Vous êtes sur la page 1sur 20

Surname Initial(s)

Centre
Paper Reference
No.

Signature
Candidate
No. 6 1 0 1 0 1
Paper Reference(s)

6101/01 Examiner’s use only

Edexcel GCE Team Leader’s use only

Biology
Biology (Human) Question Leave
Number Blank

Advanced Subsidiary 1
Unit Test 1 2
Wednesday 10 January 2007 – Morning 3

Time: 1 hour 4
5
6
Materials required for examination Items included with question papers 7
Ruler Nil
8

Instructions to Candidates
In the boxes above, write your centre number, candidate number, your surname, initial(s) and
signature. The paper reference is shown above. Check that you have the booklet for the correct unit.
Answer ALL EIGHT questions in the spaces provided in this booklet.
Show all the steps in any calculations and state the units. Calculators may be used.
Include diagrams in your answers where these are helpful.

Information for Candidates


The marks for individual questions and the parts of questions are shown in round brackets: e.g. (2).
The total mark for this question paper is 60.

Advice to Candidates
You will be assessed on your ability to organise and present information, ideas, descriptions and
arguments clearly and logically, taking account of your use of grammar, punctuation and spelling.

Total
This publication may be reproduced only in accordance with
Edexcel Limited copyright policy.
©2007 Edexcel Limited. Turn over
Printer’s Log. No.

N24718A
W850/R6101/57570 7/7/7/7/15,100
*N24718A0120*
Leave
blank
Answer ALL questions in the spaces provided.

1. The table below refers to the processes of natural and artificial cloning. If the statement
is correct, place a tick (9) in the appropriate box and if the statement is incorrect, place a
cross (8) in the appropriate box.

Natural Artificial
Statement
cloning cloning

Involves mitosis

Occurs in both plants and animals

Produces offspring that are genetically identical

Produces offspring by sexual reproduction


Q1

(Total 4 marks)

2. Read through the following passage about water, then write on the dotted lines the most
appropriate word or words to complete the passage.

A water molecule consists of two hydrogen atoms and one oxygen atom held

together by ........................................ bonds. There is an unequal distribution of charge

over the molecule. This is called a ........................................ and results in water being a

good ........................................ for many substances such as sodium ions.

Bonds called ........................................ bonds form between water molecules. As a result

water has a high ................................................................ meaning that a lot of

energy is needed to cause a small rise in temperature. Q2

(Total 5 marks)

2
*N24718A0220*
Leave
blank

BLANK PAGE

3
*N24718A0320* Turn over
Leave
blank
3. (a) The diagram below represents a transfer RNA (tRNA) molecule.

X { A
C
C

A G U

(i) Name the type of bond labelled Y.

................................................................................................................................
(1)

(ii) Name the molecule that is attached to position X during protein synthesis.

................................................................................................................................
(1)

(iii) Explain the meaning of the term anticodon.

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................
(2)

4
*N24718A0420*
Leave
blank
(b) State two ways in which the structure of a tRNA molecule differs from the structure
of a messenger RNA (mRNA) molecule.

1 .....................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

2 .....................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................
(2) Q3

(Total 6 marks)

5
*N24718A0520* Turn over
Leave
blank
4. The table below describes some structures found in eukaryotic cells.

Complete the table below by writing the name of the structure in the box next to its
description.

Description Name of structure

Cylindrical organelle made up of microtubules,


involved in spindle organisation.

Site where ribosomal RNA is made and the


subunits of the ribosomes are assembled.

Organelle consisting of stacks of cisternae and


vesicles, concerned with the modification of
proteins.

Small spherical structures surrounded by a single


membrane, containing hydrolytic enzymes.
Q4

(Total 4 marks)

6
*N24718A0620*
Leave
blank

BLANK PAGE

7
*N24718A0720* Turn over
Leave
blank
5. (a) DNA in eukaryotic organisms is a double helix. Bases on one strand bond to bases
on the second strand to form base pairs. During protein synthesis, one strand of DNA
(the coding strand) acts as a template to make mRNA. The second strand is known
as the non-coding strand.

The base sequence of a small section of the coding strand of a DNA molecule is
shown below.

AGACTTGCAACTTGACATGTA

(i) How many codons are shown in this sequence?

................................................................................................................................
(1)

(ii) Give the sequence of the first five bases that would be present in each of the
following:

1. the mRNA molecule transcribed from this DNA strand

.........................................................................................................................

2. the non-coding strand of this DNA

.........................................................................................................................
(2)

8
*N24718A0820*
Leave
blank
(b) A sample of DNA from a locust was analysed to determine the percentage of each
base present. The percentage of adenine was found to be 29.4%.

Calculate the percentage of cytosine in this sample. Show your working and give an
explanation for your answer.

Percentage of cytosine = ..............................................................................................

Explanation: ...................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................
(5) Q5

(Total 8 marks)

9
*N24718A0920* Turn over
Leave
blank
6. (a) Describe the structure of a plant cell wall.

