Vous êtes sur la page 1sur 135

REMERCIEMENTS

Je tiens tout d’abord à remercier le Professeur Pierre Brousset pour la confiance qu’il
m’a accordée pour mener à bien ce projet et pour l’intérêt qu’il porte à mon devenir
professionnel. Je vous remercie de m’avoir encouragée à réaliser cette thèse et de m’avoir
soutenue tout au long de ce parcours.
Je remercie le Professeur Georges Delsol de m’avoir accueillie dans son laboratoire
sept années auparavant et de m’avoir donnée son approbation et ses encouragements pour
effectuer cette thèse.
Je remercie les Professeurs Serge Romana, Nicolas Sirvent et Claude Preudhomme
d’avoir accepté et donné de leur temps pour juger ce travail. Je vous remercie aussi pour
toutes vos remarques qui ont permis d’améliorer ce manuscrit.
Je remercie le Professeur Eric Delabesse de m’avoir fait l’honneur de présider mon
jury. Je vous remercie également d’être toujours disponible et de très bon conseil.
Je remercie le Docteur Nicole Dastugue qui a accepté de me confier ce projet qu’elle
avait initié. Je vous suis très reconnaissante de m’avoir soutenue tout au long de ce travail et
de m’avoir consacrée de votre temps. Je suis aussi heureuse d’avoir pu finaliser cette étude
qui vous tenait à cœur.
Je remercie toutes les personnes ayant travaillé sur ce projet et notamment le Docteur
Eric Lippert et le Professeur François-Xavier Mahon qui ont permis de relancer cette étude et
le Docteur Gwendoline Soler qui l’avait débutée. Je tiens à remercier Stéphanie Struski qui a
pris beaucoup de son temps pour effectuer l’étude cytogénétique et surtout l’interpréter, chose
qui s’est avérée difficile. Je remercie aussi le Docteur Cécile Demur pour sa disponibilité et
son aide précieuse lors des analyses cytologiques. Je tiens à remercier Cyril Broccardo d’avoir
pensé à moi pour ce projet. Je te remercie aussi pour tous tes conseils et ton aide. Je remercie
enfin Nais Prade et Cindy Cavalier pour leur efficacité et leur aide lors des analyses
génomiques.
Je tiens à remercier globalement tous les membres de l’équipe qui, à un moment ou un
autre, m’ont apporté du soutien, des conseils ou de l’aide et aussi leur petite touche
personnelle permettant de passer de bons moments : Marie-Pierre et sa gentillesse, Emilie D
et sa décontraction, Julie et sa gaieté, , Charlotte et son franc parler, Céline et ses bons plans,
Cécile et sa douceur, Laure et son entrain, Julien et son humour décalé. Je remercie Estelle,
Fabienne, Laurence et Sylvie qui savent se rendre disponibles et toujours prêtes à donner de
bons conseils.
Je remercie plus personnellement, Jeannine, l’âme et la mémoire de cette équipe, qui
est toujours là quand on a besoin d’elle. Je vous remercie pour votre disponibilité et votre
bonne humeur quotidienne qui m’accompagne depuis mon arrivée au laboratoire. Etienne,
mon soutien sans faille pendant cette thèse qui as toujours répondu présent et trouvé les mots
pour me remonter le moral quand j’en avais besoin et cela même après une attaque frontale
par un tiroir. Merci pour les fous rires mais aussi les instants de culture générale. J’aurais
vraiment voulu que tu sois là pour la dernière ligne droite fichu pancake. Wilfried, monsieur
Sno, et son oreille attentive. Merci pour les instants partagés et pour la confiance que tu me
témoignes. Je suis admirative de ton parcours et je te souhaite beaucoup de réussite pour la
suite. Marina, avec qui tout a commencé et qui est revenue à temps pour le grand final. Je te
remercie pour toutes les années que nous avons passées ensemble à travailler avant cette
thèse. Je suis très touchée pour toute l’aide et le soutien que tu m’as apportés à la fin de cette
étape. J’espère que maintenant nos chemins professionnels resteront liés, pour le reste je ne
m’en fait pas.
Je remercie mes colocataires de bureau non citées précédemment qui sont Emilie L,
Pauline et Emilie-Fleur. Merci à vous trois pour votre gentillesse et votre disponibilité.
Je remercie aussi les anciens qui ont partagé avec moi un bout de vie au laboratoire et
de bons moments comme Jeff, Michèle, Ashraf et la Gilles’s dream team : Gilles, Alan,
Jérôme et Catherine.
Je remercie tous les membres des équipes de l’étage « jaune » qui sont les équipes
Fournié, Manenti et Payrastre avec qui j’ai pu interagir ou tout simplement discuter. Je
remercie Anne-Marie Benot, Nathalie Frances et Sébastien Guibert pour leur gestion au
quotidien et tous les membres des plateaux techniques pour leur disponibilité et leur
efficacité.

Je tiens à remercier toute ma famille et mes amis qui m’ont fait l’honneur d’être là
pour me soutenir et célébrer la fin de ma thèse. Enfin, Arnaud, je te remercie de m’avoir
épaulée et d’avoir réussit à me supporter tout au long de cette thèse. Je finis par un clin d’œil
à mon fils Arthur…
TABLE DES MATIERES
LISTE DES ABBREVIATIONS............................................................................................. 3
INTRODUCTION.................................................................................................................... 5
I. INTRODUCTION GENERALE......................................................................................... 7
II. L’HEMATOPOÏESE.......................................................................................................... 9
A. LE MODELE CLASSIQUE ....................................................................................................... 9
1. La cellule souche hématopoïétique .............................................................................. 11
2. Les progéniteurs hématopoiétiques.............................................................................. 13
3. Révision du modèle classique....................................................................................... 15
B. LA MYELOPOÏESE .............................................................................................................. 17
1. Les facteurs de régulation ............................................................................................ 17
a) Les facteurs extrinsèques ......................................................................................... 17
(1) Les cellules stromales......................................................................................... 19
(2) Les facteurs solubles........................................................................................... 19
b) Les facteurs intrinsèques.......................................................................................... 21
(1) GATA1 ............................................................................................................... 23
(2) MYB ................................................................................................................... 29
(3) PU.1 .................................................................................................................... 35
(4) C/EBPα ............................................................................................................... 35
C. ONTOGENESE DES GRANULOCYTES BASOPHILES ............................................................... 37
1. Fonction des basophiles ............................................................................................... 37
2. Origine des basophiles humains .................................................................................. 39
3. Les basophiles murins .................................................................................................. 41
III. LES LEUCEMIES AIGUËS MYELOBLASTIQUES................................................. 43
A. CLASSIFICATION ............................................................................................................... 43
B. LES ALTERATIONS GENETIQUES ........................................................................................ 43
1. Les anomalies de structure........................................................................................... 43
a) Les translocations chromosomiques ........................................................................ 43
(1) Mécanismes de formation................................................................................... 45
(2) Types de translocation ........................................................................................ 49
(3) GATA1 et MYB dans les anomalies chromosomiques...................................... 57
2. Les anomalies de séquences......................................................................................... 57
a) Mutations des facteurs de transcription.................................................................... 59
b) Mutations fréquentes dans les LAM ........................................................................ 61
c) Mutations de MYB et GATA1 ................................................................................... 63
3. Les dérégulations épigénétiques .................................................................................. 63
C. LES LEUCEMIES AIGUËS MYELOBLASTIQUES PEDIATRIQUES ............................................. 67
D. LES LEUCEMIES AIGUËS A BASOPHILES DE NOVO .............................................................. 69
1. Généralités ................................................................................................................... 69
2. Diagnostic .................................................................................................................... 69
OBJECTIFS............................................................................................................................ 73
RESULTATS .......................................................................................................................... 77
DISCUSSION ET CONCLUSION ....................................................................................... 91
REFERENCES BIBLIOGRAPHIQUES........................................................................... 103

1
2
LISTE DES ABBREVIATIONS
AD : Domaine d’activation
AMV : Avian Myeloblastosis virus
ATRA: All-Trans Retinoic Acid
Ba/Eo : Basophile/Eosinophile
Ba/Mast : Basophile/Mastocyte
Ba/Meg : Basophile/Mégacaryocyte
CD : Cluster of Differentiation
CFC : Colony Forming Cell
CFU: Colony Forming Unit
CFU-E : Colony Forming Unit–Erythroïde
CFU-G : Colony Forming Unit–Granulocyte
CFU-GEMM : Colony Forming Unit–Granulocyte Erythrocyte Monocyte Megacaryocyte
CFU-GM : Colony Forming Unit–Granulocyte Monocyte
CFU-M : Colony Forming Unit–Monocyte
CFU-MC : Colony Forming Unit–Megacaryocyte
CFU-S : Colony Forming Unit–Spleen
ChIP-Seq : Chromatin ImmunoPrecipitation–Sequencing
CSH : Cellule Souche Hématopoïétique
CT-CSH : Court Terme–CSH
C-term Znf : Doigt de Zinc C–terminal
DBD : Domaine de liaison à l’ADN
DMT : Désordre myéloprolifératif transitoire
DNMT : DNA méthyltransférase
DSB : Double-Strand Break
EPO : Erythropoïétine
HAT : Histone acétyltransférase
HDAC : Histone désacétylase
HDM : Histone Déméthylase
HLA-DR : Human Leucocyte Antigen–DR
HMT : Histone méthylase
HR : Homologous Recombination
IL : Interleukine
KD : Knock–Down
KDa : KiloDalton
KO : Knock–Out

3
LAB : Leucémie Aiguë à Basophiles
LAL : Leucémie Aiguë Lymphoblastique
LAM : Leucémie Aiguë Myéloblastique
LAMK : Leucémie Aiguë Mégacaryoblastique
Lin–: lignage négatif
LMC : Leucémie Myéloïde Chronique
LSK : Lin–Sca1+Kit+
LTC–IC : Long Term Culture-Initiating Cell
LT–CSH : Long Terme-Cellule souche hématopoïétique
MBS : MYB Binding Site
MGG : May-Grünwald-Giemsa
NHEJ : Non-Homologous End Joining
NOD/SCID : Non-Obese Diabetic/ Severe Combined ImmunoDeficiency
NRD : Domaine de régulation négatif
N-term Znf : Doigt de Zinc N-terminal
OMS : Organisation Mondiale de la Santé
PB : Progéniteur Lymphoïde B
PCEM : Progéniteur Commun Erythro-Myéloïde
PCL : Progéniteur Commun Lymphoïde
PCML : Progéniteur commun myéloïde-lymphoïde
PE : Progéniteur Erythroïde
PG : Progéniteur Granulocytaire
PGM : Progéniteur Granulo-Monocytaire
PM : Progéniteur Monocytaire
PMB : Progéniteur myéloide lymphocyte B
PMC : Progéniteur MégaCaryocytaire
PMP : Progéniteur MultiPotent
PMT : Progéniteur Myéloide lymphocyte T
PT : Progéniteur lymphoïde T
RAG : Recombination-Activating Gene
SCF : Stem Cell Factor
SMD : Syndrome MyéloDysplasique
SRC : SCID repopulating cells
TAD : Domaine de transactivation
TCR : T cell receptor
TK : Tyrosine kinase

4
INTRODUCTION

5
6
I. Introduction générale
L’hématopoïèse est un processus physiologique complexe et finement régulé qui
aboutit à la formation de divers types cellulaires formant le tissu hématopoïétique.
Schématiquement, on distingue deux lignées : la lignée lymphoïde et la lignée myéloïde.
L’équilibre entre ces différentes populations cellulaires est obtenu par une fine régulation des
processus de prolifération et de différenciation. La dérégulation d’un de ces deux ou de ces
deux paramètres fondamentaux conduit au développement d’hémopathies malignes. On
distingue par exemple les hémopathies chroniques, caractérisées par l’augmentation de la
prolifération d’un ou plusieurs types cellulaires, des hémopathies aiguës, durant lesquelles les
cellules bloquées à un stade précoce de la différenciation prolifèrent de manière excessive. Au
cours de l’introduction, nous nous intéresserons à l’hématopoïèse normale et notamment aux
acteurs de ce processus. Nous présenterons également des données de la littérature qui ont
permis de réviser le modèle classique de l’hématopoïèse. Par la suite, la myélopoïèse sera
présentée, et notamment les facteurs régulant ce processus parmi lesquels les facteurs
intrinsèques et extrinsèques. Une troisième partie s’intéressera aux granulocytes basophiles
qui sont touchés lors de la pathologie présentée ici. Ensuite, l’hématopoïèse pathologique et
en particulier la leucémie aiguë myéloblastique (LAM) sera présentée. Nous développerons
les causes moléculaires des LAM telles que les dérégulations suite aux translocations
chromosomiques. Enfin, nous présenterons en détail une sous-classe de LAM, la leucémie
aiguë à basophiles (LAB), qui forment un groupe hétérogène de part la diversité des
translocations associées et des phénotypes observés.
Notre laboratoire s’intéresse à la caractérisation des réarrangements chromosomiques.
D’un point de vue clinique, nos travaux ont pour objectif d’améliorer la prise en charge du
patient. Sur un plan scientifique, nous cherchons à mettre en évidence des gènes importants
dans l’ontogénèse des cellules sanguines. Dans ce contexte, nous nous sommes intéressés à
quatre cas de nourrissons porteurs de la même translocation, la t(X;6)(p11;q23), et atteints de
LAB avec une présentation clinique similaire. Par des analyses cytogénétiques, nous avons pu
vérifier le réarrangement du gène MYB situé sur le chromosome 6 au niveau de la bande q23.
Les étapes suivantes ont permis de cloner un nouveau transcrit de fusion MYB–GATA1 et
d’étudier son rôle dans la myélopoïèse. Nos travaux in vitro ont prouvé que MYB–GATA1
peut être à l’origine de l’apparition d’une LAM par ses capacités à bloquer la différenciation
et à transformer les cellules exprimant cette protéine chimérique. Sur un plan clinique, cette
étude a permis de définir une nouvelle entité clinico-biologique.

7
Prolifération

LT-CSH
CSH

CT-CSH
PMP

Moelle osseuse
PCEM PCL

Progéniteurs

PE PGM PMC PB PT
Différenciation

PM PG

Précurseurs

Sang
Erythrocyte Monocyte Granulocyte Plaquette Lymphocyte B Lymphocyte T

Lignée myéloïde Lignée lymphoïde

Figure 1 : Schéma de l’hématopoïèse classique. Le modèle classique de l’hématopoïèse


repose sur un système pyramidal. La cellule souche hématopoïétique en haut de cette structure
est capable de générer par des étapes de différenciation successives toutes les cellules matures
du tissu sanguin. CSH : Cellule Souche Hématopoïétique, PMP : Progéniteur MultiPotent,
PCEM : Progéniteur Commun Erythroïde Myéloïde, PCL : Progéniteur Commun Lymphoïde,
PE : Progéniteur Erythroïde, PGM : Progéniteur Granulo-Monocytaire, PMC : Progéniteur
MégaCaryocytaire, PB : Progéniteur lymphoide B, PT : Progéniteur lymphoïde T, PM :
Progéniteur Monocytaire, PG : Progéniteur Granulocytaire. * Les lymphocytes T maturent
dans le thymus.

8
II. L’hématopoïèse
A. Le modèle classique
L’hématopoïèse est un processus physiologique hiérarchisé qui assure la production de
cellules sanguines matures qui sont les érythrocytes, les plaquettes et les leucocytes
comprenant les granulocytes, les monocytes, les lymphocytes B et T. Les cellules
hématopoïétiques jouent un rôle dans l’hémostase, le transport de gaz, l’immunité innée et
l’immunité adaptative.
L’hématopoïèse est initiée par les cellules souches hématopoïétiques (CSH) qui
donnent naissance progressivement à des progéniteurs engagés dans des voies de
différenciation permettant d’obtenir in fine les cellules sanguines matures (Figure 1). Les CSH
génèrent le progéniteur multipotent (PMP) qui se différencie en progéniteur commun érythro-
myéloïde (PCEM) ou en progéniteur commun lymphoïde (PCL)1 à l’origine des cellules
myéloïdes ou érythroïdes et des lymphocytes B ou T, respectivement. Ces progéniteurs
prolifèrent et se différencient en progéniteurs unipotents puis en précurseurs de chaque cellule
sanguine reconnaissable morphologiquement.
Au cours du développement, l’hématopoïèse humaine se déroule dans différents
organes. Elle commence dans le sac vitellin (hématopoïèse primitive), puis dans le foie fœtal,
la rate et la moelle osseuse (hématopoïèse définitive). Chez l’adulte, l’hématopoïèse n’a lieu
que dans la moelle osseuse. Dans cet organe, le devenir des CSH est soumis à des régulations
orchestrées par des facteurs intrinsèques ainsi que par des facteurs extrinsèques provenant du
microenvironnement.
Le modèle classique de l’hématopoïèse, repose sur la dichotomie entre la lignée
lymphoïde et myéloïde qui trouve son fondement dans les observations histologiques. La
lignée myéloïde regroupe les érythrocytes, les plaquettes, les granulocytes ainsi que les
monocytes et a été définie comme telle car les précurseurs de ces cellules sont observés dans
la moelle osseuse. Les lymphocytes T et B forment la lignée lymphoïde nommée ainsi car les
lymphocytes ont tout d’abord été identifiés dans la lymphe.

9
A B
CSH CSH

Cellule  Cellule 
différenciée différenciée

Figure 2 : Schématisation de la division asymétrique d’une cellule souche


hématopoïétique. D’après Wilson et al. 2

10
1. La cellule souche hématopoïétique

Les CSH de la moelle osseuse sont des cellules quiescentes, rares, indifférenciées et
caractérisées par leur capacité à s’auto-renouveler, c'est-à-dire à se diviser en une cellule
identique, et par leur pluripotence, c'est-à-dire à se différencier en plusieurs types cellulaires
constituant le tissu sanguin. La CSH s’engage dans la différenciation après division
asymétrique. Deux mécanismes sont proposés : - une cellule fille conserve sa capacité d’auto-
renouvellement contrairement à l’autre qui se différencie sous l’influence de facteurs
cellulaires répartis inégalement lors de la division ; - une des deux cellules filles sort de la
niche hématopoïétique afin de se relocaliser dans un microenvironnement induisant la
différenciation (Figure 2).
La première mise en évidence de l’existence d’une CSH a été réalisée par Till et
McCulloch par transplantation de moelle osseuse dans une souris irradiée à une dose létale.
L’existence dans la moelle osseuse de cellules capables de la reconstituer a été démontrée par
la présence de colonies dans la rate. Chacune d’entre elle, appelées CFU-S (Colony Forming
Unit-Spleen) 3, correspondait à une cellule souche pluripotente injectée capable de générer
plusieurs lignées cellulaires.
Les CSH sont définies comme des cellules médullaires exprimant le marqueur
membranaire CD34+. Néanmoins, sur la base de ce seul marqueur, cette population est
hétérogène, c’est pourquoi de nombreux travaux tendent à préciser leur phénotype afin de
mieux étudier chaque sous-population. Ce type de caractérisation fine du compartiment des
CSH est permis, entre autres, par un test de clonogénicité en méthylcellulose après plusieurs
semaines de culture sur des cellules stromales (Long Term Culture-Initiating Cell : LTC-IC).
Ainsi, nous pouvons distinguer les cellules CD34+ HLA-DR+ capables de former des colonies
en méthylcellulose, de celles négatives ou exprimant faiblement HLA-DR, capables d’initier
une hématopoïèse complète et à long terme in vitro. Sur la base du marqueur CD38, les
cellules CD34+CD38−ont pu être isolées et correspondent à une sous-population enrichie en
CSH primitives 4.

Bien que ces expériences in vitro apportent d’importantes informations sur le potentiel
des CSH à se différencier en progéniteurs et à s’auto-renouveler, ces fonctionnalités doivent
être vérifiées in vivo. En effet, les conditions de culture lors de ces expériences ne permettent
pas de tester le développement de toutes les cellules sanguines ni de prédire si la population
isolée est capable de reproduire in vivo la reconstitution à long terme. C’est pourquoi une

11
12
technique de transplantation a été développée. Cette technique repose sur un modèle de
xénogreffe des CSH humaines dans des souris NOD/SCID (Non-Obese Diabetic/ Severe
5
Combined ImmunoDeficiency) irradiées . Les cellules capables de reconstituer le
compartiment myéloïde et lymphoïde dans ce type de souris sont appelées SCID repopulating
6
cells (SRC) et il semblerait qu’elles soient plus primitives que les LTC-IC . Les
transplantations successives permettent d’évaluer le potentiel de reconstitution à long terme.
Ainsi l’étude des marqueurs CD45RA et CD90 ont permis de discriminer dans la population
des CSH, deux sous-populations contenant les cellules dites long terme-CSH (LT-CSH :
CD34+CD38−CD45RA−CD90+) et court terme-CSH (CT-CSH :
CD34+CD38−CD45RA−CD90−) 7. La différence entre ces deux populations repose sur leur
capacité ou non à reconstituer dans le temps une moelle osseuse complète chez des souris
irradiées.

Récemment, une équipe a mis en évidence l’existence d’un nouveau marqueur


pouvant discriminer plus précisément les CSH, des PMP. Ce besoin de les différencier
s’expliquait par l’observation que la population décrite comme celle des PMP était capable de
reconstituer des souris à long terme (20 semaines) et de manière successive. Ce résultat
démontre que des cellules de cette fraction conservent un potentiel d’auto-renouvellement.
D’autre part, l’expression de plusieurs intégrines, protéines membranaires notamment
impliquées dans les interactions des cellules avec leur microenvironnement, a été testée et il
s’est avéré que l’intégrine α6 (CD49f) est différentiellement exprimée. En étudiant, le
potentiel des différentes sous-populations à reconstituer la moelle osseuse des souris
NOD/SCID, Notta et al. ont démontré que les CSH qui avaient le potentiel de reconstitution à
plus long terme étaient contenues dans la population CD34+CD38−CD45RA−CD90+CD49f+ 8.

2. Les progéniteurs hématopoiétiques

Les progéniteurs hématopoïétiques sont les cellules engagées dans les processus de
différenciation et ayant perdu une partie de leurs pouvoirs d’auto-renouvellement et de
multipotence. Leur potentiel de différenciation peut être étudié par un test de clonogénicité en
méthylcellulose (Colony Forming Cell assay : CFC assay). Cette technique est basée sur la
capacité des progéniteurs hématopoïétiques à proliférer et à se différencier dans un milieu
semi-solide en présence de cytokines. Elle permet d’étudier le degré de pluripotence de
cellules progénitrices triées. De plus, elle peut être envisagée pour tester les effets de
cytokines particulières ou de combinaisons de cytokines 9 ainsi que pour tester des drogues 10.

13
PCEM
PCEM

PMP PMP PMT

PCL

PCML

PMB

Modèle classique « Myeloid based » modèle


Figure 3 : Comparaison entre le modèle classique et le modèle révisé d’après Kawamoto
et Katsura 11. METB : progéniteur commun Myéloïde-Erythroïde-lymphocyte T-lymphocyte
B ; PMP : Progéniteur MultiPotent, PCEM : Progéniteur Commun Erythroïde Myéloïde,
PCL : Progéniteur Commun Lymphoïde, PMT : Progéniteur myéloïde-lymphoïde T, PMB :
Progéniteur myéloïde-lymphoïde B, M : myéloïde (granulocyte, monocyte), E : Erythroïde
(plaquette, érythrocyte), T : lympocyte T, B : lymphocyte B.

14
Cette analyse par CFC assay a permis d’identifier la fraction cellulaire
Lin−CD34+CD38+IL-3RαloCD45RA− , capable de générer tous les types de progéniteurs
12
myéloïdes, qui correspond au PCEM . Par la suite, le progéniteur des granulocytes
éosinophiles a été isolé à partir d’une sous-population des PCEM exprimant le récepteur à
l’interleukine-5 (IL-5) et qui, en culture en méthylcellulose, est capable de générer des
13
colonies de précurseurs éosinophiles . Cette étude invalide l’existence d’un progéniteur
commun à tous les granulocytes. Ainsi, ce type de travail permet de mieux caractériser les
progéniteurs hématopoïétiques et les étapes de la différenciation hématopoïétique, apportant
des arguments pour compléter ou modifier le modèle classique de l’hématopoïèse.

3. Révision du modèle classique


Le modèle classique de l’hématopoïèse repose sur la dichotomie entre la lignée
myéloïde et lymphoïde. Au cours des années, plusieurs équipes ont proposé des révisions de
ce modèle. Nous nous intéresserons au modèle de l’équipe de Katsura appelé « myeloid
14
based » modèle (Figure 3). Ce modèle correspondrait plus à une dichotomie basée sur la
fonction des cellules, d’une part les cellules non immunitaires ou cellules érythroïdes
(plaquettes et érythrocytes) et d’autre part les cellules immunitaires comprenant les cellules
lymphoïdes (lymphocytes T et B) et myéloïdes (granulocytes et monocytes).

Cette équipe a développé un test in vitro permettant la différenciation des progéniteurs


hématopoïétiques murins en cellules érythroïdes, myéloïdes et lymphoïdes (multi-lineage
progenitor assay). En cultivant une cellule de la fraction Lin–c-Kit+Sca1+ (LSK : cellules
souches et progéniteurs) par puits dans un milieu adapté, ils ont pu analyser les cellules issues
de la différenciation du progéniteur originel. Ces expériences ont démontré qu’il existe un
progéniteur commun myéloïde-lymphoïde (PCML), érythroïde-myéloïde (PCEM), un
progéniteur bipotent myéloïde-lymphoïde T (PMT) et myéloïde-lymphoïde B (PMB).
Contrairement au modèle classique qui propose l’existence d’un PCL, ce type de progéniteur
n’a pas été observé lors de leurs expériences 11,15. De plus, l’étude de la population LSK Gfp+
issue de souris exprimant la gfp sous le contrôle du promoteur de Rag1 (expression restreinte
aux lymphocytes) a confirmé qu’une fraction de ces cellules se différenciait en cellules
myéloïdes 16.

