Vous êtes sur la page 1sur 3

r

TD de Génie Génétique M . MAHAMEDI A-E

Série 3

Exercice 1

La séquence d’un ADN bicaténaire (double brin), correspondant à un gène, est partiellement
reportée ci-dessous.

5’ ATACGGGATCCGAGCTCTCGATCGTCTGCAGAAATTCC 3’

1) Ecrire la séquence et l’orientation du second brin de ce fragment.


2) Donner le brin complémentaire d’ARN
3) Soient les enzymes de restriction BamH I, Pst I , Xho I et Mbo I dont les sites reconnus sont :
BamH I : 5' G/GATCC 3' ; Pst I : 5' CTGCA/G 3' ; Xho I : 5' C/TCGAG 3' ;
Mbo I : 5'/GATC3'. Recopier la séquence de l’ADN et encadrer les sites de restriction en
indiquant la position des coupures et préciser le type d’extrémités obtenu.
4) Voici la séquence d’une amorce (ou primer) : 5’-TTTCTGCA-3’ Où cette amorce se fixera-t-
elle sur la séquence d’ADN ? Quelle séquence obtiendra-t-on après élongation par la DNA-
polymérase ?

Exercice 2

Si nous travaillons avec un ADN linéaire tel que celui montré dans la figure ci-dessous, Quelle est
la taille en paires de bases (pb) des fragments d'ADN obtenus en effectuant des digestions
simples par les enzymes d, e et f et des doubles digestions avec diverses combinaisons entre eux?.

NB : Les chiffres correspondent au nombre de paires de bases d'ADN (taille totale est de 1500
pb).

Exercice 3

On souhaite étudier la fonctionnalité d’un gène M d’une bactérie. Pour cela, on essaie de Le
cloner au site Eco RI du vecteur plasmidique pBR330 (voir schéma) un fragment Eco RI- Eco RI
d'ADN génomique de la bactérie d’intérêt :

Page 1
r
TD de Génie Génétique M . MAHAMEDI A-E

1) Proposez un protocole de clonage et indiquez comment vous sélectionnez les clones


recombinants.
2) Un des plasmides recombinants contenant le gène M (appelé pBM1) est digéré par les enzymes
de restriction Bam HI et Eco RI. Après migration et séparation des fragments d'ADN sur gel
d'agarose puis coloration au bromure d'éthidium, on obtient les profils de restriction suivants:

Donnez la carte de restriction du plasmide recombinant pBM1.

Exercice 4

Voici la carte de restriction suivante :

Schématiser le profil électrophorétique des fragments issus de la digestion de ce plasmide par


chacune des enzymes et par la double digestion (Eco RI + Pst I).

Page 2
r
TD de Génie Génétique M . MAHAMEDI A-E

Exercice 05 :

On dispose de l’ADNc (ADN complémentaire) de l’insuline humaine, du plasmide pBR322, de


bactéries hôtes sensibles à l’ampicilline (AMP) et à la tétracycline (TET) ainsi qu’une
enzyme de restriction: Bam HI.

A la fin de cette expérience, nous obtenons trois types de clones bactériens dont les
caractéristiques sont regroupées dans le tableau suivant :

Clone Milieu de culture Milieu de culture Milieu de culture


+ TET + AMP Sans antibiotique

I + + +
II - - +
III - + +
+: croissance bactérienne ; - : absence de croissance bactérienne
1/Donner les principales étapes de cette expérience ?
2/Interpréter les résultats regroupés dans ce tableau en précisant le clone positif ?

Exercice 06 :

Mettez les vecteurs suivants par ordre croissant selon la taille du fragment de DNA inséré dans
lesquels :, Cosmide, YAC, Plasmide et Phage λ.

Page 3