ARTICLES

PUBLISHED: 22 DECEMBER 2016 | VOLUME: 3 | ARTICLE NUMBER: 16205

Plant cholesterol biosynthetic pathway overlaps

with phytosterol metabolism
Prashant D. Sonawane1, Jacob Pollier2,3, Sayantan Panda1,4, Jedrzej Szymanski1,5, Hassan Massalha1,
Meital Yona6, Tamar Unger6, Sergey Malitsky1, Philipp Arendt2,3,7,8, Laurens Pauwels2,3,
Efrat Almekias-Siegl1, Ilana Rogachev1, Sagit Meir1, Pablo D. Cárdenas1, Athar Masri1,
Marina Petrikov9, Hubert Schaller10, Arthur A. Schaffer9, Avinash Kamble4, Ashok P. Giri11,
Alain Goossens2,3 and Asaph Aharoni1*

The amount of cholesterol made by many plants is not negligible. Whereas cholesterogenesis in animals was elucidated
decades ago, the plant pathway has remained enigmatic. Among other roles, cholesterol is a key precursor for thousands
of bioactive plant metabolites, including the well-known Solanum steroidal glycoalkaloids. Integrating tomato transcript
and protein co-expression data revealed candidate genes putatively associated with cholesterol biosynthesis.
A combination of functional assays including gene silencing, examination of recombinant enzyme activity and yeast mutant
complementation suggests the cholesterol pathway comprises 12 enzymes acting in 10 steps. It appears that half of the
cholesterogenesis-specific enzymes evolved through gene duplication and divergence from phytosterol biosynthetic
enzymes, whereas others act reciprocally in both cholesterol and phytosterol metabolism. Our findings provide a unique
example of nature’s capacity to exploit existing protein folds and catalytic machineries from primary metabolism to
assemble a new, multi-step metabolic pathway. Finally, the engineering of a ‘high-cholesterol’ model plant underscores the
future value of our gene toolbox to produce high-value steroidal compounds via synthetic biology.

S
terols are isopentenyl pyrophosphate derived molecules vital
for eukaryotic life1,2. Cholesterol and ergosterol are the major
sterols accumulating in animals and fungi, respectively. The
phytosterols (that is, C-24 alkylsterols) campesterol, stigmasterol
and sitosterol are the most abundant sterols in the plant
kingdom3. Besides their major importance as membrane
components, phytosterols serve as precursors for brassinosteroids,
signalling molecules involved in growth and development4. It is
commonly believed that cholesterol is only found in animal
products whereas plant foods (for example, fruit, vegetable and
grains) do not contain cholesterol at all. This erroneous perception
is probably caused by the fact that most plants contain relatively
small quantities of cholesterol (free and esterified) which gives the
legitimacy to define small quantities of food cholesterol as ‘zero’
levels5. Although the cholesterol content of plants is typically
several hundreds to thousands fold less than that of animals, it is
by no means negligible. Aside from serving as a component of
membranes and leaf surface lipids, the cholesterol derivative
7-dehydrocholesterol is a key precursor for the biosynthesis of
vitamin D36. Furthermore, cholesterol serves as the precursor for
specialized (bioactive) metabolites such as the steroidal glycoalkaloids
(SGAs) and phytoecdysteroids7–9.
In animals and fungi, lanosterol formed from 2,3-oxidosqualene
through the action of lanosterol synthase (LAS) serves as a universal
precursor for both cholesterol and ergosterol biosynthesis,
respectively (Fig. 1). The conversion of lanosterol to cholesterol
(termed cholesterogenesis) in animals was elucidated more than
50 years ago and it involved ten enzymatic steps1,10. The committed
precursor for plant sterols (cholesterol and C-24 alkyl phytosterols)
is cycloartenol, generated by cycloartenol synthase (CAS). However,
the presence of a putative LAS gene has been observed in only a few
plant species and has suggested two possible biosynthetic routes for
plant sterol biosynthesis via cycloartenol and/or via lanosterol,
although the contribution of lanosterol in sterol biosynthesis
remains limited11. In plants, cholesterogenesis has been hypoth-
esized to occur either via a similar biosynthetic route and via the
same enzymes producing phytosterols or else via a distinct but
unknown pathway9,12,13. Members of the Solanaceae family, predo-
minantly those producing SGAs (for example, α-solanine in potato,
α-tomatine in tomato), accumulate cholesterol as a major sterol6,7
and hence could serve as unique models for studying plant choles-
terogenesis. Indeed, two genes of the plant cholesterogenesis
pathway were recently identified in tomato and potato14,15. They
encode a sterol side chain reductase enzyme (SSR2) catalysing the
conversion of cycloartenol (the precursor for phytosterols) to
cycloartanol, the first committed step in cholesterogenesis, and a
sterol C-5(6) desaturase (C5-SD) catalysing a later step in the
pathway (Fig. 1).
In this study, we have elucidated the entire plant cholestero-
genesis pathway comprising ten enzymatic steps starting from