15
CFU-E Globules
rouges
EPO

Cellule souche
pluripotente

CFU- CFU-MK
Plaquettes
GEMM
TPO
Progéniteur
multipotent

CFU-M Monocytes
M-CSF
CFU-GM

GM-CSF
CFU-G Granulocytes
G-CSF

Cellules souches Progéniteurs Précurseurs Cellules matures

Figure 4 : Schéma de la myélopoïèse. Les facteurs solubles spécifiques de chaque type


cellulaire sont indiqués.

Microenvironnement hors niche Interface Niche

CSH quiescente
Signaux extrinsèques de 
différenciation

Cellule stromale Cellule de la niche spécialisée

Figure 5 : Principe de la niche hématopoïétique. Les CSH sont maintenues en quiescence


dans la niche. Après division asymétrique, les cellules quittent la niche et sont soumis à des
signaux extrinsèques qui influencent leur engagement dans la différenciation. D’après Wilson
et al. 2

16
Comme chez la souris, l’hématopoïèse humaine ne suit pas strictement le schéma
classique. Plus récemment, Doulatov et al. ont démontré que les cellules caractérisées par le
phénotype : CD34+CD38−CD90neg–loCD45RA+ correspondaient à des progéniteurs capables
de se différencier en cellules lymphoïdes B et T ainsi qu’en monocytes et macrophages 17.

B. La myélopoïèse
La myélopoïèse est l’ensemble des processus de prolifération et différenciation qui
permettent d’aboutir à l’obtention des cellules hématopoïétiques matures à l’exception des
lymphocytes. Ces processus nécessitent une régulation fine de l’expression de facteurs de
transcription majeurs, faisant intervenir des cytokines spécifiques de l’engagement dans
chaque lignage ou communes pour la prolifération des cellules.

La différenciation myéloïde est bien caractérisée car elle ne nécessite pas l’utilisation
d’un stroma et ainsi peut être facilement étudiée in vitro grâce au CFC assay. Lors de ce test,
les progéniteurs sont capables de former des colonies (Colony Forming Cell : CFU) de
morphologie particulière suivant le lignage. Les cellules les plus progénitrices forment les
CFU-Granulocyte Erythrocyte Monocyte Megacaryocyte (CFU-GEMM) qui sont des
colonies mixtes multipotentes correspondant au progéniteur commun myéloïde. Au fur et à
mesure de la différenciation, ces cellules perdent leur multipotence et s’orientent vers un type
cellulaire défini. Ainsi, les CFU-GEMM se différencient en CFU-Erythrocyte (CFU-E),
CFU-Mégacaryocyte (CFU-MK) et CFU-Granulocyte Monocyte (CFU-GM) à l’origine des
CFU-Granulocyte (CFU-G) et CFU-Monocyte (CFU-M) (Figure 4). Ces différents
progéniteurs unipotents se différencient en précurseurs par des étapes de maturation
successives faisant intervenir un réseau de facteurs de transcription et de facteurs solubles.

1. Les facteurs de régulation

a) Les facteurs extrinsèques

Les facteurs extrinsèques qui régulent l’hématopoïèse sont retrouvés dans le


microenvironnement médullaire formant la niche hématopoïétique (Figure 5). Cette dernière
est constituée de divers types cellulaires qui procurent aux CSH des chimiokines, permettant
de les attirer vers cet environnement ainsi que des cytokines, impliquées dans la survie, la
prolifération et la différenciation. De plus, les CSH établissent des interactions cellulaires
avec cette niche via des molécules d’adhésion spécifiques.

17
Figure 6 : Facteurs solubles impliquées dans la différenciation. IL : Interleukine, GM-
CSF : Granulocyte-macrophage-colony stimulating factor, M-CSF : Macrophage- colony
stimulating factor , G-CSF : Granulocyte - colony stimulating factor , Tpo : Thrombopoïétine,
Epo : Erythrpoïétine. D’après Brown et al.18

18
(1) Les cellules stromales

La moelle osseuse est constituée de cellules hématopoïétiques et de cellules stromales


qui peuvent être des fibroblastes, des adipocytes, des cellules endothéliales et des
ostéoblastes. Parmi les composants critiques de la niche hématopoïétique, nous pouvons citer
les ostéoblastes qui forment la niche endostéale. En effet, la déplétion de ces cellules chez la
19
souris entraîne une diminution des CSH dans la moelle osseuse . Le rôle des ostéoblastes
passe par l’expression de molécules d’adhésion comme la N-cadhérine 20, et par leur capacité
à secréter des facteurs solubles tels que l’angiopoïétine et Jagged-1 qui sont respectivement
associés à la quiescence et au blocage de différenciation des CSH 21,22.
De plus, la présence d’un grand nombre de CSH au contact des cellules endothéliales
formant les sinusoïdes de la moelle osseuse suggère l’existence d’une niche hématopoïétique
dite vasculaire 23. En effet, ces cellules permettent in vitro de cultiver des CSH 24. Dans cette
niche, les CSH seraient moins quiescentes que celle retrouvées dans la niche endostéale et
serviraient à une reconstitution rapide du tissu hématopoïétique si nécessaire.

(2) Les facteurs solubles

Les facteurs solubles impliqués dans la régulation de l’hématopoïèse regroupent les


cytokines, telles que les interleukines, les chimiokines et les Colony Stimulating Factors
(CSF) ainsi que les hormones comme l’érythropoïétine. Les cytokines sont des protéines
sécrétées qui régulent l’hématopoïèse, la réponse immunitaire et l’inflammation. Les
cytokines hématopoïétiques, après fixation sur leurs récepteurs spécifiques, activent des voies
de signalisation régulant la quiescence des CSH, leur auto-renouvellement, la différenciation
(Figure 6) et l’apoptose. Bien que certaines cytokines possèdent une ou plusieurs de ces
propriétés, la plupart d’entre elles montrent des effets additifs ou synergiques en combinaison
avec d’autres cytokines. Les facteurs solubles peuvent être sécrétés par les cellules stromales
de la moelle osseuse mais aussi par d’autres organes tels que le rein pour l’érythropoïétine.

La question soulevée par les cytokines est la suivante : sont-elles à l’origine de


l’engagement des cellules vers un type cellulaire ou régulent-elles la prolifération de cellules
déjà engagées ? Cette question trouve son origine dans l’interaction qui existe entre les
cytokines et les facteurs de transcription. En effet, ces derniers régulent la transcription des
récepteurs aux cytokines et donc la possibilité des cellules à répondre aux signaux
extracellulaires tandis que les cytokines peuvent induire des voies de signalisation aboutissant
à la transcription de facteurs de transcription. Il existe donc une boucle de régulation entre ces

19
20
deux types de molécules. A titre d’exemple, PU.1 est impliqué dans la différenciation
monocytaire et régule la transcription du récepteur au M-CSF 25.

b) Les facteurs intrinsèques

Les facteurs de transcription sont des protéines capables, via leur domaine de liaison à
l’ADN, de se fixer dans les régions régulatrices (promoteur, enhancer et silencer) de gènes
dont ils modulent la transcription. Cette régulation peut être positive et/ou négative, et passer
par les mécanismes suivants: stabiliser ou bloquer la liaison de l’ARN polymérase à l’ADN,
réguler directement ou via d’autres protéines l’acétylation ou la désacétylation des histones et
enfin, recruter des co-activateurs ou des co-répresseurs sur les complexes de transcription.

Tous ces facteurs sont composés de plusieurs domaines fonctionnels : les domaines de
liaison à l’ADN qui sont de divers types tels que le domaine leucine zipper, hélice-boucle-
hélice, hélice-tour-hélice et doigt de zinc; le domaine de trans-activation et/ou de répression
qui recrute des co-facteurs ou qui interagit directement avec la machinerie transcriptionnelle
pour réguler la transcription.

Durant la myélopoïèse, la balance entre les différents facteurs de transcription va


permettre l’engagement vers une lignée définie. Leur expression doit être finement régulée
dans le temps. En effet, il a été démontré en modèle murin que leur ordre d’expression est
déterminant pour l’engagement et la maturation des cellules 26. L’engagement dans un lignage
implique l’activation de gènes spécifiques concomitants à une inhibition d’un ensemble de
gènes intervenant dans les autres lignages. Ce phénomène est contrôlé en partie par un
nombre restreint de facteurs de transcription qui se régulent entre eux.

GATA1, MYB, PU.1 et C/EBPα sont ces facteurs de transcription impliqués dans la
myélopoïèse. Leur importance est démontrée par l’effet de leur invalidation par
recombinaison homologue dans des souris (Knock-out ou KO). Ils sont également liés à une
myélopoïèse pathologique lorsqu’ils sont mutés. Nous reviendrons sur ces mutations plus loin
dans ce manuscrit. Un éclairage particulier sera apporté sur les facteurs de transcription MYB
et GATA1 car ils sont impliqués dans la translocation étudiée lors de cette thèse.

21
1 413
ZnF
ZnF

GATA1 AD

Figure 7 : Structure de la protéine GATA1. AD: domaine d’activation, ZnF : doigt de zinc.

22
(1) GATA1

9 Structure

La protéine GATA1 fait partie d’une famille composée de 6 facteurs de transcription


de GATA1 à GATA6. Leur caractéristique commune est la reconnaissance d’une séquence
consensus (A/T)GATA(A/G) par leur domaine de liaison à l’ADN en doigt de zinc. Cette
famille est subdivisée en deux sous-familles sur la base de leur profil d’expression. La
première est la sous-famille hématopoïétique qui comprend GATA1, GATA2 et GATA3.
GATA2 régule la prolifération des progéniteurs hématopoïétiques ainsi que la différenciation
des mastocytes 27 et GATA3 intervient pour sa part dans le développement des lymphocytes T
28
. La seconde est la sous-famille non-hématopoïétique qui regroupe GATA4, GATA5 et
GATA6 qui sont exprimés dans divers tissus dont le cœur et les organes digestifs.
Le gène GATA1, situé au niveau de la bande p11.23 du chromosome X, est composé
de 5 exons codant la protéine et deux premiers exons alternatifs correspondants à la région 5’
29
non traduite. L’exon distal est utilisé dans les testicules tandis que l’exon proximal est
30
utilisé dans les cellules hématopoïétiques .
GATA1 code une protéine de 413 acides aminés constituée d’un domaine d’activation,
d’un doigt de zinc N-terminal (N-term ZnF) et d’un doigt de zinc C-terminal (C-term ZnF)
(Figure 7).
Le domaine d’activation de GATA1, codé par l’exon 2, module le pouvoir de
transactivation de GATA1 sur ses cibles. In vitro dans des cellules non hématopoïétiques, la
délétion de ce domaine diminue le pouvoir de transactivation du mutant comparé à la forme
31
sauvage de GATA1 . Toutefois, dans la lignée érythroïde Gata1- (G1E) bloquée en
différenciation, la transfection de la protéine Gata1 tronquée lève le blocage de la même
manière que la forme sauvage, ce qui suggère que ce domaine n’est pas indispensable à son
32
rôle dans la différenciation érythroïde . En pathologie humaine, la délétion de ce domaine
suite à une mutation dans l’exon 2, est associée au développement d’hémopathies. Ces
mutations seront développées dans la partie traitant des mutations de facteurs de transcription
dans le développement de leucémies aiguës myéloïdes.
Le C-term ZnF constitue le domaine de liaison à l’ADN et assure la reconnaissance et
la fixation des facteurs GATA à leur séquence consensus. Le N-term ZnF permet quant à lui
de moduler l’activité de GATA1 et de stabiliser l’interaction de GATA1 avec l’ADN 33. Il est
capable de se lier à l’ADN sur des sites GATA palindromiques et également de médier
l’association de GATA1 avec le co-facteur Friend of GATA1 (FOG-1). Ce co-facteur est

23
Synthèse  Différenciation 
de l’hème érythroïde
Globine
GATA1 EPO‐R
MYB Prolifération 
CDK6 cellulaire
p16

BcL‐xL Apoptose

Figure 8 : Fonctions de GATA1. Schéma de l’effet de GATA1 sur les processus de


différenciation, de prolifération et d’apoptose via la régulation de l’expression de gènes
cibles.

24
essentiel à l’activité régulatrice de GATA1 lors de l’érythropoïèse et la mégacaryopoïèse
puisque la mutation V205M inhibant leur interaction est à l’origine de thrombocytopénies et
d’anémies 34.

9 Fonctions

La protéine GATA1 est exprimée dans divers types cellulaires du système


hématopoïétique et notamment dans les cellules érythroïdes primitives et définitives, les
mégacaryocytes, les éosinophiles, les mastocytes mais aussi dans les testicules au niveau des
cellules de Sertoli. Durant l’hématopoïèse, GATA1 est impliquée dans la régulation des
processus de différenciation, de prolifération et de survie de certaines sous-populations
cellulaires (Figure 8).
Tout d’abord, GATA1 a été identifiée dans la lignée érythroïde comme une protéine
35
se fixant à l’enhancer de la β-globine humaine . Par la suite, des invalidations ciblées du
gène Gata1 ont permis de mettre en évidence son rôle crucial dans l’érythropoïèse. En effet,
les embryons de souris Gata1null meurent au jour E10.5-11.5 d’une anémie sévère par défaut
d’érythropoïèse primitive. Les cellules de cette lignée sont bloquées au stade précoce de
36
proérythroblaste . Le même phénotype est observé chez des souris mâles homozygotes
Gata1G105Y où l’invalidation de Gata1 partielle (Knock-down ou KD) induit une expression de
37
Gata1 équivalente à 5 % de l’expression normale . L’étude in vitro des cellules souches
null G105Y
embryonnaires (cellules ES) ES Gata et Gata1 en co-culture avec des cellules
stromales OP9, qui permettent la différenciation primitive et définitive, a mis en évidence les
fonctions de Gata1 dans les cellules érythroïdes. En effet, en l’absence de Gata1, les cellules
sont bloquées au stade de proérythroblastes et un taux élevé d’apoptose est observé. A
contrario, en présence d’un faible taux de Gata1 (5%) les cellules bloquées au même stade
ont une prolifération accrue 38. Ces effets sont notamment dus à des modulations de l’activité
des protéines p16INK4A et Bcl-xL, régulateurs bien décrits des mécanismes de prolifération et
d’apoptose.
GATA1 joue donc un rôle essentiel durant l’érythropoïèse et notamment sur la
différenciation. Il permet l’engagement des progéniteurs vers la lignée érythroïde en régulant
l’action de PU.1. Effectivement, GATA1 et PU.1 se lient, ce qui entraine une régulation
négative mutuelle par séquestration réciproque : PU.1 inhibe la fixation de GATA1 sur les
39
promoteurs de ces gènes cibles et GATA1 empêche l’interaction de PU.1 avec son co-
activateur c-Jun 40. Cette régulation permet d’engager les cellules vers une différenciation soit

25
26
érythro-mégacaryocytaire, soit granulo-monocytaire en fonction des taux d’expression de
chacun.
D’autre part, GATA1 contrôle également la différenciation terminale des érythrocytes.
Cet effet passe par la régulation de la transcription de gènes spécifiques de la lignée
érythroïde tels que les enzymes permettant de produire l’hémoglobine ou encore le gène de la
globine 41. De plus, il régule l’expression de GATA2 dans les progéniteurs hématopoïétiques
en se fixant sur des sites GATA présents dans sa région 5’ ce qui entraine une diminution de
42
sa transcription . Durant toutes ces étapes, GATA1 est capable de s’auto-réguler afin de
maintenir son expression en se fixant sur des sites GATA situés dans son promoteur après
43,44
dimérisation via son N-term ZnF . De plus, son activité transcriptionnelle peut être
modulée par des interactions avec des co-facteurs comme CBP (CREB Binding Protein)/P300
45
.
En parallèle, GATA1 module la prolifération et la survie. Tout d’abord, GATA1
régule l’expression du gène codant le récepteur à l’EPO, un facteur de croissance majeur des
cellules érythroïdes impliqué dans leur survie 46. GATA1 influence la prolifération en régulant
négativement la transcription de gènes impliqués dans le cycle cellulaire comme CDK6 ou de
gènes mitogènes comme MYB 47. Enfin, l’apoptose est inhibée par GATA1 via l’induction de
l’expression du facteur anti-apoptotique BcL-xL.
48
Une étude par Chromatin Immuno Precipitation-Sequencing (ChIP-Seq) sur une
lignée murine d’érythroleucémie a permis de mettre en évidence le nombre important de
gènes régulés par Gata1. Cette étude a confirmé que les gènes régulés positivement par Gata1
participent, entre autre, à la biosynthèse de l’hémoglobine ou font partie de la voie de
signalisation Ras/GTPase. Les gènes associés au cycle cellulaire quant à eux font partie des
gènes régulés négativement par Gata1. Enfin, Gata1 régulerait négativement certaines cibles
durant l’érythropoïèse par induction de l’expression de deux microARN : miR-144 et miR-
451 49.
D’autre part, GATA1 joue un rôle important dans la mégacaryopoïèse. En effet,
l’invalidation ciblée de Gata1 dans la lignée mégacaryocytaire entraîne une diminution de la
production de plaquettes liée à un défaut de différenciation associé à une prolifération accrue
50
de mégacaryocytes immatures . L’activité de GATA1 n’est pas seulement requise pour la
différenciation érythro-mégacaryocytaire. Par exemple, lors du développement des
éosinophiles, la délétion d’un site GATA dans le promoteur Gata1 chez des souris provoque
une incapacité à produire des éosinophiles matures et fonctionnels 51. De plus, dans un modèle
de progéniteurs hématopoïétiques de poulet transformés en myéloblastes par l’oncogène Myb-

27
Figure 9 : Structure du gène MYB. La séquence d’atténuation est représentée par une étoile.
Les exons alternatifs sont représentés en gris. D’après Zhou et al. 52

28
Ets, l’expression forcée de Gata1 à un niveau intermédiaire entraîne une reprogrammation des
cellules en éosinophiles et en mégacaryocytes lorsqu’il est plus fortement exprimé 53.
Concernant les mastocytes, Gata1 interviendrait dans leur différenciation terminale étant
donné que les souris Gata1low (20 % de l’expression normale) présentent des mastocytes
54,55
anormaux . GATA1 apparaît donc requis pour le bon développement de différentes
lignées myéloïdes.

(2) MYB

9 Structure

Le gène MYB a été identifié comme l’analogue cellulaire du gène v-myb des virus
AMV (Avian Myeloblastosis Virus) et E26 capable d’induire chez le poulet des leucémies
myéloblastiques et érythroblastiques respectivement. MYB fait partie d’une famille de
facteurs de transcription comprenant, MYB, AMYB et BMYB, et partageant une forte
homologie de séquence, notamment au niveau du domaine de liaison à l’ADN. Néanmoins, ils
diffèrent par leurs profils d’expression tissulaire. Ce gène, hautement conservé au long de
l’évolution 56, est majoritairement exprimé dans les cellules hématopoïétiques immatures.
Le gène MYB est situé sur le chromosome 6 au niveau de la bande q23. Le premier
intron comprend une séquence permettant l’atténuation du niveau de transcription qui apparait
critique dans la mesure où elle est mutée dans les cancers colorectaux associés à une forte
expression de MYB 57. Ce gène est composé de 15 exons avec 6 exons alternatifs (Figure 9).
L’expression et l’activité transcriptionnelle de ces 6 variants d’épissage ont été étudiés 58. Ils
possèdent le même site de liaison à l’ADN mais diffèrent par leur domaine carboxy-terminal.
Cette différence est à l’origine d’un pouvoir de transactivation différent pour chaque variant.
De plus, leur expression varie suivant le lignage mais aussi suivant le contexte pathologique
(LAM ou LAL-T). Il semblerait alors que ces variants aient un rôle dans les processus de
différenciation physiologique mais aussi lors de phénomènes de leucémogénèse. Avant cette
étude, des différences fonctionnelles entre Myb (p75) et le variant p89 avaient été mise en
évidence. En effet, les 2 isoformes p75 et p89 n’ont pas le même impact sur l’apoptose induite
par privation en IL-3 dans une lignée myéloïde murine (32Dcl3). La forme p89 retarde
l’apoptose par l’activation transcriptionnelle du glutathion-s-transférase µ contrairement à p75
59
qui accélère l’apoptose par blocage de l’expression de cette enzyme . De plus, l’isoforme
p89 n’est pas indispensable à une hématopoïèse normale contrairement à MYB 60. Une étude

29
1 DBD TAD NRD 640
acidic

LZ

MYB R1 R2 R3 TAD NRD

Figure 10 : Structure de la protéine MYB. DBD : domaine de liaison à l’ADN ; R1, R2,
R3 : répétitions ; TAD : domaine de transactivation ; acidic : domaine acide ; NRD : domaine
de régulation négative ; LZ : domaine leucine zipper.

30
récente sur des cas de LAL-B pédiatriques suggère la possible utilisation de ces variants
d’épissage comme biomarqueurs 52.
La protéine MYB de 75 KDa, est soumise à des modifications post-traductionnelles
61
telles que la phosphorylation ou l’acétylation qui modifient son activité transcriptionnelle
62
. De plus, MYB s’auto-regule grâce à la présence dans son promoteur de sites de
reconnaissance spécifiques 63.

Cette protéine est composée de trois grands domaines fonctionnels : un domaine de


liaison à l’ADN (DBD), un domaine de transactivation (TAD) et un domaine répresseur
(NRD) 64 (Figure 10).
Le premier situé en N-terminal est constitué de 3 répétitions imparfaites d’environ 50
acides aminés formant une structure hélice-tour-hélice qui reconnaît le motif t/cAACt/gG
appelé Myb Binding Site (MBS)65. Les répétitions R2 et R3 sont impliquées dans la
reconnaissance de ces sites et dans la liaison à l’ADN stabilisée par R1 66.
67
Le domaine central correspond au domaine de transactivation et contient un
domaine acide, conservé entre espèces, qui contribue au bon fonctionnement de MYB
puisqu’une mutation dans ce domaine diminue son pouvoir transcriptionnel 68. Le domaine de
transactivation assure les interactions entre MYB et ses co-facteurs, notamment le
recrutement de CBP/P300. L’insertion d’une mutation (M303V) au sein du domaine de
transactivation empêche cette liaison et annule le pouvoir transformant de MYB dans la lignée
myéloïde murine FDB–169.
Le domaine répresseur situé en C-terminal comprend un domaine « leucine zipper »
(LZ) intervenant dans la régulation transcriptionnelle négative par MYB de ces gènes cibles
70
. Ce domaine LZ permet l’homodimérisation de MYB, mécanisme qui empêche la fixation à
l’ADN des dimères et induit des phénomènes de compétition avec les monomères de MYB à
71
travers le recrutement des mêmes co-facteurs . L’importance du domaine de régulation
négative dans la protéine MYB a été largement étudiée par l’intermédiaire d’analyses
fonctionnelles de formes tronquées de MYB. Tout d’abord, la délétion de ce domaine entraîne
72
une augmentation de l’activité transcriptionnelle , ce qui est aussi observée pour le variant
58
d’épissage MYB 9A . De plus, ces formes tronquées artificiellement ont un pouvoir
73-74
transformant . Cet effet se rapproche de celui obtenu par l’expression de v-myb qui ne
possède pas ce domaine de régulation négative.

31
Différenciation 
myéloïde 

MYB Prolifération 
cellulaire

Bcl2 Apoptose

Figure 11 : Fonctions de MYB. Schématisation de l’effet de MYB sur les processus de


différenciation, de prolifération et d’apoptose via la régulation de l’expression de gènes
cibles.

32
9 Fonctions

MYB est décrit comme un régulateur de l’hématopoïèse physiologique par son


implication dans la prolifération, la survie et la différenciation des cellules hématopoïétiques
(Figure 11). Son rôle essentiel dans l’hématopoïèse définitive a été démontré par
l’invalidation de Myb provoquant la mort in utero au jour E15.5 par défaut de développement
de la lignée érythroïde et myéloïde 75.
Son expression doit diminuer afin de permettre la différenciation des cellules
hématopoïétiques en cellules matures. En effet, l’induction de la différenciation, par des
agents chimiques, dans la lignée d’érythroleucémie murine (MEL) et de leucémie
76,77
promyélocytaire humaine HL60, entraine une diminution de l’expression de MYB .
L’expression constitutive de Myb dans la lignée MEL ainsi que dans les lignées myéloïdes
78,79
M1 et 32Dcl3 bloque la différenciation et est associée à un maintien de la prolifération
80
dans le cas de la lignée M1 . Dans la lignée promyélocytaire HL-60, l’utilisation d’un ARN
anti-sens dirigé contre l’ARNm de MYB diminue leur prolifération et ces cellules se
81
retrouvent dans l’incapacité de se différencier en granulocytes . Le blocage de
différenciation dans la lignée MEL peut se faire par une forme tronquée ne comprenant pas le
NRD 82.
Il semblerait que cette capacité de MYB à bloquer la différenciation soit spécifique du
lignage puisque dans la lignée K562, la différenciation érythroïde est bloquée tandis que la
83
différenciation mégacaryocytaire n’est pas affectée . Enfin, la délétion conditionnelle de
Myb dans des souris a permis de mettre en évidence son implication dans la différenciation
des lymphocytes B et T 84,85.
Le facteur de transcription MYB régule la prolifération par l’intermédiaire de ses
gènes cibles comme MYC, KIT et Cycline B1 (CCNB1) 86. De plus, il est impliqué dans l’auto-
renouvellement des cellules souches multipotentes et des progéniteurs communs lymphoïdes
et myéloïdes. Cet effet a été validé par modèle murin d’invalidation conditionnelle de Myb qui
montre une diminution de l’auto-renouvellement des cellules souches accompagnée d’une
accélération de la différenciation 87.
Une étude récente par ChIP-Seq dirigée contre Myb a permis de montrer l’importance
de ce facteur de transcription à travers la mise en évidence du nombre important de facteurs
de transcription qu’il est capable de réguler. Certaines cibles identifiées ou confirmées lors de
ces travaux permettent de mieux comprendre les fonctions précédemment évoquées de MYB
lors de l’hématopoïèse. En effet, Myb régule positivement les gènes Cited2 et Gfi1, tous deux

33
1 272
β3/
PU.1 TAD PEST
β4

DBD

Figure 12 : Structure de la protéine PU.1. TAD : domaine de transactivation,


PEST : Proline (P), acide glutamique (E), sérine (S), thréonine (T); DBD : domaine de liaison
à l’ADN ; β3/β4 : région impliquée dans les interactions avec des co-facteurs.

