Vous êtes sur la page 1sur 38

UNIVERSITÉ SORBONNE PARIS NORD

U.F.R LÉONARD DE VINCI SANTÉ-


MÉDECINE-BIOLOGIE HUMAINE BOBIGNY

************

MASTER "BIOLOGIE - SANTE" AXE "THERAPIES ET


ème
TECHNOLOGIES DU VIVANT" 2 ANNEE

MÉMOIRE DE STAGE

************

GUERRACHE ABDERRAHMANE

Etude de l’activation de TP53 en réponse à un dysfonctionnement


mitochondrial

Unité CNRS/Paris Saclay UMR 9018 METSY


(Aspects métaboliques et systémiques de l’oncogenèse pour de nouvelles
approches thérapeutiques)
Equipe Plasticité métabolique en physiopathologie
Institut Gustave Roussy – 114 Rue Edouard Vaillant, 94800 Villejuif

Directrice de l’équipe : Dr Nazanine Modjtahedi


Encadrante de stage : Kenza Nedara

Année universitaire : 2019/2020

1
REMERCIEMENTS
Je tiens à remercier toutes les personnes qui ont contribué au succès de mon stage et qui m’ont
aidé lors de la rédaction de ce mémoire.

Je voudrais dans un premier temps remercier les membres du jury pour m'avoir fait l'honneur
d'évaluer mon travail et de discuter ses résultats.

Je remercie, avec toute ma reconnaissance, le Dr Nazanine MODJTAHEDI pour m'avoir fait


confiance à travers son accueil au sein de son équipe. Je la remercie pour son engagement
dans ma formation, pour ses critiques constructives, pour le temps qu'elle a consacré pour moi
et pour son professionnalisme qui m’a permis d'apprendre une méthodologie de travail. Cette
méthodologie sera, sans doute, indispensable dans ma carrière professionnelle.

Je remercie Kenza NEDARA pour m'avoir accompagné et encadré. Merci pour ta patience et
ton aide Kenza. Je te souhaite une belle réussite.

Je remercie le Dr Camille Reinhardt pour son aide et son bon humeur.

Je remercie les membres de l'équipe 1 de l’unité METSY « Aspects métaboliques et


systémiques de l'oncogenèse pour de nouvelles approches thérapeutiques ». Je remercie
chaleureusement madame la directrice de l’unité Dr Catherine BRENNER.

Enfin, c'est avec beaucoup d'émotions, que je remercie mes professeurs enseignants, mes
parents qui ont été toujours à mes côtés, mon frère et ma sœur, ma famille et mes proches,
pour leurs encouragements et leur soutien.

2
ABREVIATIONS
°C : Degrés Celcius

ADN : Acide DésoxyriboNucléique

ADNmt : ADN mitochondrial

AIF : Apoptosis Inducing Factor

ALR : Augmenter of liver regeneration

ARN : Acide RiboNucléique

ARNm : ARN messager

α-KG : α-cétoglutarate

ATP : Adénosine triphosphate

BBC3 : Bcl-2-binding component 3

BTG2 : BTG Anti-Proliferation Factor 2

CCNG1 : Cyclin G1 Protein Coding gene

CDKN1A : Cyclin Dependent Kinase Inhibitor 1A

CHCHD : Coiled coil-helix1-coiled coil-helix2 domain

CHCHD4 : Coiled-coil-helix-coiled-coil-helix domain containing 4

CHX : Cycloheximide

CPC : Cystéine-proline-cystéine

Covid19 : CoronaVirus Disease 2019

DMEM : Dulbecco's Modified Eagle Medium

DMSO: Diméthylsulfoxyde

ECL : Enhanced Chemiluminescence

EndoG : Endonucléase G

Erv1 : Essential for respiration and viability 1

FADH 2 : Flavin adenine dinucleotide dihydrogen

HRP : Horse Radish Peroxydase

IMS : Espace intermembranaire

3
kDa : Kilodalton

MDM2 : Murine double minute 2

Mdm35 : Mitochondrial distribution and morphology protein 35

Mia40 : Mitochondrial intermembrane space import and assembly

MIM : Mitochondrial import

NADH : Nicotinamide adenine dinucleotide hydrogen

OXPHOS : Phosphorylation oxydative

p21: Proteine 21, cyclin-dependent kinase inhibitor 1

PBS : Phosphate Buffer Solution

ROS : Reactive oxygen species

RPS27L : Ribosomal Protein S27 Like

RT-qPCR : Reverse Transcription – quantitative Polymerase Chain Reaction

SAM : Sorting and assembly machinery

SDS : Sodium Disulfide

SDS-PAGE : SDS- Polycrylamide Gel Electrophoresis

shRNA : Short hairpin RNA

SVF : Sérum de veau fœtal

TBST : Tris buffered Saline buffe Tween

TCA : Tricarboxylic acid

TIM : Translocase of the inner membrane

TOM : Translocase of the outer mitochondrial membrane

TP53 : Tumor protein 53

YME1L : Mitochondrial Inner-Membrane Métalloprotéase

4
LISTE DES FIGURES
Figure 1 : La mitochondrie : un organite bifonctionnel.

Figure 2 : La mitochondrie est une organelle structurée en 4 sous-compartiments.

Figure 3 : Voies métaboliques et sources de carbone dans la mitochondrie.

Figure 4 : L’import mitochondrial et ses machineries chez les mammifères.

Figure 5 : Fonctionnement de la machinerie d’import mitochondriale CHCHD4/Mia40 et ses


substrats.

Figure 6 : Représentation schématique des résultats préliminaire de l’équipe

Figure 7 : La perturbation mitochondriale causée par la perte de HSPC132 provoque un stress


cellulaire impliquant l'activation de TP53.

Figure 8 : Etude de l’effet de la déplétion de HSPC132 sur la stabilité de la protéine TP53

Figure 9 : Etude de l’interaction entre TP53 et MDM2 dans les cellules déplétées pour
HSPC132.

5
TABLE DES MATIERES

1 INTRODUCTION ...................................................................................... 9
1.1 La mitochondrie : un organite bifonctionnel .............................................................9
1.1.1 La mitochondrie : origine, description et structure .............................................9
1.1.2 La mitochondrie : un acteur majeur de la survie cellulaire ............................... 11
1.2 La mitochondrie : un organite totalement dépendant du noyau ................................ 13
1.2.1 Import mitochondrial et les différents types de machinerie : ............................ 14
1.2.2 La machinerie d'import contrôlée par AIF/CHCHD4 et ses substrats : ............. 15
1.2.2.1 L’évolution de la voie d’import CHCHD4/Mia40 de la levure à l’homme .... 16
1.2.2.2 La voie d’import CHCHD4/Mia40, fonctionnement et contrôle qualité : ......16
1.2.2.3 Les protéines substrats de la machinerie CHCHD4/Mia40 : ......................... 17
1.3 Problématique et objectifs ...................................................................................... 19
2 MATERIELS ET METHODES .............................................................. 23
2.1 Matériels ................................................................................................................ 23
2.1.1 Lignée cellulaire .............................................................................................. 23
2.1.2 Anticorps......................................................................................................... 23
2.1.3 Liste des shRNA ............................................................................................. 23
2.1.4 Molécules chimiques ....................................................................................... 24
2.1.5 Amorces utilisées pour amplification de séquences spécifiques d’ADNc par
qPCR ………………………………………………………………………………….24
2.2 Méthodes................................................................................................................ 24
2.2.1 Culture cellulaire ............................................................................................. 24
2.2.2 Transduction lentivirale ................................................................................... 24
2.2.2 Préparation et quantification des extraits protéiques totaux pour immunoblot .. 25
2.2.4 Analyse des protéines par immunoblot ............................................................ 25
2.2.5 Extraction des ARN totaux pour analyse de l’expression de gènes par RTqPCR
………………………………………………………………………………….25
2.2.6 Rétro-transcription des ARNs et quantification de l’expression des gènes par
qPCR ………………………………………………………………………………….26
2.2.7 Évaluation de la demi-vie des protéines ........................................................... 26
2.2.2 Préparation et quantification des extraits protéiques totaux pour
immunoprécipitation......................................................................................................26
2.2.9 Immunoprécipitation des protéines .................................................................. 26
3 RESULTAT .............................................................................................. 27
3.1 Etude de l’effet de la déplétion de HSPC132 sur l’expression de la protéine TP53 .. 27

6
4 DISCUSSION ET PERSPECTIVES ...................................................... 30
4.1 Etude de l’effet de la déplétion de HSPC132 sur l’expression de la protéine TP53 .. 30
4.2 Etude des mécanismes moléculaires de l’induction de TP53 dans les cellules
déplétées pour HSPC132 ................................................................................................... 31
4.2.1 Etude de l’effet de la déplétion de HSPC132 sur la stabilité de la protéine TP53
………………………………………………………………………………….31
4.2.2 Etude de l’effet de la déplétion de HSPC132 sur la dégradation de TP53 par
MDM2 ………………………………………………………………………………….32
5 CONCLUSION ........................................................................................ 34
6 REFERENCES BIBLIOGRAPHIQUES ................................................ 35

7
RESUME
Notre équipe étudie le rôle du métabolisme mitochondrial dans la prolifération des cellules cancéreuses, avec un
intérêt particulier pour le dialogue mitochondrio-nucléaire. Cet intérêt est justifié par le fait que presque toutes
les protéines mitochondriales sont importées dans l'organite grâce à l'activité de machineries d'import
spécialisées. Notre équipe a focalisé ses études sur une machinerie d'import qui dépend du complexe
AIF/CHCHD4 et contrôle l'import d'une famille de petites protéines porteuses de motifs cystéine (substrats),
essentielles à la survie des cellules, à l'adaptation au stress ou à l'induction de l'apoptose. Étant donné que
certains des substrats importés par cette machinerie sont considérés comme des cibles thérapeutiques potentielles
à travers leur implication dans des activités mitochondriales, comme la biogenèse des complexes de la chaîne
respiratoire, l’homéostasie lipidique, l’ultrastructure mitochondriale, le stockage du calcium ou encore la
traduction du génome mitochondrial, il est crucial de caractériser au niveau moléculaire et fonctionnel chacune
de ces protéines qui sont assez mal connues chez l’homme. HSPC132 est l’un de ces substrats qui a été décrit
pour son rôle dans l’homéostasie lipidique de la membrane mitochondriale interne. Les travaux non publiés de
l’équipe montrent que la déplétion de cette protéine perturbe l’ultrastructure mitochondriale, inhibe la
prolifération des cellules cancéreuses et induit un changement global de l’expression génique. Ces mêmes
travaux suggéraient que le dysfonctionnement mitochondrial provoqué par la perte de HSPC132 pouvait activer
la voie de signalisation médiée par le produit du gène suppresseur de tumeur TP53. Au cours de mon stage de
master M2, j’ai validé cette hypothèse en montrant l’induction de l’expression de la protéine TP53 en réponse à
la déplétion de HSPC132. Ce travail sera poursuivi afin de déterminer les mécanismes moléculaires à l’origine
de l’activation de TP53 et étudier l’implication de cette voie dans l’inhibition de la prolifération des cellules
cancéreuses ayant perdu HSPC132.