1
Department of Plant and Environmental Sciences, Weizmann Institute of Science, Rehovot 7610001, Israel. 2 Department of Plant Systems Biology, VIB,
B-9052 Gent, Belgium. 3 Department of Plant Biotechnology and Bioinformatics, Ghent University, B-9052 Gent, Belgium. 4 Department of Botany, Savitribai
Phule Pune University, Ganeshkhind, Pune 411007, India. 5 School of Computer Sciences and Sackler School of Medicine, Tel Aviv University, Tel-Aviv 69978,
Israel. 6 Israel Structural Proteomics Centre, Weizmann Institute of Science, Rehovot 7610001, Israel. 7 Department of Biochemistry and Microbiology,
Ghent University, B-9000 Gent, Belgium. 8 VIB Medical Biotechnology Center, B-9000 Gent, Belgium. 9 Department of Vegetable Research, ARO-Volcani
Center, Bet Dagan 50250, Israel. 10 Institut de Biologie Moléculaire des Plantes du CNRS & Université de Strasbourg, Institut de Botanique, Strasbourg, France.
11
Plant Molecular Biology Unit, Division of Biochemical Sciences, Council of Scientific and Industrial Research–National Chemical Laboratory, Pune 411008,
Maharashtra, India. *e-mail: asaph.aharoni@weizmann.ac.il

NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants 1

© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
ARTICLES NATURE PLANTS

AACT HMGS HMGR MVK

Acetyl CoA MVA Squalene SQE
BAS
LAS 2,3-oxidosqualene 2,3-oxidosqualene β-amyrin
CAS
SSR2 SMT1

Lanosterol Cycloartanol Cycloartenol

24-methylenecycloartanol
3βHSD-1/2
CYP51 SMO3 SMO1
SDR?

(1) 31-norcycloartanol Cycloeucalenol

C14-R CPI

(2)
31-nor-24(25)-dihydrolanosterol Obtusifoliol
SMO/3βHSD/SR
CYP51

(3)
4α-methylcholesta-8,14-dien-3β-ol 4α-methylergostatrienol
8,7 SI
C14-R

(4)
C5-SD 4α-methyl-24(25)-dihydrozymosterol 4α-methylergostadienol
8,7 SI
SMT2
(5)
7-DR
4α-methyl-5α-cholest-7-en-3β-ol 24-methylenelophenol 24-ethylidenelophenol
3βHSD-1/2
SMO4 SDR? SMO2 SMO2

(6)
DHCR24
Cholesta-7-en-3β-ol Episterol Δ7 avenasterol
C5-SD2 C5-SD1 C5-SD1

Cholesterol

7-dehydrocholesterol Δ5,7 episterol Δ5,7 avenasterol

Humans
7-DR 2 7-DR1 7-DR1

e.g. Uttroside B Cholesterol 24-methylenecholesterol Isofucosterol

SSR1 SSR1
GAME genes

Campesterol β-sitosterol

α-solanine α-chaconine α-tomatine

Brassinolide
Potato SGAs

Stigmasterol
Esculeoside A/B
C-24 alkyl sterols (phytosterols)
Tomato SGAs

Figure 1 | The cholesterogenesis pathway in plants and its relationship to phytosterol metabolism and cholesterogenesis in humans. The plant
cholesterogenesis pathway comprises ten biosynthetic steps starting from 2,3-oxidosqualene. Enzymes taking part in both the plant cholesterol and the
C-24 alkyl phytosterols biosynthetic pathways are depicted in red whereas enzymes specific for one of these pathways are marked in green; MVA, the
triterpenoid precursor and other triterpenoid pathway enzymes are presented in orange. Enzymes catalysing human cholesterogenesis are shown in black
and bold. Note that SMO enzymes in eukaryotes function as a complex with 3βHSD and SR. MVA, mevalonic acid; AACT, acetyl CoA acetyltransferase;
HMGS, 3-hydroxy-3-methylglutaryl-CoA synthase; HMGR, 3-hydroxy-3-methylglutaryl-CoA reductase; MVK, mevalonate kinase; SQE, squalene epoxidase;
BAS, β-amyrin synthase; CAS, cycloartenol synthase; LAS, lanosterol synthase; SMT, sterol C-24 methyltransferase; SMO, C-4 sterol methyl oxidase;
SDR, side chain oxidoreductase; CPI, cyclopropylsterol isomerase; CYP51, sterol C-14 demethylase; C14-R, sterol C-14 reductase; 8,7 SI, sterol 8,7 isomerase;
C5-SD2, sterol C-5(6) desaturase 2; 7-DR2, 7-dehydrocholesterol reductase 2; C5-SD1, sterol C-5(6) desaturase 1 (DWARF7); 7-DR1, 7-dehydrocholesterol
reductase 1 (DWARF5); SSR2, sterol side chain reductase 2; DHCR24, C24-sterol reductase. In human cholesterogenesis, the intermediates are:
(1) 4,4-dimethylcholesta-8,14(15),24-trien-3β-ol; (2) 4,4-dimethylcholesta-8,24-dien-3β-ol; (3) cholesta-8,24-dien-3β-ol; (4) cholesta-7,24-dien-3β-ol,
(5) 7-dehydrodesmosterol; (6) desmosterol.