1 358

C/EBPα TAD1 TAD2 DBD

Figure 13 : Structure de la protéine C/EBPα. TAD : domaine de transactivation ; DBD :


domaine de liaison à l’ADN.

34
88-89
importants dans le maintien de l’auto-renouvellement des CSH . En outre, Myb réprime
des régulateurs de la différenciation hématopoïétique tels que PU.1 et Aml1, expliquant le
blocage de différenciation observé lors d’un maintien de l’expression de Myb 90.

(3) PU.1

Cette protéine codée par le gène SPI1 fait partie de la famille des facteurs de
transcription à domaine de liaison à l’ADN de type ets (Figure 12). Elle est activée par
phosphorylation et interagit avec des co-facteurs tels que c-Jun et AML1.

Ce facteur de transcription intervient dans le développement des monocytes et des


lymphocytes. Le choix d’une voie par rapport à l’autre dépendrait du taux d’expression de
PU.1. En effet, une forte expression dans des cellules Lin– murines PU.1-/- favorise la
différenciation en monocytes 91. Le KO de PU.1 92 affecte le développement des granulocytes,
des macrophages, et des lymphocytes B et T, entraînant la mort par septicémie des souris en 2
jours après la naissance. Lors du maintien en vie prolongée de ces souris par traitement
antibiotique, les lymphocytes T et les granulocytes commencent à se différencier
contrairement aux lymphocytes B et aux macrophages. Ceci démontre le rôle majeur de PU.1
dans l’engagement vers ces lignages. L’importance du niveau d’expression de PU.1 a été
démontrée par invalidation partielle dans un modèle murin (20 % de l’expression normale)
qui induit le développement de LAM touchant la lignée granulocytaire qui est favorisée au
détriment des monocytes. Ce phénomène s’explique par la perte d’expression des récepteurs
93
spécifiques aux facteurs de croissance de la lignée monocytaire : M-CSF et GM-CSF . Au
contraire une haploinsuffisance n’a pas d’effet sur l’expression des récepteurs aux cytokines
G-CSF, M-CSF et GM-CSF. Néanmoins, à l’état adulte l’inactivation de PU.1 favorise le
développement de LAM 94. Le rôle de PU.1 dans la myélopoïèse est donc fortement lié à son
action régulatrice sur les récepteurs aux cytokines spécifiques des granulocytes et des
monocytes. Lors des expériences d’invalidation partielle ou totale, l’expression de ces
récepteurs a été étudiée démontrant que le phénotype observé était lié à cette expression.

(4) C/EBPα

Ce facteur de transcription fait partie de la famille des CCAAT/enhancer Binding


Protein qui sont des facteurs comprenant un domaine de liaison à l’ADN de type leucine-
zipper (Figure 13).

35
A B C

Figure 14 : Images des granulocytes matures. A : Granulocyte neutrophile, B : Granulocyte


éosinophile, C : Granulocyte basophile.

36
Dans un modèle non hématopoïétique, il a été montré qu’il était capable d’inhiber la
95
prolifération . Cette protéine exprimée dans les progéniteurs myéloïdes précoces voit son

expression augmentée lors de la différenciation en granulocytes et diminuée lors de la


différenciation monocytaire 96. Le KO de C/EBPα entraîne un blocage dans la maturation des
granulocytes sans affecter les autres lignées. Son caractère indispensable pour la
différenciation des granulocytes est dû à sa capacité de réguler un gène cible clé dans ce
processus : le récepteur au G-CSF 97. En effet, l’invalidation de ce gène provoque un blocage
précoce des cellules qui ne répondent pas au G-CSF du fait d’une absence de récepteur à cette
cytokine.

C. Ontogénèse des granulocytes basophiles


1. Fonction des basophiles

Ces cellules appartiennent au groupe des granulocytes, comprenant les neutrophiles,


éosinophiles et basophiles (Figure 14). Les neutrophiles sont les granulocytes majoritaires et
sont capables de phagocyter les cellules. Les éosinophiles sont principalement impliqués dans
la réaction anti-parasitaire. Morphologiquement, les granulocytes basophiles sont des cellules
mononuclées de 10 à 14 µm de diamètre, avec un noyau en « brioche » et un cytoplasme
rempli de granules d’allure sombres et violacées à la coloration May-Grünwald-Giemsa
(MGG) et recouvrant partiellement le noyau. La caractéristique principale d’un granulocyte
basophile est la présence de granules cytoplasmiques contenant des médiateurs tels que
l’histamine. Ces médiateurs chimiques peuvent être sécrétés rapidement lors de la stimulation
ligand/ récepteur, de type IgE/ récepteur du fragment constant des IgE (FcεRI) ou IgG/
récepteur du fragment constant des IgG (FcγRII). Tout d’abord, ils interviennent dans les
réactions allergiques. En particulier, ils sont capables d’initier des allergies chroniques
98 99
médiées par les IgE et des chocs anaphylactiques médiés par les IgG . Les basophiles
jouent un rôle dans la régulation immunitaire en sécrétant des interleukines, l’IL-4 pour la
100
différenciation des lymphocytes T en lymphocytes T helper de type 2 ainsi que l’IL-4 et
101
l’IL-6 ensemble pour stimuler la production d’anticorps par les lymphocytes B . Malgré la
très faible représentation des basophiles, moins de 1% des globules blancs circulants, ils
jouent donc des rôles importants dans différents processus immunitaires.

37
38
2. Origine des basophiles humains

Comme toutes les cellules hématopoïétiques, les basophiles sont générés à partir de
CSH, néanmoins les progéniteurs basophiles humains ne sont pas bien définis. Plusieurs
hypothèses ont été émises les concernant, et notamment l’existence de progéniteurs communs
basophile/éosinophile (Ba/Eo), basophile/mégacaryocyte (Ba/Meg) et basophile/mastocyte
(Ba/Mast). La première hypothèse d’un progéniteur Ba/Eo est étayée par l’observation lors de
tests clonogéniques de colonies mixtes 9, par l’augmentation du nombre de granulocytes
102
basophiles et éosinophiles sans le sang après traitement par l’IL-3 ou encore par la
présence de cellule hybride Ba/Eo lors de leucémies 103. L’existence d’un progéniteur Ba/Meg
a été suggérée par l’observation de production d’histamine par des lignées
104
mégacaryoblastiques telle que UT7 . La lignée UT7 a d’ailleurs permis d’obtenir
105
l’anticorps spécifique des basophiles et des mastocytes, 97A6 . Enfin, du fait de certaines
analogies phénotypiques telles que l’expression du récepteur FcεRI, la présence de granules
métachromatiques ainsi que l’implication dans les réactions allergiques par sécrétion de
médiateurs, l’hypothèse d’un progéniteur commun entre les basophiles et les mastocytes a été
émise. L’un des arguments majeur en faveur de l’existence de ce progéniteur commun est que
la lignée basophile KU812 mais aussi les basophiles de patients atteints d’asthme ou
106-107
d’allergies expriment un marqueur de mastocytes : la tryptase . De plus, la production
d’un anticorps spécifique des basophiles et des mastocytes a permis de mettre en évidence que
les cellules CD34+97A6+ pouvaient donner des basophiles ou des mastocytes, en présence
105
d’IL-3 ou de SCF respectivement . Néanmoins, un argument va à l’encontre de cette
hypothèse. En effet, lors de l’augmentation du nombre de basophiles associée à des leucémies
myéloïdes chroniques, le contingent de mastocytes n’est pas affecté 108.
Sur le plan des stimulations cytokiniques, il ressort que l’IL-3 est centrale pour assurer
109
le bon déroulement de la différenciation des basophiles . Cependant, contrairement au M-
CSF pour les monocytes ou à l’EPO pour les érythrocytes, l’IL-3 ne semble pas avoir un
spectre d’action très spécifique dans la mesure où elle assure d’autres rôles tels que la
régulation de la prolifération des cellules souches hématopoïétiques. Une autre étude sur la
lignée myéloïde HL60 a proposé que l’IL-5 soit une cytokine spécifique des basophiles chez
l’homme 9. Enfin, les gènes spécifiques impliqués dans le processus de différenciation des
basophiles humains ne sont pas connus.

39
PEo

PGM
Ordre d’expression

PBa

PBa/Mast

PMast Dosage de c/ebpα

Figure 15 : Contrôle de la différenciation basophile par C/EBPα et Gata2. La


différenciation des basophiles fait intervenir l’expression ordonnée des facteurs de
transcription C/EBPα et Gata2 et le niveau d’expression de C/EBPα. PGM : Progéniteur
granulocyte monocyte ; PBa/Mast : Progéniteur Basophile mastocyte ; PEo : Progéniteur
Eosinophile ; PBa : Progéniteur basophile ; PMast : Progéniteur mastocytaire. D’après
Arinobu et al.110

40
3. Les basophiles murins
Dans les modèles murins, la démonstration de l’existence d’un progéniteur basophile
111
et Ba/Mast a été faite . Le progéniteur basophile retrouvé dans la moelle osseuse
correspond à la population cellulaire Lin–CD34+FcεRI+c-Kit–. Lors de ces travaux, les auteurs
ont identifié le progéniteur bipotent Ba/Mast dans la rate sur le critère d’expression élevée de
l’intégrine β7 dans la fraction Lin–c-Kit+FcγRII/III+. Ces travaux ont permis de mettre en
évidence le rôle important du facteur de transcription C/EBPα dans la différenciation des
basophiles. En effet, sa surexpression dans le progéniteur bipotent Ba/Mast induit une
différenciation en basophile tandis que son extinction induit une différenciation mastocytaire.
Cette même équipe a démontré que l’ordre et le niveau d’expression des facteurs de
transcription Gata2 et C/EBPα était critique dans l’engagement des progéniteurs vers la lignée
basophile, éosinophile ou mastocytaire (Figure 15). La surexpression de Gata2 dirige les
PGM vers la différenciation soit en éosinophiles, en basophiles ou en mastocytes. A ce niveau
d’expression de Gata2, si les PGM maintiennent le taux d’expression initial de C/EBPα, ils se
différencient en progéniteurs éosinophiles tandis que si l’expression de C/EBPα est diminuée,
ils se différencient en progéniteur commun Ba/Mast. Une fois le stade de progéniteur Ba/Mast
atteint, C/EBPα doit être ré-augmenté pour permettre la différenciation en progéniteur
basophile 26.

41
LAM avec anomalies cytogénétiques récurrentes
 LAM avec t(8;21) (q22;q22) ; AML1‐ETO
 LAM avec t(15;17) (q22;q12) ; PML‐RARA
 LAM avec inv(16)(p13.1q22) ou t(16 ;16)(p13.1q22) ; CBFB‐MYH11
 LAM avec t(9;11)(p22;q23) ; MLLT3‐MLL
 LAM avec t(6;9)(p23;q34) ; DEK‐NUP214
 LAM avec inv(3)(q21q26.2) ou t(3;3)(q21;q26.2) ; RPN1‐EVI1
 LAM (mégacaryoblastique) avec t(1;22)(p13;q13) ; RBM15‐MKL1
 Entités provisoires :   LAM avec mutation NPM1
LAM avec mutation CEBPA

LAM avec anomalies associées aux myélodysplasies
 Faisant suite à un syndrome myélodysplasique ou un syndrome myéloprolifératif/dysplasique
 Ou présentant des anomalies cytogénétiques identiques à celles des myélodysplasies
 Ou présentant une dysplasie sur > 50% des cellules d’au moins 2 lignées myéloïdes

LAM post chimiothérapie
LAM sans spécification particulière
 LAM avec différenciation minime
 LAM sans maturation
 LAM avec maturation
 LA myélomonocytaire
 LA monoblastique / monocytaire
 LA érythroïde : LA érythroïde pure
 LA mégacaryoblastique
 LA  à  basophile
 Panmyélose aiguë avec myélofibrose

Sarcome granulocytaire
Proliférations myéloïdes associées à la trisomie 21 constitutionnelle
 Myélopoïèse anormale transitoire
 LAM associée à la trisomie 21 constitutionnelle

Néoplasie dendritique plasmocytoïde blastique 

Tableau 1 : Classification OMS des leucémies aiguës myéloblastiques et hémopathies


apparentées (2008). D’après Vardiman et al.112

Figure 16 : Types d’anomalies chromosomiques.


(http://atlasgeneticsoncology.org/Educ/PolyMecaEng.html)

42
III. Les leucémies aiguës myéloblastiques
A. Classification
Au cours des étapes de différenciation et de prolifération nécessaires à la constitution
d’un tissu sanguin fonctionnel, peuvent survenir des mutations au sein d’une cellule. Elles
pourront être à l’origine d’une hémopathie maligne. Ces pathologies très hétérogènes sont
caractérisées par l’émergence d’une ou plusieurs populations de cellules immatures et/ou par
leur représentation anormale. Les leucémies aiguës correspondent à la prolifération d’une
cellule immature bloquée à un stade précoce de la différenciation. Elles sont classées en
fonction de la lignée cellulaire atteinte en leucémies aiguës lymphoblastiques (LAL) ou
myéloblastiques (LAM). L’OMS a reparti les LAM en 7 groupes selon des critères
cytogénétiques, moléculaires et morphologiques (Tableau 1).

B. Les altérations génétiques


1. Les anomalies de structure
La mise en évidence des anomalies de structure se fait par étude cytogénétique sur
chromosomes métaphasiques. Il existe beaucoup d’anomalies structurales du chromosome
répertoriées dont la translocation chromosomique fait partie (Figure 16).

a) Les translocations chromosomiques

Les translocations chromosomiques impliquent des recombinaisons illégitimes et des


juxtapositions de gènes normalement physiquement séparés. On distingue les translocations
inter-chromosomiques quand les deux fragments joints appartiennent à deux chromosomes
distincts, des remaniements intra-chromosomiques lorsqu’ils sont issus du même chromosome
(inversion, délétion). Les anomalies sont dites équilibrées lorsque qu’aucun gain ni perte de
matériel chromosomique n’est observé.
Pour qu’elles soient fonctionnelles et leucémogènes, elles doivent répondre à divers
critères tels que l’apparition de cassures double brin simultanées sur deux chromosomes dans
une même cellule et une proximité spatiale entre les régions chromosomiques impliquées. Le
contexte cellulaire dans lequel se produit la translocation doit également être pris en compte.
En effet, il est possible qu’un réarrangement dans un progéniteur lymphoïde ne donne pas lieu
à un avantage prolifératif comme il y donnerait lieu s’il était apparu dans un progéniteur
myéloïde.

43
44
L’effet d’un réarrangement chromosomique est, soit assez important pour conférer un
avantage à la cellule, soit il nécessite des évènements secondaires, additionnels, tels que des
mutations touchant un gène codant une kinase ou un facteur de transcription, c’est la théorie
des deux évènements (« two hits »). La progression de syndromes myélodysplasiques (SMD)
en LAM peut être liée à l’acquisition de mutations au niveau des gènes FLT3 et RAS dans 1/3
113
des cas . Un autre exemple est la transformation d’une leucémie myéloïde chronique
(LMC) en LAM. En effet, le premier évènement à l’origine de la LMC peut être l’expression
de BCR-ABL, et le second évènement conduisant à l’acutisation de la maladie par blocage de
la différenciation des cellules peut être l’apparition de la translocation t(7;11)(p15;p15)
(NUP98-HOXA9)114 par exemple.
Dans ces deux cas, les gènes impliqués dans ces réarrangements sont importants dans
la régulation de processus biologiques tels que la prolifération, la survie ou le cycle cellulaire.
Ils peuvent donc les moduler afin de conférer un avantage sélectif à la cellule et conduire à la
formation d’un clone leucémique. Ces gènes sont alors appelés des oncogènes. En parallèle de
ces translocations, le réarrangement conduit à une inactivation d’une copie du gène, et donc
une haplo-insuffisance, qui peut agir en coopération avec le transcrit de fusion dans les
processus de leucémogénèse. Cet effet a été démontré dans la leucémie aiguë promyélocytaire
au cours de laquelle la translocation t(15;17)(q22;q21) aboutit à la formation d’une protéine
chimérique, PML-RARα. L’haplo-insuffisance de Pml combiné à l’expression de Pml-Rarα
augmente la fréquence et diminue le temps d’apparition de la maladie in vivo115.

(1) Mécanismes de formation

Les étapes d’une translocation sont la formation de deux cassures double brin
(Double-Strand Break : DSB) sur deux chromosomes suivie d’un ré-appariement illégitime
lors du processus de réparation. L’apparition de DSB peut être observée lors des
recombinaisons V(D)J (Variable, Diversité, Jonction) qui sont des réarrangements somatiques
permettant de générer un vaste répertoire d’immunoglobulines et de récepteurs des
lymphocytes T (TCR) exprimés respectivement par les lymphocytes B et T. Ce mécanisme
fait intervenir les enzymes RAG1 et RAG2 (Recombination-Activating Gene 1 et 2). Des
accidents de recombinaison somatique peuvent être à l’origine de translocations
chromosomiques telle que la translocation t(14;18)(q32;q21) qui juxtapose le gène anti-
apoptotique BCL2 à l’enhancer des immunoglobulines conduisant à la surexpression de BCL2
dans les lymphomes folliculaires 116 .

45
46
Le rôle de la topoisomérase II dans l’apparition de DSB a été mis en évidence lors de
l’observation du développement de leucémies secondaires aux traitements ciblant cette
117
enzyme par des inhibiteurs , les plus courants étant l’étoposide, la daunorubicine et la
doxorubicine. La topoisomérase II, fortement exprimée dans les cellules cancéreuses, relâche
les boucles de l’ADN en créant des cassures temporaires qu’elle re-ligue et ainsi joue un rôle
important au cours de la réplication. Lors de l’utilisation des inhibiteurs de cette enzyme, les
cassures sont maintenues par stabilisation de l’enzyme sur les brins clivés, induisant ainsi une
entrée en apoptose des cellules cancéreuses. Néanmoins, ces molécules agissent sur toutes les
cellules, c’est pourquoi, l’apparition de translocations est observée post-traitement car les
brins clivés se retrouvent libres pour participer à la formation de translocations
chromosomiques. Ce mécanisme est confirmé par la présence des séquences consensus de
fixation de la topoisomérase II au niveau des points de cassure retrouvés dans le gène MLL
(Mixed Lineage Leukemia), gène le plus fréquemment réarrangé lors de l’apparition de
leucémies post-traitement 118.
De plus, il existe sur le génome des séquences définies comme des « hot-spots » de
recombinaison, c’est à dire, des sites fragiles plus favorables à subir des translocations. Elles
se définissent par des séquences particulières comme des sites de clivage à la topoisomérase II
118
, des régions comprenant des répétitions purine/pyrimidine 119 ou des séquences Alu 120.
Néanmoins, l’étape critique après formation de ces deux DSB est leur réparation. En
121
effet, on estime à 50 le nombre de DSB par cellule lors d’une division . Pour réparer ces
cassures, il existe deux systèmes opérant à différents stades du cycle qui sont la
recombinaison homologue (Homologous recombination : HR) et le principal mécanisme à
l’origine des translocations, la liaison des extrémités non homologues (Non-homologous end-
joining : NHEJ). Un défaut de ces systèmes peut expliquer l’apparition de translocations. La
HR, ayant lieu durant la phase S et G2/M, utilise des séquences répétées homologues pour
réparer les cassures. Or, il existe dans certaines régions chromosomiques des séquences
répétées de type Alu qui sembleraient être impliquées dans les translocations entre le gène
122 123
BCR et ABL ainsi que dans les réarrangements MLL . Le processus de NHEJ, opérant
durant la phase G0 et G1 du cycle, est réalisé à l’aide de deux complexes multi-protéiques,
l’un prenant en charge les brins clivés et les positionnant (l’ADN-protéine kinase et
l’hétérodimère Ku70/Ku86) pour que le deuxième effectue la re-ligation (ligase IV/XRCC4).
L’implication du NHEJ dans la recombinaison illégitime de deux chromosomes est révélée
par la présence au niveau du point de cassure de courtes séquences homologues 124.

47
Gène A Gène B

Gène B

Figure 17 : Principe d’une anomalie quantitative. Après réarrangement, le gène B peu ou


pas exprimé dans la cellule est sous dépendance transcriptionnelle des éléments régulateurs R
d’un gène A fortement exprimé dans cette même cellule. D’après Look 125.

Gene A Gène B

Gène AB

Figure 18 : Principe d’une anomalie qualitative. Après le réarrangement chromosomique,


le gène A et B fusionne pour donner un nouveau gène chimérique en phase sous dépendance
transcriptionnelle des éléments régulateurs R du gène situé en 5’. D’après Look 125.

48
(2) Types de translocation

(a) Celles qui génèrent une activation transcriptionnelle

Dans ce cas, les translocations conduisent à la dérégulation de l’expression d’un gène


mis sous la dépendance d’un nouvel élément de régulation comme un promoteur fort ou
constitutivement actif ainsi qu’un enhancer (Figure 17). Ce type d’anomalie est quantitatif et
entraîne une expression ectopique ou une surexpression d’une protéine normale. Ce type de
translocation est rarement observé dans les pathologies myéloïdes, hormis l’activation du
126
gène EVI1 dans les translocations impliquant la région chromosomique 3q26 , et sont
fréquentes dans les pathologies lymphoïdes. Citons pour exemple, la translocation
t(14;18)(q32;q21) retrouvée dans les lymphomes folliculaires qui juxtapose la région
régulatrice comprenant l’enhancer des immunoglobulines avec le gène anti-apoptotique BCL2
conférant ainsi aux cellules une protection accrue contre l’apoptose. Sur le même modèle, la
translocation t(8;14)(q24;q32) est à l’origine d’une surexpression du gène MYC induisant une
forte prolifération des lymphocytes B dans les lymphomes de Burkitt.
Enfin, cette anomalie n’est pas restreinte aux gènes codant des protéines, elle peut
aussi s’appliquer aux microARN. Dans notre équipe, nous avons mis en évidence la
surexpression de mir125b (x10 à x90) suite à la translocation t(2 ;11)(p21 ;q23) chez des
patients atteints de LAM et SMD. Nous avons ensuite démontré in vitro qu’une surexpression
de ce microARN dans des lignées myéloblastiques et des cellules souches humaines CD34+
était capable de bloquer la différenciation myéloïde 127.

(b) Celles qui sont à l’origine d’un gène chimérique

La deuxième conséquence d’une translocation peut être la création d’un nouveau gène,
appelé gène de fusion ou chimérique, dans le cas de la juxtaposition de deux gènes
« critiques » dans la même orientation et conservant un cadre de lecture ouvert (Figure 18).
Cette anomalie est alors qualitative. Lors de translocations réciproques et équilibrées, deux
gènes de fusion sont générés mais en règle générale, un seul est impliqué dans le processus
tumoral. La protéine chimérique correspondante peut être soit activée constitutivement dans le
cas d’une kinase, ou avoir une activité transcriptionnelle modifiée lorsqu’un facteur de
transcription est réarrangé.

49
p210
BCR ABL

Figure 19 : Structure de la forme p210 de la protéine de fusion BCR-ABL. SH : domaine


d’homologie Src, DBL : domaine d’homologie avec la protéine DBL, TK : Domaine tyrosine
kinase, Pxxp : domaine riche en proline, SLN : séquence de localisation nucléaire, DB :
domaine de liaison à l’ADN. La flèche rouge indique la jonction entre les deux protéines.
D’après www.imgt.org.
CC
CC
CC
CC

CC
CC

CC

PCM1‐JAK2
PCM1 JAK2

Figure 20 : Structure de la protéine PCM1-JAK2. CC: domaine coiled-coiled; JH2:


domaine pseudokinase; TK: domaine tyrosine kinase. La flèche rouge indique la jonction
entre les deux protéines.