Mots clés : Communication mitochondrio-nucléaire, dysfonctionnement mitochondrial, signalisation de stress


cellulaire, prolifération des cellules cancéreuses.

ABSTRACT
Our team studies the role of mitochondrial metabolism in cancer cell proliferation, with a particular interest in
mitochondrio-nuclear dialogue. This interest is justified by the fact that almost all mitochondrial proteins are
imported into the organelle through the activity of specialized import machineries. Our team has focused its
studies on an import machinery that depends on the AIF/CHCHD4 complex and controls the import of a family
of small proteins carrying cysteine motifs (substrates), essential for cell survival, adaptation to stress or induction
of apoptosis. Since some of the substrates imported by this machinery are considered potential therapeutic
targets through their involvement in mitochondrial activities, such as biogenesis of respiratory chain complexes,
lipid homeostasis, mitochondrial ultrastructure, calcium storage or mitochondrial genome translation, it is crucial
to characterize at the molecular and functional level each of these proteins that are not well characterized in man.
HSPC132 is one of these substrates that has been described for its role in the lipid homeostasis of the inner
mitochondrial membrane. Our team's unpublished work shows that the depletion of this protein disrupts
mitochondrial ultrastructure, inhibits cancer cell proliferation and induces an overall change in gene expression.
The same work suggested that mitochondrial dysfunction caused by the loss of HSPC132 could activate the
signaling pathway mediated by the product of the TP53 tumor suppressor gene. During my master M2
internship, I validated this hypothesis by showing the induction of TP53 expression in response to HSPC132
depletion. This work will be continued in order to determine the molecular mechanisms at the origin of TP53
activation and study the implication of this pathway in the inhibition of the proliferation of cancer cells that have
lost HSPC132.

Keywords: Mitochondrio-nuclear communication, mitochondrial dysfunction, cellular stress signaling, cancer


cell prolifération.

8
1 INTRODUCTION

1.1 La mitochondrie : un organite bifonctionnel

La mitochondrie est un organite bifonctionnel. D'une part, elle joue un rôle


indispensable dans la survie des cellules en contrôlant leur métabolisme. D'autre part, dans
des conditions de stress létal, la mitochondrie participe à la signalisation cellulaire qui engage
le processus irréversible de mort cellulaire (Figure 1) [1-4].
Dans la cellule saine, la mitochondrie transforme l’énergie des molécules organiques (issues
de la digestion des sucres, protéines et lipides) en énergie (sous forme d’ATP) immédiatement
utilisable par la cellule [5]. Par contre, dans la cellule induite à mourir, la mitochondrie
devient un centre intégrateur de divers signaux de stress et participe ainsi à la mort cellulaire
programmée, entre autres, en libérant des protéines pro-apoptotiques telles que Cytochrome c
(Cytc), Smac/Diablo, HtrA2/omi ou l’endonucléase G (EndoG) qui entrainent la cellule vers
la phase irréversible de la mort [3]. De plus, sous certaines conditions de stress qui entraînent
une altération de la mitochondrie accompagnée par une surproduction des espèces réactives
de l’oxygène (ROS), la cellule doit répondre aux dysfonctionnements mitochondriaux pour
survivre. Dans ce contexte, le procédé le plus efficace engagé par la cellule est la mitophagie,
à savoir l'élimination spécifique par autophagie des mitochondries défectueuses (Figure 1)
[6].

1.1.1 La mitochondrie : origine, description et structure

Les mitochondries seraient apparues, il y a environ 2 milliards d'années, lors de


l'enrichissement de l'atmosphère primitive en oxygène. Elles résultent de l'incorporation d'une
alphaprotéobactérie endosymbiotique dans une cellule qui est à l'origine de la cellule
eucaryote actuelle. Cette endosymbiose aurait permis à la cellule eucaryote d'utiliser
l'oxygène comme une source de production d'énergie. [7-9].

9
Figure 1 : La mitochondrie : un organite bifonctionnel. La mitochondrie est nécessaire à la
survie cellulaire à travers la production d’ATP grâce à la chaine respiratoire OXPHOS, à travers sa
participation à la synthèse des macromolécules et sa participation à des évènements extra
mitochondriaux comme la régulation de l’expression génique et signalisation à travers la production
des métabolites intermédiaires. La mitochondrie joue aussi un rôle dans la réponse de la cellule aux
stress à travers la régulation de la mitophagie, l’implication dans le stress oxydant et également la
réponse aux stress irréversibles qui mène la cellule vers la mort programmée. Figure inspirée de
Masgras, Front Oncol. 2017.

La mitochondrie, dont le nombre varie selon le type cellulaire, est un petit organite en forme
de bâtonnet de 1-2 μm long, qui a une double membrane et qui renferme son propre génome
(Figure 2). La membrane externe est pauvre en protéines et semi-perméable car elle permet le
passage d’ions et de métabolites de faible poids moléculaire. Par contre, la membrane interne
est riche en protéines et est considérée comme étant pratiquement imperméable. En effet, les
métabolites ne peuvent être transportés à travers la membrane interne qu’à l’aide de
complexes protéiques spécialisés. L’espace qui se trouve entre les deux membranes est connu
sous le nom de l’espace intermembranaire (IMS) et renferme des protéines qui jouent des
rôles importants dans la régulation de diverses fonctions mitochondriales (voir plus loin). La
membrane interne cloisonne l’espace intérieur de la mitochondrie appelé la matrice
mitochondriale [10].

10
L’ADNmt circulaire ainsi que les enzymes du cycle de Krebs (cycle TCA pour tricarboxylic
acid cycle) et de la voie de la β oxydation des acides gras (FAO) se trouvent localisés dans la
matrice mitochondriale (Figures 2 et 3).
La chaine respiratoire qui est composée de cinq complexes multi-protéiques est ancrée au
niveau de la membrane interne dont la surface est accrue grâce à la formation de crêtes.
L’organisation de l’ultrastructure des crêtes varie selon l’état métabolique des mitochondries
et permet ainsi le réajustement de l’activité de la chaine respiratoire (Figures 2 et 3) [11].

Figure 2 : La mitochondrie est une organelle structurée en 4 sous-compartiments. A :


Représentation schématique de la structure d’une mitochondrie en 3D : La mitochondrie a un
diamètre de 1-2 µm de long et environ 0,1-0,5 µm de large. Elle est constituée de 2 membranes : une
membrane externe et une membrane interne, structurée en invaginations que l'on appelle les crêtes.
Cette membrane sépare l'espace intermembranaire de la matrice qui héberge un ADN circulaire
mitochondrial. B : Observation d'une mitochondrie par microscope électronique à transmission :
Grossissement : 72,500X. Mt : mitochondrie. Photos prises sur internet.

1.1.2 La mitochondrie : un acteur majeur de la survie cellulaire

Les mitochondries jouent un rôle fondamental dans le métabolisme cellulaire. Comme


mentionné plus haut, elles jouent un rôle bioénergétique majeur au sein de la cellule eucaryote
[4]. En effet, c'est au niveau de cet organite que l'énergie fournie par les molécules organiques
est récupérée, puis stockée sous forme d'ATP, grâce à l'activité du cycle de Krebs et aux
phosphorylations oxydatives qui ont lieu au niveau de la chaîne respiratoire (Figure 3).

11
Figure 3 : Voies métaboliques et sources de carbone dans la mitochondrie. Présentation
des voies métaboliques dans la mitochondrie (cycle TCA, β-oxydation et la phosphorylation
oxydative). Le cycle TCA est une succession de réactions oxydatives qui permet de stocker des
électrons dans deux agents réducteurs : NADH et FADH2. Ces molécules déposent ensuite les
électrons dans la chaîne respiratoire. Grâce à des phosphorylations oxydatives en série, la chaîne
respiratoire transfère les électrons jusqu'à l'oxygène dans la matrice et expulse des protons dans l'IMS.
Un gradient électrochimique se crée et permet au complexe V de générer de l'ATP dans la matrice.
Trois sources de carbone permettent d'alimenter le cycle TCA: Le pyruvate issu en grande partie du
catabolisme du glucose, le glutamate issu du catabolisme de la glutamine et les acides gras après β-
oxydation dans la matrice mitochondriale. Inspirée de Dimauro et al.N Engl J Med. 2003.

La chaîne respiratoire crée un gradient électrochimique par le transfert couplé d'électrons à


l'oxygène et le transport de protons de la matrice à travers la membrane interne dans
l’IMS. Le gradient électrochimique alimente le complexe terminal V de la chaîne, l'ATP
synthase, qui catalyse la synthèse de la plupart des ATP cellulaires [12]. Le bon
fonctionnement de la chaine respiratoire nécessite un apport en électrons qui est assuré par le
cycle TCA. Il s'agit d'une succession de réactions d'oxydation de molécules carbonées qui
permettent principalement la réduction des coenzymes FADH (pour Flavin
adeninedinucleotidedihydrogen) et NADH (pour Nicotinamide adenine dinucleotide
hydrogen). Ces derniers alimentent la chaine respiratoire en électrons. Deux sources de
carbone majeures permettent l'apport en acétyl-CoA pour le cycle TCA. D'une part, le glucose

12
est transformé, dans le cytoplasme, en pyruvate via la glycolyse. Le pyruvate entre ensuite
dans la matrice mitochondriale où il est transformé en acétyl-coA. D'autre part, la beta-
oxydation des acides gras (la voie FAO), qui a lieu dans la matrice mitochondriale, permet
l'hydrolyse des acides gras en acétyl-coA. Par ailleurs, quelques acides aminés peuvent être
transformés en métabolites intermédiaires du cycle TCA. Entre autres la glutamine,
transformée en glutamate, peut donner naissance à l'α-cétoglutarate (α-KG). (Figure 3) [13].

