged ions. carbohydrate.
multifactorial inheritance An interaction between genes
karyotype The chromosomal makeup of cells. Karyotype and the environment that contributes to a phenotype or trait.
analysis can be used to detect trisomy 21 prenatally. multipotent Describes a cell with the ability to differentiate
keystone species A species on which other species depend, into a limited number of cell types in the body.
and whose removal has a dramatic impact on the community. mutagen Any chemical or physical agent that can damage
kinetic energy The energy of motion or movement. DNA by changing its nucleotide sequence.
GLOSSARY 517
mutation A change in the nucleotide sequence of DNA. paleontologist A scientist who studies ancient life by means
mutualism A type of symbiotic relationship in which both of the fossil record.
members benefit; a “win-win” relationship. parasitism A type of symbiotic relationship in which one
mycelium (plural: mycelia) A spreading mass of member benefits at the expense of the other.
interwoven hyphae that forms the often subterranean body of pathogen A disease-causing agent, usually an organism.
multicellular fungi. peer review A process in which independent scientific
experts read scientific studies before their publication to
natural resources Raw materials that are obtained from the ensure that the authors have appropriately designed and
earth and are considered valuable even in their relatively interpreted their study.
unmodified, natural form.
peptidoglycan A macromolecule that forms all bacterial cell
natural selection Differential survival and reproduction of walls and provides rigidity to the cell wall.
individuals in response to environmental pressure that leads
pH A measure of the concentration of H+ in a solution.
to change in allele frequencies in a population over time.
phenotype The visible or measurable traits of an individual.
neutron An electrically uncharged subatomic particle found
in the nucleus of an atom. phospholipid A type of lipid that forms biological
membranes.
niche The space, environmental conditions, and resources
that a species needs in order to survive and reproduce. phospholipid bilayer A double layer of phospholipid
molecules that characterizes all biological membranes.
nitrogen fixation The process of converting atmospheric
nitrogen into a form that plants can use to grow. photons Packets of light energy, each with a specific
wavelength and quantity of energy.
nonadaptive evolution Any change in allele frequency that
does not by itself lead a population to become more adapted photosynthesis The process by which plants and other
to its environment; the causes of nonadaptive evolution are autotrophs use the energy of sunlight to make energy-rich
mutation, genetic drift, and gene flow. molecules using carbon dioxide and water.
noncoding regions DNA sequences that do not hold phylogenetic tree A branching tree of relationships showing
instructions to make proteins. common ancestry.
nondisjunction Failure of chromosomes to separate phylogeny The evolutionary history of a group of organisms.
accurately during cell division; nondisjunction in meiosis pili (singular: pilus) Short, hairlike appendages extending
leads to aneuploid gametes. from the surface of some bacteria, used to adhere to surfaces
nonrenewable resources Natural resources that cannot be pistil The female reproductive structure of a flower, made up
replaced. of a stigma, style, and ovary.
nuclear envelope The double membrane surrounding the placebo A fake treatment given to control groups to mimic
nucleus of a eukaryotic cell. the experience of the experimental groups.
nucleic acids Organic molecules made up of linked placebo effect The effect observed when members of a
nucleotide subunits; DNA and RNA are examples of nucleic control group display a measurable response to a placebo
acids. because they think that they are receiving a “real” treatment.
nucleotides The building blocks of DNA. Each nucleotide plant A multicellular eukaryote that has cell walls, carries
consists of a sugar, a phosphate, and a base. out photosynthesis, and is adapted to living on land.
nucleus (atomic) The dense core of an atom. plate tectonics The movement of the earth’s upper mantle
nucleus (eukaryotic) The organelle in eukaryotic cells that and crust, which influences the geographical distribution of
contains the genetic material. landmasses and organisms.
nutrients Components in food that the body needs to grow, pluripotent Describes a cell with the ability to differentiate
develop, and repair itself. into nearly any cell type in the body.
polar molecule A molecule in which electrons are not
obese Having 20% more body fat than is recommended for shared equally between atoms, causing a partial negative
one’s height, as measured by a body mass index greater than charge at one end and a partial positive charge at the other;
30. for example, water.
oncogene A mutated and overactive form of a proto- pollen Small, thick-walled structures that contain cells that
oncogene. Oncogenes drive cells to divide continually. will develop into sperm.
organelles The membrane-bound compartments of pollination The transfer of pollen from male to female plant
eukaryotic cells that carry out specific functions. structures so that fertilization can occur.
organic molecule A molecule with a carbon-based polygenic trait A trait whose phenotype is determined by
backbone and at least one C–H bond. the interaction between alleles of more than one gene.
osmosis The diffusion of water across a semipermeable polymer A molecule made up of individual subunits, called
membrane from an area of lower solute concentration to an monomers, linked together in a chain.
area of higher solute concentration. polymerase chain reaction (PCR) A laboratory technique
osteoporosis A disease characterized by thinning bones. used to replicate, and thus amplify, a specific DNA segment.
518 GLOSSARY
population A group of organisms of the same species living ribosome The cellular machinery that assembles proteins
and interacting in a particular geographic area. during the process of translation.
population density The number of organisms per given area. RNA polymerase The enzyme that accomplishes
potential energy Stored energy. transcription. RNA polymerase copies a strand of DNA into a
predation An interaction between two organisms in which complementary strand of mRNA.
one organism (the predator) feeds on the other (the prey).
sample size The number of experimental subjects or the
prion A protein-only infectious agent.
number of times an experiment is repeated. In human
producers Autotrophs (photosynthetic organisms) that form studies, sample size is the number of subjects.
the base of every food chain.
saturated fat An animal fat, such as that found in butter;
prokaryote A usually single-cell organism whose cell lacks saturated fats are solid at room temperature.
internal membrane-bound organelles and whose DNA is not
contained within a nucleus. science The process of using observations and experiments
to draw evidence-based conclusions.
prokaryotic cells Cells that lack internal membrane-bound
organelles. scientific theory A hypothesis that is supported by many
years of rigorous testing and thousands of experiments.
protein An organic molecule made up of linked amino acid
subunits. Proteins play many critical roles in living organisms. seed The embryo of a plant, along with a starting supply of
food, encased in a protective covering.
protist A eukaryote that cannot be classified as a plant,
animal, or fungus; usually unicellular. semi-conservative DNA replication is said to be semi-
proton A positively charged subatomic particle found in the conservative because each newly made DNA molecule has
nucleus of an atom. one original and one new strand of DNA.
proto-oncogene A gene that codes for a protein that helps sex chromosomes Paired chromosomes that differ between
cells divide normally. males and females, XX in females, XY in males
punctuated equilibrium The theory that most species short tandem repeats (STRs) Sections of a chromosome in
change occurs in periodic bursts as a result of sudden which DNA sequences are repeated.
environmental change. simple diffusion The movement of small, hydrophobic
Punnett square A diagram used to determine probabilities molecules across a membrane from an area of higher
of offspring having particular genotypes, given the genotypes concentration to an area of lower concentration; simple
of the parents. diffusion does not require an input of energy.
simple sugar (monosaccharide) A carbohydrate made up
radial symmetry The pattern exhibited by a body plan that of a single sugar subunit; an example is glucose.
is circular, with no clear left and right sides. sister chromatid One of the two identical DNA molecules
radiation therapy The use of ionizing (high-energy) that make up a duplicated chromosome following DNA
radiation to treat cancer. replication.
radioactive isotope An unstable form of an element that solute A dissolved substance.
decays into another element by radiation, that is, by emitting
solution A mixture of solutes dissolved in a solvent.
energetic particles.
solvent A substance in which other substances can dissolve;
radiometric dating The use of radioactive isotopes as a
for example, water.
measure for determining the age of a rock or fossil.
randomized clinical trial A controlled medical experiment speciation The genetic divergence of populations owing
in which subjects are randomly chosen to receive either an to a barrier to gene flow between them, leading over
experimental treatment or a standard treatment (or placebo). time to reproductive isolation and the formation of new
species.
recessive allele An allele that reveals itself in the phenotype
only if the organism has two copies of that allele. stabilizing selection A type of natural selection in which
organisms near the middle of the phenotypic range of
recombination The stage of meiosis in which maternal and
variation are favored.
paternal chromosomes pair and physically exchange DNA
segments. stamen The male reproductive structure of a flower, made
up of a filament and an anther.
regulatory sequence The part of a gene that determines the
timing, amount, and location of protein produced. starch A complex plant carbohydrate made of linked chains
relative dating Determining the age of a fossil on the basis of of glucose molecules; a source of stored energy.
its position relative to layers of rock or fossils of known age. statistical significance A measure of confidence that the
renewable resources Natural resources that are replenished results obtained are “real,” rather than due to random
after use as long as the rate of consumption does not exceed chance.
the rate of replacement. stem cells Immature cells that can divide and differentiate
reproductive isolation Mechanisms that prevent mating into specialized cell types.
(and therefore gene flow) between members of different substrate A compound or molecule that an enzyme binds to
species. and on which it acts.
GLOSSARY 519
sustainability Using the earth’s resources in a way that will trophic levels Feeding levels, based on positions in a food
not permanently destroy or deplete them; living within the chain.
limits of earth’s biocapacity. tumor suppressor genes Genes that code for proteins that
symbiosis A situation in which two different organisms live monitor and check cell cycle progression. When these genes
together, often interdependently mutate, tumor suppressor proteins lose normal function.
taxonomy The process of identifying, naming, and unsaturated fat A plant fat, such as olive oil; unsaturated
classifying organisms on the basis of shared traits. fats are liquid at room temperature.
testable A hypothesis is testable if it can be supported or
rejected by carefully designed experiments or vascular plant A plant with tissues that transport water and
nonexperimental studies. nutrients through the plant body.
tetrapod An organism with four true limbs, that is, bony vertebrate An animal with a bony or cartilaginous
appendages with jointed wrists, ankles, and digits; mammals, backbone.
amphibians, birds, and reptiles are tetrapods. vestigial structure A structure inherited from an ancestor
tissue An organized group of different cell types that work that no longer serves a clear function in the organism that
together to carry out a particular function. possesses it.
totipotent Describes a cell with the ability to differentiate virus An infectious agent made up of a protein shell that
into any cell type in the body. encloses genetic information.
trans fat A type of vegetable fat which has been vitamin An organic molecule required in small amounts for
hydrogenated, that is, hydrogen atoms have been added, normal growth, reproduction, and tissue maintenance.
making it solid at room temperature. vitamin D A fat-soluble vitamin necessary to maintain a
transcription The first stage of gene expression, during healthy immune system and build healthy bones and teeth.
which cells produce molecules of messenger RNA (mRNA) The human body produces vitamin D when skin is exposed to
from the instructions encoded within genes. UV light.
transfer RNA (tRNA) A type of RNA that helps ribosomes
X chromosome One of the two sex chromosomes in
assemble chains of amino acids during translation.
humans.
transgenic Refers to an organism that carries one or more
X-linked trait A phenotype determined by an allele on an X
genes from a different species.
chromosome.
translation The second stage of gene expression. Translation
“reads” mRNA sequences and assembles the corresponding Y chromosome One of two sex chromosomes in humans.
amino acids to make a protein. The presence of a Y chromosome signals the male
transport proteins Proteins involved in the movement of developmental pathway during fetal development.
molecules across the cell membrane.
triglyceride A type of lipid found in fat cells that stores zygote A cell that is capable of developing into an adult
excess energy for long-term use. organism. The zygote is formed when an egg is fertilized by a
trisomy 21 Carrying an extra copy of chromosome 21; also sperm.
known as Down syndrome.
520 GLOSSARY
Photo Credits
Chapter 1 iStockphoto; (BL and BR) The Photo Works. p. 66: The Photo
Works. p. 67: Boissonnet/AgeFotostock. p. 71: Infographic 4.6
p. 1: Courtesy of Ann Warren. p. 3: Steve Bronstein/Getty
(TL) Rob Owen/Whal/StockXchng, (TR) ktphotog/
Images. p. 4: Courtesy of Ann Warren. p. 5: Infographic 1–1
iStockphoto, (C) Dr. Michael Klein/Peter Arnold, (B)
(TL) Used by permission of North Carolina Medical Journal
shironosov/iStockphoto. p. 73: Infographic 4.7 (L) Reprinted
(Morrisville, NC: North Carolina Institute of Medicine),
with permission © 2008 Southwest Research Institute. All
November/December 2003, www.ncmedicaljournal.org, (TR)
rights reserved. (R) David M. Phillips/Photo Researchers.