50
9 Réarrangement de gène codant une kinase

La translocation la plus connue aboutissant à l’activation constitutive d’une kinase est


la t(9;22)(q34;p11) retrouvée dans plus de 90 % des cas de leucémie myéloïde chronique
(LMC) et dans environ 30 % des LAL-B de l’adulte. Cette translocation aboutit à la formation
d’un chromosome communément appelé chromosome de Philadelphie, décrit par Nowell et
Hungerford en 1960. Ce réarrangement est à l’origine de la création d’une protéine de fusion
BCR-ABL1 128. Le point de cassure au niveau du gène BCR peut être différent et générer trois
formes de protéine de fusion nommées p190, p230 et p210 majoritaire dans les LMC (Figure
19). La partie comprenant BCR permet, par l’intermédiaire des domaines coiled-coiled, la
dimérisation de la protéine, ce qui provoque l’activation constitutive des domaines kinases
présents sur ABL1. Cette activité kinase incontrôlée va aboutir à une dérégulation du cycle
129
cellulaire et une diminution de l’apoptose par l’intermédiaire des Rac-GTPases . Un
130
inhibiteur spécifique, l’imatinib mesylate (Glivec®) , agissant comme un inhibiteur de
l’activité tyrosine kinase en occupant la poche à ATP d’ABL, a permis d’améliorer la survie
des patients.
Un autre exemple, décrit dans le laboratoire, est la protéine de fusion PCM1-JAK2
131
retrouvée dans deux cas de LMC atypique et associée à la translocation t(8;9)(p22;p24)
(Figure 20). Cette protéine est basée sur le même modèle, c’est à dire la fusion de la partie N-
terminale de PCM1 (pericentriolar material 1) impliqué dans l’assemblage des protéines du
centrosome et contenant des domaines coiled-coiled avec la tyrosine kinase JAK2. Ces
domaines coiled-coiled sont probablement à l’origine de la capacité de cette protéine à se
dimériser et à activer le domaine tyrosine kinase de JAK2 auquel elle est fusionnée.

9 Réarrangement de gène codant un facteur de transcription

Ce type de réarrangement est à l’origine de la formation de facteurs de transcription


chimériques ayant des propriétés modifiées. Ils peuvent être classés en deux familles, ceux
ayant un effet de dominant négatif ou ceux ayant un effet d’activateur transcriptionnel.

51
AML1‐ETO
AML1 ETO

Figure 21 : Structure de la protéine de fusion AML1-ETO. La flèche rouge indique la


jonction entre AML1 et ETO. Le domaine Runt d’AML1 correspond au domaine de liaison à
l’ADN. ETO est composé de trois domaines riche en proline et de deux doigts de zinc. La
flèche rouge indique la jonction entre les deux protéines. D’après www.imgt.org.

PML‐RARα
PML RARα

Figure 22 : Structure de la protéine PML-RARα. La partie PML est constituée d’un


domaine riche en proline, de trois doigts de zinc et d’un motif coiled-coil. La flèche rouge
indique la jonction entre les deux protéines. D’après www.imgt.org.

52
Facteur de transcription chimérique dominant négatif
- AML1–ETO
La translocation t(8;21)(q22;q22), retrouvée dans 10 % des cas de LAM, génère un
132
gène de fusion AML1–ETO (Figure 21). En condition physiologique, le facteur de
transcription hétérodimérique Core Binding Factor (CBF) est composé d’une sous unité α,
AML1, AML2 ou AML3 et d’une sous unité β, CBFβ. La liaison à l’ADN ainsi qu’à CBFβ
est assuré par l’intermédiaire du domaine Runt porté par AML. Lors de ce réarrangement, le
domaine de liaison à l’ADN d’AML1 est fusionné au répresseur transcriptionnel, ETO. La
protéine correspondante conserve la capacité de former le complexe CBF et de se lier à ces
133
gènes cibles, pouvant ainsi entraîner une répression transcriptionnelle . De plus, AML1–
ETO peut agir directement sur des protéines en s’y liant, comme à PU.1 par exemple, ce qui
entraîne dans ce cas le déplacement du co-activateur c-Jun et ce qui diminue ainsi son activité
transcriptionnelle. Elle peut aussi se lier à C/EBPα bloquant par ce biais son auto-régulation et
par conséquent limitant son taux d’expression 134-135. Ces mécanismes d’action d’AML1–ETO
concourent au développement des LAM. Néanmoins, l’expression d’AML1–ETO dans des
souris adultes n’est pas suffisante pour générer une leucémie aiguë 136.

- PML–RARα
La protéine de fusion PML–RARα (Figure 22) est exprimée dans 95 % des cas de
leucémies aiguës promyélocytaires associées à la translocation t(15;17)(q22;q12). PML, pour
promyelocytic leukemia, code une protéine localisée au niveau de corps nucléaires et ayant un
137
effet suppresseur de tumeur, par son implication dans les processus d’apoptose . Le gène
RARα (récepteur à l’acide rétinoïque) code un récepteur nucléaire dépendant de la présence
d’acide rétinoïque (ATRA). En absence d’ATRA, il est associé à des co-répresseurs
transcriptionnels alors qu’en sa présence, il s’associe avec des co-activateurs
transcriptionnels138.
La protéine chimère PML–RARα bloque la fonction de RARα comme celle de PML.
Effectivement, PML–RARα agit comme un dominant négatif sur RARα, en bloquant la
139
différenciation des cellules hématopoïétiques au stade de promyélocyte . L'expression de
PML–RARα conduit à la perte de la localisation de PML au niveau des corps nucléaires par la
formation d'hétérodimères PML–RARα–PML. La perte cette localisation spécifique de PML
au sein du noyau serait associée à une incapacité à bloquer la prolifération. Ainsi, la maladie
aurait deux facettes : l’inhibition de la différenciation (liée à un effet dominant négatif sur
RARα) et l’induction de la prolifération (liée à une perte du contrôle assuré par PML sur la

53
Figure 23 : Structure de la protéine PAX5–ELN. PBD : domaine Paired box;
OCT :octapeptide ; NLS : signal de localisation nucléaire ; HD : homéodomaine. La flèche
rouge indique la jonction entre les deux protéines. D’après Bousquet et al.140.

HD
FG

FG

FG
FG
FG

NUP98‐HOXA9 
NUP98 HOXA9

Figure 24 : Structure de la protéine NUP98–HOXA9. FG : FG domaine ; HD :


homéodomaine. La flèche rouge indique la jonction entre les deux protéines.

54
croissance cellulaire). Le traitement par l'acide rétinoïque induit la différenciation des cellules
leucémiques et provoque la dégradation de PML-RARα 141. Cette dégradation est associée à la
reformation des corps nucléaires PML. En association avec la chimiothérapie, l’acide
rétinoïque permet de guérir environ 93 % des leucémies aiguës promyélocytaires 142.

- PAX5–ELN
Notre laboratoire a caractérisé, dans 2 cas de LAL-B adultes, la translocation
140
t(7;9)(q11;p13) . Cette translocation isolée, équilibrée et récurrente, fusionne l’exon 7 du
gène PAX5 à l’exon 2 du gène de l’élastine (ELN) conduisant à la juxtaposition du domaine
de liaison à l’ADN de PAX5 avec la quasi-totalité de ELN (Figure 23). Le gène ELN localisé
en 7q11.2 code une protéine insoluble de la matrice extracellulaire de 72kDa qui constitue le
composant principal des fibres élastiques. PAX5–ELN a un rôle de transdominant négatif sur
la fonction de PAX5 sauvage, et interfère en particulier dans la transcription de gènes
nécessaires à la différenciation et au contrôle de la prolifération des lymphocytes B précoces.

Facteur de transcription chimérique activateur transcriptionnel


- NUP98–HOXA9
La translocation t(7;11)(p15;p15) fusionne le gène NUP98 (codant une nucléoporine),
un composant du complexe du pore nucléaire qui permet le transport bi-directionnel des
protéines et de l'ARN entre le noyau et le cytoplasme au gène HOXA9 codant un facteur de
transcription à homéodomaine. Le domaine N-terminal de NUP98, impliqué dans les
interactions protéine-protéine au pore nucléaire, et le domaine C-terminal de HOXA9,
contenant l’homéodomaine impliqué dans la fixation à l’ADN, sont conservés dans la protéine
chimère (Figure 24).
In vitro, NUP98–HOXA9 transduit dans des CD34+ induit un blocage de la
différenciation myéloïde associé à une prolifération des cellules immatures 143. Dans la lignée
myéloïde K562, NUP98–HOXA9 agit comme un facteur de transcription aberrant en activant
la transcription des gènes cibles de HOXA9 144. De plus, la transplantation de moelle osseuse
transduite par NUP98–HOXA9 dans des souris induit une LAM 145.

55
56
(3) GATA1 et MYB dans les anomalies chromosomiques

Tout d’abord, le gène GATA1 n’a jamais été retrouvé impliqué dans une translocation.
Concernant le gène MYB, peu d’anomalies chromosomiques, caractérisées d’un point de vue
moléculaire, font état de son implication. La première description, au cours d’une étude
portant sur des cas de LAL-T, a permis de mettre en évidence l’existence de duplication du
gène MYB et de caractériser la translocation t(6;7)(q23;q34) associée à des LAL-T
pédiatriques 146.
Au niveau moléculaire, ce réarrangement juxtapose les séquences régulatrices du
TCRB au locus de MYB entrainant une dérégulation de son expression. Cette translocation
n’étant pas retrouvée associée à d’autres réarrangements récurrents des LAL-T, contrairement
à la duplication de MYB, suggère que c’est un événement princeps du développement de cette
pathologie. D’après une étude sur une plus grande cohorte de patients (107), 8,4% des sujets
sont porteurs d’une duplication acquise de MYB impliquée dans le blocage de différenciation
147
des lymphocytes T . En effet, l’utilisation d’un siRNA dirigé contre MYB entraîne une
levée de ce blocage.
Le gène MYB a été retrouvé récemment impliqué dans une translocation
chromosomique générant un gène de fusion. Avant la description de Persson et al., aucune
anomalie qualitative de MYB n’avait été rapportée. Ces travaux portent sur des cas de
carcinome adénoïde kystique dont 6 d’entre eux présentent la translocation t(6;9)(q22-23;p23-
148
24) . Lors de ce réarrangement chromosomique, 11 transcrits différents ont été identifiés
dont le majoritaire est issu de la fusion de l’exon 14 de MYB avec le dernier exon du gène du
facteur de transcription Nuclear Factor IB (NFIB). Dans tous les cas, une surexpression de
MYB–NFIB est retrouvée et est associée à la surexpression des gènes cibles de MYB testés.
Cet effet serait dû à la perte du 3’UTR de MYB contenant des sites de fixation de microARNs,
149 150
tels que mir-150 et mir-15a/16-1 , suggérant une perte de régulation post-
transcriptionnelle négative de MYB.

2. Les anomalies de séquences

Les LAM sont fréquemment associées à des mutations de gènes qui sont soit isolées
ou associées à des translocations. Les gènes mutés peuvent être des proto-oncogènes ou des
gènes suppresseur de tumeurs. En effet, 40 à 50 % des patients atteints de LAM n’ont pas
d’anomalies caryotypiques visibles, le développement de ce type de leucémie peut être dû à

57
58
des mutations touchant des gènes codant des facteurs de transcription intervenant dans la
différenciation des cellules myéloïdes et/ou des gènes impliqués dans des processus plus
généraux tels que la prolifération ou la survie cellulaire. Dans ce dernier cas, il semblerait que
ces mutations soient le deuxième événement moléculaire nécessaire au développement de la
leucémie aiguë. La caractérisation de telles mutations est importante pour définir des groupes
de pronostic qui aideront à la prise en charge du patient.

a) Mutations des facteurs de transcription

Une étude portant sur 137 patients atteints de LAM a permis de mettre en évidence
pour la première fois l’existence de mutations dans le gène codant C/EBPα 151. Ces mutations
(5 délétions, 2 insertions et 4 mutations ponctuelles) retrouvées chez 10 de ces patients sont
hétérozygotes et associées à un caryotype normal pour 7 d’entre elles. Lors de cette étude, les
auteurs se sont intéressés aux patients porteurs de mutations dans la partie N-terminale de
C/EBPα. En effet, dans tous ces cas, une protéine tronquée de 30 KDa, au lieu de 42 KDa, est
produite par transcription alternative. Cette protéine tronquée conservant les domaines de
liaison à l’ADN et de dimérisation, est un dominant négatif sur la forme sauvage avec un
pouvoir transcriptionnel diminué. Enfin, l’expression de cette protéine tronquée dans la lignée
myéloïde U937 n’entraîne pas la différenciation en granulocytes matures contrairement à la
forme sauvage. C/EBPα muté peut être associé à une mutation de FLT3-ITD décrit ci après.

Un travail identique réalisé sur une cohorte de 126 patients, s’est intéressé à l’autre
152
gène clé dans les processus de différenciation myéloïde, PU.1 . Dans cette cohorte, ils ont
mis en évidence la présence de 9 patients porteurs majoritairement de mutations ponctuelles
ou de délétions hétérozygotes. Ces mutations sont retrouvées préférentiellement dans des
patients atteints de LAM-MO ou M4/5 sans association avec des anomalies chromosomiques.
Les auteurs se sont principalement intéressés aux mutations entrainant des délétions dans le
domaine de liaison à l’ADN de PU.1 dont notamment celles affectant une région spécifique,
β3β4, impliquée dans les interactions avec des régulateurs tels que c-Jun et AML1 153-154. Ces
mutations diminuent la capacité de liaison de PU.1 à l’ADN ainsi que son potentiel
d’activation sur le promoteur du gène cible du récepteur au M-CSF en présence ou non de c-
Jun et AML1. Toutefois, PU.1 aussi impliqué dans la différenciation des lymphocytes B, n’a
pas été retrouvé muté dans une étude de 64 cas de LAL-B 155.

59
60
b) Mutations fréquentes dans les LAM

Le gène le plus fréquemment muté dans les cas de LAM avec un caryotype normal est
NPM1 (50 à 60 %) 156. Il code la nucléophosmine1, une protéine ubiquitaire nucléaire faisant
la navette entre le noyau et le cytoplasme. Elle est impliquée dans l’assemblage et le transport
157
des protéines ribosomales ainsi que dans le contrôle de la duplication du centrosome . La
forme mutée de NPM1 ou NPMc se retrouve délocalisée dans le cytoplasme ainsi que la
forme non mutée par hétérodimérisation 158. La forme NPMc est préférentiellement retrouvée
156
associée à la mutation FLT3-ITD décrit ci-après . L’expression de NPMc dans des souris
159
transgéniques est à l’origine du développement d’une myéloprolifération . Néanmoins, les
mécanismes d’action moléculaires expliquant le développement de LAM chez l’homme ne
sont pas connus.
Le gène FLT3, codant un récepteur à activité tyrosine kinase, est un des plus
fréquemment touchés par des mutations dans les cas de LAM (30 à 35 %). Elles
correspondent à une duplication en tandem du domaine juxta-membranaire (FLT3-internal
domain : FLT3-ITD) 160 ou une mutation ponctuelle dans la boucle d’activation située dans le
domaine tyrosine kinase (FLT3-tyrosine kinase domain : FLT3-TKD) 161. La plus fréquente et
162
la mieux étudiée, FLT3-ITD est associée à un mauvais pronostic . Elle entraîne une
activation constitutive du récepteur tyrosine kinase 163 qui active les voies de signalisation en
164
aval (STAT5 et MAP kinase) et conduit à une prolifération accrue associée à une
protection contre l’apoptose 165.Un autre exemple de mutation activatrice est celle qui touche
les gènes de la famille RAS. Ces gènes codent des enzymes de la famille des GTPases qui
interviennent dans la transduction des signaux cellulaires permettant de moduler la
prolifération, la différenciation ainsi que la survie. Une mutation au niveau des ces enzymes
entraîne une perte de l’activité GTPase associée à une activation constitutive des voies de
signalisation en aval.
Le séquençage du génome entier d’un cas de LAM a permis de mettre en évidence la
166
présence d’une mutation au niveau du gène IDH1 (isocitrate deshydrogénase) . Ce dernier
167
comme IDH2 a été tout d’abord retrouvé muté dans les gliomes . IDH1 muté est
majoritairement associé à un caryotype normal. La mutation ponctuelle retrouvée sur ces
deux gènes entraine une modification de leur activité enzymatique résultant en une
168
augmentation du taux de 2- hydroxyglutarate . De plus, elle est associée à une
hyperméthylation de l’ADN et un blocage in vitro de la différenciation myéloïde 169.

61
A B

Figure 25 : Mutations dans le gène GATA1 et formation de GATA1 et GATA1s. A : La


position des mutations est représentée par des flèches. En haut, les insertions ou délétions et
en bas les mutations ponctuelles. B : Les deux sites de traductions de GATA1 et GATA1s
sont représentés sur l’ARNm. La structure des protéines correspondantes aux deux formes
traduites, GATA1 et GATA1s sont représentées. D’après Rainis et al. 170

62
Enfin, des mutations affectant le gène suppresseur de tumeur Wilm’s tumor 1 (WT1)
codant un facteur de transcription à doigt de zinc ont été détectées 171. Les formes mutées de
WT1 prédites correspondent à des formes tronquées de la forme sauvage ayant perdues
complètement ou en partie leur domaine à doigt de zinc.

c) Mutations de MYB et GATA1

Aucune mutation somatique dans le gène MYB n’a été rapportée dans la littérature. Le
gène GATA1, localisé sur le chromosome X, est muté dans la majorité des cas de leucémies
aiguës mégacaryoblastiques (LAMK) développées chez des patients atteints de trisomie 21
(syndrome de Down). Ces mutations de différents types se situent majoritairement dans
172
l’exon 2 du gène GATA1 créant un codon stop précoce ou à la jonction exon2/intron2
170
créant des mutants d’épissage (Figure 25A). Les conséquences sont la perte d’expression
de la protéine GATA1 sauvage et la traduction, à partir d’un site alternatif situé à la
méthionine 84 (exon 3) ou par épissage alternatif, d’une protéine GATA1 courte ou short
(GATA1s) ayant perdue son domaine d’activation N-terminal (Figure 25B). Cette forme
173
tronquée est aussi présente dans les cellules hématopoïétiques normales . GATA1s
conserve sa capacité à lier l’ADN et à fixer le co-facteur FOG1 mais son potentiel de
transactivation est réduit 172. Son implication dans le développement de la maladie est précoce
puisque cette forme est retrouvée dans les désordres myéloprolifératifs transitoires (DMT)
précédant la LAMK. De plus, son importance dans la leucémogénèse serait associée à la
trisomie 21 puisque l’expression de GATA1s seule, suite à une mutation dans l’exon 2, chez
des hommes en l’absence d’un chromosome 21 surnuméraire n’induit ni de DMT ni de
174
LAMK . Toutefois, ils sont anémiés et leurs mégacaryocytes ont une morphologie
anormale démontrant l’importance de l’expression de GATA1 pour assurer une érythropoïèse
et mégacaryopoïèse normale.

3. Les dérégulations épigénétiques


Les mécanismes de régulations épigénétiques permettent de contrôler l’expression des
gènes. Ce contrôle s’effectue à l’aide de modifications de l’ADN transmissibles et réversibles
sans changement de la séquence nucléotidique. Ces modifications sont principalement la
méthylation des cytosines, et les modifications post-traductionnelles des histones.
La méthylation des cytosines contenues dans les ilots CpG est catalysée par le groupe
des DNA méthyltransférases (DNMT). Ce groupe comporte DNMT1 qui maintient le profil

63
Figure 26 : Principe d’activation et de répression de l’expression génique par les
histones acétyltransférases (HAT) et les histones désacétylases (HDAC).

GST
Ilot CpG
Séquences
hypométhylé
répétées
hyperméthylées
Hypométhylation Hyperméthylation

Instabilité Répression
génomique transcriptionnelle
Région répétée

Méthylé

Non méthylé

Figure 27 : Implication de la régulation épigénétique dans la leucémogénèse. GST : gène


suppresseur de tumeur

64
de méthylation préexistant, ainsi que DNMT3A et DNMT3B qui ciblent les régions de l’ADN
non méthylées. La méthylation de l’ADN permet d’éteindre l’expression de gènes et de région
non codantes. La dérégulation de la méthylation de l’ADN peut donc jouer un rôle critique
dans la leucémogénèse. En effet, la diminution de l’expression par hyperméthylation de gènes
175
suppresseurs de tumeurs comme p15 (CDKN2B) , un inhibiteur de l’entrée dans le cycle
cellulaire, associée à l’hypométhylation de régions non codantes ou répétées créant de
l’instabilité génomique sont deux processus majeurs retrouvés dans le développement de
176
cancers (Figure 26). L’analyse du profil de méthylation de l’ADN d’une cohorte de 344
patients atteints de LAM a permis de mettre en évidence une hyperméthylation de leur ADN
comparé à celui de cellules CD34+ de moelle osseuse saine. De plus, les auteurs ont souligné
l’association entre des profils de méthylation spécifiques et l’expression de protéines de
fusion telles que PML–RARα ou AML1–ETO 177. Effectivement, ces protéines oncogéniques
sont capables de recruter des DNMT afin de réprimer l’expression génique 178,179.
En parallèle, les changements post-traductionnels des histones modifient la structure
de la chromatine afin d’activer ou réprimer l’expression génique (Figure 27). Les enzymes
impliquées dans ce processus sont les histones acétyltransférases (HAT) et désacétylases
(HDAC) ainsi que les histones méthyltransférases (HMT) et déméthylases (HDM).
L’acétylation des histones conduit à l’activation de l’expression des gènes par relâchement de
la chromatine tandis que la méthylation des histones peut conduire soit à une activation soit à
une répression suivant les histones et les résidus méthylés. Dans certains cas, les acteurs de la
régulation positive de l’expression génique par modification des histones, comme le gène
MLL ou CBP, sont impliqués dans des translocations chromosomiques récurrentes. En effet,
MLL code une HMT spécifique de la lysine 4 de l’histone 3 180 et CBP code une HAT. Ainsi
les translocations chromosomiques les impliquant contribuent à la leucemogénèse par
l’expression anormale de HMT et HAT modifiant la chromatine et permettant l’expression de
gènes oncogéniques.
L’importance des modifications épigénétiques observées chez les patients atteints de
leucémies aiguës, explique pourquoi la thérapeutique s’intéresse à l’utilisation d’inhibiteurs
de HDAC et de DNMT (5-azacytidine) qui sont les deux types d’enzymes clés de la
régulation de l’expression contrôlée par les modifications épigénétiques. Ces molécules sont
utilisées seules ou associées aux thérapies classiques afin de restaurer l’expression de gènes
suppresseur de tumeurs.

65
Figure 28 : Distribution des anomalies chromosomiques suivant l’âge des patients. La
répartition des réarrangements du gène MLL (MLL), de la translocation AML1-ETO (t(8;21)),
des caryotypes normaux (normal), des inversions du chromosome 16 impliquant le gène
CBFβ (inv(16)) et des autres réarrangements chromosomiques (autres) est indiquée par
groupe d’âge. D’après le Dr. Dastugue.

66
C. Les leucémies aiguës myéloblastiques pédiatriques
Les LAM pédiatriques sont rares par rapport à celle de l’adulte, leur incidence est 5
fois plus faible que celle des leucémies aiguës lymphoblastiques (15-20% des leucémies
aiguës de l'enfant)181. La proportion de patients porteurs d’anomalies chromosomiques (70-85
%) est plus importante que chez les adultes (40-47 %). Les mutations de mauvais pronostic
associées au caryotype normal sont principalement FLT3-ITD (20-25 %) et la duplication du
gène MLL, tandis que les mutations de bon pronostic touchant NPM1 sont observées dans 20
à 30 % des cas. Chez les enfants, les mêmes translocations récurrentes que chez l’adulte sont
détectées avec toutefois une distribution différente. La translocation t(8;21) est plus fréquente
que la t(15;17) et l’inv(16), tandis que les réarrangements MLL ont une plus grande fréquence,
surtout chez les enfants de moins de 2 ans où elles représentent plus de 50 % des cas de LAM
(Figure 28).

Les translocations chromosomiques à l’origine des leucémies pédiatriques


apparaissent principalement durant l’hématopoïèse fœtale. Elles peuvent initier une leucémie
mais parfois nécessitent des évènements secondaires tels que l’exposition durant la vie fœtale
à des agents cancérigènes. Les premières démonstrations de l’origine prénatale des
translocations a été faite par l’étude de jumeaux atteints de la même leucémie et porteurs du
même réarrangement chromosomique impliquant soit le gène MLL soit la translocation TEL-
182,183
AML1 dans les cellules leucémiques . L’origine prénatale des translocations peut être
vérifiée par PCR sur les cellules sanguines récoltées lors des tests de Guthrie à la naissance.
La première vérification a été faite sur deux cas d’enfants âgés de 5 mois et 2 ans atteints de
LAL associée à la protéine de fusion MLL–AF4 pour lesquels le gène de fusion dans les
184
cellules sanguines à la naissance a été amplifié . Par la suite, cette origine prénatale a été
vérifiée chez des patients porteurs de la translocation t(8;21)185.

67
Auteurs cas sexe Age Formule chromosomique
Alvarez et al. 1 M 15 mois t(3;6)(p21;q23),+8
Bernini et al. 1 F 9 mois normale
Dastugue et al. 1 M 2,5 mois t(X;6)(p11;q23)
2 M 6 mois t(X;6)(p11;q23)
Giagounidis et al. 1 M 67 normale
2 M 63 t(2,6)(q23?4;p22?3), del (12)(p11)
Ghosh et al. 1 M 7 mois normale
Kritharis et al. 1 F 82 t(6;12)(q13;p13.3),+der(12)t(6;12), +21
Kurosawa et al. 1 M nouveau né normale
Peterson et al. 1 F 9 NR
2 M 13 47,XY+21 (aq)
3 M 82 NR
4 M 28 NR
5 M 51 del 7
6 M 35 47,XY, +8, t(9;22)
7 F 26 complexe + t(9;22)
8 F 31 complexe + t(9;22)
Scolyer et al. 1 M 47 complexe
Shin et al. 1 M 72 45,XY,–7
Shvidel et al. 1 F 55 46 XX, polymorphisme chromosomique
2 F 23 normale
3 F 31 45 XX, del 8
4 M 23 47, XY, +19, t(10;11)(p13;q21)
5 F 17 46 XX, del(16)(q22)
6 F 14 NR
7 M 1 47 XY, t(16;17)(q22;q21)
8 F 72 NR
Staal-viliare et al. 1 M 73 t(9;22)(q34;q11)
Wick et al. 1 M 72 47,XY(2 cellules)
2 F 43 normale
3 M 57 normale
4 M 13 normale
Yokohama et al. 1 M 64 complexe

Tableau 2 : Récapitulatif des anomalies chromosomiques associées aux cas de LAB de


novo répertoriées dans la littérature. D’après Alvarez et al.186, Bernini et al.187, Dastugue et
al.188, Giagounidis et al.189, Ghosh et al.190, Kritharis et al.191, Kurosawa et al. 192, Peterson et
al.193, Scolyer et al.194, Shin et al.195, Shvidel et al.196, Staal-viliare et al.197, Wick et al.198.