En plus de l'ATP, les mitochondries produisent des précurseurs métaboliques pour les
macromolécules telles que les lipides, les acides aminés, le cholestérol, le glucose, l’hème,
l'ADN et l'ARN. Elles génèrent également des métabolites intermédiaires, entre autres,
dérivés du cycle TCA comme le succinate et fumarate, l’acétyl-CoA, le NADH, le FADH2 et
l'α-cétoglutarate. Ces métabolites participent non seulement à l’activité de la chaine
respiratoire mais prennent part également à des activités extra-mitochondriales qui permettent
à la mitochondrie d’adapter son activité aux besoins énergétique de la cellule aussi bien dans
des conditions physiologiques qu’en réponse à des conditions de stress ou d’adaptation aux
changements environnementaux. (Figures 1 et 3) [13].

1.2 La mitochondrie : un organite totalement dépendant du noyau

La transition d'une bactérie endosymbiotique à un organite permanent a entraîné un


nombre considérable de changements évolutifs. En l'occurrence, l’intégration progressive des
gènes bactériens dans le génome nucléaire a renforcé la relation endosymbiotique des
mitochondries avec la cellule et la régulation de l’activité mitochondriale est passée sous le
contrôle du compartiment nucléaire [7].
Bien que les mitochondries possèdent leur propre génome, leur biogenèse et leur
activité sont totalement dépendantes du noyau. En effet, le génome mitochondrial ne code que
pour 13 protéines, 22 ARN de transfert et 2 ARN ribosomiques, alors que le bon
fonctionnement des mitochondries nécessite l’import de 1000 à 1500 protéines. Ces dernières
sont codées par le génome nucléaire et importées dans l'un des quatre sous-compartiments de
la mitochondrie, à savoir les membranes externe et interne, la matrice et l’IMS (Figure 4) [4,
14, 15]. Entre autres, grâce à l'expression de facteurs de transcription et des régulateurs
traductionnels, le noyau régule l'expression des gènes nucléaires codant pour des protéines
mitochondriales. Ces protéines sont impliquées dans toutes les fonctions mitochondriales à
commencer par l'import de ces mêmes protéines dans la mitochondrie, la biogenèse et
l'assemblage des complexes de la chaîne respiratoire, la réplication, la transcription et la

13
traduction du génome mitochondrial, ainsi que l'ensemble des enzymes mitochondriales
impliquées dans les différentes voies métaboliques (cycle de krebs, Beta-oxydation des acides
gras, phosphorylation oxydative). [16].

1.2.1 Import mitochondrial et les différents types de machinerie

L’import protéique mitochondrial est un processus cellulaire fondamental, finement


régulé, qui peut être influencé par les différents états d’activation de la cellule ou affecté par
des états pathologiques tels que le stress oxydant, le vieillissement et le cancer [2, 4].
Les protéines mitochondriales sont quasiment toutes codées par le génome nucléaire et
nécessitent d'être importées dans la mitochondrie. Ainsi, au cours de l'évolution, plusieurs
machineries d'import se sont développées [4, 17, 18]. La plupart de ces machineries d'import
protéique ont été identifiées et caractérisées dans le modèle de levure Saccharomyces
cerevisiae et sont majoritairement conservés chez les mammifères [19]. Brièvement, les
protéines mitochondriales codées par le génome nucléaire entrent dans la mitochondrie via la
porte d’entrée générale, la translocase de la membrane externe TOM40, puis sont prises en
charge par différentes machineries d'import selon leur séquence et leur sous-compartiment de
destination (Figure 4) [19, 20]. Aujourd'hui, 5 voies d'import mitochondrial sont décrites : 1)
la voie pour l'import des protéines contenant une pré-séquence N-terminale qui fonctionne
comme un signal d'adressage mitochondrial. Ces protéines sont destinées à la membrane
interne et de la matrice et sont prises en charge par la translocase de la membrane interne
TIM23 ; 2) la voie pour l’import des transporteurs de la membrane interne qui sont
hydrophobes et ne possèdent pas de pré-séquence et sont prises en charge par le complexe
TIM22 ; 3) la voie d'import pour les protéines avec une structure en tonneau ß qui sont
insérées dans la membrane externe grâce à l’activité de la machinerie SAM (pour sorting and
assembly machinery) ; 4) la voie d’import des protéines de la membrane externe à hélice α qui
fait intervenir le complexe de la membrane externe MIM (pour mitochondrial import) ; et
enfin 5) la voie d'import pour les protéines à motifs cystéines de l'IMS contrôlée par l’oxydase
CHCHD4/Mia40 (Figure 4) [16-19, 21].

14
Figure 4 : L’import mitochondrial et ses machineries chez les mammifères. Les protéines
mitochondriales codées par le génome nucléaire, rentrent dans la mitochondrie via le complexe TOM.
Selon les séquences qu’elles portent et leurs destinations finales, elles seront prises en charge par
différentes machineries. On distingue 5 voies d’import de protéines mitochondriales : la voie pour
l'import des protéines de la membrane interne et de la matrice contenant une pré-séquence, la voie
pour les transporteurs de la membrane interne sans pré-séquence, les voies d'import pour les protéines
de la membrane externe avec une structure en tonneau ß ou en hélice α et la voie d'import pour les
protéines à motifs cystéines de l'IMS contrôlée par la protéine CHCHD4/Mia40.

1.2.2 La machinerie d'import contrôlée par AIF/CHCHD4 et ses


substrats

Notre laboratoire s’intéresse particulièrement à la machinerie d’import mitochondrial,


qui dépend de l’oxydase CHCHD4/Mia40 et qui régule l’import dans l’IMS d’un petit nombre
de protéines (substrats) à motifs cystéines. Etant donné que certains des substrats importés par
cette machinerie sont considérés comme des cibles thérapeutiques potentielles à travers leur
implication dans la survie cellulaire, l'adaptation au stress ainsi que l’induction de l’apoptose,
il est crucial de caractériser au niveau moléculaire et fonctionnel chacune de ces protéines qui
sont assez mal connues chez l’homme et de comprendre les bases moléculaires de la
régulation de leur import par la machinerie CHCHD4/MiA40 [17, 18].

15
1.2.2.1 L’évolution de la voie d’import CHCHD4/Mia40 de la levure à
l’homme

La voie d’import MIA (pour Mitochondrial IMS import and assembly), qui fonctionne
dans l’IMS et régule l'import de la moitié des protéines dans ce sous-compartiment, a été
initialement découverte chez la levure mais reste conservée chez les mammifères. Chez la
levure, le composant central de la machinerie est une protéine de 40 kDA (Mia40), qui est
ancrée dans la membrane interne de l’organelle. Mia40 reconnait ses protéines substrats qui
contiennent des motifs cystéines particuliers (CX3C) 2 ou (CX9C) 2 et ensuite, grâce à son
motif CPC, elle catalyse la formation de ponts disulfures qui permettent le repliement et la
rétention des substrats au niveau de l'IMS. L’oxydation du substrat est concomitante avec la
réduction du motif CPC de Mia40. Pour être de nouveau fonctionnelle, la protéine Mia40 doit
être recyclée par la protéine Erv1 qui re-oxyde le motif CPC [18, 22, 23].

Des comparaisons structurelles et fonctionnelles de la protéine Mia40 de la levure et son


homologue humain CHCHD4 montrent que les principales caractéristiques catalytiques et
structurelles de Mia40, en particulier au sein des segments qui contiennent le motif CPC et
(CX9C) 2 ont été conservées au cours de l'évolution eucaryote. Toutefois, une différence
importante est apparue. Plus précisément, au cours de l'évolution de la levure vers l'homme,
Mia40 a perdu son segment d'ancrage membranaire et est devenue une petite protéine de 16
kDA nommée CHCHD4. C’est dans ce format que notre laboratoire a révélé sa capacité
d'interagir avec la protéine mitochondriale AIF [24].

Notre équipe fut la première à montrer que l’interaction entre CHCHD4 et AIF était
nécessaire à la régulation de cette voie d'import mitochondrial chez les mammifères (Figure
5). De plus, l’équipe a montré que dans les cellules de mammifères, grâce à son interaction
avec la protéine AIF, CHCHD4 jouait un rôle crucial dans la survie cellulaire à travers la
régulation de la biogenèse de la chaîne respiratoire [17, 18, 24-29].

1.2.2.2 La voie d’import CHCHD4/Mia40, fonctionnement et contrôle


qualité

Même s'il n'est pas encore clair dans quelle mesure l'interaction avec AIF affecte l'état
redox et la disponibilité du CHCHD4, il est établi qu’AIF est un acteur important requis pour
l'import co-traductionnelle du CHCHD4 dans l'IMS [24] .

16
La perte ou le dysfonctionnement d’AIF entraine la perte de la protéine CHCHD4 qui par
conséquent impact négativement sur l’import des substrats de CHCHD4 [17, 28]. Chez
l’homme, le recyclage redox de CHCHD4 est régulé par la protéine ALR qui est l’homologue
humain de la protéine Erv1 de la levure. (Figure 5) [17, 18].

Le repliement oxydatif des protéines orchestré par CHCHD4/Mia40 est un processus


complexe et très organisé. La fonction optimale de cette voie d'import repose sur un point de
contrôle de qualité des protéines mitochondriales. Les protéines mal repliées sont soit
directement dégradées dans l'organite grâce à l'activité protéolytique de YME1L, soit rétro-
transloquées dans le cytoplasme et dégradées par le protéasome. Le résultat final est d'assurer
l'élimination des protéines mal-repliées et dysfonctionnelles qui peuvent influencer le
fonctionnement de la machinerie d’import contrôlée par CHCHD4/Mia40. Par ailleurs, les
données publiées semblent indiquer que ce mécanisme de contrôle qualité est également
impliqué dans la régulation de la voie d’import dépendante de CHCHD4/Mia40 en limitant
l’import de ces protéines dans l’IMS. Ce mécanisme a probablement évolué afin de maintenir
un certain niveau d'adaptation aux besoins métaboliques spécifiques de la cellule [18, 24, 30].