Courtesy of British Medical Journal, 28 May 2009, Vol. 338,
p. 75: Infographic 4.8 Copyright © 2008. For more information
Issue 7706, (B) Aleksej Vasic/iStockphoto. p. 6: Infographic 1.2
about The Healthy Eating Pyramid, please see The Nutrition
(TL) Science, Vol. 324, no. 5935, 26 June 2009. Reprinted with
Source, Department of Nutrition, Harvard School of Public
permission from AAAS, (TR) PLoS Med 2 (2), cover image,
Health, http://www.thenutritionsource.org, and Eat, Drink,
Krista Steinke. p. 7: Micha Pawlitzki/Zefa/Corbis: (TL) Cell
and Be Healthy by Walter C. Willett, M.D. p. 76: (L) Bengt-
Metabolism, March 4, 2009, cover illustration by Chris Lange,
Göran Carlsson/TIOFOTO/Nordic Photos; (R) Alison Wright/
© Elsevier, 2009, (TC) © Elsevier, (TR) Science, Vol. 320, no.
Photo Researchers
5882, 13 June 2008. Reprinted with permission from AAAS; (B)
Rick Wilson/The Florida Times-Union. p. 10: Infographic 1.5
(L) Jessica Peterson/Photolibrary, (TR) Nancy Nehring/
Chapter 5
iStockphoto, (CR) Interfoto/Alamy, (BL) Mark Moffett/Getty p. 81: Philip Hart. p. 83: (T) Courtesy of Sapphire Energy, Inc.,
Images, (BR) G. Lasley/VIREO. p. 12: Vicki Wagner/Alamy. (B) Philip Hart. p. 84: egdigital/iStockphoto. p. 85: Courtesy
p. 15: Infographic 1.8 Tony West/Alamy. of Sapphire Energy, Inc. p. 86: Infographic 5.2 (T, from left)
Kimberly Deprey/iStockphoto, mihtiander/FeaturePics, Bios/
Chapter 2 Photolibrary, (B) AP Photo/Arthur Max, (CL and CR) Visuals
p. 19: NASA/JPL. p. 21: Calvin J. Hamilton. p. 22: (T) NASA/JP; Unlimited/Corbis, (R, from top) Gudella/FeaturePics, moori/
(B) NASA/JSC. p. 23: Infographic 2.1 (T) Bildarchiv/ FeaturePics, Yobro10/Dreamstime.com, Photo168/
AgeFotostock, (C) globestock/iStockphoto, (B) Kazuo Ogawa/ Dreamstime.com. p. 88: Infographic 5.3 Corbis/SuperStock.
AgeFotostock. p. 27: NASA/JSC. p. 33: Infographic 2.6 (T) p. 89: Infographic 5.4 (from left) Pixelgnome/Dreamstime.
Mixa/Superstock, (C) B. Runk/S. Schoenberger/Grant com, Vasily Smirnov/Dreamstime.com, Rocky Reston/
Heilman, (B) AgeFotostock/Superstock. p. 34: NASA/Time Dreamstime.com, Shevelartur/Dreamstime.com,
Life Pictures/Getty Images. p. 35: GSFC/NASA. Aleksandr Lazarev/iStockphoto. p. 91: Ashley Cooper/Alamy;
Infographic 5.5 (top panel) (L) Visuals Unlimited/Corbis,
Chapter 3 (TR) Mark Hamblin/AgeFotostock, (BR) Visuals Unlimited/
p. 39: Joe Raedle/Getty Images. p. 41: Pictorial Press Ltd/ Corbis; (bottom panel) (L) 2ndLookGraphics/iStockphoto,
Alamy. p. 42: Fleming, Alexander. 1929. On the Antibacterial (C) Jfybel/Dreamstime, (R) NNehring/iStockphoto.
Action of Cultures of a Penicillium, with Special Reference to p. 93: Michael Macor/San Francisco Chronicle/Corbis.
Their Use in the Isolation of B. Influenzae. British Journal of p. 94: Infographic 5.7 (L) Brand X Pictures, (R) Maxrale/
Experimental Pathology, Vol. 10, pp. 226–236, Fig. 2; iStockphoto. p. 97: Courtesy of Jim Sears/A2BE Carbon
Infographic 3.1 (L) The British Library/Photolibrary, (C and R) Capture LLC.
Biophoto Associates/Photo Researchers. p. 43: Infographic 3.2
(TL) Scenics & Science/Alamy, (TC) Roland Birke/Photolibrary, Chapter 6
(TR) Dennis Kunkel/Visuals Unlimited, (BL) Ed Reschke/ p. 101: Leaf/Dreamstime. p. 103: (L) Jose Luis Pelaez Inc./
Photolibrary, (inset) David Toase/Photolibrary, (BC) Ed Getty Images; (TR) Tim Platt/Getty Images; (BR) Sian
Reschke/Photolibrary, (inset) Christian Fischer/WIKI, Kennedy/Getty Images. p. 105: (B) Courtesy of Paul Rozin;
Creative Commons, (BR) Michael Abbey/Photo Researchers, Infographic 6.2 (L) Christian Handl/Photolibrary, (C, inset)
(inset) A. & F. Michler/Photolibrary. p. 45: SPL/Photo Michael Gray/Dreamstime.com, (CT) iperl/Featurepics, (CB)
Researchers. p. 47: (T) Daily Herald Archive/SSPL/Getty Stephen Bonk/Dreamstime.com, (R) Photodisc. p. 106: (L)
Images; (B) Research and Development Division, Schenley Steve Stock/Alamy; (R) Hartmann Christian/SIPA; Infographic
Laboratories, Inc., Lawrenceburg, Indiana. p. 54: Joe Raedle/ 6.3 (T) Royalty-Free/Corbis, (B) Robert Fried/Alamy. p. 107:
Getty Images. p. 55: NIH. Infographic 6.4 Ilena Eisseva/Featurepics. p. 110: Tips Italia/
Photolibrary. p. 111: Infographic 6.6 (T) apcuk/iStockphoto, (C)
Chapter 4 EricGerrard/iStockphoto, (B) bluestocking/iStockphoto, (R)
p. 59: ma-k/iStockphoto. p. 61: ma-k/iStockphoto. p. 62: DNY59/iStockphoto. p. 115: (L) Leaf/Dreamstime; (R) Konstik/
Courtesy of Nestlé SA. p. 63: Infographic 4.1 (TL) Denis Pepin/ Dreamstime. p. 116: AP Photo/Harry Cabluck.
Featurpics, (TC) Shadow216/Dreamstime, (TR) AgeFotostock/
Superstock, (CL) Jeffrey Coolidge/Getty Images, (CC) Chapter 7
AgeFotostock/Superstock, (CR) Juanmonino/iStockphoto, (BL) p. 121: The Innocence Project. p. 122: (logo) The Innocence
AgeFotostock/Superstock, (BC) adlifemarketing/iStockphoto, Project. p. 123: JUPITERIMAGES/Brand X/Alamy. p. 124:
(BR) Tetra Images/Getty Images. p. 65: (T) BostjanT/ Infographic 7.1 ISM/Phototake. p. 125: Uli Holz, Yeshiva
521
University. p. 127: Courtesy of Kary Mullis. p. 128: The Milestones in Biology: Mendel’s Garden
Innocence Project. p. 132: Infographic 7.6 (L) Biophoto
p. 221: Authenticated News/Getty Images. pp. 222–223:
Associates/Photo Researchers, (C) Dr. Gopal Murti/ Photo
Malcolm Gutter/Visuals Unlimited. p. 224: Concepts of
Researchers, (R) Biophoto Associates/Photo Researchers.
Inheritance before Mendel (L) Preformation, drawn by N.
p. 133: Kevin Rivoli/The New York Times/Redux.
Hartsoecker, 1695, (R) Bildagentur-online/Alamy. p. 227: (T)
Authenticated News/Getty Images, (B) Garden World Images/
Milestones in Biology: The Model Makers
AgeFotostock.
p. 137: SSPL/Getty Images. pp. 138–139: James D. Watson
Collection, Cold Spring Harbor Laboratory Archives. p. 140: Chapter 12
Rosalind Franklin and the Shape of DNA (L) National Portrait p. 229: Courtesy of Peter Morenus. p. 230: Sebastian
Gallery, London, (R) Omikron/Photo Researchers. p. 141: Kaulitzki/Alamy. p. 232: Infographic 12.1 (L and R)) ISM/
Erwin Chargaff’s Work Provided a Clue to Base Pairing National Phototake. p. 234: Biophoto Associates/Photo Researchers.
Library of Medicine. p. 142: SSPL/Getty Images. p. 237: AP Photo/Leslie Close. p. 240: (T, from left) Ludo
Kuipers Photography; photographersdirect.com; Yuri Arcurs/
Chapter 8 Fotolia; ImageSource/AgeFotostock; Tatiana Morozova/
p. 143: Edwin Remsberg/Alamy. p. 145: Sebastian Knight/ FeaturePics; (C, from left) Denis Pepin/FeaturePics;
Dreamstime.com. p. 146: Nigel Cattlin/Visuals Unlimited. PhotosIndia/Alamy; Jacob Langvad/Getty Images; Thomas
p. 148: Infographic 8.3 Eye of Science/Photo Researchers. Cockrem/Alamy; (BL) leaf/FeaturePics; (BR) Dmitriy
p. 151: Infographic 8.6 (from left) MedicalRF.com/ Shironosov/Dreamstime.com. p. 241: Susumu Nishinaga/
AgeFotostock, Lauritzasoare/Dreamstime.com, Courtesy of Photo Researchers; Infographic 12.6 (L) ImageSource/
GTC Biotherapeutics, Courtesy of Lundbeck Inc. p. 152: Edwin AgeFotostock, (C) leaf/FeaturePics, (R) Ryan McVay/Getty
Remsberg/Alamy. p. 156: Courtesy of GTC Biotherapeutics, Images. p. 243: Courtesy of Peter Morenus. p. 245: Jason Sitt/
Inc. p. 159: Dan Reynolds/CartoonStock. Fotolia. p. 246: Infographic 12.10 National Institute of Mental
Health. p. 247: Markus Moellenberg/Corbis. p. 249:
Milestones in Biology: Sequence Sprint Infographic 12.13 ISM/Phototake.
p. 161: Mario Tama/Getty Images. pp. 162–163: Alex Wong/
Chapter 13
Newsmakers/Getty Images. p. 166: Mario Tama/Getty Images.
p. 167: Sinclair Stammers/Photo Researchers. pp. 253 and 254: AP Photo/PA. p. 255: Deco Images II/Alamy.
p. 256: Infographic 13.1 (T) Ed Reschke/Photolibrary, (C)
Chapter 9 Robert Knauft/Biology Pics/Photo Researchers, (B) Phototake/
Alamy. p. 257: Courtesy of Robert Langer, photo by Stu
p. 169: Stefano Lunardi/AgeFotostock. p. 171: Emilio Ereza/
Rosner. p. 258: Infographic 13.3 AP Photo/Brian Walker.
Alamy. p. 173: Infographic 9.1 (TL) NIH, (TR) Courtesy of
p. 259: Wake Forest University Health Sciences/Center for
Bristol-Myers Squibb Company, (BL) Steffen Hauser/
Regenerative Medicine/Urology. p. 264: Infographic 13.7 (T)
Botanikfoto/Alamy, (BR) Stefano Lunardi/AgeFotostock.
James King-Holmes/Science Photo Library, (B) AP Photo/PA/
p. 174: Infographic 9.2 Targeting Connexin43 Expression
Files. p. 266: Infographic 13.8 NIH.