68
D. Les leucémies aiguës à basophiles de novo
1. Généralités
La première description de LAB a été faite en 1906 par Joachim et al. Depuis 1999,
l’Organisation Mondiale de la Santé l’a reconnue comme une entité clinique. Cette
hémopathie rare (<1 % des cas de leucémies aiguës) est caractérisée par la présence d’un
contingent de blastes indifférenciés et de blastes basophiles appelés aussi basophiloblastes
188
dont les proportions respectives sont très variables d’un cas à l’autre (0 à 70 % de
basophiloblastes dans la mœlle osseuse), en général inférieur à 20 %.

D’autre part, les LAB sont distinctes par leurs origines. Il faut distinguer les LAB de
novo, des leucémies myéloïdes accompagnées d’un contingent de basophiles constitué pour la
plupart de basophiles matures. Ces dernières incluent principalement les LAM avec une
augmentation du contingent de granulocytes basophiles associées aux t(6;9)(DEK–CAN),
t(8 ;21)(AML1–ETO) ou del(12p11-13). Des leucémies myéloïdes chroniques (LMC) en
phase d’acutisation peuvent également correspondre à ce sous-groupe. Les LAB peuvent
présenter un caryotype normal ou des réarrangements chromosomiques tels que la
translocation qui fait l’objet de cette thèse, la t(X;6)(p11;q23)188, ou une monosomie 7195
(Tableau 2).

Compte-tenu du faible nombre de cas rapportés et des divers traitements appliqués, il


est difficile de conclure quant au pronostic de cette maladie. Cependant, la tendance générale
se dégageant de la littérature est plutôt celle d’une leucémie aiguë d’assez mauvais pronostic.
Concernant l’incidence dans la population, il est difficile de tirer des conclusions étant donné
le nombre de patients. D’après les cas de LAB de novo répertoriés dans la littérature, la
médiane d’âge chez les adultes serait de 53 ans. Concernant les LAB pédiatriques, elles
semblent plus fréquentes chez les nourrissons âgés de moins de 1 an.

2. Diagnostic
La LAB est une hémopathie difficile à diagnostiquer et qui, de fait, pourrait être sous
196
évaluée . Le diagnostic repose, tout d’abord, sur l’observation des cellules leucémiques en
coloration MGG. Les basophiloblastes sont des cellules d’allure immature, de taille variable
avec un cytoplasme faiblement basophile et contenant de gros grains violets foncés (Figure
29A). Dans beaucoup de cas, ces cellules peuvent avoir une allure indifférenciée et orienter le

69
B
A

Figure 29 : Images de basophiloblastes. A : coloration au MGG ; B : coloration au bleu de


toluidine (Staal-Viliaire et al.197).

Auteurs cas Marqueurs positifs Marqueurs negatifs


Alvarez et al. 1 CD13, CD34
Bernini et al. 1 CD45, CD33
Dastugue et al. 1 CD24, CD13, CD33
2 CD117 marqueurs lymphoïdes
CD13, CD15, CD3, CD64, CD123, CD25, CD34, CD117, CD14, HLA-
Ghosh et al. 1
CD45 DR, marqueurs lymphoides
Giagounidis et al. 1
2 CD33, CD34, CD38, HLA-DR CD13, CD14, CD15, CD19, CD7
CD13, CD33, HLA-DR, CD117,
Kritharis et al. 1
CD15, CD34
Shin et al. 1 CD33, CD13, CD34 TdT, HLA-DR, CD10, CD19
Shvidel et al. 1 HLA-DR, CD34, CD11 CD13, CD33, CD2, CD5, CD10,
2 HLA-DR, CD2, CD34 CD3, CD10, CD19, CD33, CD13
CD2, CD3, CD10, CD13, CD19,
3 HLA-DR
CD20, CD33, CD34, CD41
4 HLA-DR, CD33, CD34, CD7, CD4, CD8, CD13, CD19, CD10,
5 CD45 CD20, CD79a, CD3, CD43, CD68
6 HLA-DR, CD34, CD33, CD19 CD4, CD8, CD10, CD14
HLA-DR, CD34, CD33, CD41,
7 CD13, CD19
CD61, CD7, CD8, CD56
CD3, CD4, CD8, CD10, CD13,
8 HLA-DR, CD34
CD19, CD20, CD33, CD41
CD13, CD33, CD11c, CD7, CD65, CD117, CD34, HLA-DR,
Staal-viliare et al. 1
CD203c tdT, marqueurs lymphoides

Tableau 3 : Récapitulatif du phénotype des cellules de patients décrits.

Figure 30 : Ultrastructure d’un


basophiloblaste. (Shvidel et al. 196)

70
diagnostic vers une LAM avec différenciation minimale ou sans maturation. Le diagnostic
complet repose sur la morphologie, la cytochimie, l’immunophénotype et l’observation de
l’ultrastructure des cellules leucémiques en microscopie électronique199. Les signes clinico-
biologiques peuvent aider au diagnostic. En effet, les patients peuvent présenter au diagnostic
des prurits, rash cutané ou hyperpigmentation de la peau liés à un syndrome
d’hyperhistaminémie due à la dégranulation massive des blastes basophiles.

D’un point de vue morphologique, les blastes contiennent d’amples granules mises en
évidence par la coloration métachromatique au bleu de toluidine (Figure 29B). Mais, dans de
nombreux cas, les granules basophiles des cellules leucémiques ne sont pas visibles en
microscopie optique. Les cellules sont négatives aux tests de la myéloperoxydase, spécifique
des cellules myéloïdes granulocytaires, et du naphtol AS acétate estérase, spécifique de la
lignée monocytaire. Cependant, la cytochimie ne contribue pas toujours au diagnostic, car
certains de ces résultats peuvent être équivoques, et des diagnostics de LAB ont été
répertoriés avec des résultats de coloration au bleu de toluidine négatifs et des tests
myéloperoxydase positifs.

Sur un plan immunophénotypique, les études ont montré que le phénotype des cellules
leucémiques n’est pas homogène (Tableau 3). En général, elles sont porteuses des marqueurs
myéloïdes tels que CD13 et CD33. Les marqueurs étant hétérogènes, il semblerait pertinent de
réaliser le marquage CD203c spécifique des basophiles.

Enfin, lorsque que les techniques précédentes ne permettent pas de poser le diagnostic
de LAB, l’utilisation de la microscopie électronique peut être une bonne approche. L’étude de
Shvidel et al.196 a montré que dans une cohorte de 184 patients atteints de LAM avec
différenciation minimale, la microscopie électronique avait permis de mettre en évidence 8
cas de LAB non suspectés au diagnostic.

Les basophiloblastes sont composés de nombreux organites intra-cytoplasmiques,


reflet d’une importante activité métabolique. Il est possible de discerner la nature des granules
200
contenus dans les blastes . Les basophiloblastes sont composés, entre autres, de granules
théta, communes aux basophiles et mastocytes, mais ne contiennent pas de granules en
rouleaux (Figure 30).

71
72
OBJECTIFS

73
74
Les travaux antérieurs sur les LAB de novo portent essentiellement sur la description
de cas cliniques et sur les méthodes de diagnostic de la maladie. Au début de cette étude, les
événements moléculaires aboutissant au développement de cette pathologie n’étaient pas
connus. Aucune altération génétique n’avait été identifiée comme impliquée dans les
translocations chromosomiques associées aux LAB. Or, la caractérisation moléculaire des
réarrangements chromosomiques permet d’améliorer la compréhension des fonctions des
gènes impliqués. En effet, en condition pathologique le rôle crucial d’un gène est souvent
souligné. Lorsqu’un gène est réarrangé ou muté, les dérèglements associés mettent en
évidence ses fonctions régulatrices sur des processus impliqués dans la leucémogénèse. De
surcroit, les travaux portant sur l’identification des gènes réarrangés dans les translocations
chromosomiques ont permis d’améliorer le diagnostic, de préciser le pronostic ainsi que
d’orienter le traitement. Dans ce cas, la caractérisation moléculaire de nouvelles translocations
pourrait servir à améliorer la prise en charge du patient. Par ailleurs, l’ontogénèse de
basophiles étant peu connue, et notamment le ou les gènes spécifiquement impliqués dans
l’engagement des cellules dans ce type cellulaire, l’identification des gènes réarrangés dans
cette pathologie pourrait contribuer à une meilleure compréhension des voies de
différenciation de la lignée basophile.

Ce projet de thèse avait pour objectif d’étudier quatre cas de LAB de novo porteurs
d’une même translocation t(X;6)(p11;q23). Deux cas, inclus dans notre étude, avaient été
décrits il y a quelques années par le Dr. Dastugue, sans étude moléculaire des réarrangements
chromosomiques. C’est l’ajout de deux nouveaux cas présentant la même translocation et le
même tableau clinique qui a relancé cette étude. En effet, notre projet permet de décrire pour
la première fois une translocation récurrente dans cette pathologie rare qu’est la LAB et ainsi
définir une nouvelle entité clinico-pathologique. Par ailleurs, la détermination des gènes
impliqués dans ce réarrangement pourrait mettre en évidence leur importance dans
l’ontogénie des basophiles. Enfin, à travers l’étude de ce réarrangement dans des LAB, nous
pourrions proposer un modèle des mécanismes oncogéniques impliqués dans cette pathologie.

75
76
RESULTATS

77
78
Identification of a transforming MYB-GATA1 fusion
gene in acute basophilic leukemia:
a new entity in male infants

Cathy Quelen, Eric Lippert, Stephanie Struski, Cécile Demur, Gwendoline

Soler, Nais Prade, Eric Delabesse, Cyril Broccardo, Nicole Dastugue,

François-Xavier Mahon et Pierre Brousset.

Blood. 2011;117(21):5719-5722

79
80
SUPPLEMENTAL DATA

Supplemental Materials and Methods


Case reports.

Patients P1 and P2: Both patients presented at diagnosis with similar clinical signs consistent

with a hyperhistaminemia syndrome and acute basophilic leukemia associated with a

chromosomal translocation t(X;6)(p11;q23). We reported both cases previously1.

Patient P3: A three-month-old boy was admitted to hospital with diarrhea, vomiting and fever.

Examination revealed diffuse erythema, hepatomegaly and splenomegaly. The cerebrospinal

fluid was normal. Analyses of the blood showed anemia (hemoglobin: 6g/100mL),

thrombocytopenia (42 000/mm3) and hyperleukocytosis (53 000/mm3) due to the presence of

77% blast cells (indicative of acute leukemia). Bone marrow smear confirmed this diagnosis

of acute leukemia; the nucleated cells were large blasts with a high nucleocytoplasmic ratio,

intensely basophilic cytoplasm (sometimes containing vacuoles), and, often, large purple

granulations revealed by May-Grunwald-Giemsa (MGG) staining and metachromatic with

toluidine blue staining. The blasts were negative for the myeloperoxidase reaction but positive

for the markers of myeloid lineage, CD13, CD33 and CD117 (CD34-). The karyotype at

diagnosis, showed a rearrangement between chromosomes X, 6 and 12:

46,Y,der(X)t(X;12)(p21;q23)t(X;6)(q28;q23),der(6)t(X;6)(q28;q23),del(12)(q23)[18]/46,XY[

6]. Rapid treatment first with corticoids followed by a combination of aracytin and

anthracyclin according to the ELAM02 protocol (aracytine, mitoxantrone and methotrexate)

produced prompt regression of the symptoms and complete remission has been obtained. The

remission persists after 2 years of follow-up.

Patient P4: A 5-week-old boy was admitted to hospital with fever and vomiting. Physical

examination revealed generalized erythema and substantial hepatosplenomegaly. Blood

analysis revealed anemia (8.3g/100mL), thrombocytopenia (84 000/mm3) and

hyperleukocytosis (125 000/mm3) with 87% blast cells. The bone marrow smear showed 84%
blast cells with a high nucleocytoplasmic ratio, fine and nucleolated chromatin, and a small

ring of intensely basophilic cytoplasm. A quarter of the blasts displayed fine granulations.

None of these was positive for myeloperoxidase activity. The immunophenotype confirmed

the myeloid nature of the blasts (CD33+) with positive CD24. The karyotype showed 46,XY

t(X;6)(p11;q23). After aracytin–daunorubicin based chemotherapy, complete remission was

achieved and, after intrafamilial hematopoietic stem cell transplantation (from a brother), has

persisted during 12 years of follow-up.

Fresh and frozen samples from patients P1 and P2 have been obtained after informed consent

and stored at the HIMIP collection. According to the French law, HIMIP collection has been

registered by the Ministry of Higher Education and Research (DC 2008-307 collection 1) and

obtained a transfer agreement (AC 2008-129) after approval by the “Comité de Protection des

Personnes Sud-Ouest et Outremer II” (ethical committee). Clinical and biological annotations

of the samples have been approved by the CNIL (Comité National Informatique et Libertés

i.e. Data processing and Liberties National Committee). Samples from patient 3 and 4 have

been obtained from the tumor bank of the Centre Hospitalier Universitaire Bordeaux

(Declared to the Ministry of Higher Education and Research).

FISH. Cytogenetic analysis of diagnostic bone marrow samples was performed by standard

methods as previously described 2. As probes for the MYB and GATA1 genes, we selected the

BAC and fosmids clones (Supplemental Figure 1) by using the Human Genome Browser

Gateway (http://genome.ucsc.edu/cgi-bin/hgGateway/). The probes were labeled by nick

translation with dUTP-SpectrumOrange or dUTP-SpectrumGreen (Abbott). We mapped the

breakpoints on chromosome X and 6 by using high-resolution multicolour banding (mBAND)

FISH according to the manufacturer’s instructions (Metasystems).

RACE. Total RNA was extracted according to the Trizol method (Invitrogen). One

microgram of total RNA from each patient (P2, P3 and P4) was reverse-transcribed into

cDNA by using an oligo dT-anchor primer (5’/3’ RACE Kit, 2nd Generation; Roche). This

cDNA product was used as a template for PCR by using the BD Advantage 2 PCR Enzyme
System (BD Biosciences), the PCR anchor primer and a MYB-specific forward primer,

MYB1F (Supplemental Table 2). PCR was carried out in a GeneAmp PCR system 9600

(Perkin Elmer) with the following cycling parameters: 94°C initial denaturation for 1 min, 1

cycle of 94°C for 30 s, 64°C for 30 s, 68°C for 40 min, 35 cycles of 94°C for 30 s, 64°C for

30 s, 68°C for 5 min and a final extension of 68°C for 10 min. The PCR product was purified

by using the QIAquick Gel Purification Kit (Qiagen) and sequenced with the ABI Prism Dye

Terminator Kit (Perkin-Elmer, Applied Biosystems).

Screening of mutations. The mutational status of eight genes (FLT3, NPM1, WT1, CEBPa,

K-RAS, N-RAS, IDH1, IDH2) was analyzed by high-resolution melting (HRM) PCR. DNA

mutation screening of FLT3-TKD exon 20, IDH1 and IDH2 exon 4, N-RAS and K-RAS exons

2 and 3, WT1 exons 7 and 9 was performed by HRM with the use of LightCycler 480 (Roche

Applied Science) in High Melting Resolution Master Mix 1X (Roche Applied Science) with

10 ng of genomic DNA, 0.1 µmol/L of each primer (Supplemental Table 2), and 25 mmol/L

MgCl2. High-resolution melting–PCR cycling conditions were: initial denaturation at 95°C for

10 min, followed by 50 cycles at 95°C for 10 s, 63°C for 15 s, and 72°C for 25 s. The melting

curve was measured from 72°C to 95°C with 25 acquisitions per degree centigrade. FLT3

exon 13, ITD and NPM1c mutation screening was performed by multiplex PCR using Gold

Taq DNA polymerase (Applied Biosystems). PCR products were analyzed on a sequencer by

using sizing fragment analysis. CEBPA screening was performed according to Pabst et al.3.

Cloning of MYB-GATA1. Full-length MYB-GATA1 cDNA was amplified with Advantage 2

Polymerase Mix (Clontech) by using MYB-8F and GATA1-2R primers (Supplemental Table

2) and cloned in the pCR®2.1 vector (TA cloning kit, Dual Promoter, Invitrogen). After

cleavage of the PCR product with EcoRI or BstXI, MYB-GATA1 was cloned into the

pMSCVIresEGFP (pMIE) retroviral vector (pMIE-MG) and pcDNA3 (pcDNA3-MG)

respectively.

Preparation of lin- cells. Bone marrow cells were harvested from C57BL/6 mice aged 6–12

weeks by flushing their femurs, tibias and hips with IMDM (Invitrogen), 2% Fetal Bovine
Serum (FBS) (PAN Biotech). After lysis of red blood cells with ammonium chloride–

potassium (ACK) buffer and filtration through a 0.70 µm filter, the cells were washed and

counted. Lin- cells were obtained after two rounds of separation using the Lineage Cell

Depletion Kit (Miltenyi Biotec) to remove mature hematopoietic cells and their committed

precursor, according to the manufacturer’s instructions. Cells obtained were seeded 24 h

before transduction in untreated plates at a density of 5 x 105 cells/mL in Stemspan (StemCell

technologies), 10% FBS supplemented with 10 ng/mL of IL3, 20ng/mL of IL6 and 40 ng/mL

of SCF (Peprotech).

Retrovirus production and transduction. Cells of the packaging cell line Phoenix-Eco were

seeded at a density of 1.6 x 106 cells/6 cm plate the day before transfection. The cells were

transiently transfected with 6 µg of retroviral expression vector by using Lipofectamine 2000

Transfection Reagent (Invitrogen). The next day, cells were treated for 6 h with 10 mM

sodium butyrate and then incubated for 24 h at 32°C in IMDM containing 10% FBS. The

virus-containing supernatant was collected and filtered through a 0.45µm filter and incubated

for 15 min with 8 µg/mL of polybrene (Sigma Aldrich). Lin- cells were re-suspended in this

supernatant supplemented with 10 ng/mL of IL3, 20ng/mL of IL6 and 40 ng/mL of SCF at a

final density of 106 cells/mL. The cells were plated and centrifuged for 2 h at 3000 rpm and

32°C and the medium was replaced by Stemspan, 10% FBS supplemented with 10 ng/mL of

IL3, 20ng/mL of IL6 and 40 ng/mL of SCF. The next day, the cells were transduced a second

time.

Colony-forming cell assays. Lin- cells were transduced with: pMIE or pMIE-MG. The

transduced cells were then seeded at a density of 1.5 x 104 cells in 3mL of methylcellulose

(M3434; StemCell Technologies) and 1mL of this mixture was plated in 35 mm dishes (n=3).

Twelve days later, the colonies were counted. For in vitro transforming assays described

previously 4, cells were plated at the same density as previously reported. Colonies were

scored and cells were harvested and re-plated at the same density every 7 days. Cell samples

were also harvested for further analyses (FACS analysis and MGG staining).
Cloning of the genomic breakpoints. DNA from two patients (P2 and P3) was used as a

template for PCR by using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies),

MYB-1130F primer (located at the end of exon 8) and GATA1-810R primer (located at the

beginning of exon 5) (Supplemental Table 2). PCR was carried out in a GeneAmp PCR

system 9600 (Perkin Elmer) with the following cycling parameters: 95°C initial denaturation

for 2 min, 30 cycles of 95°C for 20 s, 56°C for 20 s, 72°C for 45 s and a final extension of 5

min at 72°C . The PCR product was purified by using the QIAquick PCR Purification Kit

(Qiagen) and sequenced with the ABI Prism Dye Terminator Kit (Perkin-Elmer, Applied

Biosystems).

Western blotting. Cells of patient P2, or HeLa cells transfected with pcDNA3 or pcDNA3-

MG by using Lipofectamine 2000, were lysed with RIPA buffer and sonicated. Total proteins

were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-

PAGE) and then electrotransferred onto nitrocellulose membranes. The membranes were

blocked with a solution of 10% milk in PBST (0.1% Tween 20 in PBS) and probed with anti-

GATA1 antibody (sc-1234, Santa Cruz) or anti -actin antibody (Sigma Aldrich) and

secondary antibodies diluted in PBST 1 %. The immunoreactive bands were visualized using

the enhanced chemiluminescence (ECL) system (Perkin Elmer).

Immunolocalization. Twenty-four hours post-transfection with pcDNA3-MG, HeLa cells

were fixed with 3% paraformaldehyde for 10 minutes at room temperature. Cells were

permeabilized for 10 minutes with 0.2% Triton X-100 in phosphate-buffer saline (PBS)

containing 10 mM HEPES, 3% bovine serum albumin (BSA). Nonspecific sites were

saturated with 3% BSA and 3% FBS in the same buffer for 1 hour. The cells were incubated

for 1 hour at room temperature with anti-GATA1 antibody (sc-1234, Santa Cruz). After three

washings with PBS containing 10 mM HEPES and 3% BSA, cells were incubated with Alexa

Fluor 546 labeled anti-goat antibody (Invitrogen) for 1 hour at a dilution of 1:300 in the same

buffer. Samples were mounted in ProLong® Gold antifade reagent containing DAPI

(Invitrogen).
Quantitative RT-PCR. cDNAs were synthesized using M-MLV reverse transcriptase

(Invitrogen) according to the manufacturer’s instructions. Quantitative PCR was performed on

an ABI Prism 7000 (Applied Biosystems) using qPCR MasterMix Plus for SYBR green

(Eurogentec). Primers were designed based on the 5’ part of MYB (exons 3–5) to detect MYB

and MYB-GATA1; on the 3’ part of MYB (exons 13–15) to detect MYB; on the 5’ part of

GATA1 (exons 2–3) to detect GATA1 and on the 3’ part of GATA1 (exons 5–6) to detect

GATA1 and MYB-GATA1. The presented data correspond to the mean of 2- Ct


in three

independent reactions for the three patients (P2, P3 and P4), normalized to the human actin

gene and calibrated with two normal bone marrows.

1. Dastugue N, Duchayne E, Kuhlein E, et al. Acute basophilic leukaemia and

translocation t(X;6)(p11;q23). Br J Haematol. 1997;98(1):170-176.

2. Coyaud E, Struski S, Prade N, et al. Wide diversity of PAX5 alterations in B-ALL: a

Groupe Francophone de Cytogenetique Hematologique study. Blood;115(15):3089-3097.

3. Pabst T, Mueller BU, Zhang P, et al. Dominant-negative mutations of CEBPA,

encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia.

Nat Genet. 2001;27(3):263-270.

4. Lavau C, Szilvassy SJ, Slany R, Cleary ML. Immortalization and leukemic

transformation of a myelomonocytic precursor by retrovirally transduced HRX-ENL. Embo J.

1997;16(14):4226-4237.
Table S1
Characteristics of ABL patients with t(X;6)(p11;q23) translocation

Patient Sex Age % Karyotype at diagnosis / Mutation


(wks) blast Karyotype revised after FISH analysis (BACs, Fosmids and mBAND)

P1 M 10 80 46,Y,t(X;6)(p11;q23)[40]/46,XY[1] ND

der(X)(6qter 6q24::6q23::Xp11 Xq13::6q22q23::Xp11 Xp22::Xq24::Xp22 Xpter),


der(6)(6pter 6q22::Xq28 Xq25::Xq23 Xq13::Xqter)
P2 M 24 89 46,Y,t(X;6)(p11;q23)[29]/46,XY[1] K-RAS
(G12S)
no material available

P3 M 12 77 46,Y,der(X)t(X;12)(p21;q23)t(X;6)(q28;q23), der(6)t(X;6)(q28;q23), No mutation


del(12)(q23)[18]/46,XY[6]

der(X)(12qter 12q23::6q22 6q23::Xp11 Xq28::Xp11 Xpter),


del(6)(q21q23),del(12)(q23)
P4 M 5 87 46,Y,t(X;6)(p11;q23)[16]/46,XY[13] ND

der(X)(6qter 6q24::6q23::Xp11 Xq23::Xq25 Xqter),


der(6)(6pter 6q23::Xp11 Xp21::Xq24::Xp21 Xpter)

Biological characteristics of the patients. Revised karyotypes were established according to

the FISH results. ND, not determined. The presence of a fusion gene involving MYB was

investigated by RACE on three patients for whom nucleic acids were available (P2, P3 and

P4). For P1, the chimeric gene was determined by FISH.


Table S2
List of the primers used for screening mutations, cloning of MYB-GATA1, cloning of genomic
breakpoint and quantitative PCR.