1.2.2.3 Les protéines substrats de la machinerie CHCHD4/Mia40

La découverte du système d’import mitochondrial contrôlé par AIF/CHCHD4, chez les


mammifères, a mis la lumière sur une vingtaine de substrats potentiels de CHCHD4 qui,
d’après les données de la littérature, seraient impliqués dans un large panel d’activités
mitochondriales, comme la biogenèse des complexes de la chaîne respiratoire, l’homéostasie
lipidique, la plasticité mitochondriale, le stockage du calcium ou encore la traduction du
génome mitochondrial. (Figure 5) [17].
La majorité des connaissances actuelles sur les substrats de CHCHD4/MIA40 ont été acquises
chez la levure. Typiquement, ces substrats sont des protéines de taille relativement petite
(généralement inférieure à 25 kDa) et partagent une structure en hélice hélicoïdale 1 - hélice
hélicoïdale 2 (CHCHD). Dans chacune des hélices, il y a deux cystéines séparées par 3
(CX3C) ou 9 (CX9C) acides aminés, les deux motifs de cystéine étant juxtaposés l'un à l'autre
et reliés par des liaisons disulfures intramoléculaires [31, 32]. En fonction de leurs motifs
cystéines, ils peuvent être regroupés dans trois catégories: (i) Les substrats portant un motif
(CX3C)2: Ce sont principalement des protéines de la famille des petites protéines TIM. Elles
sont impliquées dans l'import des protéines de la membrane interne et externe. (ii) Les
substrats portant un motif (CX3C)9: Ils sont principalement impliquées dans l'activité de la

17
chaine respiratoire. Soit directement, en contrôlant la biogenèse et l'assemblage de la chaine
respiratoire [31, 33, 34]. Soit indirectement, en contrôlant l'ultrastructure de la membrane
mitochondriale interne. Ils sont aussi impliqués dans d'autres fonctions mitochondriales
comme l'homéostasie lipidique ou alors la traduction mitochondriale. (iii) En plus des
protéines précitées, des substrats de CHCHD4/MIA40 portant d'autres motifs cystéines
atypiques ont été rapportés (Figure 5) [17].

Figure 5 : Fonctionnement de la machinerie d’import mitochondriale CHCHD4/Mia40


et ses substrats. Les substrats de cette machinerie sont codés par le génome nucléaire et portent,
pour la grande majorité, des motifs cystéines (CX3C)2 ou (CX9C)2. Après leur passage à travers la
translocase TOM, ces substrats sont oxydés par CHCHD4, ce qui entraîne leur repliement par la
formation de ponts disulfures. Suite à leur repliement, les substrats correctement repliés sont retenus
dans l'IMS et impliqués dans de nombreuses activités mitochondriales comme l'import, la biogenèse
de la chaîne respiratoire, l'homéostasie lipidique, le contrôle de l'ultrastructure de la membrane interne
et la signalisation du calcium. Pour son fonctionnement optimal, CHCHD4 nécessite d'interagir avec
le complexe AIF/NADH. Les électrons générés par l'oxydation des substrats (petite flèche rouge) sont
transférés de motif CPC de CHCHD4 à ALR puis au cytochrome c (Cyto C), au complexe IV de la
chaîne respiratoire et enfin à l'oxygène. Il est possible également que ALR transfère les électrons
directement à l'oxygène. Ainsi, ALR permet de réduire l'enzyme CHCHD4 pour qu'elle puisse oxyder
de nouveaux substrats. D’après Reinhardt et al., BBADIS (2020)

De par leur implication dans les fonctions mitochondriales majeures, ces substrats jouent des
rôles primordiaux dans l'adaptation au stress, la survie cellulaire et l’induction de l’apoptose.

18
De plus, les données de la littérature décrivent des mutations et/ou des anomalies d'expression
dans les gènes codant pour les composantes de la machinerie AIF/CHCHD4 ainsi que ses
substrats dans des maladies mitochondriales et des cancers [18, 35, 36]. L'ensemble de ces
données illustrent l'importance d'une caractérisation moléculaire et fonctionnelle des substrats
de AIF/CHCHD4 dans la compréhension du métabolisme mitochondrial mais aussi dans
l’identification de cibles thérapeutiques prometteuses.

1.3 Problématique et objectifs

Comme il a été mentionné plus haut, grâce à la régulation de l’import dans l’IMS d’une
vingtaine de protéines (substrats) qui portent des motifs cystéines particuliers, la voie
d’import mitochondrial contrôlée par l’oxydase CHCHD4/Mia40 joue un rôle incontournable
dans l’adaptation aux changements métaboliques, la survie cellulaire ainsi que la réponse au
stress (Figure 5). La majorité des connaissances acquises sur cette voie d'import a été obtenue
chez la levure S. cerevisiae et c'est seulement depuis peu que son rôle dans le métabolisme
mitochondrial est étudié dans les cellules des mammifères. Notre équipe (dir. N. Modjtahedi)
a été la première à montrer que dans les cellules humaines 1) l’activité optimale de la voie
d’import mitochondrial CHCHD4/Mia40 nécessite l'interaction physique et fonctionnelle de
CHCHD4 avec la protéine AIF, et que 2) la perturbation de l’interaction entre les deux
partenaires entraine le dysfonctionnement de la chaîne respiratoire et affecte la survie
cellulaire. Dans ce contexte, les protéines substrats de AIF/CHCHD4 représentent des cibles
thérapeutiques potentielles à travers leur implication dans la biogenèse de la chaîne
respiratoire, la réponse anti-oxydante, l’homéostasie lipidique, le stockage du calcium, ainsi
que l'ultrastructure et la dynamique mitochondriale [17, 18, 37]. Sans aucun doute, la
caractérisation moléculaire et fonctionnelle de chacun des substrats de CHCHD4/Mia40 chez
l'homme est indispensable pour 1) une meilleure compréhension du rôle de cette voie d'import
dans le contrôle de la plasticité métabolique des cellules et 2) l'identification de nouvelles
cibles thérapeutiques ou de biomarqueurs cliniquement utiles.

Étant donné que les mitochondries sont désormais reconnues comme des acteurs majeurs dans
la plasticité métabolique des cellules tumorales et dans la signalisation qui s’établit entre les
cellules tumorales et les effecteurs du microenvironnement tumoral [38], au sein de l’unité
CNRS UMR9018, l’équipe du Dr Modjtahedi étudie l’impact de la voie AIF/CHCHD4 sur le
métabolisme tumoral. Dans ce contexte, notre équipe s’intéresse, entre autres, aux substrats
potentiels de CHCHD4 qui sont impliqués dans le contrôle de l'ultrastructure mitochondriale

19
et qui de plus ont été trouvés mutés ou anormalement exprimés dans divers maladies
humaines (exemple : CHCHD2, CHCHD3, CHCHD6, CHCHD10 ou HSPC132) (Figure 5)
[18]. L’intérêt porté à ces substrats est justifié par le fait que l'organisation structurée de la
membrane interne des mitochondries et la formation des crêtes sont des processus finement
régulés qui impactent non seulement le fonctionnement de la chaîne respiratoire et l'activité
de plusieurs complexes protéiques, tels que les transporteurs de métabolites qui sont logés
dans la membrane interne, mais également, la traduction du génome mitochondrial qui
nécessite le contact des ribosomes avec la membrane interne du côté de la matrice [17, 18,
39].

Au mois de Janvier 2020, pour la réalisation de mon stage de master 2, j’ai rejoint
l’équipe du Dr Modjtahedi et, sous l’encadrement de Mme Kenza Nedara, j’ai participé à
l’étude de HSPC132, l’un des substrats de CHCHD4 qui a été impliqué dans le contrôle de
l’ultrastructure mitochondriale (Figure 5) [18]. HSPC132 (appelée aussi P53CSV ou
TRIAP1) est une petite protéine de 9kDa (76 acides aminés), qui porte un motif cystéine du
type (CX9C)2 et est l’homologue humain de mdm35 (pour mitochondrial distribution and
morphology protein 35) de la levure. Bien que chez la levure la protéine mdm35 a été
caractérisée comme un substrat de Mia40 qui régule la morphologie des mitochondries en
participant à l’homéostasie lipidique de la membrane interne [17, 40], l’implication de son
homologue humain HSPC132 dans le métabolisme mitochondrial et la survie cellulaire est
mal comprise. L’équipe a entrepris l’étude moléculaire et fonctionnelle de HSCP132 dans les
cellules cancéreuses humaines afin de comprendre l’avantage sélectif que pourrait apporter sa
surexpression observée dans divers types de cancer [18, 35, 36].

Pour étudier la relevance de l'expression de HSPC132 dans la croissance tumorale, la lignée


cellulaire HCT116 dérivée d'un adénocarcinome de colon a été choisi comme modèle. En
effet, l'équipe a montré que la survie de ces cellules était dépendante de la voie d’import
AIF/CHCHD4 (données non publiées). Par la suite, grâce à l'utilisation de la technique d'ARN
interférence, l’équipe a observé que la déplétion de HSPC132 perturbait la morphologie des
mitochondries (observation par microscopie électronique) et inhibait la prolifération des
cellules in vitro ainsi que la croissance de xénogreffes tumorales in vivo (Kenza Nedara,
Camille Reinhardt et al. en préparation) (Figure 6). Afin de mieux comprendre les effets
cellulaires de la perte de HSPC132, une étude transcriptomique (approche RNAseq) des
lignées cellulaires isogéniques HCT116 exprimant ou pas HSPC132 a été réalisée. Ainsi,
l'équipe a pu observer que la perte de la protéine HSPC132 dans les cellules HCT116

20
provoque une signalisation de détresse mitochondriale qui agit d’une manière rétrograde sur
le compartiment nucléaire et entraîne un changement global de l'expression génique.
L’analyse bioinformatique des données RNAseq a clairement mis en évidence la modification
de l’expression d’un groupe de gènes cibles du produit du gène suppresseur de tumeur TP53.
La majorité de ces gènes sont connus pour leur implication dans le contrôle du cycle cellulaire
et de la prolifération (Nedara, Reinhardt et al. en préparation).

Figure 6 : Représentation schématique des résultats préliminaire de l’équipe. Dans la


lignée HCT116 TP53WT dérivée d’un cancer colorectal, l’équipe a montré que la déplétion (par la
stratégie d’ARN interférence) de la protéine mitochondriale HSPC132 perturbe l’ultrastructure des
mitochondries (analyse par microscopie électronique) et inhibe la prolifération des cellules
cancéreuses. Les analyses transcriptomiques (RNaseq) ont révélé que les événements cellulaires
observées étaient accompagnés par la modification de l’expression des gènes cibles de TP53 qui sont
connus pour leur implication dans le contrôle du cycle cellulaire et de la prolifération. Représentation
de gauche : schéma de dialogue mitochondrio-nucléaire physiologique normale. Représentation de
droite : Schéma de la perturbation du dialogue mitochondrio-nucléaire après la perte de HPC32
(Kenza Nedara, Camille Reinhardt et al. en préparation).