Accelerates the Rate of Wound Repair. (2003). Cindy Qiu,
Petula Coutinho, Stefanie Frank, Susanne Franke, Lee-yong Chapter 14
Law, Paul Martin, Colin R. Green and David L. Becker. Current
p. 271: ISM/Phototake. p. 273: CDC/ Janice Carr; Jeff
Biology, 13(19), 1697–1703. p. 177: Michael Abbey/Photo
Hageman. p. 274: Infographic 14.1 (L) USDA/ARS, (TR) Paulo
Researchers. p. 180: Infographic 9.7 (L) Jim West/
Cruz/Dreamstime.com, (CR, inset) DNY59/iStockphoto, (CR)
AgeFotostock, (R) Peter Arnold, Inc./Alamy. p. 181: Steve
Offscreen/Dreamstime.com, (BR) Genevieve Astrelli/
Gschmeissner/Photo Researchers. p. 182: Alex Segre/
iStockphoto. p. 281: Infographic 14.7 (T) CDC/Janice Haney
Photographers Direct.
Carr/Jeff Hageman, M.H.S., (C) Binh Tran/iStockphoto, (B) W.
Lane/Minden Pictures. p. 282: ISM/Phototake. p. 284:
Chapter 10
Infographic 14.8 (TL) Gallo Images/Getty Images, (TR) alandj/
p. 187: Du Cane Medical Imaging Ltd./Photo Researchers. iStockphoto, (CL) walik/iStockphoto, (CR) Steve Shepard/
p. 189: UPI/BIll Greenblatt/Newscom. p. 190: Infographic 10.1 iStockphoto, (BL) Ewa Walicka/Dreamstime.com, (BR)
(L) Stockbyte, (R) Ingram Publishing/Photolibrary. p. 191: Du Christine Schuhbeck/AgeFotostock. p. 287: Nick D. Kim/
Cane Medical Imaging Ltd./Photo Researchers. p. 194: CartoonStock.
Infographic 10.4 (TL) Lepas/Dreamstime, (TC) Larry Jordan/
FeaturePics, (TR) Photodisc, (BL and BC) Royalty-Free/Corbis, Milestones in Biology: Adventures in Evolution
(BR) Mary Lane/FeaturePics. p. 197: Glow Wellness/ p. 289: London Stereoscopic Company/Getty Images.
SuperStock. p. 199: Courtesy of Lorene Ahern. pp. 290–291: HMS Beagle in the Galápagos by John Chancellor
(1925–984). Courtesy of Gordon Chancellor. p. 292:
Chapter 11 Lamarckianism Bettmann/Corbis. p. 293 The Evolution of
p. 203: AP Photo/Carlos Osorio. p. 205: Courtesy of Emily Darwin’s Thought (TC) public domain, (TR) Reproduced with
Schaller. p. 207: Infographic 11.2 ISM/Phototake. p. 211: Jeffrey permission from John van Wyhe, ed., The Complete Work of
Sauger. p. 212: Infographic 11.6 Simon Fraser/Photo Charles Darwin Online (http://darwin-online.org.uk/), (BL)
Researchers. p. 217: AP Photo/Carlos Osorio. Classic Image/Alamy, (BC) Reproduced with permission from
Note: page numbers followed by f indicate figures; those followed by t indicate tables.
abiotic factors, 424, 425f Mendel’s discovery of, 223–228 eukaryotic cells and, 50–54, 51f
abiotic methanogenesis, 372f recessive, 212–214, 213f, 215t, 216f, 226– misuse and overuse of, 283
ABO blood type, 241–242, 242f–243f 228, 234, 235f–236f, 240, 241f, 309 reasons for failure of, 276
Acadian flycatcher, 458, 459f selection of, 214 side effects of, 54
Acasta Gneiss, 341 for skin color, 408–409 specific action of, 41–45, 43f–46f
Acer saccharum, 450, 452f, 458, 459f allele frequency, 303 types of, 48–49, 48f
acid, 32–33, 34f in analyzing evolution, 307–310 yeast infections and, 368
activation energy, 66 Allnutt, Tom, 89–90 antibiotic resistance, 54–55, 271–284
active site, 66, 67f allopatry, 315, 316f acquiring resistance through reproduc-
active transport, 49, 50f “altruistic suicide,” of honey bees, tion, 277–278, 277f–278f
adaptation, 279 440–441 antibiotic revolution and, 275–277, 276f
to climate change, 466 Alvin, 363 evolution of, 278–279, 279f
genetic diversity and, 306 Amazon River, Wallace’s observations at, MRSA, 272–276, 274f, 281–284
nonadaptive evolution v., 303 296–297, 296f natural selection for, 279–281, 280f–281f
species survival and, 315–316 Amazonian manatees, 312–314, 314f superbugs, 282–284, 284f
adaptive radiation, 346–347 amino acid, 26–28, 62, 145–147, 153–155, treating and prevention infection, 282–
adenine, 125–126, 126f, 140–141, 140f–142f 155f 284, 284f
adenosine triphosphate (ATP), 95, 110– protein shape and function and, 146, antibiotic revolution, 275–277, 276f
114, 111f–112f, 114f 146f anticodon, 154, 155f
adhesion, 33f sequences of, 145–146, 146f, 150, 150f antifreeze proteins, of fish, 348–349
adult stem cells, 260, 262, 262f–263f aminoglycosides, 48 antithrombin, 145–150, 146f–149f
creating embryonic stem cells from, amniocentesis, 248, 249f deficiency of, 148–149, 148f
265–267, 266f amphibians, fish transition to, 322–326, from transgenic animals, 144–145, 151f
aerobic respiration, 111–112, 112f–113f, 115f 328–331, 331f ants, 386
African honey bees, 443, 443f amplification, of DNA, 127–129, 128f–129f apes, evolution of, 405–407, 406f
age. See also maternal age anabolic reaction, 66–67, 67f Apis mellifera, 434, 443f
chronological age v. tissue age, 260, anaphase, 179 Apis mellifera scutellata, 443, 443f
261t ancestry, DNA studies of, 314–315, 315f APO E gene, 244
of earth, 341–343, 342f–343f anecdotal evidence, 4–5 apoptosis, 177, 177f
agriculture anencephaly, folate and, 399, 400f aquatic: freshwater biome, 455
antibiotic overuse by, 283 aneuploidy, 247, 248f aquatic: marine biome, 455
bees and, 433–434, 435f angiosperm, reproduction of, 435–436, aquifers, 484, 484f
Ahern, Lorene, 188–190, 192, 196–198 436f archaea, 366–367, 369–372, 371f
albinism, 215t angiosperms, 382f, 383 diversity of, 371f
Aldrin, Buzz, 341 animals, 383–386, 384f Archaea domain, 354, 354f, 367f
algae, 388–389, 390f adaptability of, 458 Arctic amplification, 458–459
biofuel from, 82–86, 87t, 88–93, 95–96 classification of, 353 Arctic Climate Impact Assessment, 459
energy capture by, 86f definition of, 384 arctic fox, 458
alien life, 20–22 evolution of, 384f Arctic landmass, species distribution on,
definition of, 34–35 transgenic, 144–145, 149–152, 150f–151f, 347–348, 348f–349f
elements of, 24f–25f, 25–26, 28–29 155–157 Arctic meltdown, 458–462, 460f–461f
Martian bacteria, 27, 30–31, 30f animal cell, 51f Ardipithecus ramidus, 406, 406f
molecules of, 24f–25f, 25–26, 28–29 Animal kingdom, 380f Armstrong, Neil, 341
search for, 22–24, 23f annelids, 384f, 385–386 arthropods, 384f, 386
signs of, 26–27 Antarctic landmass, species distribution As Nature Made Him: The Boy Who Was
water’s role in, 31–34, 32f–34f on, 347–348, 348f–349f Raised as a Girl (Colapinto), 231
allele, 148, 149f, 190, 190f anthropogenic greenhouse gases, 466, asexual reproduction, 277, 277f
blood type, 241–242, 242f–243f 467f Ashkenazi Jews, 192–193, 193t
in CFTR gene, 216–217 antibiotics, 39–56, 40, 275 aspirin, 172, 172t
dominant, 212–214, 213f–214f, 215t, 216f, cell membrane penetration by, 49–50, assisted reproduction, 214
226–228, 240–242, 241f–243f 50f astragalus, 182
environment and, 398 discovery of, 40–41, 42f, 43 Atala, Anthony, 254, 257–258, 260, 263,
flow of, 311–312, 311f drug development of, 45–48, 275 266–267
527
atom, 24–25, 24f nondisjunction and, 246–248, 248f–249f Calorie, 107
ATP. See adenosine triphosphate birth rate, growth rate and, 418 in food, 107–108, 107f, 108t
Australophithecus, 406f, 407 bladder, engineered, 254, 257–260, 258f, calorie, 107
autosomes, 231 263, 266–267 Cambrian explosion, 345
autotroph, 90, 91f, 368, 370–371 Blair, Tony, 166 Campylobacter, resistance in, 283
blastocyst stage, stem cells from, 262 cancer, 172, 187–199. See also breast can-
backbone, 384f, 385 blending theories, 224f cer; pancreatic cancer; prostate
Backes, Nina, 61 blood clots, antithrombin deficiency and, cancer
bacteria. See also antibiotics 148–149, 148f cell division and, 172–177, 172t, 173f–178f
cell wall of, 44–45, 45f–46f blood type, 241–242, 242f–243f coffee and, 2
diversity of, 370f blueberry bee, 443 ethnic groups and, 192–193, 193t
genetic variation in, 277, 278f BMI. See body mass index fighting against, 177–182, 180f–181f
Martian, 27, 30–31, 30f body mass index (BMI), 102, 104f genetics of, 193–196, 194f–197f
MRSA, 272–276, 274f, 281–284 Bonde, Robert, 300–302, 304, 306, 310, herbal supplements for, 170–173, 173f,
as prokaryotes, 368–369, 370f 316 177–182, 180f–181f
reproduction of, 277–278, 277f–278f bone deformities, in wolves, 426 inherited mutations and, 189–192,
staph, 273–275, 274f, 277–278, 278f, 369 bone marrow stem cells, 257f, 261–263 191f–192f
superbugs, 282–284, 284f bones reducing risk of, 199t
treating and prevention infection by, nutrition for, 70–72, 71f, 73f treatment of, 196–198, 199t
282–284, 284f vitamin D and, 401 canine parvovirus (CPV), 424
types of, 48–49 Boost Glucose Control drink, 60, 66, 69 Canis lupis, 414
Bacteria domain, 354, 354f, 367f bottleneck effect, 304–305, 305f capsule, 369, 370f
barnacles, Darwin’s research on, 293f, Bowen, Brian, 310 carbohydrate, 26, 28
295 brain, caffeine effects on, 9–11, 11f digestion of, 66–69, 68f, 70f
base, 32–33, 34f brain stem cells, 257f energy in, 107, 107f
base pairing, 125–126, 126f, 128–129, branch, in phylogenetic tree, 352–354, in food, 61–62, 63f, 66
128f–129f, 141f–142f, 153 352f, 354f carbon, 25–26, 25f
Beagle voyage, 291–295, 293f–294f Brazelton, Bill, 362–363, 365, 367, 373 in environment, 462–464, 464f
“bee AIDS,” 441 BRCA genes, 188–190, 190f, 192–193, 195– carbon cycle, 461–466, 464f
bees. See honey bees 198, 195f–197f, 199t carbon dioxide, 90–92, 95–96
beetles, 386 breast cancer, 187–199, 190f, 195f–197f, in greenhouse effect, 461–462
behavioral isolation, 313f 199t measuring levels of, 464, 465f
Bench, Barry, 126–127, 133–134 cancer genetics, 193–196, 194f–197f temperature and, 457f
Berry, Halle, 396 ethnic groups and, 192–193, 193t carbon fixation, 95
beta-carotene, 182 inherited mutations, 189–192, 191f–192f carbon footprint, 466
beta-lactamase, 277 treatment of, 196–198, 199t carbon reactions, in photosynthesis, 96f
beta-lactams, 49 breeding, true, 225, 225f carcinogen, 193–194, 194f
mechanism of, 276f Brown, Roy, 122–124, 126–128, 130, 132–134 Carr, John, 238
resistance to, 275, 277 brown bears, polar bears v., 348–349 carrier, 213
bilateral symmetry, 384f, 385 Browne, Janet, 295 female, 234, 235f–236f
binary fission, 277, 277f Brownell, Kelly, 104, 117 Hardy-Weinberg equilibrium for esti-
biocapacity, 476 bryophytes, 381–382, 382f mating frequency of, 309