Name Sequence (5’ 3’)


FLT3_X20_F2 TCACAGAGACCTGGCCGC
FLT3_X20_R1 TGCCCCTGACAACATAGTTGG
IDH1_X4_F1 GGCTTGTGAGTGGATGGGTAA
IDH1_X4_R2 GCATTTCTCAATTTCATACCTTGCTTA
IDH2_X4_F1 GAAAGATGGCGGCTGCAGT
IDH2_X4_R3 TGTTTTTGCAGATGATGGGC
NRAS_X2_F2 CTGATTACTGGTTTCCAACAGGTTCT
NRAS_X2_R2 TGGGTAAAGATGATCCGACAAGT
NRAS_X3_F1 TTGTTGGACATACTGGATACAGCTG
NRAS_X3_R1 CATTTCCCCATAAAGATTCAGAACAC
KRAS_X2_F4 GGCCTGCTGAAAATGACTGAA
KRAS_X2_R4 AATTAGCTGTATCGTCAAGGCACTC
KRAS_X3_F2 TCCCTTCTCAGGATTCCTACAGG
KRAS_X3_R2 ACAGGGATATTACCTACCTCATAAACATT
WT1_X7_F2 CCCTCAAGACCTACGTGAATGTT
WT1_X7_R2 GGAGCTCTTGAACCATGTTTGC
WT1_X9_F1 TAGGGCCGAGGCTAGACCTT
WT1_X9_R1 TCTCATCACAATTTCATTCCACAATA
HsNPM1_X12_F1 5’-GAAGTGTTGTGGTTCCTTAAC
HsNPM1_X12_R1FAM 5’(FAM) TGGACAACACATTCTTGGCA
FLT3_NEM_E TGGTGTTTGTCTCCTCTTCATTGT
FLT3_NEM_Qned 5’(NED) GTTGCGTTCATCACTTTTCCAA
PCR anchor primer GACCACGCGTATCGATGTCGAC
MYB-1F TAGCATGTACGAGGATGATGAGG
MYB-8F GCCATGGCCCGAAGACCCC
GATA1-2R TGTCCAGAATTCTGGCTACAAG
MYB 5’-ex 3F TATCTCCCGAATCGAACAGATG
MYB 5’-ex 5R CAAGCTCTATCACTCTCTGATC
MYB 3’-ex 13F GTGGCAGATGCACCGAATATTC
MYB 3’-ex 15R GTACTGCTACAAGGCTGCAAG
GATA1 5’- ex 2F CCAGTCTTTCAGGTGTACCCA
GATA1 5’- ex 3R TTCCATCCAGATCTTCCACGG
GATA1 3’- ex 5F AGCTACACCAGGTGAACCGG
GATA1 3’- ex 6R ACCACCATAAAGCCACCAGCT
Actin-F TCCCTGGAGAAGAGCTACGA
Actin-R AGGAAGGAAGGCTGGAAGAG
MYB-1130F GGACAGCAGGTGCTACCAG
GATA1-810R GAGTACCTGCCCGTTTACTG
RP11-104D9
RP11-905P20

G248P84467F3
G248P8806E9

100 Kb

RP11-416B14
G248P85531H11
G248P87328H10

50 Kb

Figure S1: Fosmids and BACs used to refine the karyotype of the patients.
Breakpoint site
at genomic level

MYB exon 8 GATA1 exon 5

MYB intron 8-9 GATA1 intron 4-5 MYB intron 8-9 GATA1 intron 4-5
Position on
chromosome : 135,516,674 48,651,387 135,515,673 48,651,018

Patient 2 Patient 3

Figure S2: Cloning of the breakpoint at the genomic level. We confirmed the rearrangement

of the two genes for patient P2 and P3 for whom DNA was available. These breakpoints

were distinct for P2 and P3. The shade box corresponds to an overlapping sequence

between MYB and GATA1 respective introns.


A B C
P2 - +
MYB-GATA1

-ACTIN

Figure S3: Expression and location of MYB-GATA1. (A) Western blotting with anti-GATA1

antibody confirmed the expression of MYB-GATA1 (53 kDa) in patient 2 (P2) compared with

HeLa cells transfected with pcDNA3 empty vector as negative control and pcDNA3 MYB-

GATA1 as positive control. (B) HeLa cells transfected with pcDNA3 MYB-GATA1 were

immunostained with anti-GATA1 antibody to show the nuclear localization of the protein. (C)

DAPI staining. Magnification x 630.


A PATIENT 1
Chr X der(X) 6qter

6q24
6q23.3
Xp11.23
Xp11.23 GATA1
Xq13
6q22
6q23
Xp11.3

Xp22.1
Xq24
Xp22.1
Xpter

6pter
Chr(6) der(6)

6q22.1
Xq28

Xq25
Xq23
6q23.3 MYB

Xq13
Xqter

B
LOSS

No signal
on der(6)

6
RP11-104D9

GATA1

RP11-416B14

MYB-GATA1

der(X)
MYB

20kb
C

No signal LOSS
on der(6)

G248P87328H10
6

GATA1
der(X)

G248P85531H11
G248P8806E9
MYB

der(X)
G248P84467F3

20kb

D PATIENT 3
Chr 12
Chr X der(X)
6q22
6q23.3
Xp11.23

Xp11.23 GATA1

Xq28
Xp11.23

Chr(6) der(6) Xpter

6pter

6q21
6q23.3 MYB 6q23.3

6qter
F
E

20kb
MYB

G248P84467F3
G248P8806E9
MYB

6
RP11-104D9

der(X)
der(6)
GATA1

RP11-416B14
6

GATA1

G248P87328H10
G248P85531H11
Der (6)

der(X)

der(X)
MYB-GATA1

20kb
G PATIENT 4
Chr X der(X)
6qter

Xp11.23 GATA1 6q24


6q23.3
Xp11.23

Xq23
Xq25

Xqter

Chr(6) der(6) 6pter

6q23.2
Xp11.23
6q23.3 MYB Xp21.3
Xq24
Xp21.3
Xpter

6 Der (6)
RP11-104D9

GATA1

RP11-416B14

MYB-GATA1

der(X)
MYB

20kb
I

No signal
on der(6)
6 der(6)

G248P87328H10
GATA1

G248P85531H11
G248P8806E9
MYB

der(X)
G248P84467F3

der(X)

20kb

Figure S4: FISH results in 3 patients (P1, P3 and P4): (A, D, G) Interpretation of mBAND

results. On the left, colored bars show the location of region specific paints on normal

chromosomes X and 6; breakpoints are represented by lines. On the right, the resulting

derivative chromosomes, der(X) and der(6), are schematized. (B, E, H) Results of BAC

hybridization on metaphasic chromosomes. The der(X) showed colocalization of the probes

for GATA1 (green) and MYB (red). No signal was present on the der(6) suggesting a loss of

5’ GATA1 for Patient 1. (C, F, I) Hybridization of fosmids providing further details on the

mechanism of translocation.
A B

D E

Figure S5: Phenotype of lin- cells transduced with MYB-GATA1. (A-B) Toluidine blue

staining of mouse mast cells as a positive control on the left and lin- cells transduced with

MYB-GATA1 on the right. (C) FACS analysis of cells transduced with MYB-GATA1, collected

from methylcellulose at each plating and stained with anti-Fc RIa (PE) and anti-c-Kit (PE-

Cy7). Cells remained Fc RIa -/ c-Kit -. FACS analysis of lin- cells transduced with empty

vector at plating 1 is presented as a positive control (D-E). Myeloperoxidase staining of HL60

cells as a positive control on the left and of lin- cells transduced with MYB-GATA1 on the

right. Magnification x 630.


15
14

Relative mRNA expression


13
12
11
10
9
8
7
6
5
4
3
2
1
0
ex 3-5 ex 13-15 ex 2-3 ex 5-6

MYB GATA1

Figure S6: Expression of MYB-GATA1. Expression levels of MYB, GATA1 and MYB-GATA1

in patient cells (P2, P3 and P4) compared to expression in healthy bone marrow (n=2)

arbitrarily set as 1 for each condition. The data are normalized against actin expression.
DISCUSSION ET CONCLUSION

91
92
Ce travail a permis de cloner et d’étudier les effets de la nouvelle protéine de fusion
MYB-GATA1 associée à la LAB. Néanmoins, nous n’avons pas pu associer cette nouvelle
translocation à une atteinte préférentielle des granulocytes basophiles in vitro. Certaines
questions soulevées par ce travail nécessitent quelques développements :

• L’expression de la protéine de fusion MYB-GATA1 est-elle restreinte aux cas de


LAB ?
L’origine de cette question se trouve dans la littérature où trois cas de translocation
t(X;6)(p11;q23) ont été rapportés. Un cas, décrit par Chessels et al., correspond à un
201
nourrisson de sexe masculin âgé de 4 mois et atteint d’une LAM sans maturation . Deux
des quatre cas inclus dans notre étude (Patient 1 et 2) ont été décrits par le Dr Nicole
177
Dastugue . Une autre étude rapporte le cas de jumelles âgées de 4 mois, atteintes de LAM
avec maturation (25ième Réunion de l'Association Cytogénétique du Québec, 25 avril 2008 et
The Great Lakes Chromosome Conference, 2008). Leur caryotype montre une insertion de la
bande 6q21 à 6q23 dans la bande Xp11.23 soit ins(X;6)(p11.2;q21q23). Les auteurs ont
rapporté une division du signal de la sonde marquant MYB démontrant son implication dans
ce réarrangement chromosomique. Sachant que l’insertion de MYB se fait dans la bande
Xp11.23 contenant le gène GATA1, il est raisonnable d’envisager que cette insertion conduit à
la formation du gène de fusion MYB-GATA1. Récemment, Belloni et al.202 ont caractérisé le
même gène de fusion MYB-GATA1, chez un nourrisson de sexe masculin (6 mois) porteur de
la translocation t(X;6)(p11;q23) et atteint de leucémie aiguë monocytaire (LAM5).
Ces patients sont tous porteurs d’un réarrangement chromosomique impliquant les
mêmes loci et expriment probablement le même gène de fusion, mais le diagnostic de LAB
n’a été documenté que dans nos deux cas. Compte tenu de la difficulté d’établir le diagnostic
morphologique de LAB, il n’est pas exclu que les autres patients aient présenté une LAB. En
effet, plusieurs éléments sont compatibles avec le diagnostic de LAB dans le cas étudié par
Belloni et al. Ce dernier, diagnostiqué comme une LAM5, présentait un pourcentage élevé de
basophiles dans le sang périphérique (38%). Cette donnée biologique est exceptionnellement
observée dans les LAM autres que les LAB et est donc compatible avec une leucémie
impliquant la lignée basophile. Concernant les autres cas de la littérature, les données
biologiques sont peu détaillées. En effet, le cas rapporté par Chesssels et al. fait partie d’une
série de 180 leucémies aiguës du nourrisson pour lequel les seules données disponibles sont
l’âge, le sexe, le nombre de globules blancs, le caryotype et la classification en LAM sans

93
maturation (LAM1). Les deux derniers cas porteurs d’une insertion ins(X;6), pour lequel le
réarrangement de MYB a été confirmé, ont été classés en LAM avec maturation (LAM2).
Les diagnostics de LAM5, LAM1 ou LAM2, établis avec les seuls critères de la
microscopie optique standard, ont pu être des LAB mal diagnostiquées. En effet, le diagnostic
de LAB est difficile à établir avec les outils classiquement utilisés que sont la coloration des
myélogrammes et frottis sanguin au MGG et le test cytochimique de la myéloperoxydase. La
population de basophiloblastes (blastes avec grosses granulations basophiles) peut être très
minoritaire dans des LAB de novo, et coexister avec des basophiloblastes sans granulations.
Cette dernière population ne peut pas être rattachée à la lignée basophile sur la base de
critères morphologiques car les cellules ont l’aspect des blastes sans grains communément
observés dans les LAM. De plus, même en présence de blastes à grains, seule la coloration
cytochimique au bleu de toluidine permet de révéler la nature métachromatique des
granulations caractéristiques des basophiles. Or cette coloration n’est pas un test réalisé
systématiquement lors des diagnostics de LAM. Pour ces raisons, des LAB peuvent être
classées, à tort, dans d’autres sous-groupes de LAM. Cette hypothèse est d’autant plus
crédible que les cellules leucémiques présentent un immunophénotype de type myéloïde
(CD13, CD33, CD117 etc…) qui n’est pas spécifique des LAB car les marquages spécifiques
de la lignée basophile ne sont pas réalisés en routine.
Au niveau clinique, le diagnostic de LAB peut être établi à partir d’un tableau clinique
d’hyperhistaminémie, comparable aux réactions allergiques, dont l’intensité varie en fonction
de la charge histaminique. Les quatre cas de notre série ont tous présenté ce syndrome
d’hyperhistaminémie qui regroupent des signes cutanés avec rash, prurit, érythrodermie
(contrastant avec la pâleur des zones non atteintes liée à l’anémie), des troubles gastro-
intestinaux (vomissement, ballonnement abdominal et diarrhée), des signes cardiaques
(tachycardie..), des signes pulmonaires avec toux liée à l’œdème pouvant aller jusqu’au choc
anaphylactique. Or ce tableau, exceptionnellement observé au diagnostic d’une LAM, doit
orienter vers le diagnostic de LAB. Le cas rapporté par Belloni et al. présente plusieurs de ces
symptômes, notamment la fièvre, la toux, la tachycardie, les vomissements et la distension de
l’abdomen. Aucune précision clinique n’est disponible pour les autres cas de la littérature.
Pour conclure, il existe une conjonction d’éléments cliniques et biologiques qui
permettent de penser que le patient porteur de le translocation t(X;6)(p11;q23) rapporté par
Belloni et al. présentait une LAB. Il est donc permis de conclure que la protéine MYB-
GATA1 est à l’heure actuelle vraisemblablement associée au développement de leucémies
aiguës à basophiles chez des nourrissons (de 2,5 à 6 mois).

94
• La perte de l’expression de GATA1 est-elle indispensable au développement de la
leucémie associée à la translocation t(X ;6) ?
En effet, les patients étudiés sont tous de sexe masculin, ce qui implique que le
réarrangement de GATA1, situé sur le chromosome X, entraîne la perte d’expression de sa
forme sauvage. Pour répondre à cette question, nous pouvons nous baser sur les résultats
obtenus par Belloni et al. Lors de cette étude, des cellulles Lin– isolées à partir de souris
sauvage ou p53-/- et transduites avec MYB-GATA1 ont été injectées à des souris irradiées à une
dose létale afin d’évaluer leurs caractéristiques de reconstitution hématopoïétique. Etant
donné qu’aucune souris ne développait d’hémopathies, ils ont effectué la même expérience à
50
partir de souris Gata1-low (≤ 10 % de l’expression sauvage). Les souris reconstituées ont
toutes été atteintes de syndromes myélodysplasiques. L’une d’entre elles, après une longue
latence (13-15 mois), a développé une leucémie aiguë laissant envisager l’apparition d’une
mutation ponctuelle jouant le rôle de second « hit » ou soulignant le faible pouvoir
oncogénique de MYB-GATA1 in vivo. Toutefois, il apparait important de noter que les
phénotypes oncogéniques rapportés dans les travaux de Belloni sont obtenus à partir de
cellules Lin– exprimant faiblement Gata1. Cette observation est importante car des modèles
murins ont permis de distinguer l’effet de la diminution du niveau d’expression de Gata1 par
rapport à son invalidation. Des souris transgéniques ont été crées afin d’obtenir une
expression correspondant à 5% de l’expression normale par KD (Gata1G105). Le KO de Gata1
(Gata1null) ainsi que le KD dans des souris mâles engendre une létalité due à un défaut de
l’érythropoïèse primitive 36. Chez des souris femelles, l’inactivation du chromosome X permet
d’obtenir une population cellulaire exprimant soit l’allèle sauvage soit l’allèle Gata105. Chez
ces souris, on observe une forte incidence de leucémies touchant la lignée érythroïde ou la
203
lignée lymphocytaire B. De plus ces leucémies sont transplantables dans des souris nude .
Par opposition, dans les souris femelles gata1null/+, les progéniteurs érythroïdes mourant par
apoptose, aucune leucémie ne se développe. Dans l’étude de Belloni, les auteurs ont eu pour
objectif de faire émerger un phénotype leucémique associé à MYB-GATA1. Pour y parvenir,
ils ont adopté une stratégie favorisant le développement de leucémies et ne reproduisant pas
une des conséquences moléculaires de la translocation t(X ;6) chez des patients de sexe
masculin, c’est à dire, la perte totale d’expression de GATA1 sauvage. C’est pourquoi, leurs
travaux ne permettent pas de conclure sur le rôle joué par la perte de GATA1 dans le
développement de LAB.

95
Néanmoins, en mettant en parallèle ces résultats et le développement de LAM chez les
patients exprimant MYB-GATA1, on peut supposer que la perte d’expression de GATA1 joue
un rôle dans le développement de la maladie. En effet, les souris ne souffrent pas
d’hémopathies lorsque Gata1 est normalement exprimé. Toutefois, lors de mon étude, les
cellules Lin– transduites par MYB-GATA1 provenaient de souris normales et, malgré cela,
des effets sur la différenciation comparables à ceux retrouvés dans les LAM, ont été observés.
Comme MYB-GATA1, AML1-ETO est une protéine de fusion capable in vitro de bloquer la
204 205
différenciation granulocytaire et de prolonger l’auto-renouvellement de progéniteurs .
Cependant, AML1-ETO seule est incapable de reproduire une LAM in vivo sans l’induction
206
complémentaire de mutations par un agent mutagène . Il est possible d’expliquer cette
différence entre les expériences in vivo et in vitro par les conditions expérimentales. En effet,
lors des tests in vitro de CFC assay, les cellules transduites par MYB-GATA1 sont dans des
conditions de culture artificielles, c’est à dire, avec un cocktail simple de cytokines choisies,
induisant une différenciation myéloïde tandis que, in vivo, les cellules sont soumises à un
environnement plus complexe.

Dans le contexte pathologique qui nous concerne, nous pouvons envisager que la perte
d’expression de GATA1 pourrait provoquer la levée de deux freins. Nous pouvons d’abord
envisager la levée de l’inhibition de la transcription de gènes cibles tels que MYB et donc de
207
MYB-GATA1 . En effet, les niveaux d’expression des transcrits MYB, MYB-GATA1 et
GATA1 chez les patients comparés à ceux de moelle osseuse saine ont été évalués. Cette
analyse a montrée que MYB sauvage est sur-exprimé chez les patients étudiés (~2 fois) et que
MYB-GATA1 est fortement exprimé par rapport à MYB et GATA1. Cette sur-expression de
MYB participe positivement au processus de leucémogénèse. En effet, son inactivation dans
208
des lignées cellulaires de LAM entraîne une diminution de la prolifération cellulaire .
D’autre part, la perte de GATA1 pourrait provoquer la levée d’un frein au niveau de la
différenciation en déverrouillant l’engagement des cellules dans d’autres voies et notamment
celle la lignée granulocytaire.

96
• La translocation t(X ;6) est-elle restreinte aux patients de sexe masculin ?
Les patients porteurs de la translocation t(X;6) décrits dans la littérature sont tous de
sexe masculin. Néanmoins, si l’hypothèse de la formation du gène MYB-GATA1 lors de
l’insertion ins(X;6)(p11.2;q21q23) chez les jumelles décrites précédemment s’avérait vraie,
alors ce réarrangement ne serait pas exclusivement associé au sexe masculin. Toutefois, la
fréquence de survenue de ce réarrangement serait inférieure chez les patients de sexe féminin.
Pourquoi cette différence de fréquence dans les deux sexes ?
Chez le garçon, le chromosome X étant en simple copie, l’ensemble des gènes portés
par l’X sont exprimés. Un réarrangement MYB-GATA1 ne peut donc se produire qu’avec un
chromosome X activé (et des gènes potentiellement fonctionnels). Si un gène hybride MYB-
GATA1 est généré par translocation ou insertion, il sera fonctionnel et pourra être à l’origine
du développement d’une leucémie.
Chez la fille, deux copies du chromosome X sont présents et une des deux est
inactivée au hasard dans les différentes cellules par le phénomène dit de lyonisation. Si un
réarrangement MYB-GATA1 se produit avec le gène GATA1 d’un chromosome X inactivé, la
fusion ne sera pas fonctionnelle et la cellule porteuse du remaniement disparaitra sans
développer un clone leucémique. Au contraire, si la fusion se fait avec un gène GATA1 porté
par un chromosome X actif, la protéine MYB-GATA1 pourra être exprimée et donner lieu au
développement d’un clone leucémique, comme chez les garçons. De ce fait, le réarrangement
ne pourrait initier une leucémie qu’une fois sur deux chez les patients de sexe féminin.
Le mécanisme d’inactivation de l’X observé chez les filles pourrait donc expliquer la
plus faible probabilité de survenue des LAB chez les patients de sexe féminin et donc pourrait
expliquer pourquoi MYB-GATA1 est préférentiellement (mais non exclusivement) observé
chez les garçons.

• Pourquoi MYB-GATA1 n’induit pas un blocage des granulocytes basophiles?


Au début de ce travail, nous pensions trouver des gènes clés impliqués dans
l’ontogénie des basophiles. En effet, à l’heure actuelle, la différenciation des basophiles
humains est peu connue. Des facteurs de transcription ou des cytokines clés et spécifiques de
ce processus ne sont pas déterminés comme pour la différenciation des lymphocytes B pour
laquelle PAX5 et l’IL-7 sont par exemple des éléments majeurs. Aux vues des caractéristiques
fonctionnelles de MYB et de GATA1, l’hypothèse d’une implication spécifique de l’un ou de
l’autre dans la différenciation des basophiles n’était pas des plus probables.

97
Dans le cadre de la pathologie étudiée, j’ai réalisé des expériences permettant
d’étudier la différenciation myéloïde, en utilisant des tests de CFC assay sur des progéniteurs
hématopoïétiques murins transduits par MYB-GATA1. Cette expérience permet d’analyser les
paramètres de prolifération, par rapport aux nombres de colonies totales obtenues et de
différenciation, par rapport aux proportions respectives de chaque type de CFU entre les
progéniteurs de la moelle contrôle et ceux transduits par MYB-GATA1. Ces expériences ont
mis en évidence l’effet de MYB-GATA1 sur l’engagement des cellules dans la lignée
granulocytaire. En effet, nous avons observé que lorsque les progéniteurs expriment la
protéine chimérique, le nombre de CFU-G augmente et en parallèle ceux des CFU-GM et des
CFU-M diminuent. Ceci montre que MYB-GATA1 oriente préférentiellement la
différenciation des progéniteurs vers la lignée granulocytaire. Ce résultat a été confirmé par
coloration des cellules récoltées au MGG. De plus, cette approche a permis de faire apparaître
que l’augmentation des précurseurs immatures granulocytaires (myéloblastes et
promyélocytes) se faisait au détriment de la différenciation monocytaire. Enfin, MYB-
GATA1 bloque les cellules à un stade de précurseurs granulocytaires immatures, puisqu’elles
conservent la morphologie et le phénotype membranaire caractéristiques de ce stade
(CD11b+Gr1+). Cependant, ces cellules se sont révélées négatives pour deux tests spécifiques
des granulocytes basophiles (expression membranaire du FcεRI, coloration métachromatique
au bleu de toluidine).

Dans les cellules leucémiques des patients étudiés, le gène GATA1 est invalidé ce qui
pourrait les mettre dans un contexte cellulaire favorable à l’engagement vers la différenciation
en granulocytes basophiles. Les résultats obtenus par Belloni et al., abordés précédemment,
ne supportent pas cette hypothèse puisque des blastes atypiques sont observés lors de leurs
tests de reconstitution de souris par des cellules Lin–Gata1-low. Toutefois, comme nous
l’avons discuté auparavant, le modèle utilisé lors de cette étude ne reconstitue pas fidèlement
le contexte pathologique.
Pour cette étude, je me suis placé dans un modèle murin, pertinent au regard de la forte
homologie des protéines MYB et GATA1 humaines et murines. Il est pourtant possible que
les mécanismes moléculaires conduisant à l’engagement des cellules vers la lignée basophile
soient différents entre les deux espèces et que les cytokines requises pour une différenciation
basophile soient spécifiques d’une espèce à l’autre. Les tests ont été effectués dans des
conditions expérimentales permettant la différenciation myéloïde, associées donc à un
cocktail de cytokines défini. Ces cytokines, et notamment leurs concentrations relatives, sont

98
susceptibles d’introduire un biais. En effet, le microenvironnement et les stimulations
cytokiniques qui s’y rattachent sont certainement décisifs pour que la cellule choisisse de
s’orienter vers la production de basophiles. En outre, il est possible que MYB-GATA1 régule
l’expression de récepteurs à certaines cytokines spécifiques de la différenciation basophile,
présentes dans le microenvironnement mais absentes dans notre test. Les progéniteurs que
nous avons étudiés pourraient alors s’être engagés par défaut vers la lignée des granulocytes
neutrophiles.
188
Lors de la description des cas cliniques réalisée par le Dr. Dastugue , elle fait état
de la présence d’un contingent de cellules leucémiques dont la majorité est composée de
cellules immatures sans pour autant présenter les caractéristiques spécifiques des
basophiloblastes. A partir de cette observation, nous pouvons émettre les hypothèses que tous
les blastes sont à l’origine des progéniteurs de la lignée granulocytaire, et qu’une sous-
population clonale a émergé suite à une mutation additionnelle qui oriente les cellules vers un
phénotype basophile. En effet, il est courant d’observer des mutations additionnelles
susceptibles de faire évoluer le phénotype dans les leucémies aiguës myéloblastiques. Nous
avons entrepris la recherche de mutations dans les gènes FLT3, NPM1, WT1, CEBPa, K-RAS,
N-RAS, IDH1 et IDH2 chez deux de nos patients (#2 et #3). Le patient 2 est porteur d’une
mutation secondaire dans l’exon 2 du gène K-RAS (G12S). Cette mutation peut correspondre
à la sous-population clonale des basophiloblastes leucémiques qui représente 20 % des blastes
totaux chez ce patient. Si cette hypothèse est juste, il serait plus probable que la mutation de
K-RAS soit à l’origine de l’augmentation de la proportion des basophiloblastes (20% contre 2
% pour le patient 1) par un effet prolifératif, plutôt qu’à la base de l’orientation des cellules
vers la lignée basophile puisque l’autre patient testé est négatif pour les mutations choisies.
Une autre mutation, commune aux patients, pourrait avoir eu lieu dans un gène
spécifiquement impliqué dans l’engagement des progéniteurs vers la lignée basophile. Cette
explication serait un argument en faveur de l’existence d’un progéniteur commun
neutrophile/basophile chez l’homme. Une autre hypothèse serait de considérer que les cellules
touchées par cette translocation sont dès l’origine des progéniteurs basophiles et que toutes les
cellules n’ont pas encore acquis leurs caractéristiques phénotypiques.