Sur la base des observations décrites ci-dessus, l'équipe a émis l'hypothèse que l’inhibition de
la prolifération des cellules HCT116 déplétées de HSPC132 pourrait être due à la
modification de l'expression des gènes cibles de TP53. Dans ce contexte, le
dysfonctionnement mitochondrial déclenché par la perte de HSPC132 serait à l’origine de

21
l'activation de TP53 et la modification de l’expression de ses gènes cibles (Figure 6) (Nedara,
Reinhardt et al. en préparation).

Au cours de mon stage M2, j’ai eu la mission de participer à l’étude de l’activation de la


voie de signalisation TP53 en réponse au dysfonctionnement mitochondrial causé par la
déplétion de HSPC132 et mon travail devait s’articuler autour de trois objectifs: 1) comparer
les niveaux d’expression de TP53 dans les cellules déplétées ou pas de HSPC132 ; 2) Valider
les changements d’expression des gènes cibles de TP53 identifiés par l’analyse RNAseq ; et
3) étudier les bases moléculaires de l’activation de TP53 dans les cellules déplétées de
HSPC132.

Je tiens à mentionner que le déroulement de mon stage M2 a été sérieusement perturbé


en relation avec la crise sanitaire qui a touché la France ainsi que le monde entier. En raison
du confinement, qui a été imposé dans le cadre de la pandémie de Covid-19, mon stage a été
arrêté depuis le 16 mars 2020 et par conséquent je n'ai pu atteindre qu'une fraction des
objectifs que je m'étais initialement fixés. Mon rapport de stage a été préparé en suivant les
nouvelles consignes qui ont été envoyées par l’université en réponse à cette situation
pandémique.

22
2 MATERIELS ET METHODES

2.1 Matériels

2.1.1 Lignée cellulaire

La lignée cellulaire HCT116 est dérivée d'un carcinome colorectal (ATCC-CCL 247). Cette
lignée exprime la forme sauvage de la protéine TP53 (TP53WT). Pour les différentes
expériences, ces cellules ont été transduites par des vecteurs lentiviraux codant pour des
shRNA contrôle ou dirigés contre la protéine HSPC132.

2.1.2 Anticorps

Spécificité Fournisseur Espèce Dilution PM (KDa)

HSPC132 Santa Cruz Lapin 1/1000 9

TP53 Santa Cruz Souris 1/5000 53

P21 Cell signaling Souris 1/2000 21

Actine Sigma Souris 1/50000 43

AIF Santa Cruz Lapin 1/5000 57

CHCHD4 Proteintech Lapin 1/4000 22

Anti-souris- HRP Cell Signalling Chèvre 1/5000 -

Anti-lapin - HRP Cell signalling Chèvre 1/5000 -

2.1.3 Liste des shRNA

Des shRNA ont été utilisés pour construire des lentivirus pour la transduction des cellules
HCT116-TP53WT. Les lentivirus recombinants exprimant les shRNA suivants ont été achetés
chez Sigma-Aldrich :
- Plasmide contenant le shRNA contrôle 1) MISSION pLKO.1-puro SHC002
- Séquences des shRNA contre HSPC132 : 1) 5’-GAGATTCCTATTGAAGGACTG 3’,
2) 5’-GCTGTGGAGGAAGAACCTAAA-3’ et 3) 5’-CCTTGTATGCAAACGATGATA-3’.

23
2.1.4 Molécules chimiques

- Cycloheximide (CHX): (3-[2-(3,5-Dimethyl-2-oxocyclohexyl)-hydroxymethyl]


glutarimide); (C15 H23 N-O4) (Sigma-Aldrich; référence C4859, concentration = 100mg/ml,
préparée dans du DMSO) inhibe de manière réversible l’initiation et l’élongation de la
traduction.

2.1.5 Amorces utilisées pour amplification de séquences spécifiques


d’ADNc par qPCR

Les séquences des amorces utilisées ont été déterminées sur la plateforme Primer3Plus
(http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) puis commandées chez
Sigma-Aldrich.
Pour l’ARNm HSPC132 : 5’- GTGCTTCAATCGCTGGTTCG -3’(forward) et 5’-
CATGGCCCATGAACTCCAGT -3’ (reverse)
Pour l’ARNm TP53 : 5’- CCTCCTCAGCATCTTATCCG -3’ (forward) and 5’-
CAAACACGCACCTCAAAGC -3’ (reverse).
Pour l’ARNm P21: 5’-CCTAATCCGCCCACAGGAA-3’ (forward) and 5’-
ACCTCCGGGAGAGAGGAAAA-3’ (reverse).
Pour l’ARNm Actine: 5'-CCTCGCCTTTGCCGATCC-3' (forward) and 5'-
ATGGATGATGATATCGCCGCG-3' (reverse).

2.2 Méthodes

2.2.1 Culture cellulaire

La lignée cellulaire HCT116 TP53WT est maintenue en culture dans du milieu DMEM
Glutamax (Gibco / Life Technologies ; réf 31966) supplémenté avec 10% de sérum bovin
fœtal décomplémenté (SVF) et 1% de pénicilline/streptomycine (Life Technologies ; réf
15140130). La culture cellulaire est réalisée à 37°C dans un incubateur qui assure une
atmosphère humide et maintient 5% de CO2.

2.2.2 Transduction lentivirale

Le lendemain de l'ensemencement, les cellules HCT116 ont été incubées avec le surnageant
viral et après 16h à 37°C le milieu a été remplacé. 24h après, les cellules transduites ont été
sélectionnées grâce à une incubation de 3 jours dans un milieu contenant 0.4µg/ml de
puromycine. Les cellules vivantes sont par la suite ensemencées pour réaliser les différentes
expériences.

24
2.2.3 Préparation et quantification des extraits protéiques totaux pour
immunoblot

Après trois lavages au PBS (8,1 mM NA2HPO4 ; 135 mM NaCl ; 1,5 mM KH2PO4 ; 2,7 mM
KCl) (Gibco / Life Technologies), les cellules sont lysées avec 1% SDS (Biorad). Le lysat a
été bouillis 5 min à 95 ° C et soniqués 3 fois 10s à 40 Hz. Ensuite, les protéines contenues
dans les lysats ont été quantifiées en se basant sur le protocole de Lowry et en utilisant le kit
de dosage colorimétrique « DC Protein Assay» (Biorad). Les extraits protéiques totaux ont été
soit stockés à -20°C, soit utilisés pour des analyses par immunoblot.

2.2.4 Analyse des protéines par immunoblot

Pour les analyses par immunoblot, le tampon de charge (4% SDS, 20% glycérol, 125 mM Tris
pH 6.8, 200 mM DTT et du bleu de bromophénol) a été ajouté (v/v) aux extraits cellulaires
contenant la même quantité de protéines, qui ont ensuite été résolus, après chauffage 5 min à
95°C, par SDS-PAGE (NUPAGE Gel 4-12% Bis-Tris, Invitrogen / Life Technologies) dans
un tampon MES 1X pendant environ 2h à 100 volts constants. Après migration, les protéines
ont été transférées sur une membrane de nitrocellulose (0,2 µm) pendant 1h à 100 volts
constants. Après transfert, la membrane a été lavée au PBS puis au tampon TBST (TBS-
Tween : 10 mM Tris-HCl pH 8.0 ; 150 mM NaCl ; 0.05% Tween 20), saturée avec soit du
lait 5%, soit de la BSA 5% dans le TBST et incubée avec l’anticorps primaire toute la nuit à
4°C sous agitation. Ensuite, la membrane a été lavée au TBST puis incubée avec l’anticorps
secondaire couplé à la HRP 1h à température ambiante sous agitation. Enfin, les protéines ont
été détectées grâce au système de chimioluminescence ECL prime (Amersham Biosciences)
et à la caméra Image Quant LAS 4000 (GE Healthcare).

2.2.5 Extraction des ARN totaux pour analyse de l’expression de gènes


par RTqPCR

Pour l’analyse des ARN totaux, les cellules ont été lavées trois fois avec du PBS (Gibco / Life
Technologies), lysées 5 min avec du Trizol (Invitrogen / Life technologies). Ensuite, 100µl de
chloroforme est ajouté et le mélange est centrifugé pendant 15min à 12000g. La phase
aqueuse contenant les ARNs est récupérée et les ARN totaux ont été précipités avec 500µl
l’isopropanol. Enfin, le culot est lavé avec 500µl d’éthanol 75% et resuspendu dans 20ul
d’eau RNAse free.

25
2.2.6 Rétro-transcription des ARNs et quantification de l’expression des
gènes par qPCR
Les ARNs totaux sont retro-transcrits en utilisant le kit "Quantiscript Reverse Transcription"
(Qiagen ; référence 205311) selon les instructions du fournisseur. La PCR quantitative est
réalisée dans la machine the "CFX96 Real-Time PCR Detective System" (Biorad) en utilisant
le POWER SYBER GREEN Master Mix et les amorces spécifiques détaillées dans la partie
Matériels.

2.2.7 Évaluation de la demi-vie des protéines

Les cellules HCT116-TP53WT transduites avec le shCtrl ou shHSPC132 devrait être


ensemencées. 24h après, les cellules vont être traitées pendant 0 à 8h avec 10 µg/ml de
Cycloheximide. Des extraits protéiques totaux seront par la suite préparés, migrés et séparés
par SDS PAGE et la protéine concernée sera analysée par immunoblot.

2.2.8 Préparation et quantification des extraits protéiques totaux pour


immunoprécipitation

Afin de réaliser les immunoprécipitations de protéines, les cellules sont lavées trois fois avec
du PBS froid (Gibco / Life Technologies), lysées avec le tampon NetN 120 (20 mM Tris-HCl
pH 8 ; 120 mM NaCl ; 1 mM EDTA ; 5% NP40 (IGEPAL-Sigma Aldrich) ; inhibiteurs des
protéases (Roche) + inhibiteurs des phosphatases (Roche)) pendant 30 min et centrifugés. Les
surnageants constituent les extraits totaux. Ces extraits doivent être dosés et soumis à
l'immunoprécipitation.

2.2.9 Immunoprécipitation des protéines

Les billes liées aux protéines G-Sépharose de 50 µl (GE Healthcare) seront recouvertes de 2
µg de l'anticorps indiqués, par incubation pendant 2h à 4°C dans 800 µl de tampon NetN120.
Les billes recouvertes d'anticorps seront lavées trois fois dans du tampon NetN120 et incubées
pendant 16h à 4°C avec 200 µg de lysat cellulaire contenant des quantités égales en protéines,
dans un volume final de 800 µl. Ensuite, les billes seront lavées quatre fois avec du tampon
NetN120 et les protéines co-immunoprécipitées seront éluées en chauffant 5min à 95°C dans
du tampon de charge (2% SDS ; 10% glycérol ; 62,5 mM Tris-HCl pH 6,8 ; 100 mM
dithiothréitol). Enfin 20µl de surnageant doivent être déposés sur un gel SDS-PAGE pour une
analyse par immunoblot.