ecological footprint v., 476, 477f Bud, Robert, 47 carrying capacity, 420, 420f, 487–489
biochemistry, of life, 343–344 bumblebee species, extinction of, 444 cartilage, engineered, 256–257
biodiversity Bump, Joseph, 422–423 Caspi, Avshalom, 245–246, 247f
climate change and, 456–458, 456f–457f Burgess shale, 347 catabolic reaction, 66, 67f
protection of, 390, 392 Burke, John, 256 causation, correlation v., 14f
biofuels, 86, 87t, 88, 95–96, 96f Bush, George W., 83 CCD. See colony collapse disorder
from algae, 82–86, 87t, 88–93, 95–96 butterflies, niche of, 442, 442f cell, 39–56. See also stem cells
greenness of, 87t antibiotic resistance, 54–55
biogeography, 347–348, 348f–349f caffeine antibiotic types, 48–49, 48f
biological species concept, 312 benefits and risks of, 2–4, 5f chronological age v. age of, 260, 261t
biomass, 480 in beverages, 13t definition of, 30
biome, 455 epidemiological studies of, 11–14, 14f discovery of penicillin, 40–41, 42f, 43,
climate change and, 455–456 media reports on, 14–15, 15f 275
biotic factors, 424, 425f samples for studies of, 7–9, 9f–10f eukaryotic organelles, 50–54, 51f
biotic methanogenesis, 372f scientific process of investigation of, macronutrients in, 64f
bird, phylogenetic tree of, 352–353, 352f 4–7, 6f, 8f movement in and out of, 49–50, 50f
birth defects side effects of, 9–11, 11f penicillin as drug, 45–48
folate and, 399–401, 400f calcium, 70–72, 71f, 74t specialized, 259f, 260–261
528 INDEX
types and components of, 41–45, analysis of, 234–240, 238f–239f incomplete dominance, 240, 241f
43f–46f in cell division, 176, 176f multifactorial inheritance, 242–246,
cell cycle, 175–176, 175f homologous, 206–207, 207f 246f–247f
cell cycle checkpoint, 176–177, 177f–178f sex, 231–234, 232f, 233t, 235f–236f nondisjunction, 246–248, 248f–249f
cell division, 169–183, 174, 174f chronic disease, nutrition for, 69–70 sex determination, 231–234, 232f, 233t
cancer and, 172–177, 172t, 173f–178f chronological age, cell age v., 260, 261t sex-linked inheritance, 234, 235f–236f
fighting cancer, 177–182, 180f–181f citric acid cycle, 112–113, 113f concrete production, 466, 467f
regulation of, 177f–178f classification, of organisms, 348–354, cone plants, 382f, 383
cell membrane, 30, 30f, 42–43, 44f–45f 350f–352f, 354f congenital adrenal hyperplasia, 232
in beginning of life, 344 Cleland, Carol, 24, 27 coniferous forest biome, 455
movement across, 49–50, 50f climate, plate movement and, 349f conservation of energy, 88, 88f
phospholipid bilayer, 43, 44f climate change, 450–467 consumers, 437
cell replacement, cell division in, 174f arctic meltdown, 458–462, 460f–461f control group, 6–7, 8f
cell replication, genetic mutation and, biodiversity and, 456–458, 456f–457f convergent evolution, 348–349
407 biomes and, 455–456 Copenhagen Accord, 466
cell theory, 41, 43f carbon cycle, 461–466 correlation, 13, 14f
cell therapy, 262f changing seasons, 452–456, 453f covalent bond, 25f, 26
cell wall, 44–45, 45f–46f freshwater availability and, 486 Cox-Foster, Diana, 440–441
cellular differentiation, 260–261 clinical trial, randomized, 14 CPV. See canine parvovirus
cellular energy, from food, 105–108, 107f, Clinton, Bill, 21, 166 Cretaceous period, 346
108t cloning, 255, 264–265, 264f Crick, Francis, 137–142
cellular respiration. See aerobic clumping distribution, 417, 419f crime scene, DNA from, 129–131
respiration cnidarian, 384f crocodile, phylogenetic tree of, 352–353,
centromere, 176 coal, 478f 352f
cephalexin, resistance to, 275 codeine, 172t cross-pollination, 225, 225f
cephalosporins, resistance to, 273, 275 coding sequence, 131, 150, 150f cultural traditions, race and, 398, 398f
CF. See cystic fibrosis codominance, 241–242, 242f–243f culture, of eating, 102–104, 105f, 115–117
CFTR gene, 205–207, 206f–207f, 215 codon, 153–155, 155f–156f cyanobacteria, 95–96, 368, 370f
CFTR protein, 211, 212f coenzyme, 71 cycle. See cell cycle
Chain, Ernst, 46, 55 cofactor, 71, 73f cycle of life, 388, 389f
Chambers, Robert, 295 coffee cystic fibrosis (CF), 203–217, 407
Chaplin, George, 399–402, 402f benefits and risks of, 2–4, 5f disease process of, 211–214, 212f–214f
Chargaff, Erwin, 141, 141f in beverages, 13t Hardy-Weinberg equilibrium for esti-
Charles, Marie-Aline, 116 epidemiological studies of, 11–14, 14f mating frequency of, 309
checkpoint, cell cycle, 176–177, 177f–178f media reports on, 14–15, 15f inheritance of, 206–211, 206f–210f,
cheetah, bottleneck effect in, 304–305 samples for studies of, 7–9, 9f–10f 215t
chemical energy, 85, 88f, 89, 91f scientific process of investigation of, new research for, 214–217, 216f
chemical reaction, enzymes and, 67f 4–7, 6f, 8f sequence homology and, 335
chemistry of life, 19–35 side effects of, 9–11, 11f cytokinesis, 176, 176f, 179
characteristics of life, 22–24, 23f Cohanim, 237 cytoplasm, 42–43
elements, 24f–25f, 25–26, 28–29 cohesion, 33f cytosine, 126, 126f, 140–141, 140f–142f
Martian bacteria, 27, 30–31, 30f Colapinto, John, 231 cytoskeleton, 53–54
molecules, 24f–25f, 25–26, 28–29 Collins, Francis, 166, 205
search for alien life, 22–24, 23f colony collapse disorder (CCD), 432–433, Daeschler, Ted, 322–323, 325–326, 328–
traces of alien life, 26–27 439–441, 440f 329, 335
water, 31–34, 32f–34f cause of, 444, 445f Darwin, Charles, 227, 280, 315, 324
“weird” life, 34–35 losses from, 439 descent with modification theory, 325–
chemotherapy, 173f, 174, 177–182, 180f–181f remedy for, 444–445 326, 327f, 333
chimpanzee Colorado River, 485, 485f in development of natural selection the-
evolution of, 405–407, 406f commensalism, 439, 440f ory, 290–298, 292f–294f
sweat glands of, 407–408 community, 416–417, 416f, 434 on homology between species, 331
chloride, 74t MRSA in, 281–283 Darwin, Erasmus, 292
chlorophyll, 94–95 competition, 442 Darwin, Robert, 291
chloroplast, 51, 53–54, 92 competitive exclusion principle, 442–443 Darwinism (Wallace), 298
Chongming, 481 complementary strands, 128–129 Darwin’s Origin of Species: A Biography,
chordates, 384f complex carbohydrate, 68–69, 68f 295
chromatids, sister, 176 complex inheritance, 229–249 Daum, Robert, 273–274, 282, 284
chromosomal abnormality, 246–248, chromosome analysis, 234–240, death rate, growth rate and, 418
248f–249f 238f–239f decomposers, 388
chromosome, 123–124, 124f, 147f codominance, 241–242, 242f–243f decomposition, in carbon cycle, 463
INDEX 529
deep-sea hydrothermal vents. See hydro- population sampling methods and, 417, by country, 476, 476f
thermal vents 418f human population growth and, 474,
defensive behavior, 443f diversifying selection, 280–281, 281f 474f
deforestation, in carbon cycle, 463, 466, diversity of humans, 474–475, 475f
467f analysis of, 306–310 nonrenewable resources and, 477–478,
Dennett, Daniel, 295 of archaea, 371f 478f
density-dependent factors, 424, 425f of bacteria, 370f renewable resources and, 482, 483f
density-independent factors, 424, 425f gene flow and, 311–312, 311f ecological isolation, 313f
deoxyribonucleic acid (DNA), 29, 52, 121– genetic drift and, 303–306, 304f–305f ecology, 414–417
134, 124f, 153f of prokaryotes, 366f of Isle Royale, 416, 416f
amplification of, 127–129, 128f–129f protection of, 390, 392 eco-metropolis, 472–489
for assessing genetic diversity, 314–315, using mitochondrial DNA for assess- ecological footprint, 474–479, 474f–478f
315f ment of, 314–315, 315f finding limits, 486–489, 487f–488f
building phylogenetic trees from, 353 division. See cell division sustainable by design, 479–481, 481f
from crime scene, 129–131 DMD. See Duchenne muscular dystrophy water resources, 484–486, 484f–486f
descent and shared sequences of, 334– DNA. See deoxyribonucleic acid ecosystem, 416–417, 416f, 452–453
335, 334f DNA polymerase, 129, 129f honey bees and, 433
DNA profiling, 127, 130f, 131–133, DNA profiling, 127, 130f, 131–133, 132f–133f egg, 207–210, 209f, 213f
132f–133f of moose and wolves, 423 aging of, 246–248, 248f–249f
domains defined by, 354f Dolly the sheep, 264–265, 264f mitochondria in, 404f
as evidence, 123–126, 124f, 126f domain, 354, 354f, 367f electron, 24f, 25
mutations, 190–191, 191f–192f, 194f, 196f Archaea, 354, 354f, 367f electron transport, 112–113, 113f
of prokaryotes, 365f, 366 Bacteria, 354, 354f, 367f elements, 24–25, 24f
race and differences in, 397 Eukarya, 367f, 380f of life, 24f–25f, 25–26, 28–29
replication of, 127–129, 128f–129f dominant allele, 212–214, 213f–214f, 215t, Ellesmere Island, fossils on, 322, 325–326
sequencing of, 161–167 216f, 226–228 Elwha River, 381f
structure of, 125–126, 126f, 128f, 137–142 codominance, 241–242, 242f–243f embryo, 208
dependent variable, 7, 8f incomplete dominance by, 240, 241f embryonic stem cells created without
depression, genetic predisposition to, Domning, Daryl, 312 use of, 265–267, 266f
245–246, 246f–247f Don, Carlos, 272, 276, 281, 283 obtaining stem cells from, 264–265,
descent, shared DNA sequences and, 334– Dongtan, 472 264f
335, 334f bird buffer for, 486 embryological development, of verte-
descent with modification, 325–326, 327f, design of, 479–481, 481f brates, 333, 333f
333 moving forward with, 481–482, 483f embryonic development, cell division in,
desert biome, 455 double-helix model, of DNA, 125, 126f, 141, 174f
Devonian period, 383 142f embryonic stem cells (ESCs), 262–265,
evolution during, 328–329 Douglas fir, 381 263f–264f
diabetes, 60, 66–69, 68f, 70f Down syndrome, nondisjunction and, induced, 265–267, 266f
diet. See food 246–248, 248f–249f emigration, population growth and, 418
dietary energy, 101–117 Drew, Theresa, 275 Empidonax virescens, 458, 459f
aerobic respiration, 111–112, 112f–113f, 115f drug. See pharmaceuticals endangered species
eating culture and, 102–104, 105f, drug-resistant bugs. See antibiotic assessing genetic diversity in, 307
115–117 resistance fisher as, 378–379
extracting energy from food, 110–113, Duchenne muscular dystrophy (DMD), manatees as, 300–302
111f–113f 234, 235f–236f endoplasmic reticulum, 50–52