Enfin, aux vues des réarrangements complexes mis en évidence chez nos patients, il
est possible qu’un désordre moléculaire ait été créé au niveau d’un autre point de cassure que
ceux situés en Xp11 et 6q23. En effet, la translocation de MYB sur le chromosome X nécessite
une autre cassure sur le chromosome 6 et deux des patients présentent plusieurs points de

99
cassure différents sur le chromosome X. Cependant, cette hypothèse est moins probable étant
donné que les autres points de cassures ne sont pas identiques entre les patients.

• Quels sont les mécanismes moléculaires aboutissant aux effets observés par
l’expression de MYB-GATA1 ?
Lors de ce travail, j’ai décris le phénotype engendré par l’expression de la protéine de
fusion MYB-GATA1. La caractérisation des mécanismes moléculaires associés aux
phénotypes conférés par l’expression de MYB-GATA1 devra faire l’objet de travaux
complémentaires. MYB-GATA1 est une protéine singulière car elle comporte deux domaines
de liaison potentiels avec des motifs nucléotidiques différents, l’un hélice-tour-hélice, et
l’autre en doigt de zinc. Lors de translocations fusionnant deux facteurs de transcription, il est
peu courant d’observer deux sites de liaison à l’ADN. En règle générale, lors de ce type de
translocation, un partenaire apporte son domaine de liaison à l’ADN et l’autre des éléments
régulateurs négatifs ou positifs. Il existe cependant d’autres cas comparables tel que PAX5-
209
ETV6 qui conserve les sites de liaison à l’ADN à la fois de PAX5 et de ETV6 . Toutefois
cette protéine de fusion agit comme un dominant négatif sur l’activité de la protéine PAX5
210
sauvage car le domaine de transactivation de PAX5 est perdu dans la chimère . Cette
propriété semble moins probable dans le cas de MYB-GATA1 dans la mesure où MYB
conserve également son domaine de transactivation. Des tests complémentaires sont en tous
cas nécessaires pour déterminer l’impact de la fusion MYB-GATA1 par rapport au
fonctionnement normal de MYB.
Une hypothèse serait que cette protéine chimérique corresponde à une protéine MYB
activée suite à la délétion du domaine NRD. En effet, les formes tronquées de MYB sont
capables de transformer les cellules, ce qui correspondrait dans notre cas à une augmentation
du potentiel clonogènique in vitro. De plus, MYB est capable de s’auto-réguler grâce à la
présence dans son promoteur de site de liaison de MYB. Les augmentations de l’expression
de MYB-GATA1 et de MYB observées chez les patients pourraient être dues à ce mécanisme
d’auto-régulation par MYB sauvage sur son propre promoteur ou par MYB-GATA1. En
parallèle, la forte expression de MYB-GATA1 pourrait s’expliquer par la perte des sites de
fixation des microARN situés au niveau de la région 3’ non traduite de MYB. Le maintien
d’un fort niveau d’expression de ces deux formes induirait un blocage de la différenciation.
Pour répondre à ces questions, des expériences de transactivation du gène luciférase
sous dépendance de promoteurs de gènes cibles spécifiques de MYB permettraient de tester

100
les hypothèses d’une formation d’une forme activée de MYB. En parallèle, une étude par
ChIP-Seq apporterait des réponses quant aux cibles de cette nouvelle protéine de fusion.
L’analyse de l’impact de l’expression de MYB-GATA1 sur le niveau d’expression des cibles
déterminées par les expériences de ChIP-seq pourrait apporter une vue globale des
dérégulations induites par MYB-GATA1.

• La découverte de MYB-GATA1 peut-elle aider à la prise en charge des patients ?


La découverte de translocations peut améliorer la prise en charge du patient à plusieurs
titres. Ces translocations, quand elles sont retrouvées dans un grand nombre de patients,
peuvent être liées à des valeurs pronostique et prédictive et aider à la mise en place d’une
thérapie adaptée. Pour le moment, MYB-GATA1 ne peut être associé à de telles valeurs étant
donné le faible nombre de cas. Au regard du profil des patients porteurs de cette translocation,
une recherche systématique de la présence du transcrit de fusion chez des patients âgés de
moins de 1 an et atteints de LAM sans anomalie récurrente pourrait être envisagée. En effet, il
est possible que cette translocation, difficile à caractériser par les techniques de cytogénétique
conventionnelles du fait de sa complexité, soit sous-diagnostiquée.
En pratique médicale, l’identification de MYB-GATA1 peut permettre la recherche
par PCR du transcrit au diagnostic et par RT-PCR quantitative des cellules leucémiques
résiduelles chez les patients après traitement. En effet, la recherche de la maladie résiduelle
permet d’évaluer le risque de rechute. Cette approche est couramment utilisée lors des
traitements de patients atteints de LAL. Elle permet de déterminer le pourcentage de cellules
leucémiques présentes après traitement dans environ 90 % des cas par recherche de
l’expression de récepteurs antigéniques spécifiques du clone leucémique (immunoglobulines
ou TCR)211. De part l’hétérogénéité des désordres moléculaires associés aux LAM, cette
approche est peu développée dans ce type de leucémies aiguës comparativement aux LAL.
Néanmoins, des études récentes portent sur la valeur pronostique du pourcentage de cellules
leucémiques résiduelles chez des patients atteints de LAM exprimant les protéines de fusion
récurrentes telles que AML1–ETO et CBFβ–MYH11 212-213.
D’un point de vue thérapeutique, l’utilisation de molécules ciblant les transcrits MYB
et MYB-GATA1 pourrait être envisagé en parallèle de la chimiothérapie. En effet, chez les
patients, les gènes MYB et MYB-GATA1 sont fortement exprimés. C’est pourquoi l’utilisation
d’un oligonucléotide antisens ciblant la partie commune des deux transcrits respectifs pourrait
être une bonne approche. Un oligonucléotide anti-sens de l’ARNm de MYB modifié
chimiquement afin d’augmenter sa stabilité a été développé. Ce dernier a été utilisé lors

101
d’essais cliniques sur des patients atteints de LMC. Malgré la démonstration que l’injection de
cet oligonucléotide modifié n’était pas toxique, les conclusions quant au bénéfice clinique
n’étaient pas certaines 214.

Pour conclure, ce travail associe pour la première fois une translocation récurrente
identifiée au développement d’une leucémie aiguë à basophile. De plus, cette étude a abouti
au clonage d’une nouvelle protéine de fusion capable de bloquer la différenciation et de
transformer des progéniteurs hématopoïétiques murins. Enfin, cette translocation touchant
quatre enfants de sexe masculin et atteints de la même maladie définit une nouvelle entité
clinico-pathologique.

102
REFERENCES BIBLIOGRAPHIQUES

103
104
1. Galy, A., Travis, M., Cen, D. & Chen, B. Human T, B, natural killer, and dendritic
cells arise from a common bone marrow progenitor cell subset. Immunity 3, 459-73
(1995).
2. Wilson, A. & Trumpp, A. Bone-marrow haematopoietic-stem-cell niches. Nat Rev
Immunol 6, 93-106 (2006).
3. Becker, A.J., Mc, C.E. & Till, J.E. Cytological demonstration of the clonal nature of
spleen colonies derived from transplanted mouse marrow cells. Nature 197, 452-4
(1963).
4. Rusten, L.S. et al. Functional differences between CD38- and DR- subfractions of
CD34+ bone marrow cells. Blood 84, 1473-81 (1994).
5. Lapidot, T. et al. Cytokine stimulation of multilineage hematopoiesis from immature
human cells engrafted in SCID mice. Science 255, 1137-41 (1992).
6. Larochelle, A. et al. Identification of primitive human hematopoietic cells capable of
repopulating NOD/SCID mouse bone marrow: implications for gene therapy. Nat Med
2, 1329-37 (1996).
7. Majeti, R., Park, C.Y. & Weissman, I.L. Identification of a hierarchy of multipotent
hematopoietic progenitors in human cord blood. Cell Stem Cell 1, 635-45 (2007).
8. Notta, F. et al. Isolation of single human hematopoietic stem cells capable of long-
term multilineage engraftment. Science 333, 218-21 (2011).
9. Denburg, J.A., Silver, J.E. & Abrams, J.S. Interleukin-5 is a human basophilopoietin:
induction of histamine content and basophilic differentiation of HL-60 cells and of
peripheral blood basophil-eosinophil progenitors. Blood 77, 1462-8 (1991).
10. Holtz, M.S. et al. Imatinib mesylate (STI571) inhibits growth of primitive malignant
progenitors in chronic myelogenous leukemia through reversal of abnormally
increased proliferation. Blood 99, 3792-800 (2002).
11. Kawamoto, H., Ohmura, K. & Katsura, Y. Direct evidence for the commitment of
hematopoietic stem cells to T, B and myeloid lineages in murine fetal liver. Int
Immunol 9, 1011-9 (1997).
12. Manz, M.G., Miyamoto, T., Akashi, K. & Weissman, I.L. Prospective isolation of
human clonogenic common myeloid progenitors. Proc Natl Acad Sci U S A 99, 11872-
7 (2002).
13. Mori, Y. et al. Identification of the human eosinophil lineage-committed progenitor:
revision of phenotypic definition of the human common myeloid progenitor. J Exp
Med 206, 183-93 (2009).
14. Kawamoto, H. & Katsura, Y. A new paradigm for hematopoietic cell lineages:
revision of the classical concept of the myeloid-lymphoid dichotomy. Trends Immunol
30, 193-200 (2009).
15. Lu, M., Kawamoto, H., Katsube, Y., Ikawa, T. & Katsura, Y. The common
myelolymphoid progenitor: a key intermediate stage in hemopoiesis generating T and
B cells. J Immunol 169, 3519-25 (2002).
16. Igarashi, H., Gregory, S.C., Yokota, T., Sakaguchi, N. & Kincade, P.W. Transcription
from the RAG1 locus marks the earliest lymphocyte progenitors in bone marrow.
Immunity 17, 117-30 (2002).
17. Doulatov, S. et al. Revised map of the human progenitor hierarchy shows the origin of
macrophages and dendritic cells in early lymphoid development. Nat Immunol 11,
585-93 (2010).
18. Brown, G., Hughes, P.J., Michell, R.H. & Ceredig, R. The versatility of
haematopoietic stem cells: implications for leukaemia. Crit Rev Clin Lab Sci 47, 171-
80 (2010).

105
19. Visnjic, D. et al. Hematopoiesis is severely altered in mice with an induced osteoblast
deficiency. Blood 103, 3258-64 (2004).
20. Rafii, S., Mohle, R., Shapiro, F., Frey, B.M. & Moore, M.A. Regulation of
hematopoiesis by microvascular endothelium. Leuk Lymphoma 27, 375-86 (1997).
21. Arai, F. et al. Tie2/angiopoietin-1 signaling regulates hematopoietic stem cell
quiescence in the bone marrow niche. Cell 118, 149-61 (2004).
22. Calvi, L.M. et al. Osteoblastic cells regulate the haematopoietic stem cell niche.
Nature 425, 841-6 (2003).
23. Kiel, M.J., Yilmaz, O.H., Iwashita, T., Terhorst, C. & Morrison, S.J. SLAM family
receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial
niches for stem cells. Cell 121, 1109-21 (2005).
24. Li, W. et al. Primary endothelial cells isolated from the yolk sac and para-aortic
splanchnopleura support the expansion of adult marrow stem cells in vitro. Blood 102,
4345-53 (2003).
25. Zhang, D.E., Hetherington, C.J., Chen, H.M. & Tenen, D.G. The macrophage
transcription factor PU.1 directs tissue-specific expression of the macrophage colony-
stimulating factor receptor. Mol Cell Biol 14, 373-81 (1994).
26. Iwasaki, H. et al. The order of expression of transcription factors directs hierarchical
specification of hematopoietic lineages. Genes Dev 20, 3010-21 (2006).
27. Tsai, F.Y. & Orkin, S.H. Transcription factor GATA-2 is required for
proliferation/survival of early hematopoietic cells and mast cell formation, but not for
erythroid and myeloid terminal differentiation. Blood 89, 3636-43 (1997).
28. Ting, C.N., Olson, M.C., Barton, K.P. & Leiden, J.M. Transcription factor GATA-3 is
required for development of the T-cell lineage. Nature 384, 474-8 (1996).
29. Ito, E. et al. Erythroid transcription factor GATA-1 is abundantly transcribed in mouse
testis. Nature 362, 466-8 (1993).
30. Tsai, S.F., Strauss, E. & Orkin, S.H. Functional analysis and in vivo footprinting
implicate the erythroid transcription factor GATA-1 as a positive regulator of its own
promoter. Genes Dev 5, 919-31 (1991).
31. Martin, D.I. & Orkin, S.H. Transcriptional activation and DNA binding by the
erythroid factor GF-1/NF-E1/Eryf 1. Genes Dev 4, 1886-98 (1990).
32. Weiss, M.J., Yu, C. & Orkin, S.H. Erythroid-cell-specific properties of transcription
factor GATA-1 revealed by phenotypic rescue of a gene-targeted cell line. Mol Cell
Biol 17, 1642-51 (1997).
33. Trainor, C.D., Ghirlando, R. & Simpson, M.A. GATA zinc finger interactions
modulate DNA binding and transactivation. J Biol Chem 275, 28157-66 (2000).
34. Nichols, K.E. et al. Familial dyserythropoietic anaemia and thrombocytopenia due to
an inherited mutation in GATA1. Nat Genet 24, 266-70 (2000).
35. Wall, L., deBoer, E. & Grosveld, F. The human beta-globin gene 3' enhancer contains
multiple binding sites for an erythroid-specific protein. Genes Dev 2, 1089-100
(1988).
36. Fujiwara, Y., Browne, C.P., Cunniff, K., Goff, S.C. & Orkin, S.H. Arrested
development of embryonic red cell precursors in mouse embryos lacking transcription
factor GATA-1. Proc Natl Acad Sci U S A 93, 12355-8 (1996).
37. Takahashi, S. et al. Arrest in primitive erythroid cell development caused by
promoter-specific disruption of the GATA-1 gene. J Biol Chem 272, 12611-5 (1997).
38. Pan, X. et al. Graded levels of GATA-1 expression modulate survival, proliferation,
and differentiation of erythroid progenitors. J Biol Chem 280, 22385-94 (2005).
39. Zhang, P. et al. PU.1 inhibits GATA-1 function and erythroid differentiation by
blocking GATA-1 DNA binding. Blood 96, 2641-8 (2000).

106
40. Zhang, P. et al. Negative cross-talk between hematopoietic regulators: GATA proteins
repress PU.1. Proc Natl Acad Sci U S A 96, 8705-10 (1999).
41. Orkin, S.H. GATA-binding transcription factors in hematopoietic cells. Blood 80, 575-
81 (1992).
42. Grass, J.A. et al. GATA-1-dependent transcriptional repression of GATA-2 via
disruption of positive autoregulation and domain-wide chromatin remodeling. Proc
Natl Acad Sci U S A 100, 8811-6 (2003).
43. Crossley, M., Merika, M. & Orkin, S.H. Self-association of the erythroid transcription
factor GATA-1 mediated by its zinc finger domains. Mol Cell Biol 15, 2448-56
(1995).
44. Mackay, J.P. et al. Involvement of the N-finger in the self-association of GATA-1. J
Biol Chem 273, 30560-7 (1998).
45. Blobel, G.A., Nakajima, T., Eckner, R., Montminy, M. & Orkin, S.H. CREB-binding
protein cooperates with transcription factor GATA-1 and is required for erythroid
differentiation. Proc Natl Acad Sci U S A 95, 2061-6 (1998).
46. Zon, L.I., Youssoufian, H., Mather, C., Lodish, H.F. & Orkin, S.H. Activation of the
erythropoietin receptor promoter by transcription factor GATA-1. Proc Natl Acad Sci
U S A 88, 10638-41 (1991).
47. Bartunek, P., Kralova, J., Blendinger, G., Dvorak, M. & Zenke, M. GATA-1 and c-
myb crosstalk during red blood cell differentiation through GATA-1 binding sites in
the c-myb promoter. Oncogene 22, 1927-35 (2003).
48. Yu, M. et al. Insights into GATA-1-mediated gene activation versus repression via
genome-wide chromatin occupancy analysis. Mol Cell 36, 682-95 (2009).
49. Dore, L.C. et al. A GATA-1-regulated microRNA locus essential for erythropoiesis.
Proc Natl Acad Sci U S A 105, 3333-8 (2008).
50. Shivdasani, R.A., Fujiwara, Y., McDevitt, M.A. & Orkin, S.H. A lineage-selective
knockout establishes the critical role of transcription factor GATA-1 in
megakaryocyte growth and platelet development. Embo J 16, 3965-73 (1997).
51. Yu, C. et al. Targeted deletion of a high-affinity GATA-binding site in the GATA-1
promoter leads to selective loss of the eosinophil lineage in vivo. J Exp Med 195,
1387-95 (2002).
52. Zhou, Y.E., O'Rourke, J.P., Edwards, J.S. & Ness, S.A. Single Molecule Analysis of
c-myb Alternative Splicing Reveals Novel Classifiers for Precursor B-ALL. PLoS One
6, e22880 (2011).
53. Kulessa, H., Frampton, J. & Graf, T. GATA-1 reprograms avian myelomonocytic cell
lines into eosinophils, thromboblasts, and erythroblasts. Genes Dev 9, 1250-62 (1995).
54. Migliaccio, A.R. et al. GATA-1 as a regulator of mast cell differentiation revealed by
the phenotype of the GATA-1low mouse mutant. J Exp Med 197, 281-96 (2003).
55. Harigae, H. et al. Differential roles of GATA-1 and GATA-2 in growth and
differentiation of mast cells. Genes Cells 3, 39-50 (1998).
56. Lipsick, J.S. One billion years of Myb. Oncogene 13, 223-35 (1996).
57. Hugo, H. et al. Mutations in the MYB intron I regulatory sequence increase
transcription in colon cancers. Genes Chromosomes Cancer 45, 1143-54 (2006).
58. O'Rourke, J.P. & Ness, S.A. Alternative RNA splicing produces multiple forms of c-
Myb with unique transcriptional activities. Mol Cell Biol 28, 2091-101 (2008).
59. Kumar, A., Baker, S.J., Lee, C.M. & Reddy, E.P. Molecular mechanisms associated
with the regulation of apoptosis by the two alternatively spliced products of c-Myb.
Mol Cell Biol 23, 6631-45 (2003).
60. Baker, S.J., Kumar, A. & Reddy, E.P. p89c-Myb is not required for fetal or adult
hematopoiesis. Genesis 48, 309-16 (2010).

107
61. Miglarese, M.R., Richardson, A.F., Aziz, N. & Bender, T.P. Differential regulation of
c-Myb-induced transcription activation by a phosphorylation site in the negative
regulatory domain. J Biol Chem 271, 22697-705 (1996).
62. Tomita, A. et al. c-Myb acetylation at the carboxyl-terminal conserved domain by
transcriptional co-activator p300. Oncogene 19, 444-51 (2000).
63. Nicolaides, N.C., Gualdi, R., Casadevall, C., Manzella, L. & Calabretta, B. Positive
autoregulation of c-myb expression via Myb binding sites in the 5' flanking region of
the human c-myb gene. Mol Cell Biol 11, 6166-76 (1991).
64. Sakura, H. et al. Delineation of three functional domains of the transcriptional
activator encoded by the c-myb protooncogene. Proc Natl Acad Sci U S A 86, 5758-62
(1989).
65. Biedenkapp, H., Borgmeyer, U., Sippel, A.E. & Klempnauer, K.H. Viral myb
oncogene encodes a sequence-specific DNA-binding activity. Nature 335, 835-7
(1988).
66. Dini, P.W. & Lipsick, J.S. Oncogenic truncation of the first repeat of c-Myb decreases
DNA binding in vitro and in vivo. Mol Cell Biol 13, 7334-48 (1993).
67. Kalkbrenner, F., Guehmann, S. & Moelling, K. Transcriptional activation by human c-
myb and v-myb genes. Oncogene 5, 657-61 (1990).
68. Dubendorff, J.W. & Lipsick, J.S. Transcriptional regulation by the carboxyl terminus
of c-Myb depends upon both the Myb DNA-binding domain and the DNA recognition
site. Oncogene 18, 3452-60 (1999).
69. Pattabiraman, D.R., Sun, J., Dowhan, D.H., Ishii, S. & Gonda, T.J. Mutations in
multiple domains of c-Myb disrupt interaction with CBP/p300 and abrogate myeloid
transforming ability. Mol Cancer Res 7, 1477-86 (2009).
70. Kanei-Ishii, C. et al. Transactivation and transformation by Myb are negatively
regulated by a leucine-zipper structure. Proc Natl Acad Sci U S A 89, 3088-92 (1992).
71. Nomura, T. et al. Negative autoregulation of c-Myb activity by homodimer formation
through the leucine zipper. J Biol Chem 268, 21914-23 (1993).
72. Grasser, F.A., Graf, T. & Lipsick, J.S. Protein truncation is required for the activation
of the c-myb proto-oncogene. Mol Cell Biol 11, 3987-96 (1991).
73. Gonda, T.J., Buckmaster, C. & Ramsay, R.G. Activation of c-myb by carboxy-
terminal truncation: relationship to transformation of murine haemopoietic cells in
vitro. Embo J 8, 1777-83 (1989).
74. Hu, Y.L., Ramsay, R.G., Kanei-Ishii, C., Ishii, S. & Gonda, T.J. Transformation by
carboxyl-deleted Myb reflects increased transactivating capacity and disruption of a
negative regulatory domain. Oncogene 6, 1549-53 (1991).
75. Mucenski, M.L. et al. A functional c-myb gene is required for normal murine fetal
hepatic hematopoiesis. Cell 65, 677-89 (1991).
76. Ramsay, R.G., Ikeda, K., Rifkind, R.A. & Marks, P.A. Changes in gene expression
associated with induced differentiation of erythroleukemia: protooncogenes, globin
genes, and cell division. Proc Natl Acad Sci U S A 83, 6849-53 (1986).
77. Westin, E.H. et al. Differential expression of the amv gene in human hematopoietic
cells. Proc Natl Acad Sci U S A 79, 2194-8 (1982).
78. Clarke, M.F., Kukowska-Latallo, J.F., Westin, E., Smith, M. & Prochownik, E.V.
Constitutive expression of a c-myb cDNA blocks Friend murine erythroleukemia cell
differentiation. Mol Cell Biol 8, 884-92 (1988).
79. McClinton, D., Stafford, J., Brents, L., Bender, T.P. & Kuehl, W.M. Differentiation of
mouse erythroleukemia cells is blocked by late up-regulation of a c-myb transgene.
Mol Cell Biol 10, 705-10 (1990).

108
80. Selvakumaran, M., Liebermann, D.A. & Hoffman-Liebermann, B. Deregulated c-myb
disrupts interleukin-6- or leukemia inhibitory factor-induced myeloid differentiation
prior to c-myc: role in leukemogenesis. Mol Cell Biol 12, 2493-500 (1992).
81. Ferrari, S. et al. Differential effects of c-myb and c-fes antisense
oligodeoxynucleotides on granulocytic differentiation of human myeloid leukemia
HL60 cells. Cell Growth Differ 1, 543-8 (1990).
82. Cuddihy, A.E., Brents, L.A., Aziz, N., Bender, T.P. & Kuehl, W.M. Only the DNA
binding and transactivation domains of c-Myb are required to block terminal
differentiation of murine erythroleukemia cells. Mol Cell Biol 13, 3505-13 (1993).
83. Rosson, D. & O'Brien, T.G. Constitutive c-myb expression in K562 cells inhibits
induced erythroid differentiation but not tetradecanoyl phorbol acetate-induced
megakaryocytic differentiation. Mol Cell Biol 15, 772-9 (1995).
84. Thomas, M.D., Kremer, C.S., Ravichandran, K.S., Rajewsky, K. & Bender, T.P. c-
Myb is critical for B cell development and maintenance of follicular B cells. Immunity
23, 275-86 (2005).
85. Bender, T.P., Kremer, C.S., Kraus, M., Buch, T. & Rajewsky, K. Critical functions for
c-Myb at three checkpoints during thymocyte development. Nat Immunol 5, 721-9
(2004).
86. Nakata, Y. et al. c-Myb contributes to G2/M cell cycle transition in human
hematopoietic cells by direct regulation of cyclin B1 expression. Mol Cell Biol 27,
2048-58 (2007).
87. Lieu, Y.K. & Reddy, E.P. Conditional c-myb knockout in adult hematopoietic stem
cells leads to loss of self-renewal due to impaired proliferation and accelerated
differentiation. Proc Natl Acad Sci U S A (2009).
88. Zeng, H., Yucel, R., Kosan, C., Klein-Hitpass, L. & Moroy, T. Transcription factor
Gfi1 regulates self-renewal and engraftment of hematopoietic stem cells. Embo J 23,
4116-25 (2004).
89. Chen, Y., Haviernik, P., Bunting, K.D. & Yang, Y.C. Cited2 is required for normal
hematopoiesis in the murine fetal liver. Blood 110, 2889-98 (2007).
90. Zhao, L. et al. Integrated genome-wide chromatin occupancy and expression analyses
identify key myeloid pro-differentiation transcription factors repressed by Myb.
Nucleic Acids Res (2011).
91. DeKoter, R.P. & Singh, H. Regulation of B lymphocyte and macrophage development
by graded expression of PU.1. Science 288, 1439-41 (2000).
92. McKercher, S.R. et al. Targeted disruption of the PU.1 gene results in multiple
hematopoietic abnormalities. Embo J 15, 5647-58 (1996).
93. Rosenbauer, F. et al. Acute myeloid leukemia induced by graded reduction of a
lineage-specific transcription factor, PU.1. Nat Genet 36, 624-30 (2004).
94. Metcalf, D. et al. Inactivation of PU.1 in adult mice leads to the development of
myeloid leukemia. Proc Natl Acad Sci U S A 103, 1486-91 (2006).
95. Watkins, P.J., Condreay, J.P., Huber, B.E., Jacobs, S.J. & Adams, D.J. Impaired
proliferation and tumorigenicity induced by CCAAT/enhancer-binding protein.
Cancer Res 56, 1063-7 (1996).
96. Radomska, H.S. et al. CCAAT/enhancer binding protein alpha is a regulatory switch
sufficient for induction of granulocytic development from bipotential myeloid
progenitors. Mol Cell Biol 18, 4301-14 (1998).
97. Zhang, D.E. et al. Absence of granulocyte colony-stimulating factor signaling and
neutrophil development in CCAAT enhancer binding protein alpha-deficient mice.
Proc Natl Acad Sci U S A 94, 569-74 (1997).