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................
(3)

(b) An experiment was carried out to determine the effect of two enzymes, enzyme A and
enzyme B, on the yield of apple juice.

An apple was cut into small pieces and blended in a food processor to produce apple
pulp.

Four samples of apple pulp of equal mass were mixed with various combinations of
enzyme A, enzyme B and water, as detailed in the table below. Both enzyme solutions
were at the same concentration.

Sample number Mixture

1 Apple pulp + 5 cm3 enzyme A + 5 cm3 water

2 Apple pulp + 5 cm3 enzyme B + 5 cm3 water

3 Apple pulp + 5 cm3 enzyme A + 5 cm3 enzyme B


4 Apple pulp + 10 cm3 water

The samples were incubated at 30 °C for 15 minutes.

Each sample was then placed in a separate filter funnel and the apple juice collected
into a measuring cylinder. The volumes of the apple juice collected from each sample
are shown in the bar chart opposite.

10
*N24718A01020*
Leave
blank
40 ±
3mc / detcelloc

30 ±
eciuj elppa fo emuloV

20 ±

10 ±


1 2 3 4
Sample number

(i) Suggest why the apple pulp incubated with water only (sample 4) yielded some
apple juice.

................................................................................................................................

................................................................................................................................
(1)

(ii) Describe the effect that enzymes A and B have on the yield of apple juice in
samples 1, 2 and 3.

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................
(2)

QUESTION 6 CONTINUES OVERLEAF.

11
*N24718A01120* Turn over
Leave
blank
(iii) Suggest how these enzymes increase the yield of apple juice.

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................
(4) Q6

(Total 10 marks)

12
*N24718A01220*
Leave
blank

BLANK PAGE

13
*N24718A01320* Turn over
Leave
blank
7. (a) Beetroot cells contain a red water-soluble pigment in their vacuoles. This pigment
cannot pass through membranes. If the membrane is damaged, red pigment will leak
out of the cell.

An experiment was carried out to test the effect of different temperatures on beetroot
cell membranes. Eight equal-sized discs of beetroot were cut and carefully rinsed in
distilled water.

One disc was transferred to a test tube containing 10 cm3 of distilled water maintained
at a temperature of 25 °C and left for 30 minutes. After this time, the intensity of red
coloration of the liquid in the test tube was measured using a colorimeter.

Each of the other seven discs was treated in a similar way but maintained at a different
temperature.

The results of the investigation are shown in the graph below.

2.0 ±

1.8 ±

1.6 ± x x x
Intensity of 1.4 ±
red coloration
/arbitrary
1.2 ±
units

1.0 ±

0.8 ±

0.6 ±

0.4 ±

0.2 ± x
x
x x x

±

20 30 40 50 60 70 80 90 100
Temperature / 8C

14
*N24718A01420*
Leave
blank
(i) Describe the effect of increasing temperature on the intensity of the red coloration
of the solution.

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................
(3)

(ii) Suggest an explanation for these results.

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................
(3)

QUESTION 7 CONTINUES OVERLEAF.

15
*N24718A01520* Turn over
Leave
blank
(b) Some substances pass through membranes by active transport. Describe the process
of active transport.

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................
(5) Q7

(Total 11 marks)

16
*N24718A01620*
Leave
blank
8. Amylase is an enzyme that catalyses the breakdown of starch into maltose. An experiment
was carried out to investigate the effect on amylase by keeping it at a high temperature
before it was used.

A 1% solution of amylase was prepared and placed in a waterbath at 60 °C. Immediately,


2 cm3 of this amylase solution was put into a test tube and placed in another waterbath
set at 20 °C. Five more 2 cm3 samples of amylase were removed at 1 minute intervals
from the amylase solution kept at 60 °C. These samples were also placed in the 20 °C
waterbath.

The activity of each amylase sample was then determined.

(a) Describe how the test for starch can be used to compare the activity of these amylase
samples.

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................
(3)

QUESTION 8 CONTINUES OVERLEAF.

17
*N24718A01720* Turn over
Leave
blank
(b) The results of this experiment are shown in the table below.

Length of time that amylase was in the


60 °C waterbath / mins Activity of amylase / arbitrary units
(Incubation time)

0 12.5

1 4.9

2 2.3

3 0.2

4 0.1

5 0.0

Describe the effect of increasing the length of the incubation time at 60 °C on the
activity of amylase.

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................

.......................................................................................................................................
(3)

18
*N24718A01820*
Leave
blank
(c) (i) Enzymes are proteins. Describe the tertiary structure of an enzyme.

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................
(3)

(ii) Suggest an explanation for the change in amylase activity with increased
incubation time at 60 °C.

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................

................................................................................................................................
(3) Q8

(Total 12 marks)
TOTAL FOR PAPER: 60 MARKS

END

19
*N24718A01920*
BLANK PAGE

20
*N24718A02020*