fermentation, 113–115, 114f–115f dugongs, 314f endoskeleton, 386
food as energy, 105–108, 107f, 108t geographic ranges of, 303f endosymbiosis, 54, 390, 391f
food portion sizes and, 104–105, 106f Dunham, Bernadette, 144, 157 energy, 84. See also dietary energy
weight gain and, 108–110, 109f conservation of, 88, 88f
differential gene expression, 261 ear, engineered, 254, 257 food as, 61, 105–108, 107f, 108t, 110–113,
differentiation, cellular, 260–261 earth 111f–113f
diffusion, 49, 50f age of, 341–343, 342f–343f life use of, 22–23, 23f
digestion, 66, 67f geologic timeline of, 345–347, 346f transfer of, 89, 89f
of carbohydrate, 66–69, 68f, 70f life history of, 344–345 U.S. consumption of, 84f
Dillion, Harrison, 93 eating culture, 102–104, 105f, 115–117 energy flow, 81–97
dinosaurs, extinction of, 346–347 echinacea, 171 beyond biofuel, 95–96, 96f
diploid, 206–208, 207f–209f, 227 echinoderms, 384f energy basics, 84–89, 86f, 87t, 88f–89f
directional selection, 280, 281f Eckstadt, Katherine, 133–134 photosynthesis, 90–95, 92f, 96f
disease. See chronic disease ecological footprint, 474–479 source of energy, 89–90, 91f
distribution pattern, 417, 419f biocapacity v., 476, 477f from sun to fuel, 93–95, 94f
530 INDEX
sun-free fuel, 93 descent and shared DNA sequences, fishers
Engelman, Robert, 489 334–335, 334f animal characteristics of, 383–386, 384f
engineering. See tissue engineering earth’s geology and, 341–343, 342f–343f as endangered species, 378–379
enhanced greenhouse effect, 456, 456f fossil finding, 326–328, 328f mammalian characteristics of, 386–387
environment fossil record of, 324f, 325–326, 327f, as part of cycle of life, 388
adaptation and survival in, 315–316 335, 345–347, 346f protection of, 390, 392
alleles and, 398 fossils as evidence for, 322–323 repopulation of, 378–379
carbon in, 462–464, 464f gene flow, 311–312, 311f fitness
evolution and, 278–279, 279f gene pools and, 302–303, 303f of evolving organisms, 279, 279f
genetic interaction with, 242–246, 244f, genetic drift, 303–306, 304f–305f natural selection and, 280f
246f homology between species, 331–334, Fitzroy, Robert, 291
natural selection and, 279–281, 332f–333f fixation, carbon, 95
280f–281f of humans, 402–407, 403f, 406f flagella, 369, 370f
plate movement and, 349f natural selection in, 279–281, 280f–281f flatworms, 384f
of prokaryotes, 366f nonadaptive, 303, 311 Fleming, Alexander, 40–41, 42f, 43,
enzyme, 66, 67f, 71, 73f phylogenetic trees, 352–354, 352f, 354f, 45–46, 48, 55, 275
epidemiology, 11–14, 14f 380f Florey, Howard, 46, 55
equilibrium of plants, 382f Florida manatees
Hardy-Weinberg, 307–309 of populations, 278–280, 279f–280f adaptation by, 315–316
punctuated, 347 of skin color, 398–402, 409, 410f analysis of evolution of, 306–310
ESCs. See embryonic stem cells speciation, 312–315, 313f–316f boat collisions with, 300–302
An Essay on the Principle of Population vertebrate movement to land, 322–326, gene flow in, 311–312, 311f
(Malthus), 295 328–331, 331f gene pools of, 302–303, 303f
essential amino acid, 62 Wallace’s work on, 295–298, 296f genetic drift in, 303–306, 304f–305f
estrogen, 231, 232f exercise, for bone health, 71 inbreeding in, 307, 310–311
ethics, of obtaining stem cells from exoskeleton, 386 speciation in, 312–315, 313f–316f
embryos, 264–265, 264f experiment, 5–7, 6f, 8f flowering plants, 382f, 383
ethnic groups, genetic disease in, 192–193, experimental group, 6–7, 8f flowers
193t exponential growth, 418–419, 420f honey bees and, 434, 442, 442f
Eukarya, 380f extinction, 346 luring of pollinators, 435
Eukarya domain, 354, 354f of dinosaurs, 346–347 reproduction, 435–436, 436f
eukaryotes, 377–392 habitat destruction and, 390, 392 fluoroquinolones, resistance to, 283
animals, 383–386, 384f extraterrestrial life. See alien life flycatchers, 458, 459f
beginning of, 345 extremophiles, 367, 369–372, 371f folate, 75t
definition of, 379–380 birth defects and, 399–401, 400f
endosymbiosis of, 390, 391f facilitated diffusion, 49, 50f skin color and, 399–401, 399f, 408–409
fungi, 388, 389f factor VIIa, 156–157 folic acid. See folate
mammals, 350, 386–388 falsifiable hypothesis, 5 food, 60–77. See also dietary energy;
plants, 380–383, 381f–382f fat, 61–62, 63f nutrition
protecting diversity in, 390, 392 energy in, 107, 107f, 109–110 for bones, 70–72, 71f, 73f
protists, 388–390, 390f–391f types of, 116–117 for diabetes, 66–69, 68f, 70f
vertebrates, 322–326, 328–331, 331f, fat storage, 109–110, 109f digestion, 66–69, 67f–68f, 70f
333, 333f, 350, 384f, 385–388 fatty acid, 29, 62 as energy, 61, 105–108, 107f, 108t, 110–
eukaryotic cell, 42–45, 43f, 45f FDA. See Food and Drug Administration 113, 111f–113f
organelles of, 50–54, 51f, 391f female enzymes, 66, 67f
prokaryotic cell v., 45, 45f, 48–49, 48f, determination of, 231–234, 232f, 233t for fighting chronic disease, 69–70
51 sex-linked inheritance in, 234, labeling of, 65–66
evidence 235f–236f manufacture of, 62–65
anecdotal, 4–5 female carrier, 234, 235f–236f metabolism, 66–67, 67f
DNA as, 123–126, 124f, 126f fermentation, 113–115, 114f–115f, 368, 370f micronutrients in, 72, 73f, 74t–75t
evaluation of, 2–4, 5f, 14–15, 15f Fern, Brian, 76 nutrition in, 61–62, 63f–64f
evolution, 289–317, 321–336, 339–355 ferns, 382, 382f portion sizes of, 104–105, 106f
adaptation and survival, 315–316 fiber, 68–69, 68f, 70f Food and Drug Administration (FDA), 65
analysis of, 306–310 fire, control of, 407 supplement regulation by, 171–172
of animals, 384f Fischer, Jennifer, 110 food chain, 436–438, 438f
beginning of life, 343–344, 372–373, 372f fish food partitioning, 443f
biogeography and, 347–348, 348f–349f antifreeze proteins of, 348–349 food poisoning, 369
of chimpanzee, 405–407, 406f move to land by, 322–326, 328–331, 331f food pyramid, 72–76, 74t–75t
convergent, 348–349 tetrapod homology with, 331–332, 332f food web, 438, 439f
Darwin’s work on, 290–298, 292f–294f “fishapod,” 330 foraging trips, of honey bees, 434–435
INDEX 531
forelimb homology, 331–332, 332f gel electrophoresis, 131, 132f inheritance of, 189–192, 191f–192f, 205–
forensic science, 122–126, 124f, 126f, 129– gene, 143–157, 147f 206, 206f
132, 130f, 132f GMO advantages, 155–157 mitochondrial DNA, 403
DNA as evidence, 123–126, 124f, 126f making transgenic animals, 149–152, genetic predisposition, 245–246,
DNA from crime scene, 129–131 150f–151f 246f–247f
DNA profiling, 127, 130f, 131–133, Mendel’s discovery of, 223–228 genetic variation, in bacteria, 277, 278f
132f–133f modifier, 206, 215–216 genetically modified organism (GMO),
forest fires, 458, 459f parts of, 150f 144, 151–152
Forest tent caterpillar, 458, 459f protein from, 145–149, 146f–149f advantages of, 155–157
fossil fuel, 82–83, 84f, 85t, 90–91 for skin color, 409 genome, 131. See also Human Genome
in carbon cycle, 463, 466, 467f gene expression, 147, 147f Project
costs of, 482 differential, 261 genotype, 147, 207
as nonrenewable resource, 477–478, protein and, 152–155, 153f–156f heterozygous, 212–213, 240, 241f–242f
478f specialized cells and, 259f, 260–261 homozygous, 212–213, 240, 241f
fossil record, 324f, 325–326, 327f, 335, gene flow, 311–312, 311f gentamicin, 49
345–347, 346f gene pools, 302–303, 303f geographic distribution, of species, 347–
fossils gene therapy, 151 348, 348f–349f
Darwin’s observations of, 293f, 294 gene transfer, in bacteria, 277, 278f geography, skin color and, 397, 399, 409,
dating of, 328, 328f generalist foraging patterns, 443f 410f
as evidence for evolution, 322–323 genesis rock, 341 geologic timeline, of life, 345–347, 346f
formation of, 324f, 325 genetic code, 155, 156f geology, 341–343, 342f–343f
hunting for, 326–328, 328f genetic diversity geothermal, 483f
intermediate (transitional), 330–331, analysis of, 306–310 giardiasis, 390
331f gene flow and, 311–312, 311f ginseng, 171
Foster, Eugene A., 237 genetic drift and, 303–306, 304f–305f global hectares, 475
founder effect, 304, 304f using mitochondrial DNA for assess- global warming, 456
Framingham Heart Study, 12 ment of, 314–315, 315f glucose, 111–112
Franklin, Rosalind, 140–142, 140f genetic drift, 303–306, 304f–305f glycogen, 68–69, 68f, 109, 109f
Frazier, Maryann, 441, 444 genetic inheritance, 203–217, 229–249 glycolysis, 111–113, 113f–114f
freshwater of CF, 206–211, 206f–210f, 215t GMO. See genetically modified organism
depletion of, 484–486, 485f chromosome analysis, 234–240, goat, transgenic, 144–145, 155–157
distribution of, 486, 486f 238f–239f Golgi apparatus, 51–52
pollution and, 485 codominance, 241–242, 242f–243f gonorrhea, 369
Friedman, Sue, 198 dominant allele, 212–214, 213f–214f, 215t, antibiotic-resistant, 283
Frisen, Jonas, 260 216f, 226–228, 240–242, 241f–243f Gosling, Raymond, 141
Früh-Green, Gretchen, 360–362 incomplete dominance, 240, 241f Gould, Stephen Jay, 291
fuel. See also biofuels; energy; fossil fuel meiosis, 208–210, 208f–209f, 213, 247, Gram, Hans Christian, 48
from algae, 82–86, 87t, 88–93, 95–96 248f Gram-negative bacteria, 48–49
from sun, 93–95, 94f before Mendel, 223, 224f Gram-positive bacteria, 48
sun-free, 93 modifier genes, 206, 215–216 grassland biome, 455
functional foods, 60–77 multifactorial, 242–246, 246f–247f Green, W. T., 256
for bones, 70–72, 71f, 73f nondisjunction, 246–248, 248f–249f Green Metropolis: Why Living Smaller,
for diabetes, 66–69, 68f, 70f Punnett square for, 212–213, 213f, 215, Living Closer, and Driving Less are
digestion, 66–69, 67f–68f, 70f 216f the Keys to Sustainability (Owen), 481
enzymes, 66, 67f recessive allele, 212–214, 213f, 215t, 216f, green tea extract, 182
for fighting chronic disease, 69–70 234, 235f–236f, 240, 241f, 309 greenhouse effect, 456, 456f
labeling of, 65–66 sex determination, 231–234, 232f, 233t carbon dioxide in, 461–462
manufacture of, 62–65 sex-linked, 234, 235f–236f greenhouse gases, 456
metabolism, 66–67, 67f sexual reproduction, 207–210, anthropogenic production of, 466, 467f
fungi, 388, 389f 208f–210f, 213f–214f, 216f Griffith-Cima, Linda, 254