109
98. Mukai, K. et al. Basophils play a critical role in the development of IgE-mediated
chronic allergic inflammation independently of T cells and mast cells. Immunity 23,
191-202 (2005).
99. Tsujimura, Y. et al. Basophils play a pivotal role in immunoglobulin-G-mediated but
not immunoglobulin-E-mediated systemic anaphylaxis. Immunity 28, 581-9 (2008).
100. Oh, K., Shen, T., Le Gros, G. & Min, B. Induction of Th2 type immunity in a mouse
system reveals a novel immunoregulatory role of basophils. Blood 109, 2921-7 (2007).
101. Denzel, A. et al. Basophils enhance immunological memory responses. Nat Immunol
9, 733-42 (2008).
102. Lindemann, A. et al. Biologic effects of recombinant human interleukin-3 in vivo. J
Clin Oncol 9, 2120-7 (1991).
103. Weil, S.C. & Hrisinko, M.A. A hybrid eosinophilic-basophilic granulocyte in chronic
granulocytic leukemia. Am J Clin Pathol 87, 66-70 (1987).
104. Dy, M. et al. Modulation of histidine decarboxylase activity and cytokine synthesis in
human leukemic cell lines: relationship with basophilic and/or megakaryocytic
differentiation. Exp Hematol 27, 1295-305 (1999).
105. Buhring, H.J. et al. The monoclonal antibody 97A6 defines a novel surface antigen
expressed on human basophils and their multipotent and unipotent progenitors. Blood
94, 2343-56 (1999).
106. Blom, T. & Hellman, L. Characterization of a tryptase mRNA expressed in the human
basophil cell line KU812. Scand J Immunol 37, 203-8 (1993).
107. Li, L. et al. Identification of basophilic cells that express mast cell granule proteases in
the peripheral blood of asthma, allergy, and drug-reactive patients. J Immunol 161,
5079-86 (1998).
108. Boissan, M., Feger, F., Guillosson, J.J. & Arock, M. c-Kit and c-kit mutations in
mastocytosis and other hematological diseases. J Leukoc Biol 67, 135-48 (2000).
109. Valent, P. et al. Interleukin-3 is a differentiation factor for human basophils. Blood 73,
1763-9 (1989).
110. Arinobu, Y., Iwasaki, H. & Akashi, K. Origin of basophils and mast cells. Allergol Int
58, 21-8 (2009).
111. Arinobu, Y. et al. Developmental checkpoints of the basophil/mast cell lineages in
adult murine hematopoiesis. Proc Natl Acad Sci U S A 102, 18105-10 (2005).
112. Vardiman, J.W. et al. The 2008 revision of the World Health Organization (WHO)
classification of myeloid neoplasms and acute leukemia: rationale and important
changes. Blood 114, 937-51 (2009).
113. Shih, L.Y. et al. Acquisition of FLT3 or N-ras mutations is frequently associated with
progression of myelodysplastic syndrome to acute myeloid leukemia. Leukemia 18,
466-75 (2004).
114. Yamamoto, K., Nakamura, Y., Saito, K. & Furusawa, S. Expression of the
NUP98/HOXA9 fusion transcript in the blast crisis of Philadelphia chromosome-
positive chronic myelogenous leukaemia with t(7;11)(p15;p15). Br J Haematol 109,
423-6 (2000).
115. Rego, E.M. et al. Role of promyelocytic leukemia (PML) protein in tumor
suppression. J Exp Med 193, 521-29 (2001).
116. Tsujimoto, Y., Finger, L.R., Yunis, J., Nowell, P.C. & Croce, C.M. Cloning of the
chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome
translocation. Science 226, 1097-9 (1984).
117. Felix, C.A. Secondary leukemias induced by topoisomerase-targeted drugs. Biochim
Biophys Acta 1400, 233-55 (1998).

110
118. Felix, C.A., Lange, B.J., Hosler, M.R., Fertala, J. & Bjornsti, M.A. Chromosome band
11q23 translocation breakpoints are DNA topoisomerase II cleavage sites. Cancer Res
55, 4287-92 (1995).
119. Thandla, S.P. et al. ETV6-AML1 translocation breakpoints cluster near a
purine/pyrimidine repeat region in the ETV6 gene. Blood 93, 293-9 (1999).
120. Kolomietz, E., Meyn, M.S., Pandita, A. & Squire, J.A. The role of Alu repeat clusters
as mediators of recurrent chromosomal aberrations in tumors. Genes Chromosomes
Cancer 35, 97-112 (2002).
121. Vilenchik, M.M. & Knudson, A.G. Endogenous DNA double-strand breaks:
production, fidelity of repair, and induction of cancer. Proc Natl Acad Sci U S A 100,
12871-6 (2003).
122. Jeffs, A.R., Benjes, S.M., Smith, T.L., Sowerby, S.J. & Morris, C.M. The BCR gene
recombines preferentially with Alu elements in complex BCR-ABL translocations of
chronic myeloid leukaemia. Hum Mol Genet 7, 767-76 (1998).
123. So, C.W. et al. MLL self fusion mediated by Alu repeat homologous recombination
and prognosis of AML-M4/M5 subtypes. Cancer Res 57, 117-22 (1997).
124. Betti, C.J., Villalobos, M.J., Diaz, M.O. & Vaughan, A.T. Apoptotic triggers initiate
translocations within the MLL gene involving the nonhomologous end joining repair
system. Cancer Res 61, 4550-5 (2001).
125. Look, A.T. Oncogenic transcription factors in the human acute leukemias. Science
278, 1059-64 (1997).
126. De Weer, A. et al. EVI1 overexpression in t(3;17) positive myeloid malignancies
results from juxtaposition of EVI1 to the MSI2 locus at 17q22. Haematologica 93,
1903-7 (2008).
127. Bousquet, M. et al. Myeloid cell differentiation arrest by miR-125b-1 in
myelodysplastic syndrome and acute myeloid leukemia with the t(2;11)(p21;q23)
translocation. J Exp Med 205, 2499-506 (2008).
128. Shtivelman, E., Lifshitz, B., Gale, R.P. & Canaani, E. Fused transcript of abl and bcr
genes in chronic myelogenous leukaemia. Nature 315, 550-4 (1985).
129. Thomas, E.K., Cancelas, J.A., Zheng, Y. & Williams, D.A. Rac GTPases as key
regulators of p210-BCR-ABL-dependent leukemogenesis. Leukemia 22, 898-904
(2008).
130. Deininger, M., Buchdunger, E. & Druker, B.J. The development of imatinib as a
therapeutic agent for chronic myeloid leukemia. Blood 105, 2640-53 (2005).
131. Bousquet, M. et al. The t(8;9)(p22;p24) translocation in atypical chronic myeloid
leukaemia yields a new PCM1-JAK2 fusion gene. Oncogene 24, 7248-52 (2005).
132. Erickson, P. et al. Identification of breakpoints in t(8;21) acute myelogenous leukemia
and isolation of a fusion transcript, AML1/ETO, with similarity to Drosophila
segmentation gene, runt. Blood 80, 1825-31 (1992).
133. Frank, R. et al. The AML1/ETO fusion protein blocks transactivation of the GM-CSF
promoter by AML1B. Oncogene 11, 2667-74 (1995).
134. Pabst, T. et al. AML1-ETO downregulates the granulocytic differentiation factor
C/EBPalpha in t(8;21) myeloid leukemia. Nat Med 7, 444-51 (2001).
135. Vangala, R.K. et al. The myeloid master regulator transcription factor PU.1 is
inactivated by AML1-ETO in t(8;21) myeloid leukemia. Blood 101, 270-7 (2003).
136. Higuchi, M. et al. Expression of a conditional AML1-ETO oncogene bypasses
embryonic lethality and establishes a murine model of human t(8;21) acute myeloid
leukemia. Cancer Cell 1, 63-74 (2002).
137. Guo, A. et al. The function of PML in p53-dependent apoptosis. Nat Cell Biol 2, 730-
6 (2000).

111
138. Chakravarti, D. et al. Role of CBP/P300 in nuclear receptor signalling. Nature 383,
99-103 (1996).
139. He, L.Z. et al. Distinct interactions of PML-RARalpha and PLZF-RARalpha with co-
repressors determine differential responses to RA in APL. Nat Genet 18, 126-35
(1998).
140. Bousquet, M. et al. A novel PAX5-ELN fusion protein identified in B-cell acute
lymphoblastic leukemia acts as a dominant negative on wild-type PAX5. Blood 109,
3417-23 (2007).
141. Yoshida, H. et al. Accelerated degradation of PML-retinoic acid receptor alpha (PML-
RARA) oncoprotein by all-trans-retinoic acid in acute promyelocytic leukemia:
possible role of the proteasome pathway. Cancer Res 56, 2945-8 (1996).
142. Kelaidi, C. et al. Improved outcome of acute promyelocytic leukemia with high WBC
counts over the last 15 years: the European APL Group experience. J Clin Oncol 27,
2668-76 (2009).
143. Takeda, A., Goolsby, C. & Yaseen, N.R. NUP98-HOXA9 induces long-term
proliferation and blocks differentiation of primary human CD34+ hematopoietic cells.
Cancer Res 66, 6628-37 (2006).
144. Ghannam, G. et al. The oncogene Nup98-HOXA9 induces gene transcription in
myeloid cells. J Biol Chem 279, 866-75 (2004).
145. Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T. & Sauvageau, G. NUP98-
HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid
leukemias in mice. Embo J 20, 350-61 (2001).
146. Clappier, E. et al. The C-MYB locus is involved in chromosomal translocation and
genomic duplications in human T-cell acute leukemia (T-ALL), the translocation
defining a new T-ALL subtype in very young children. Blood 110, 1251-61 (2007).
147. Lahortiga, I. et al. Duplication of the MYB oncogene in T cell acute lymphoblastic
leukemia. Nat Genet 39, 593-5 (2007).
148. Persson, M. et al. Recurrent fusion of MYB and NFIB transcription factor genes in
carcinomas of the breast and head and neck. Proc Natl Acad Sci U S A 106, 18740-4
(2009).
149. Xiao, C. et al. MiR-150 controls B cell differentiation by targeting the transcription
factor c-Myb. Cell 131, 146-59 (2007).
150. Sankaran, V.G. et al. MicroRNA-15a and -16-1 act via MYB to elevate fetal
hemoglobin expression in human trisomy 13. Proc Natl Acad Sci U S A 108, 1519-24
(2011).
151. Pabst, T. et al. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer
binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat Genet 27, 263-70
(2001).
152. Mueller, B.U. et al. Heterozygous PU.1 mutations are associated with acute myeloid
leukemia. Blood 100, 998-1007 (2002).
153. Behre, G. et al. c-Jun is a JNK-independent coactivator of the PU.1 transcription
factor. J Biol Chem 274, 4939-46 (1999).
154. Petrovick, M.S. et al. Multiple functional domains of AML1: PU.1 and C/EBPalpha
synergize with different regions of AML1. Mol Cell Biol 18, 3915-25 (1998).
155. Mueller, B.U., Pabst, T., Hauser, P., Neuberg, D. & Tenen, D.G. Mutations of the
transcription factor PU.1 are not associated with acute lymphoblastic leukaemia. Br J
Cancer 94, 1918-20 (2006).
156. Falini, B. et al. Cytoplasmic nucleophosmin in acute myelogenous leukemia with a
normal karyotype. N Engl J Med 352, 254-66 (2005).

112
157. Okuda, M. et al. Nucleophosmin/B23 is a target of CDK2/cyclin E in centrosome
duplication. Cell 103, 127-40 (2000).
158. Grisendi, S. & Pandolfi, P.P. NPM mutations in acute myelogenous leukemia. N Engl
J Med 352, 291-2 (2005).
159. Cheng, K. et al. The cytoplasmic NPM mutant induces myeloproliferation in a
transgenic mouse model. Blood 115, 3341-5 (2010).
160. Nakao, M. et al. Internal tandem duplication of the flt3 gene found in acute myeloid
leukemia. Leukemia 10, 1911-8 (1996).
161. Yamamoto, Y. et al. Activating mutation of D835 within the activation loop of FLT3
in human hematologic malignancies. Blood 97, 2434-9 (2001).
162. Kottaridis, P.D. et al. The presence of a FLT3 internal tandem duplication in patients
with acute myeloid leukemia (AML) adds important prognostic information to
cytogenetic risk group and response to the first cycle of chemotherapy: analysis of 854
patients from the United Kingdom Medical Research Council AML 10 and 12 trials.
Blood 98, 1752-9 (2001).
163. Kiyoi, H. et al. Internal tandem duplication of the FLT3 gene is a novel modality of
elongation mutation which causes constitutive activation of the product. Leukemia 12,
1333-7 (1998).
164. Hayakawa, F. et al. Tandem-duplicated Flt3 constitutively activates STAT5 and MAP
kinase and introduces autonomous cell growth in IL-3-dependent cell lines. Oncogene
19, 624-31 (2000).
165. Spiekermann, K. et al. The protein tyrosine kinase inhibitor SU5614 inhibits FLT3
and induces growth arrest and apoptosis in AML-derived cell lines expressing a
constitutively activated FLT3. Blood 101, 1494-504 (2003).
166. Mardis, E.R. et al. Recurring mutations found by sequencing an acute myeloid
leukemia genome. N Engl J Med 361, 1058-66 (2009).
167. Yan, H. et al. IDH1 and IDH2 mutations in gliomas. N Engl J Med 360, 765-73
(2009).
168. Gross, S. et al. Cancer-associated metabolite 2-hydroxyglutarate accumulates in acute
myelogenous leukemia with isocitrate dehydrogenase 1 and 2 mutations. J Exp Med
207, 339-44 (2010).
169. Figueroa, M.E. et al. Leukemic IDH1 and IDH2 mutations result in a
hypermethylation phenotype, disrupt TET2 function, and impair hematopoietic
differentiation. Cancer Cell 18, 553-67 (2010).
170. Rainis, L. et al. Mutations in exon 2 of GATA1 are early events in megakaryocytic
malignancies associated with trisomy 21. Blood 102, 981-6 (2003).
171. King-Underwood, L. & Pritchard-Jones, K. Wilms' tumor (WT1) gene mutations
occur mainly in acute myeloid leukemia and may confer drug resistance. Blood 91,
2961-8 (1998).
172. Wechsler, J. et al. Acquired mutations in GATA1 in the megakaryoblastic leukemia of
Down syndrome. Nat Genet 32, 148-52 (2002).
173. Calligaris, R., Bottardi, S., Cogoi, S., Apezteguia, I. & Santoro, C. Alternative
translation initiation site usage results in two functionally distinct forms of the GATA-
1 transcription factor. Proc Natl Acad Sci U S A 92, 11598-602 (1995).
174. Hollanda, L.M. et al. An inherited mutation leading to production of only the short
isoform of GATA-1 is associated with impaired erythropoiesis. Nat Genet 38, 807-12
(2006).
175. Herman, J.G. et al. Distinct patterns of inactivation of p15INK4B and p16INK4A
characterize the major types of hematological malignancies. Cancer Res 57, 837-41
(1997).

113
176. Esteller, M. Epigenetics in cancer. N Engl J Med 358, 1148-59 (2008).
177. Figueroa, M.E. et al. DNA methylation signatures identify biologically distinct
subtypes in acute myeloid leukemia. Cancer Cell 17, 13-27 (2010).
178. Di Croce, L. et al. Methyltransferase recruitment and DNA hypermethylation of target
promoters by an oncogenic transcription factor. Science 295, 1079-82 (2002).
179. Liu, S. et al. Interplay of RUNX1/MTG8 and DNA methyltransferase 1 in acute
myeloid leukemia. Cancer Res 65, 1277-84 (2005).
180. Milne, T.A. et al. MLL targets SET domain methyltransferase activity to Hox gene
promoters. Mol Cell 10, 1107-17 (2002).
181. Manola, K.N. Cytogenetics of pediatric acute myeloid leukemia. Eur J Haematol 83,
391-405 (2009).
182. Ford, A.M. et al. In utero rearrangements in the trithorax-related oncogene in infant
leukaemias. Nature 363, 358-60 (1993).
183. Ford, A.M. et al. Fetal origins of the TEL-AML1 fusion gene in identical twins with
leukemia. Proc Natl Acad Sci U S A 95, 4584-8 (1998).
184. Gale, K.B. et al. Backtracking leukemia to birth: identification of clonotypic gene
fusion sequences in neonatal blood spots. Proc Natl Acad Sci U S A 94, 13950-4
(1997).
185. Wiemels, J.L. et al. In utero origin of t(8;21) AML1-ETO translocations in childhood
acute myeloid leukemia. Blood 99, 3801-5 (2002).
186. Alvarez Y., O.M., Escudero T., Ortega JJ., Bastida P., . Translocacion t(3;6)(p21;q26)
y trisomia 8 en un caso de leucemia aguda de precursores mieloides de basofilos.
XXXVIII Reunion nacional de la AEHH (1996).
187. Bernini, J.C., Timmons, C.F. & Sandler, E.S. Acute basophilic leukemia in a child.
Anaphylactoid reaction and coagulopathy secondary to vincristine-mediated
degranulation. Cancer 75, 110-4 (1995).
188. Dastugue, N. et al. Acute basophilic leukaemia and translocation t(X;6)(p11;q23). Br J
Haematol 98, 170-6 (1997).
189. Giagounidis, A.A. et al. Acute basophilic leukemia. Eur J Haematol 67, 72-6 (2001).
190. Ghosh, I., Bakhshi, S. & Gupta, R. Acute basophilic leukemia in an infant with
proptosis. Indian J Pathol Microbiol 54, 210-1 (2011).
191. Kritharis, A., Brody, J., Koduru, P., Teichberg, S. & Allen, S.L. Acute basophilic
leukemia associated with loss of gene ETV6 and protean complications. J Clin Oncol
29, e623-6 (2011).
192. Kurosawa, H., Eguchi, M., Sakakibara, H., Takahashi, H. & Furukawa, T.
Ultrastructural cytochemistry of congenital basophilic leukemia. Am J Pediatr
Hematol Oncol 9, 27-32 (1987).
193. Peterson, L.C., Parkin, J.L., Arthur, D.C. & Brunning, R.D. Acute basophilic
leukemia. A clinical, morphologic, and cytogenetic study of eight cases. Am J Clin
Pathol 96, 160-70 (1991).
194. Scolyer, R.A., Brun, M., D'Rozario, J. & Webb, M. Acute basophilic leukemia
presenting with abnormal liver function tests and the absence of blast cells in the
peripheral blood. Pathology 32, 52-5 (2000).
195. Shin, S.Y. et al. Monosomy 7 as the sole abnormality of an acute basophilic leukemia.
Cancer Genet Cytogenet 172, 168-71 (2007).
196. Shvidel, L. et al. Acute basophilic leukaemia: eight unsuspected new cases diagnosed
by electron microscopy. Br J Haematol 120, 774-81 (2003).
197. Staal-Viliare, A. et al. [A case of de novo acute basophilic leukaemia: diagnostic
criteria and review of the literature]. Ann Biol Clin (Paris) 64, 361-5 (2006).

114
198. Wick, M.R., Li, C.Y. & Pierre, R.V. Acute nonlymphocytic leukemia with basophilic
differentiation. Blood 60, 38-45 (1982).
199. Duchayne, E., Demur, C., Rubie, H., Robert, A. & Dastugue, N. Diagnosis of acute
basophilic leukemia. Leuk Lymphoma 32, 269-78 (1999).
200. Lichtman, M.A. & Segel, G.B. Uncommon phenotypes of acute myelogenous
leukemia: basophilic, mast cell, eosinophilic, and myeloid dendritic cell subtypes: a
review. Blood Cells Mol Dis 35, 370-83 (2005).
201. Chessells, J.M. et al. Clinical features, cytogenetics and outcome in acute
lymphoblastic and myeloid leukaemia of infancy: report from the MRC Childhood
Leukaemia working party. Leukemia 16, 776-84 (2002).
202. Belloni, E. et al. In vivo expression of an aberrant MYB-GATA1 fusion induces
leukemia in the presence of GATA1 reduced levels. Leukemia (2011).
203. Shimizu, R. et al. Leukemogenesis caused by incapacitated GATA-1 function. Mol
Cell Biol 24, 10814-25 (2004).
204. Burel, S.A. et al. Dichotomy of AML1-ETO functions: growth arrest versus block of
differentiation. Mol Cell Biol 21, 5577-90 (2001).
205. Mulloy, J.C. et al. The AML1-ETO fusion protein promotes the expansion of human
hematopoietic stem cells. Blood 99, 15-23 (2002).
206. Yuan, Y. et al. AML1-ETO expression is directly involved in the development of
acute myeloid leukemia in the presence of additional mutations. Proc Natl Acad Sci U
S A 98, 10398-403 (2001).
207. Takahashi, T. et al. Inhibitory interaction of c-Myb and GATA-1 via transcriptional
co-activator CBP. Oncogene 19, 134-40 (2000).
208. Anfossi, G., Gewirtz, A.M. & Calabretta, B. An oligomer complementary to c-myb-
encoded mRNA inhibits proliferation of human myeloid leukemia cell lines. Proc Natl
Acad Sci U S A 86, 3379-83 (1989).
209. Cazzaniga, G. et al. The paired box domain gene PAX5 is fused to ETV6/TEL in an
acute lymphoblastic leukemia case. Cancer Res 61, 4666-70 (2001).
210. Kawamata, N. et al. Cloning of genes involved in chromosomal translocations by
high-resolution single nucleotide polymorphism genomic microarray. Proc Natl Acad
Sci U S A 105, 11921-6 (2008).
211. Campana, D. Minimal residual disease in acute lymphoblastic leukemia. Hematology
Am Soc Hematol Educ Program 2010, 7-12 (2010).
212. Perea, G. et al. Prognostic value of minimal residual disease (MRD) in acute myeloid
leukemia (AML) with favorable cytogenetics [t(8;21) and inv(16)]. Leukemia 20, 87-
94 (2006).
213. Weisser, M., Haferlach, C., Hiddemann, W. & Schnittger, S. The quality of molecular
response to chemotherapy is predictive for the outcome of AML1-ETO-positive AML
and is independent of pretreatment risk factors. Leukemia 21, 1177-82 (2007).
214. Gewirtz, A.M. Myb targeted therapeutics for the treatment of human malignancies.
Oncogene 18, 3056-62 (1999).

115
AUTHOR: Cathy QUELEN

TITLE: The t(X;6)(p11;q23) chromosomal translocation involved in acute basophilic


leukaemia

Childhood acute myeloblastic leukemias are haematological malignancies frequently


associated with chromosomal translocations. The molecular characterization of these
chromosomal rearrangements highlights genes important in haematopoietic differentiation.
Furthermore, the discovery of recurrent chromosomal translocation is essential for the
detection of residual disease, establishment of prognostic value and therapeutic choices. Acute
basophilic leukemia is a rare sub-type of acute myeloblastic leukaemia. Despite rare cases of
t(X;6)(p11;q23) translocation reported for this pathology, no molecular characterization was
available until recently.
The aim of our work was to characterize genes rearrangement in four cases of male
infants carrying t(X;6). Because of its location on chromosome 6q23, MYB was a good
candidate gene. Our molecular investigations, based on fluorescence in situ hybridization and
rapid amplification of cDNA ends, revealed a complex chromosomal rearrangement leading
to the creation of a MYB–GATA1 fusion gene. Moreover, this translocation is associated with
an invalidation of the GATA1 gene located on chromosome X. These two proteins are master
regulators of haematopoiesis. GATA1 is essential for normal erythropoiesis and MYB is
involved in hematopoietic stem cell renewal and myeloid differentiation. Expression of MYB–
GATA1 in mouse lineage-negative cells committed them to the granulocyte lineage and
blocked them at an early stage of differentiation. Moreover, this protein increased clonogenic
potential. Taken together, these results establish, for the first time, a link between a recurrent
chromosomal translocation and the development of this particular subtype of infant leukemia

KEYWORDS: chromosomal translocation, acute basophilic leukaemia, MYB, GATA1,


hematopoietic differentiation.