26
3 RESULTATS

3.1 Etude de l’effet de la déplétion de HSPC132 sur l’expression de la


protéine TP53

Les résultats préliminaires du laboratoire ont montré que, dans la lignée cellulaire
cancéreuse HCT116, la déplétion de la protéine HSPC132 provoque une altération de la
structure mitochondriale et une inhibition de la prolifération cellulaire (Nedara et al. en
préparation). Pour comprendre les mécanismes sous-jacents, une étude transcriptomique
comparée a été réalisée, à partir de cellules HCT116 exprimant ou non la protéine HSPC132.
L’analyse par RNAseq a notamment montré que la déplétion de HSPC132 modifie, entre
autres, l’expression génique d’un certain nombre de gènes cibles de TP53, qui sont impliqués
dans la régulation du cycle cellulaire et de la prolifération (exemples : CDKN1A, BTG2,
CCNG1, PRM2B, RPS27L, BBC3, MDM2) (Nedara et al. en préparation). Comme
mentionnée dans la section problématique, l'équipe a émis l'hypothèse que l’inhibition de la
prolifération des cellules HCT116 déplétées de HSPC132 pourrait être due à la modification
de l'expression des gènes cibles de TP53. Il a été proposé que le dysfonctionnement
mitochondrial déclenché par la perte de HSPC132 serait à l’origine de l'activation de TP53 et
la modification conséquente de l’expression de ses gènes cibles (Figure 6).

Dans ce contexte, le premier objectif de mon stage a été d’étudier l’expression de la protéine
TP53 dans les cellules HCT116 afin de vérifier son éventuelle induction en réponse à la
déplétion de HSPC132. Afin de dépléter HSPC132, trois shRNA ciblant l’ARNm HSPC132
dans des régions différentes (shRNA HSPC132-1, -2, et -3) ou bien un shRNA contrôle
(shRNA Ctrl) ont été introduits dans les cellules HCT116 à l'aide d’un système lentiviral. Par
la suite, les cellules traduites ont été sélectionnées grâce à un traitement avec la puromycine et
six jours après transduction, les protéines ont été extraites puis analysées par immunoblot
(Figure 7.A). L’analyse montre que, 6 jours après la transduction, les trois shRNA déplètent
de manière efficace HSPC132 au niveau de l’ARNm (Figure 7.D) et de la protéine (Figure
7.B et 7.C). La déplétion de HSPC132 par les trois shRNA perdurent au moins 12 jours après
transduction (résultats d’analyse par immunoblot non montrés). A l’aide d’un anticorps dirigé
contre la protéine TP53, nous avons cherché à savoir si la perte de HSPC132 pouvait
provoquer l’induction de l’expression de celle-ci. L’analyse par immunoblot montre
clairement que dans les cellules HCT116 transduites par les trois shRNA HSPC132,
l’expression de TP53 est induite comparé aux cellules contrôles (Figure 7.B et 7.C).

27
A la suite de cette observation, il nous a paru plausible que le changement d’expression des
gènes cibles de TP53 observé par RNAseq dans les cellules ayant perdu HSPC132 pourrait
bien être la conséquence de l’augmentation de l’expression de la protéine TP53.

Figure 7 : La perturbation mitochondriale causée par la perte de HSPC132 provoque un stress


cellulaire impliquant l'activation de TP53. A. Mise en place du protocole pour l’étude de l’effet de
la déplétion de HSPC132 sur l’activation de la voie TP53. Deux jours après transduction des cellules
HCT116TP53WT par un shRNA contrôle ou les trois shRNA contre HSPC132 (HSPC132-1, -2, -3), les
cellules transduites sont sélectionnées en présence de Puromycine (0.4µg/ml) pendant trois jours.
Ensuite, les ARNs et les protéines sont extraits et analysés. B. Analyse par immunoblot des extraits
protéiques provenant des cellules HCT116 à 6 jours post-transduction avec les anticorps indiqués. C.
Les quantités des protéines révélées par immunoblot sont quantifiées, normalisées par rapport à
l’actine et représentées en histogramme d’expression relative au shRNA contrôle. D. Analyse par
RTqPCR des ARNm extraits HCT116 à 6 jours post-transduction avec les amorces indiquées.
L’expression des ARNm indiqués est normalisée par rapport à l’ARNm de l’actine et représentées en
histogramme d’expression relative au shRNA contrôle.

Après avoir observé l’induction de l’expression de TP53 dans les cellules déplétées de
HSPC132, le deuxième objectif de mon stage était d’étudier un groupe sélectionné de gènes
cibles de TP53 (exemples : CDKN1A, BTG2, CCNG1, PRM2B, RPS27L, BBC3, MDM2)
afin de valider les changements des niveaux d’expression qui étaient observées auparavant
grâce à des analyses RNAseq. Malheureusement, mon stage a été arrêté au 16 Mars et je n’ai

28
eu le temps d’étudier que le taux d’expression de P21 (produit du gène CDKN1A). L’analyse
des ARNm par RT-qPCR, obtenus à partir de cellules exprimant ou non HSPC132, montre
une induction de l’ARNm P21 dans les cellules déplétées pour HSPC132 (Figure 7.D). De
façon concordante, l’analyse par immunoblot des extraits protéiques des cellules déplétées ou
non pour HSPC132 indique une augmentation de l’expression de la protéine P21 dans les
cellules qui sont dépourvues de HSPC132 mais qui surexpriment la protéine TP53 (Figure
7.B et C).

En conclusion, les expériences que j’ai réalisées au laboratoire ont permis de montrer que le
stress cellulaire causé par la perte de HSPC132 entraîne une augmentation de l’expression de
la protéine TP53. Il en résulte un changement de l’expression de gènes cibles de TP53,
comme observé par RNAseq. Par exemple, l’expression de l’ARNm et de la protéine P21 est
augmentée en réponse à l’accumulation de TP53 dans les cellules n’exprimant pas HSPC132.

Une fois que j’ai mis en évidence l’induction de la protéine TP53, en réponse à la
déplétion de HSPC132, le deuxième objectif de mon stage a été de comprendre les
mécanismes moléculaires responsables de l’accumulation de TP53 dans les cellules déplétées
de HSPC132. Pour commencer, j’ai testé l’hypothèse selon laquelle l’induction de TP53 serait
la conséquence d’une augmentation de l’expression de l’ARNm de TP53. Pour cela, les ARNs
totaux des cellules HCT116 déplétées ou pas pour HSPC132 ont été extraits et analysés par
RTqPCR (Figure 7.A). Ayant observé que la perte de HSPC132 n’a pas d’effet sur le niveau
d’expression de l’ARNm de TP53, nous avons conclu que l’induction de TP53 dans les
cellules n’exprimant pas HSPC132 est régulée au niveau post-transcriptionnelle (traduction,
stabilité de la protéine, modifications post-traductionnelles). Pour la suite de mon stage,
j’avais la mission de tester cette dernière hypothèse afin d’expliquer l’induction de TP53, en
réponse au stress mitochondrial induit par l’absence de la protéine HSPC132.
Malheureusement, comme je l’ai mentionné plus haut, j’ai été obligé d’arrêter mon stage le 16
Mars. Les hypothèses et les expériences qui étaient prévues pour cette partie du travail sont
détaillées dans la partie discussion et perspectives.

29
4 DISCUSSION ET PERSPECTIVES

Mon sujet de stage de master s’intègre dans un programme de recherche qui vise à
comprendre le rôle de la protéine HSPC132 dans la croissance tumorale. Chez l’homme, la
protéine HSPC132 est importée dans l’espace intermembranaire de la mitochondrie grâce à
l’activité du complexe AIF/CHCHD4 (Reinhardt et al. en préparation). L’étude de mdm35
l’homologue de HSPC132 chez la levure montre son rôle primordial dans l’homéostasie
lipidique de la membrane mitochondriale interne qui contrôle la morphologie et
l’ultrastructure de la mitochondrie [18]. Dans notre modèle cellulaire HCT116, dérivée d’un
cancer colorectal, la perte de HSPC132 perturbe l’ultrastructure mitochondriale, diminue la
prolifération des cellules in vitro et affecte la croissance tumorale in vivo (Nedara et al. en
préparation). L’analyse transcriptomique des cellules qui ont perdu HSPC132 a montré la
modification de l’expression d’un groupe de gènes cibles de TP53. Suite à ces observation, il
a été émis l’hypothèse que le dysfonctionnement mitochondrial causé par la perte de
HSPC132 serait à l’origine d’un stress cellulaire qui au retour activerait la voie TP53.
L’objectif de mon stage était de valider l’hypothèse de l’activation de la voie de signalisation
de P53 et étudier les mécanismes moléculaires à l’origine de cette activation.

4.1 Etude de l’effet de la déplétion de HSPC132 sur l’expression de la


protéine TP53

Le premier objectif de mon stage était de vérifier si la perte de HSPC132 provoquait


une accumulation de la protéine TP53. Les résultats obtenus avec trois shRNA ciblant
différentes régions de l’ARNm HSPC132 montrent que la déplétion de HSPC132 induit une
accumulation de la protéine TP53 et une induction de l’expression de son gène cible p21.
Ayant démontré l’activation de la voie TP53, le travail sera poursuivi (approche RTqPCR)
afin de valider l’induction des gènes cibles de TP53 qui ont été révélés par des analyses
RNAseq. Ce groupe de gènes (exemples : CDKN1A, BTG2, CCNG1, PRM2B, RPS27L,
BBC3, MDM2) nous intéresse particulièrement car, il a été impliqué, entre autres, dans la
régulation du cycle cellulaire et de la prolifération. L’ensemble des gènes validés, nous
permettra de mieux comprendre le rôle de l’activation de la voie TP53 dans l’inhibition de la
prolifération des cellules ayant perdu HSPC132.

30
4.2 Etude des mécanismes moléculaires de l’induction de TP53 dans les
cellules déplétées pour HSPC132

Le second objectif de mon stage était d’établir les mécanismes moléculaires de


l’accumulation de TP53 en réponse à la perte de HSPC132. La première hypothèse que j’ai
testée, était celle d’une induction de l’expression de l’ARNm TP53. L’analyse par RT-qPCR
montre que le niveau de l’ARNm de TP53 n’est pas modifié en réponse à la déplétion de
HSPC132 ce qui suggère que l’induction de TP53 est régulée au niveau post-transcriptionnel.