classification of, 353 of two genes, 215, 216f growth, 23, 23f
Fungi kingdom, 380f genetic mutation, 187–199 growth rate, 418, 420f
fungus. See penicillin allele frequencies and, 303 guanine, 126, 126f, 140–141, 140f–142f
antibiotic resistance via, 277–278, Guiliano, Mireille, 110, 117
Galápagos finches 277f–278f gymnosperms, 382f, 383
Darwin’s observations of, 294–295 cancer genetics, 193–196, 194f–197f
speciation of, 315, 316f cancer treatment, 196–198, 199t Häagen-Dazs, 445–446
Galbraith, Hector, 458, 466 causes of, 194f habitat, 455
gamete, 207–210, 208f, 213, 226f, 227 cell replication and, 407 temperature and, 458
gametic isolation, 313f ethnic groups and, 192–193, 193t habitat destruction, 390, 392
532 INDEX
Habropoda laboriosa, 436–437 African, 443, 443f inbreeding, 307, 310–311, 311f
Hackenberg, Dave, 432, 439–441 agricultural crops and, 433–434, 435f inbreeding depression, 307, 310
Haemophilus influenzae, vaccination CCD and, 432–433, 439–441, 440f incomplete dominance by, 240, 241f
against, 284 decline of, 444–446, 445f independent assortment, 209–210, 210f
hair, inheritance of, 240, 241f in food chain, 436–438, 438f Mendel’s law of, 227, 228f
half-life, of radioisotopes, 341–342, 342f forensics of, 441–442 independent variable, 7, 8f
halophiles, 370–371, 371f niche of, 442, 442f individual organism, 416, 416f
hand washing, for reducing infection, 282 plant reproduction and, 435–436, 436f induced pluripotent stem cells (IPS cells),
haploid, 207–208, 208f–209f pollination and, 433–436, 434f 265–267, 266f
Happe, Patti, 379–380, 387, 392 resource competition of, 442–443, infection
Hardy, Mary, 182 442f–443f antibiotic revolution and, 275–277, 276f
Hardy-Weinberg equilibrium, 307–309 hormones, sex, 231–232 MRSA, 272–276, 274f, 281–284
Hart lake, 381f horses, fossil record of, 326, 327f pathogens as source of, 369, 370f
Head, Peter, 473, 481–482 humans staph, 273–275, 274f, 277–278, 278f, 369
health care workers, hand washing classification of, 350–351, 351f by superbugs, 282–284, 284f
among, 282 ecological footprint of, 474–475, 475f treatment and prevention of, 282–284,
health journalism, 14–15, 15f evolution of, 402–407, 403f, 406f 284f
heart stem cells, 257f population growth of, 474, 474f infertility, hybrid, 313f
heat, 88–89, 88f–89f Human Genome Project (HGP), 163–167, inheritance. See genetic inheritance
“heat in the pipeline,” 466 164f inherited antithrombin deficiency,
heat-island effect, 479–480 human migration, 402–404, 403f, 405f 148–149
height, inheritance of, 242–244, 244f hummingbirds, niche of, 442, 442f Innocence Project, 123–125, 127, 132, 134
Heisner, Tamara, 126–127 Hunt, Mary, 47 inorganic molecule, 25f, 26
Helicobacter pylorus, 369 Huntington disease, 213, 214f, 215t creating organic molecules from,
Hellen, 204–205, 216–217 Hutton, James, 293 343–344
“Help the Honey Bee” campaign, 445–446 hybrid, 223–224 insects, 389
Hemings, Eston, 238–239, 239f hybrid infertility, 313f insulin, 66–67, 70f
Hemings, Sally, 236–240, 239f hybrid inviability, 313f intermediate fossils, 330–331, 331f
hemophiliac, 157 hydroelectric, 483f interphase, 175, 175f, 179
Henig, Robin Marantz, 223 hydrogen bond, 31, 33f intersexual person, 231–232
Henry, Jeya, 69, 76 hydrophilic molecule, 29–31, 30f, 43, 44f invertebrate iridescent virus (IIV), 441
herbal supplement, for cancer, 170–173, hydrophobic molecule, 29–31, 30f, 43, 44f invertebrates, 329, 385–386
173f, 177–182, 180f–181f hydrothermal vents inviability, hybrid, 313f
herbivory, 437 as clue to beginning of life, 372–373, ion, 31
Hercules, 363–364 372f ionic bond, 31, 32f
hereditary cancer, 187–199 collecting and processing microbials ipecac, 172t
cancer genetics, 193–196, 194f–197f from, 363–364, 364f IPS cells. See induced pluripotent stem
ethnic groups and, 192–193, 193t extremophiles in, 369–372, 371f cells
inherited mutations, 189–192, 191f–192f life in, 360–362, 363f irinotecan, 178, 180f–181f, 181
treatment of, 196–198, 199t methane production and consumption iron, 74t
Herto fossils, 405f in, 369–372, 372f Isle Royale, 414–427
heterotroph, 93, 368 types of life in, 364–367, 365f–367f ecology of, 416, 416f
heterozygous, 212–213, 213f, 240, 241f–242f hygiene, for reducing infection, 282–283 monitoring animal health, 421–423, 422f
HGP. See Human Genome Project hyperthermophiles, 369, 371f moose arrival on, 417–418, 420–421
hierarchical shotgun sequencing, 164 hyphae, 388, 389f population density, 424
Higley, Dee, 245 hypothesis, 4–5, 6f population growth on, 417–421, 420f
Hoekstra, Arjen Y., 484–485 population patterns on, 423
homeostasis, 22–23, 23f IAPV. See Israeli acute paralysis virus wolves arrival on, 421
hominid, 405 ice cores, carbon dioxide in, 464, 465f Isle Royale wolf and moose study, 414–427
Homo erectus, 406f, 407 igneous rock, 342–343, 343f isolation, reproductive, 312–313, 313f
Homo sapiens, 397 IIV. See invertebrate iridescent virus isotopes, radioactive, 341–343, 342f–343f
defining characteristics of, 406 immigration, population growth and, 418 Israeli acute paralysis virus (IAPV), 441,
evolution of, 406f, 407 immune cells, differential gene expres- 445f
homologous chromosomes, 206–207, sion in, 261
207f immune compromise, staph infection Jablonski, Nina, 398–402, 402f, 407–409
homology and, 274 Jason, 363–365
sequence, 334–335, 334f immune-suppressing drugs, for prevent- Jefferson, Field, 237, 239f
between species, 331–334, 332f–333f ing tissue rejection, 259 Jefferson, John Weeks, 239f
homozygous, 212–213, 240, 241f imprints, fossil, 324 Jefferson, Randolph, 238
honey bees, 432–446 In Darwin’s Shadow (Shermer), 297 Jefferson, Thomas, 234–240, 238f–239f
INDEX 533
Jefferson Westerinen, Julia, 239 as clue to beginning of life, 372–373, Mendel, Johann Gregor, 221–228
journalism, health in, 14–15, 15f 372f concepts of inheritance before, 223,
junk science, DNA v., 124–126, 126f exploration of, 363–364, 364f 224f
extremophiles in, 369–372, 371f pea plant experiments of, 224–227,
karyotype, 248, 249f methane production and consumption 225f–226f, 228f
Kenworthy, Jeff, 479 in, 369–372, 372f Mendel’s law of independent assortment,
keystone species, 434 types of life in, 364–367, 365f–367f 227, 228f
Khan, Genghis, 237 unique microbial life in, 360–362, 363f Mendel’s law of segregation, 226f, 227
“killer bee,” 443 lung damage, in CF patients, 211, 212f messenger RNA (mRNA), 152–155,
kinetic energy, 88–89, 88f–89f Lyell, Charles, 293, 293f, 297 153f–155f
Klebsiella, resistance in, 283 Lynfield, Ruth, 276, 282–283 metabolism, 23, 66–67, 67f
Klevens, Monica, 272 lysosome, 51, 53 metaphase, 179
Knoll, Andrew, 22 metastasis, 177
Kulakowski, Sabina, 122, 124, 126–127, 129, MacMahon, Brian, 2 meteorite ALH84001, 20–22, 26–27, 31–32,
133–134 macromolecule, 26–27 34
Kyoto Protocol, 466 macronutrient, 61–62, 63f–64f methane
magnesium, 74t from cattle, 466, 467f
labeling, of food, 65–66 Malacosoma disstria, 458, 459f in hydrothermal vents, 369–372, 372f
lactic acid, 113–114, 114f male methanogenesis, 369–372, 372f
Lactobacillus bulgaricus, 368 determination of, 231–234, 232f, 233t methanogens, 369–370, 371f
Lamarck, Jean-Baptiste, 292, 292f sex-linked inheritance in, 234, Methanopyrus kandleri, 370, 371f
Lamarckianism, 292–293, 292f 235f–236f methicillin-resistant Staphylococcus
land, first vertebrates on, 322–326, 328– Malthus, Thomas, 293f, 295, 296f aureus (MRSA), 272–275, 274f, 284
331, 331f mammals, 350, 386–388 in communities, 281–283
Langer, Robert, 257 manatees microbial life
Lannetti, Rick, 275, 283 adaptation by, 315–316 collection and processing of, 363–364,
Lannetti, Ricky, 272, 275, 281 Amazonian, 312–314, 314f 364f
law of independent assortment, 227, 228f analysis of evolution of, 306–310 in hydrothermal vents, 360–362, 363f
law of segregation, 226f, 227 boat collisions with, 300–302 types of, 364–367, 365f–367f
Lemba, 237 Florida, 300–316, 303f–305f, 311f, micronutrient, 72, 73f, 74t–75t
leukemia, transplantation for, 261 313f–316f milk, transgenic, 144–145, 155–157
leukocytes, transplantation of, 261 gene flow in, 311–312, 311f Miller, Stanley, 343–344
Lewis, Jeffrey, 378, 383, 392 gene pools of, 302–303, 303f mineral, 70–72, 71f, 74t
life, 19–35 genetic drift in, 303–306, 304f–305f mineralization, 324
beginning of, 343–344, 372–373, 372f geographic ranges of, 303f mitochondria, 50–51, 53–54
characteristics of, 22–24, 23f inbreeding in, 307, 310–311 mitochondrial DNA (mtDNA), 402–404,
classification of, 348–354, 350f–352f, natural selection in, 313 404f
354f speciation in, 312–315, 313f–316f for assessing genetic diversity, 314–315,
cycle of, 388, 389f West African, 312–314, 314f 315f
elements of, 24f–25f, 25–26, 28–29 West Indian, 312–314, 314f mitochondrial Eve, 402–404, 403f
geologic timeline of, 345–347, 346f maple syrup production, 451–455, 452f, mitosis, 175f–176f, 176, 179
Martian bacteria, 27, 30–31, 30f 454f modifier gene, 206, 215–216
molecules of, 24f–25f, 25–26, 28–29 Margulis, Lynn, 54, 390 Moffitt, Terrie, 245–246, 247f
search for alien, 22–24, 23f Mars, life on. See alien life molds, 389f
traces of alien, 26–27 Martian bacteria, 27, 30–31, 30f fossil, 324
water’s role in, 31–34, 32f–34f maternal age, Down syndrome risk and, molecules, of life, 24f–25f, 25–26, 28–29
“weird,” 34–35 246–248, 248f–249f mollusks, 384f, 385
life history timeline, 344–345 matter, 24–25, 24f Monera, 367
light energy, 91f, 94, 94f McKay, Chris, 31, 35 Money, John, 231
light reactions, in photosynthesis, 96f McKay, David, 20–21 The Monk in the Garden (Henig), 223–224
lipid, 26, 29 Meade, Harry, 149–150 monomer, 26–27
lipid membrane, in beginning of life, 344 mechanical isolation, 313f monosaccharide, 26–28, 68–69
livestock, antibiotic overuse in, 283 media, health in, 14–15, 15f moose, 414–427
lizard, phylogenetic tree of, 352–353, 352f Meier, Walt, 459–460 arrival on Isle Royale, 417–418, 420–421
lobe-finned fish, 329, 332f meiosis, 208–210, 208f–209f, 213, 247, distribution patterns of, 418f
logistic growth, 420, 420f 248f health monitoring of, 423
Lohsen, Rebecca, 272, 275–276, 281, 283 melanin, skin color and, 399–401, 399f population cycles of, 421, 421f
London, 473 melanocytes, 399, 399f population growth of, 417–423, 420f,
Loomis, W. Farnsworth, 400–401 Melatonin, 171 422f
Lost City, 359–374 membrane. See cell membrane population sampling of, 417
534 INDEX
warming climate and, 425, 426f Nosema ceranae, 441, 445f from embryonic stem cells, 262–265,
Morrison, Nina, 134 nuclear DNA, evolution and, 404 263f–264f
Morse, Burr, 450 nuclear energy, 482, 483f from induced stem cells, 265–267, 266f
moths, niche of, 442, 442f nuclear envelope, 50–52 regeneration v., 259–262, 259f, 261t,
mRNA. See messenger RNA nucleic acid, 26, 29, 61 262f
MRSA. See methicillin-resistant Staphylo- nucleotide, 26–27, 29, 125–126, 126f, 140, research progress in, 256–259,
coccus aureus 140f 257f–258f
mtDNA. See mitochondrial DNA structure of, 126f from stem cells, 258f
mucus, in CF patients, 211, 212f nucleus organelle, 42, 45f
Mullis, Kary, 127–128 of atom, 24f, 25 eukaryotic, 50–54, 51f, 391f
multifactorial inheritance, 242–246, of cell, 44, 45f, 51–52 in prokaryotes, 365f
246f–247f nutraceuticals, 60–77 organic molecule, 25f, 26
multipotent cells, 262, 263f for bones, 70–72, 71f, 73f in beginning of life, 343–344
muscle cells, differential gene expression for diabetes, 66–69, 68f, 70f organisms, classification of, 348–354,
in, 261 digestion, 66–69, 67f–68f, 70f 350f–352f, 354f
mushrooms, 388, 389f enzymes, 66, 67f Origin of Species (Darwin), 227
mutagen, 193–194, 194f for fighting chronic disease, 69–70 Osmia ribifloris, 443f
mutation. See genetic mutation labeling of, 65–66 osmosis, 44–45
mutualism, 439, 440f manufacture of, 62–65 osteoporosis, 60, 70–72, 71f, 73f
mycelium, 388 metabolism, 66–67, 67f “out of Africa” hypothesis, 402–404, 403f,
Myers, Richard, 404 nutrients, 61 405f
in whole foods, 73, 74t–75t Owen, David, 481
national park. See Olympic National Park nutrition, 60–77 oxygen, in respiration, 111–112, 112f–113f,
natural gas, 478f for bones, 70–72, 71f, 73f 115f
natural resources, 474–475 carbohydrate digestion, 66–69, 68f, 70f
natural selection, 279–281, 280f–281f chronic disease and, 69–70 paclitaxel (Taxol), 172, 173f, 177, 179, 180f
allele frequencies and, 303 digestion, 66–69, 67f–68f, 70f pairing, of DNA bases, 125–126, 126f, 128–
descent with modification, 325–326, enzymes, 66, 67f 129, 128f–129f, 141f–142f
327f, 333 food as, 61–62, 63f–64f paleontologists, 325, 345
development of theory of, 290–298, food labeling, 65–66 paleontology, 345–347, 346f
292f–294f, 296f food manufacturing, 62–65 pancreatic cancer, coffee causing, 2
genetic diversity and, 306 food pyramid, 72–76, 74t–75t Pangaea, 347, 349f
for skin color, 407–409, 408f honey bees and, 441–442 panthers, inbreeding depression in, 307,
for sweat glands, 407–408 human height and, 242–244, 244f 310
“nature deficit disorder,” 445 metabolism, 66–67, 67f parasitism, 439, 440f
nebular hypothesis, 341 Parkinson disease, coffee and, 12–14
necrotizing fasciitis, bacterial, 282 Obama, Barack, 396 paternity testing, 234–240, 238f–239f
necrotizing pneumonia, 282–283 obesity, 108–110, 109f, 116–117 pathogens, 369, 370f
Neisseria gonorrhoeae, 369 in United States, 102–105, 105f–106f, patterns, in scientific process, 11–14, 14f
nematodes, 384f 115–117 Pauling, Linus, 140
neonicotinoids, honey bees and, 444 oil, from algae, 95 PCR. See polymerase chain reaction
nerve cells, transplantation of, 265 Olympic mountains, 381f PC-SPES, 170, 173f
Nestlé, functional foods of, 60–62, 66, Olympic National Park, 377–392 pea plants, Mendel’s experiments on,
69–70, 72, 76 animal diversity in, 383–386, 384f 224–227, 225f–226f, 228f
Nestle, Marion, 72, 116 cycles of life in, 388, 389f peer review, 4–6
Neufeld, Peter, 123–125, 133 landscape of, 381f penguins, geographic distribution of, 347–
neutron, 24f, 25 plant diversity in, 380–383, 381f–382f 348, 348f–349f
New York City, 473 protecting diversity in, 390, 392 penicillin
Newberry, Thomas, 156–157 protists in, 388–390, 390f–391f cell membrane and, 49–50
Newman, Peter, 479, 489 vertebrates in, 386–388 cell target of, 42–45, 46f
news, health in, 14–15, 15f Omo fossils, 405f discovery of, 40–41, 42f, 43, 275
niche, 442, 442f On the Origin of Species by Means of drug development of, 45–48, 275
nitrogen, natural cycles of, 462–463 Natural Selection (Darwin), 298, 326, resistance to, 54–55, 273, 275
nitrogen fixation, 368 331 peptidoglycan, 45, 46f
node, in phylogenetic tree, 352, 352f oncogene, 194–195, 195f–196f performance-based design, 479
nonadaptive evolution, 303, 311 opportunistic pathogens, 369 periodic table of elements, 24f
noncoding sequence, 131 Ordovas, José, 72–73, 76 Perkins, Tim, 451–454
nondisjunction, 246–248, 248f–249f Oregon vent microbes, 366, 366f pesticides, honey bees and, 444, 445f
nonevolving population, 307–309 organ, 256f Peterson, Rolf, 415
nonrenewable resources, 477–478, 478f organ engineering, 253–267 petroleum oil, 478f
INDEX 535
pH, 32–33, 34f pollen, 433–434 beginning of, 345
pharmaceuticals. See also antibiotics; pollinating insects, 433–434 as beginning of life, 372–373, 372f
herbal supplement pollination, 433–436 collection and processing of, 363–364,
for chemotherapy, 173f, 174, 177–182, cross, 225, 225f 364f
180f–181f honey bees and, 434–435, 435f definition of, 364
development of penicillin, 45–48, 275 for reproduction, 435–436, 436f in hydrothermal vents, 360–362, 363f
herbal supplements v. traditional pollinators types of, 364–367, 365f–367f
drugs, 173f flowers luring of, 435 prokaryotic cell, 42–45, 43f, 45f, 54
for regenerative medicine, 262f niches of, 442, 442f eukaryotic cell v., 45, 45f, 48–49, 48f, 51
“pharming,” 155–157 pollution, freshwater and, 485 prometaphase, 179
phenotype, 147, 149f, 207 polydactyly, 214f, 215t prophase, 179
phospholipid, 29–30, 30f, 42–43, 44f polygenic trait, 242–244, 244f prostate cancer, PC-SPES for, 170
phospholipid bilayer, 43, 44f polymer, 26–27 protein, 26, 28, 147f
phosphorus, 70–72, 71f, 74t polymerase chain reaction (PCR), 127–129, amino acids in, 146, 146f
natural cycles of, 463 129f, 132f energy in, 107, 107f
photo reactions, 96f polysaccharide, 68 in food, 61–62, 63f
photon, 94, 94f population, 416, 416f gene expression and, 152–155, 153f–156f
photosynthesis, 90–95, 96f boom and bust of, 417–421, 420f from genes, 145–149, 146f–149f
in carbon cycle, 463, 466 population cycles, of predator and prey, genetic mutation and, 192f
by cyanobacteria, 368, 370f 421, 421f production and transport of, 52
energy capture through, 90–93, 92f population density, 424, 425f shape and function and, 146, 146f
food energy from, 114–115, 115f population ecology, 417 transport, 49, 50f
PHY906, 172–173, 180–182, 181f population growth, 417–421, 420f Protist kingdom, 380f
phylogenetic tree, 352–354, 352f, 354f, abiotic influences on, 424, 425f protists, 388–390, 390f–391f
380f biotic influences on, 424, 425f classification of, 353, 390f
phylogeny, 348–352, 350f–351f of humans, 474, 474f, 487–489 proton, 24f, 25
pili, 369, 370f patterns of, 421–423, 422f proto-oncogene, 194–195, 195f
pilocarpine, 172t population sampling, distribution pattern pseudoephedrine, 172t
pistil, 435–436, 436f and, 417, 418f public transportation, 481
placebo, 7, 8f populations punctuated equilibrium, 347
placebo effect, 7 analysis of evolution in, 306–310 Punnett, Reginald C., 212
plants, 380–383, 381f–382f evolution of, 278–280, 279f–280f Punnett square
adaptability of, 458 gene flow in, 311–312, 311f for inheritance of two genes, 215, 216f
changing temperatures and, 452, 453f gene pools in, 302–303, 303f for single-gene inheritance, 212–213,
classification of, 353 genetic drift in, 303–306, 304f–305f 213f
cone, 382f, 383 porcupines, 387
evolution of, 382f portion sizes, 104–105, 106f quinine, 172t
flowering, 382f, 383 potassium, 74t
primitive, 346 potential energy, 88, 88f race, 395–410
seed, 382f, 383 predation, 437 definition of, 397–399, 398f
vascular, 382 predators, 386–387 in history, 396
plant cell, 51f population cycles of, 421, 421f radial symmetry, 384f, 385
Plant kingdom, 380f preformation theories, 224f radiation therapy, 178–180, 180f
plant medicine, 159–183 pre-implantation genetic diagnosis, 214 radioactive isotopes, 341–343
cell division and cancer, 172–177, 172t, prey, population cycles of, 421, 421f decay of, 342f–343f
173f–178f primordial sea, 344 radiometric dating, 328, 328f, 341–343,
fighting cancer, 177–182, 180f–181f Principles of Geology (Lyell), 293 343f
herbal supplements, 170–173, 173f, 177– prion, 34 rain forest. See Olympic National Park
182, 180f–181f process of science, 1–16 random distribution, 417, 419f
plaque, 369 epidemiological studies, 11–14, 14f randomized clinical trial, 14
plate movements, biogeography and, evaluating evidence, 2–4, 5f, 14–15, 15f recessive allele, 212–214, 213f, 215t, 216f,
349f experiments, 5–7, 6f, 8f 226–228, 234, 235f–236f, 240, 241f
pluripotent cells, 263, 263f hypotheses, 4–5, 6f Hardy-Weinberg equilibrium for esti-
induced, 265–267, 266f samples, 7, 9f mating frequency of, 309
pneumonia, necrotizing, 282–283 theories, 8–9, 10f recombination, 208–209, 210f
poison oak, 383 producers, 437 red fox, 458
polar bears, 459 profiling. See DNA profiling regeneration
brown bears v., 348–349 prokaryotes, 359–374 engineering v., 259–262, 259f, 261t, 262f
geographic distribution of, 347–348, abundance and diversity of, 366f by stem cells, 257f
348f–349f archaea, 366–367, 369–372, 371f regenerative medicine, 261–262, 262f
polar molecule, 31, 32f bacteria as, 368–369, 370f regulatory sequence, 150, 150f
536 INDEX
Reimer, Bruce (David), 231–232 sea cow, 314f slugs, 385
rejection, of transplanted tissue, 259 sea ice, area of, 459–460, 461f snails, 385
relative dating, 328, 328f Sears, Jim, 82–86, 90, 95–96 snake, vestigial structures in, 333