4.2.1 Etude de l’effet de la déplétion de HSPC132 sur la stabilité de la


protéine TP53

En absence de stress, la protéine TP53 a une demi-vie très courte (5 à 15 minutes), alors
qu’en réponse à différents types de stress (exemples : dommages d’ADN, stress oxydant,
hypoxie…), elle peut être stabilisée et sa durée de demi-vie peut passer de quelques minutes à
quelques heures. Comme toutes les autres protéines, la quantité cellulaire de TP53 à un temps
donné est un état d’équilibre entre sa production et sa dégradation. La stabilité (ou bien
autrement dit la dégradabilité) de TP53 est une propriété caractéristique, qui peut être
modulée par des modifications post-traductionnelles, un changement de localisation ou bien la
modification de son interaction avec d’autres protéines. Dans notre modèle, nous avons émis
l’hypothèse selon laquelle la déplétion de HSPC132 provoquerait une stabilisation de la
protéine TP53. Pour tester cette hypothèse, nous avions décidé de déterminer la demi-vie de
TP53, définie comme le temps nécessaire pour que 50% de la quantité de protéine soit
dégradée, pendant que sa traduction est bloquée en présence d’un inhibiteur général de
traduction, la Cycloheximide (CHX). Dans cette expérience, il était prévu que des cellules
HCT116 déplétées ou pas pour HSPC132 soient incubées pendant différents temps en
présence de CHX, les protéines soient extraites à différents temps post-traitement et analysées
par immunoblot (Figure 8). Il était attendu que, la stabilisation de TP53 dans les cellules
déplétées pour HSPC132 soit reflétée par une augmentation de sa demi-vie.

31
Figure 8 : Etude de l’effet de la déplétion de HSPC132 sur la stabilité de la protéine TP53.
Mise en place du protocole de mesure de demi-vie de TP53 dans les cellules déplétées pour
HSPC132. Les cellules HCT116 sont transduites par des lentivirus codant pour shRNA contre
HSPC132. Ensuite, les cellules transduites sont sélectionnées en présence de la puromycine. Six
jours après transduction, les cellules sont traitées avec 10µg/ml de Cycloheximide pendant des
temps allant de 30 minutes à 8 heures. Enfin des extraits protéiques sont préparés et la quantité de la
protéine TP53 est analysée par immunoblot afin de déterminer la durée de sa demi-vie.

4.2.2 Etude de l’effet de la déplétion de HSPC132 sur la dégradation de


TP53 par MDM2

Entre autres, la durée de la demi-vie de TP53 dans la cellule est fortement liée à son
interaction avec son partenaire MDM2 [41]. En effet, dans des conditions physiologiques,
TP53 interagit avec MDM2 qui catalyse son ubiquitinylation induisant sa dégradation par le
protéasome (Figure 9.A ; modèle moléculaire n°1). En condition de stress, TP53 et/ou
MDM2 peuvent subir des modifications post-traductionnelles ; en l’occurrence des
phosphorylations ; qui vont dissocier le complexe TP53/MDM2 (Figure 9.A ; modèle
moléculaire n°2). Une fois stabilisée, dans le noyau, TP53 joue un rôle de facteur de
transcription et régule ainsi l’expression d’un certain nombre de gènes qui, selon la nature et
l’intensité du stress, sont impliqués dans l’arrêt de la prolifération, la mort cellulaire par
apoptose ou alors l’entrée des cellules en sénescence (Figure 9.A).Dans notre modèle, nous
voulions tester l’hypothèse selon laquelle, la déplétion de HSPC132 provoquerait une
dissociation du complexe TP53/MDM2 qui pourrait expliquer la stabilisation de TP53. Pour
tester cette hypothèse, TP53 serait immunoprécipité à partir d’extraits protéiques de cellules
déplétées ou pas pour HSPC132. Ensuite la quantité de MDM2 co-immunoprécipitée serait
analysée et comparée dans les conditions de présence ou absence de HSPC132 (Figure 9.B).

32
Figure 9 : Etude de l’interaction entre TP53 et MDM2 dans les cellules déplétées pour
HSPC132. A. Représentation schématique de la régulation de TP53 par MDM2. Dans les conditions
physiologiques, la protéine MDM2 se lie à TP53 et induit son ubiquitinylation et sa dégradation par
le protéasome (1). En réponse à des conditions de stress, le complexe TP53/MDM2 se dissocie, TP53
est stabilisée et joue un rôle de facteur de transcription. Elle régule, entre autres, l’expression de
gènes impliqués dans l’arrêt de la prolifération, la sénescence ou la mort cellulaire (2). B. Mise en
place du protocole pour l’étude de l’interaction entre TP53 et MDM2 dans les cellules déplétées pour
HSPC132. Les cellules HCT116 sont transduites par des lentivirus codant pour shRNA contre
HSPC132. Ensuite, les cellules transduites sont sélectionnées en présence de la puromycine. Six jours
après transduction, la protéine TP53 est immunoprécipitée et la quantité de la protéine MDM2 co-
immunoprécipitée est analysée par immunoblot.

Si les expériences prévues révèlent un changement dans la capacité de TP53 à interagir avec
MDM2, l’équipe souhaite déterminer les mécanismes qui inhibent l’interaction entre MDM2
et TP53, dans les conditions de perte de HSPC132. Plusieurs hypothèses pourraient être
envisagées. D’une part, il serait intéressant d’examiner les modifications post-traductionnelles
de TP53 et de MDM2, en particulier sa phosphorylation, en réponse à la perte de HSPC132.
D’autre part, la dissociation du complexe TP53/MDM2 pourrait être due à l’interaction de

33
MDM2 avec d’autres protéines. Par exemple, dans des conditions de stress nucleolaire,
l’interaction de MDM2 avec la protéine RPS27L a été décrite pour inhiber le complexe
MDM2/TP53 [42]. De manière intéressante, les analyses RNAseq ont révélées l’induction de
l’expression de RPS27L en réponse à la perte de HSPC132. Il serait donc judicieux de
quantifier par co-immunoprécipitation l’interaction entre MDM2 et RPS27L.
L’établissement de ces mécanismes moléculaires d’induction de TP53 en réponse à la perte de
HSPC132 nous aidera à mieux comprendre le stress cellulaire à l’origine de l’induction de la
voie de signalisation P53.

5 CONCLUSION

Pour conclure, mon projet de stage vise à comprendre les mécanismes moléculaires de
l’induction de la voie de signalisation TP53 en réponse à la perte de la protéine HSPC132. Le
but ultime étant de comprendre le dialogue mitochondrio-nucléaire qui s’établit suite à la
perte de HSPC132 et qui est à l’origine de l’activation de cette voie TP53 et l’inhibition de la
prolifération dans ces cellules tumorales. Enfin, ce projet s’insère dans un plus vaste
programme qui vise à étudier le rôle de la protéine mitochondriale HSPC132 dans le
métabolisme tumoral et comprendre son implication dans la prolifération et la progression
tumorale.

34
6 REFERENCES BIBLIOGRAPHIQUES

[1] D.R. Green, G. Kroemer, The Pathophysiology of Mitochondrial Cell Death, Science
305(5684) (2004) 626-629.

[2] A.B. Harbauer, R.P. Zahedi, A. Sickmann, N. Pfanner, C. Meisinger, The protein import
machinery of mitochondria-a regulatory hub in metabolism, stress, and disease, Cell
metabolism 19(3) (2014) 357-72.

[3] G. Kroemer, L. Galluzzi, C. Brenner, Mitochondrial membrane permeabilization in cell


death, Physiological reviews 87(1) (2007) 99-163.

[4] P.M. Quiros, A. Mottis, J. Auwerx, Mitonuclear communication in homeostasis and stress,
Nat Rev Mol Cell Biol 17(4) (2016) 213-26.

[5] A.M. van der Bliek, M.M. Sedensky, P.G. Morgan, Cell Biology of the Mitochondrion,
Genetics 207(3) (2017) 843-871.

[6] A.L. Anding, E.H. Baehrecke, Cleaning House: Selective Autophagy of Organelles,
Developmental cell 41(1) (2017) 10-22.

[7] A.J. Roger, S.A. Muñoz-Gómez, R. Kamikawa, The Origin and Diversification of
Mitochondria, Current biology : CB 27(21) (2017) R1177-r1192.

[8] L. Eme, A. Spang, J. Lombard, C.W. Stairs, T.J.G. Ettema, Archaea and the origin of
eukaryotes, Nature reviews. Microbiology 15(12) (2017) 711-723.

[9] D.A. Baum, B. Baum, An inside-out origin for the eukaryotic cell, BMC biology 12
(2014) 76.

[10] T.G. Frey, C.A. Mannella, The internal structure of mitochondria, Trends in biochemical
sciences 25(7) (2000) 319-24.

[11] S.E. Horvath, G. Daum, Lipids of mitochondria, Prog Lipid Res 52(4) (2013) 590-614.

[12] S. DiMauro, E.A. Schon, Mitochondrial respiratory-chain diseases, The New England
journal of medicine 348(26) (2003) 2656-68.

[13] J.B. Spinelli, M.C. Haigis, The multifaceted contributions of mitochondria to cellular
metabolism, Nature cell biology 20(7) (2018) 745-754.

[14] G.S. Gorman, P.F. Chinnery, S. DiMauro, M. Hirano, Y. Koga, R. McFarland, A.


Suomalainen, D.R. Thorburn, M. Zeviani, D.M. Turnbull, Mitochondrial diseases, Nature
reviews. Disease primers 2 (2016) 16080.

[15] J.B. Stewart, P.F. Chinnery, The dynamics of mitochondrial DNA heteroplasmy:
implications for human health and disease, Nature reviews. Genetics 16(9) (2015) 530-42.

[16] N. Pfanner, B. Warscheid, N. Wiedemann, Mitochondrial proteins: from biogenesis to


functional networks, Nat Rev Mol Cell Biol 20(5) (2019) 267-284.

35
[17] N. Modjtahedi, K. Tokatlidis, P. Dessen, G. Kroemer, Mitochondrial Proteins Containing
Coiled-Coil-Helix-Coiled-Coil-Helix (CHCH) Domains in Health and Disease, Trends in
biochemical sciences 41(3) (2016) 245-260.

[18] C. Reinhardt, G. Arena, K. Nedara, R. Edwards, C. Brenner, K. Tokatlidis, N.


Modjtahedi, AIF meets the CHCHD4/Mia40-dependent mitochondrial import pathway,
Biochim Biophys Acta Mol Basis Dis 1866(6) (2020) 165746.