renewable resources, 480, 482, 483f seasons, changes in, 452–456, 453f Snyder, Evan, 266
replication sedimentary rock, 342–343 sodium, 74t
of DNA, 127–129, 128f–129f seed, 435–436, 436f solar energy, 480, 482, 483f
semi-conservative, 129 seed plants, 382f, 383 solute, 31, 34f
reproduction, 23, 23f segregation, Mendel’s law of, 226f, 227 solution, 31
asexual, 277, 277f Self Normal, 216–217 solvent, 31, 32f
assisted, 214 Seliger, Kel, 116 somatic cell nuclear transfer (SCNT), 264–
of bacteria, 277–278, 277f–278f Sellers, Thomas, 189, 195, 197–198 265, 264f
folate and, 399–400, 400f semi-conservative replication, 129 somatic stem cells, 260, 262, 262f–263f
pollination for, 435–436, 436f sequence homology, 334–335, 334f creating embryonic stem cells from,
sexual, 207–216, 208f–210f, 213f–214f, sequencing, of DNA, 161–167 265–267, 266f
216f serotonin transporter gene, 245–246, specialized cells, 259f, 260–261
vitamin D and, 400–401, 400f 246f–247f speciation, 312–315, 313f–316f
reproductive cloning, 265 serpentinization, 372f, 373 species, 312
reproductive isolation, 312–313, 313f Serreze, Mark, 458–460, 466 adaptation of, 315–316
reptiles, 346 sex chromosome, 231–234, 232f, 233t, geographic distribution of, 347–348,
reserpine, 172t 235f–236f 348f–349f
resistance. See antibiotic resistance sex determination, 231–234, 232f, 233t homology between, 331–334, 332f–333f
respiration sex hormones, 231–232, 232f number of, 349–352, 350–351f
aerobic, 111–112, 112f–113f, 115f sex-linked inheritance, 234, 235f–236f reproductive isolation of, 312–313, 313f
in carbon cycle, 463 sexual reproduction, 207–216, 208f–210f, tracking of, 349–352, 350–351f
Rhesus factor, 241–242, 243f 213f–214f, 216f Wallace’s conception of, 298
ribosome, 43, 48–49, 48f, 153–154, 155f Shermer, Michael, 297 species loss, 486–487, 487f
prokaryotic v. eukaryotic, 48–49, 48f short tandem repeats (STRs), 130f, 131, sperm, 207–210, 209f, 213f
rice agriculture, 466, 467f 132f–133f, 238, 239f mitochondria in, 404f
RNA, 29, 152–155, 153f–155f Shubin, Neil, 322, 324–326, 328–329, 332, Spike Shooter, 10
RNA polymerase, 152–153, 154f 335 spina bifida, 259
rock sickle-cell disease, 215t folate and, 399, 400f
igneous, 342–343, 343f significance, statistical, 7–8 spinal cord injuries, transplanted nerve
sedimentary, 342–343 simple diffusion, 49, 50f cells for, 265
Rogers, Alan, 408 simple sugar, 62, 68–69, 68f sponges, 384, 384f
Rogers, Peter, 11 single-gene inheritance, 203–217. See also spore, 389f
root, of phylogenetic tree, 352, 352f genetic mutation SRY gene, 232
Ross, G. Webster, 13 dominant allele, 212–214, 213f–214f, 215t, St. John’s wort, 171
Rozin, Paul, 102–105, 110, 117 216f, 226–228, 240–242, 241f–243f stabilizing selection, 280, 281f
Ryan, Lee, 5, 8 meiosis, 208–210, 208f–209f, 213, 247, stamen, 435–436, 436f
248f staph bacteria, 273–275, 274f. See also
S phase, 176f modifier genes, 206, 215–216 methicillin-resistant Staphylococcus
Salmonella, resistance in, 283 Punnett square for, 212–213, 213f aureus
sample size, 7, 9f recessive allele, 212–214, 213f, 215t, 234, food poisoning by, 369
sampling, of hydrothermal vents, 363– 235f–236f, 240, 241f, 309 methods of acquiring antibiotic resis-
364, 364f sexual reproduction, 207–210, tance in, 277–278, 278f
saturated fat, 116 208f–210f, 213f–214f, 216f starch, 68, 68f
scaffolds, for tissue engineering, 256–258, Sirenia, 301. See also manatees statistical significance, 7–8
258f physical traits in, 314f Steller’s sea cow, 314f
Schaller, Debbie, 206–207, 210–213, 213f Sirenia Project, 302, 306 stem cells, 253–267
Schaller, Emily, 204–217, 213f sister chromatids, 176 adult (somatic), 260, 262, 262f–263f,
Schaller, Lowell, 206–207, 210–213, 213f Sitka spruce, 381 265–267, 266f
Schatz, Albert, 48 skin, engineered, 256–257 definition of, 255, 256f
Scheck, Barry, 123, 125 skin color embryonic, 262–267, 263f–264f, 266f
Schwitzer, Gary, 3, 15 allele for, 408–409 engineering organs from, 258f
science. See also process of science evolution of, 398–402, 409, 410f induced, 265–267, 266f
as way of knowing, 4–7, 6f, 8f folate and, 399–401, 399f, 408–409 for regeneration v. engineering, 259–
scientific hypothesis, 5 natural selection for, 407–409, 408f 262, 259f, 261t, 262f
scientific theory, 8–9, 10f selection for, 407–409 regenerative properties of, 257f
SCNT. See somatic cell nuclear transfer ultraviolet light and, 402, 402f research progress, 256–259, 257f–258f
scopolamine, 172t variation in, 397 specialization of, 259f, 260–261
Score, Roberta, 20 vitamin D, 400–401, 400f, 409 sterol, 29
INDEX 537
stigma, 435–436, 436f dating of, 328, 328f vitamin D and, 400, 409
stimuli, life response to, 23, 23f discovery of, 322–326, 335 uniform distribution, 417, 419f
Streptococcus mutans, 369 as intermediate fossilized organism, United States
Streptococcus pneumoniae, vaccination 331f energy consumption in, 84f
against, 284 Tilton, Robert, 172 obesity in, 102–105, 105f–106f, 115–117
streptomycin, 48–50 tissue, 255, 256f universal blood donor, 241–242, 242f–243f
stress, honey bees and, 445f tissue engineering, 253–267 unsaturated fat, 116–117
STRs. See short tandem repeats from embryonic stem cells, 262–265, uranium-238, 341, 342f–343f
substrate, 66, 67f 263f–264f Urey, Harold, 343–344
sugar, simple, 62, 68–69, 68f from induced stem cells, 265–267, 266f USA300 MRSA, 282–283
sugar maple, 450, 452f, 458, 459f regeneration v., 259–262, 259f, 261t,
sun, energy from, 93–95, 94f 262f Vacanti, Charles, 254
sun-free fuel, 93 research progress in, 256–259, Vacanti, Joseph, 257
sunlight, melanin and, 399, 399f 257f–258f vaccination, 284
Suomi, Stephen, 245 from stem cells, 258f vancomycin, resistance to, 275–276
superbugs, 282–284, 284f tissue rejection, after transplant, 259 vanEnglesdorp, Dennis, 434, 440–441
supplements, 73, 76. See also herbal Tomasz, Alexander, 50 variables, 7, 8f
supplement tools, development of, 407 varroa mite, 439–440
sustainability, 472, 488f totipotent cells, 263, 263f vascular plants, 382, 382f
Sustainability and Cities: Overcoming Toxicodendron diversilobum, 383 Venter, Craig, 165–167
Automobile Dependence (Newman, trans fat, 116 vertebrates, 323, 350, 384f, 385–388
Kenworthy), 479 transcription, 152–153, 153f movement to land by, 322–326, 328–
sweat glands, natural selection for, transfer, of energy, 89, 89f 331, 331f
407–408 transfer RNA (tRNA), 154 shared early development patterns in,
symbiosis, 368, 370f transfusion, blood type and, 241–242, 333, 333f
symmetry 242f–243f Vestiges of the Natural History of Creation
bilateral, 384f, 385 transgenic animal, 144–145, 155–157 (Chambers), 295
radial, 384f, 385 creation of, 149–152, 150f–151f vestigial structures, 333
synthesis reactions, in photosynthesis, transitional fossils, 330–331, 331f Vianna, Juliana, 315
96f translation, 152–153, 153f Vibrio fischeri, 368
syphilis, 369 transplant, rejection of, 259 Vinblastine, 172t, 178
systems, of human body, 256f transplant engineering, 253–267 virus, 34
from embryonic stem cells, 262–265, vitamin, 71–72, 75t
Taxol. See paclitaxel 263f–264f supplementation, 73, 76
taxonomy, 350 from induced stem cells, 265–267, 266f vitamin A, 75t
Tay-Sachs disease, 215t regeneration v., 259–262, 259f, 261t, vitamin B, 75t
telophase, 179 262f vitamin C, 75t
temperate deciduous forest biome, 455 research progress in, 256–259, vitamin D, 75t, 76
temperature 257f–258f skin color and, 400–401, 400f, 409
carbon dioxide and, 457f from stem cells, 258f vitamin E, 75t, 182
habitat and, 458 transport proteins, 49, 50f vitamin K, 75t
wolves and moose and, 425, 426f tree of life. See phylogenetic tree The Voyage of the Beagle (Darwin), 294,
temporal isolation, 313f Treponema pallidum, 369 296
testable hypothesis, 5 Triassic period, 346 Vucetich, John, 414–417, 424–427
testosterone, 231, 232f Trichomonas vaginalis, 389 Vulpes lagopus, 458
tetracycline, 49 triglyceride, 29, 109, 109f Vulpes vulpes, 458
tetrapods trisomy 21, nondisjunction and, 246–248,
earliest known, 329–331, 331f 248f–249f Wackernagel, Mathis, 476–477
fish homology with, 331–332, 332f tRNA. See transfer RNA Wagner, William, 254, 267
homology in, 331–334, 332f–333f trophic levels, 437–438, 438f Waksman, Selman, 48
TGFB1 gene, 215, 216f tropical forest biome, 455 Wallace, Alfred Russel, in development of
theophylline, 172t true bred, 225, 225f natural selection theory, 295–298,
theory, 8–9, 10f Tsui, Lap Chee, 205 296f
therapeutic cloning, 265 tumeric, 182 warming climate, wolves and moose and,
therapeutic drugs. See pharmaceuticals tumor suppressor gene, 194–195, 195f 425, 426f
Thomas, Lewis, 41 tumors, development of, 196f water, life and, 31–34, 32f–34f
Thompson, James, 265 tundra biome, 455 water footprint, 484–485
thymine, 126, 126f, 140–141, 140f–142f water resources, 484–486, 484f–486f
ticks, moose and, 425 ultraviolet light Watson, James, 137–142, 163, 166
Tiktaalik folate and, 399–400, 409 wavelength, of light energy, 94, 94f
amphibian-like limbs of, 329–331, 331f skin color and, 402, 402f weight gain, 108–110, 109f
538 INDEX
West African manatees, 312–314, 314f population growth of, 417–423, 420f, XYY male, 233
West Indian manatees, 312–314, 314f 422f
whole genome shotgun sequencing, 165 population sampling of, 417 Y chromosome, 231–234, 232f, 233t
Wilkins, Maurice, 141–142 warming climate and, 425, 426f Yamanaka, Shinya, 265
Wilson, Allan, 402–404 Woods, Tiger, 396 Yannas, Ioannis, 256
wind energy, 480, 482, 483f Woodson, Thomas, 237 Y-chromosome analysis, 236–238, 238f
wind pollination, 433 wound healing, cell division in, 174f yeast, 389f
Woese, Carl, 354, 367 yeast infections, 368
Wolfson, Jonathan, 93 X chromosome, 231–234, 232f, 233t, Yeung, K. Simon, 173–174
wolves, 414–427 235f–236f Young, Lisa, 116
arrival on Isle Royale, 421 X-linked trait, 234, 235f–236f
distribution patterns of, 418f X-ray diffraction, of DNA, 140–141, 140f zygote, 208, 208f
health monitoring of, 423 XXX female, 233
population cycles of, 421, 421f XXY male, 233
INDEX 539