[19] N. Wiedemann, N. Pfanner, Mitochondrial Machineries for Protein Import and


Assembly, Annual review of biochemistry 86 (2017) 685-714.

[20] A. Chacinska, C.M. Koehler, D. Milenkovic, T. Lithgow, N. Pfanner, Importing


mitochondrial proteins: machineries and mechanisms, Cell 138(4) (2009) 628-44.

[21] E. Nicolas, R. Tricarico, M. Savage, E.A. Golemis, M.J. Hall, Disease-Associated


Genetic Variation in Human Mitochondrial Protein Import, American journal of human
genetics 104(5) (2019) 784-801.

[22] L. Banci, I. Bertini, C. Cefaro, S. Ciofi-Baffoni, A. Gallo, M. Martinelli, D.P. Sideris, N.


Katrakili, K. Tokatlidis, MIA40 is an oxidoreductase that catalyzes oxidative protein folding
in mitochondria, Nature structural & molecular biology 16(2) (2009) 198-206.

[23] A. Chacinska, S. Pfannschmidt, N. Wiedemann, V. Kozjak, L.K. Sanjuán Szklarz, A.


Schulze-Specking, K.N. Truscott, B. Guiard, C. Meisinger, N. Pfanner, Essential role of
Mia40 in import and assembly of mitochondrial intermembrane space proteins, The EMBO
journal 23(19) (2004) 3735-46.

[24] E. Hangen, O. Féraud, S. Lachkar, H. Mou, N. Doti, G.M. Fimia, N.V. Lam, C. Zhu, I.
Godin, K. Muller, A. Chatzi, E. Nuebel, F. Ciccosanti, S. Flamant, P. Bénit, J.L. Perfettini, A.
Sauvat, A. Bennaceur-Griscelli, K. Ser-Le Roux, P. Gonin, K. Tokatlidis, P. Rustin, M.
Piacentini, M. Ruvo, K. Blomgren, G. Kroemer, N. Modjtahedi, Interaction between AIF and
CHCHD4 Regulates Respiratory Chain Biogenesis, Molecular cell 58(6) (2015) 1001-14.

[25] E. Hangen, K. Blomgren, P. Bénit, G. Kroemer, N. Modjtahedi, Life with or without


AIF, Trends in biochemical sciences 35(5) (2010) 278-87.

[26] N. Modjtahedi, F. Giordanetto, G. Kroemer, A human mitochondriopathy caused by AIF


mutation, Cell death and differentiation 17(10) (2010) 1525-8.

[27] N. Modjtahedi, E. Hangen, P. Gonin, G. Kroemer, Metabolic epistasis among apoptosis-


inducing factor and the mitochondrial import factor CHCHD4, Cell cycle (Georgetown, Tex.)
14(17) (2015) 2743-7.

[28] N. Modjtahedi, G. Kroemer, CHCHD4 links AIF to the biogenesis of respiratory chain
complex I, Mol Cell Oncol 3(2) (2016) e1074332.

[29] H.L. Wiraswati, E. Hangen, A.B. Sanz, N.V. Lam, C. Reinhardt, A. Sauvat, A. Mogha,
A. Ortiz, G. Kroemer, N. Modjtahedi, Apoptosis inducing factor (AIF) mediates lethal redox
stress induced by menadione, Oncotarget 7(47) (2016) 76496-76507.

36
[30] P. Bragoszewski, A. Gornicka, M.E. Sztolsztener, A. Chacinska, The ubiquitin-
proteasome system regulates mitochondrial intermembrane space proteins, Molecular and
cellular biology 33(11) (2013) 2136-48.

[31] K. Gabriel, D. Milenkovic, A. Chacinska, J. Müller, B. Guiard, N. Pfanner, C. Meisinger,


Novel Mitochondrial Intermembrane Space Proteins as Substrates of the MIA Import
Pathway, Journal of Molecular Biology 365(3) (2007) 612-620.

[32] C.M. Koehler, The small Tim proteins and the twin Cx3C motif, Trends in biochemical
sciences 29(1) (2004) 1-4.

[33] M. Habich, S.L. Salscheider, J. Riemer, Cysteine residues in mitochondrial


intermembrane space proteins: more than just import, British Journal of Pharmacology 176(4)
(2019) 514-531.

[34] A. Mordas, K. Tokatlidis, The MIA Pathway: A Key Regulator of Mitochondrial


Oxidative Protein Folding and Biogenesis, Accounts of Chemical Research 48(8) (2015)
2191-2199.

[35] C. Adams, G. Cazzanelli, S. Rasul, B. Hitchinson, Y. Hu, R.C. Coombes, S. Raguz, E.


Yagüe, Apoptosis inhibitor TRIAP1 is a novel effector of drug resistance, Oncology reports
34(1) (2015) 415-22.

[36] R.S. Felix, G.W. Colleoni, O.L. Caballero, M. Yamamoto, M.S. Almeida, V.C. Andrade,
L. Chauffaille Mde, W.A. Silva, Jr., M.D. Begnami, F.A. Soares, A.J. Simpson, M.A. Zago,
A.L. Vettore, SAGE analysis highlights the importance of p53csv, ddx5, mapkapk2 and
ranbp2 to multiple myeloma tumorigenesis, Cancer letters 278(1) (2009) 41-8.

[37] A. Chatzi, P. Manganas, K. Tokatlidis, Oxidative folding in the mitochondrial


intermembrane space: A regulated process important for cell physiology and disease,
Biochimica et biophysica acta 1863(6 Pt A) (2016) 1298-306.

[38] K.G. Roth, I. Mambetsariev, P. Kulkarni, R. Salgia, The Mitochondrion as an Emerging


Therapeutic Target in Cancer, Trends Mol Med 26(1) (2020) 119-134.

[39] S. Longen, M. Bien, K. Bihlmaier, C. Kloeppel, F. Kauff, M. Hammermeister, B.


Westermann, J.M. Herrmann, J. Riemer, Systematic Analysis of the Twin Cx9C Protein
Family, Journal of Molecular Biology 393(2) (2009) 356-368.

[40] T. Tatsuta, T. Langer, Prohibitins, Current biology : CB 27(13) (2017) R629-r631.

[41] S. Nag, J. Qin, K.S. Srivenugopal, M. Wang, R. Zhang, The MDM2-p53 pathway
revisited, J Biomed Res 27(4) (2013) 254-71.

[42] X. Xiong, Y. Zhao, H. He, Y. Sun, Ribosomal protein S27-like and S27 interplay with
p53-MDM2 axis as a target, a substrate and a regulator, Oncogene 30(15) (2011) 1798-811.

37
RESUME
Notre équipe étudie le rôle du métabolisme mitochondrial dans la prolifération des cellules cancéreuses, avec un
intérêt particulier pour le dialogue mitochondrio-nucléaire. Cet intérêt est justifié par le fait que presque toutes
les protéines mitochondriales sont importées dans l'organite grâce à l'activité de machineries d'import
spécialisées. Notre équipe a focalisé ses études sur une machinerie d'import qui dépend du complexe
AIF/CHCHD4 et contrôle l'import d'une famille de petites protéines porteuses de motifs cystéine (substrats),
essentielles à la survie des cellules, à l'adaptation au stress ou à l'induction de l'apoptose. Étant donné que
certains des substrats importés par cette machinerie sont considérés comme des cibles thérapeutiques potentielles
à travers leur implication dans des activités mitochondriales, comme la biogenèse des complexes de la chaîne
respiratoire, l’homéostasie lipidique, l’ultrastructure mitochondriale, le stockage du calcium ou encore la
traduction du génome mitochondrial, il est crucial de caractériser au niveau moléculaire et fonctionnel chacune
de ces protéines qui sont assez mal connues chez l’homme. HSPC132 est l’un de ces substrats qui a été décrit
pour son rôle dans l’homéostasie lipidique de la membrane mitochondriale interne. Les travaux non publiés de
l’équipe montrent que la déplétion de cette protéine perturbe l’ultrastructure mitochondriale, inhibe la
prolifération des cellules cancéreuses et induit un changement global de l’expression génique. Ces mêmes
travaux suggéraient que le dysfonctionnement mitochondrial provoqué par la perte de HSPC132 pouvait activer
la voie de signalisation médiée par le produit du gène suppresseur de tumeur TP53. Au cours de mon stage de
master M2, j’ai validé cette hypothèse en montrant l’induction de l’expression de la protéine TP53 en réponse à
la déplétion de HSPC132. Ce travail sera poursuivi afin de déterminer les mécanismes moléculaires à l’origine
de l’activation de TP53 et étudier l’implication de cette voie dans l’inhibition de la prolifération des cellules
cancéreuses ayant perdu HSPC132.

Mots clés : Communication mitochondrio-nucléaire, dysfonctionnement mitochondrial, signalisation de stress


cellulaire, prolifération des cellules cancéreuses.

ABSTRACT
Our team studies the role of mitochondrial metabolism in cancer cell proliferation, with a particular interest in
mitochondrio-nuclear dialogue. This interest is justified by the fact that almost all mitochondrial proteins are
imported into the organelle through the activity of specialized import machineries. Our team has focused its
studies on an import machinery that depends on the AIF/CHCHD4 complex and controls the import of a family
of small proteins carrying cysteine motifs (substrates), essential for cell survival, adaptation to stress or induction
of apoptosis. Since some of the substrates imported by this machinery are considered potential therapeutic
targets through their involvement in mitochondrial activities, such as biogenesis of respiratory chain complexes,
lipid homeostasis, mitochondrial ultrastructure, calcium storage or mitochondrial genome translation, it is crucial
to characterize at the molecular and functional level each of these proteins that are not well characterized in man.
HSPC132 is one of these substrates that has been described for its role in the lipid homeostasis of the inner
mitochondrial membrane. Our team's unpublished work shows that the depletion of this protein disrupts
mitochondrial ultrastructure, inhibits cancer cell proliferation and induces an overall change in gene expression.
The same work suggested that mitochondrial dysfunction caused by the loss of HSPC132 could activate the
signaling pathway mediated by the product of the TP53 tumor suppressor gene. During my master M2
internship, I validated this hypothesis by showing the induction of TP53 expression in response to HSPC132
depletion. This work will be continued in order to determine the molecular mechanisms at the origin of TP53
activation and study the implication of this pathway in the inhibition of the proliferation of cancer cells that have
lost HSPC132.

Keywords: Mitochondrio-nuclear communication, mitochondrial dysfunction, cellular stress signaling, cancer


cell prolifération.

38