2 NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants

© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
NATURE PLANTS ARTICLES
a Transcript Protein Skin Flesh
co-expression co-expression

MG

MG
Or

Or
IG

IG
Br

Br
R

R
SSR2
SSR2 SSR2 (Sterol side chain reductase 2)
Putative cholesterol (3) CAS (Cycloartenol synthase)
Putative cholesterol (12) 7-DR2 (7-dehydrocholesterol reductase 2)
Core SGAs (GAMES) (7) SDR (Side chain oxidoreductase)
Phytosterol (1) MVA (1) GAME1 (UDP-galactosyltransferase)
GAME12 (Transaminase)
Core SGAs (GAMEs) (8) GAME17 (UDP-glucosyltransferase)
Other (22) GAME11 (2-oxoglutarate dependent dioxygenase)
GAME6 (CYP72)
MVA (10) GAME18 (UDP-glucosyltransferase)
GAME7 (CYP72)
SQE (Squalene epoxidase)
33 proteins UDP-glucosyltransferase
of the 117 genes co-expressed Cellulose synthase
ATP citrate lyase a-subunit
with SSR2 S8-RNase
UDP-glucuronosyltransferase 1-6
Retinol dehydrogenase 12
Glutathione S-transferase
Aldehyde oxidase/xanthine dehydrogenase
Sulfotransferase family protein
GDSL esterase/lipase
Non-specific lipid-transfer protein
Pathogenesis-related protein
Other (86) Hypersensitive response assisting protein
Spermidine synthase 1
Mitochondrial carrier protein expressed
Cytochrome b5 reductase
Deoxyuridine 5-triphosphate nucleotidohydrolase
Cysteine-rich extensin-like protein-4
Sterol 3-β-glucosyltransferase
Choline dehydrogenase
Unknown Protein
Threonine ammonia-lyase

117 transcripts −2 0 2
co-expressed with SSR2 (r ≥ 0.75)
Relative protein expression
(Z-score)
b Transcripts Proteins
Skin Flesh Seed Skin Flesh
Pollen
Petals
Buds

Root
Leaf
MG

MG

MG

MG

MG
Or

Or

Or

Or

Or
IG

IG

IG

IG

IG
Br

Br

Br

Br

Br
R

TTS2 (Triterpene synthase 2)

TTS1 (Triterpene synthase 1)
SQE (Squalene epoxidase)
GAME7 (CYP72)
ERG28-T (Erg28-like protein)
SQS (Squalene synthase)
FPP Synthase (Farnesyl pyrophosphate synthase)
AACT (Acetyl CoA acetyltransferase)
Phytosterol and MVA- IPP isomerase 1 (Isopentenyl pyrophosphate isomerase 1)
C5-SD1 (Sterol C-5(6) desaturase 1; DWARF7/STE1)
associated cluster 7-DR1 (Sterol Δ7 reductase 1; DWARF5)
MVK (Mevalonate kinase)
MVD (Diphosphomevalonate decarboxylase)
SMO2 (C-4 sterol methyl oxidase 2)
IPP isomerase 2 (Isopentenyl pyrophosphate isomerase 2)
SSR1 (Sterol side chain reductase 1; DWF1)
CPI (Cyclopropylsterol isomerase)
SMO3 (C-4 sterol methyl oxidase 3)
C14-R (Sterol C-14 reductase)
3βHSD2 (3β-hydroxysteroid dehydrogenase/C4-decarboxylase 2)
GAME18 (UDP-glucosyltransferase)
GAME12 (Transaminase)
GAME1 (UDP-galactosyltransferase)
7-DR2 (7-dehydrocholesterol reductase 2)
SDR (Side chain oxidoreductase)
GAME4 (CYP88)
SMT1 (Sterol C-24 methyltransferase 1)
CAS (Cycloartenol synthase)
GAME11 (2-oxoglutarate dependent dioxygenase)
C5-SD 2 (Sterol C-5(6) desaturase 2)
SMO4 (C-4 sterol methyl oxidase 4)
GAME6 (CYP72)
SSR2 (Sterol side chain reductase 2)
GAME9 (Ethylene responsive transcription factor)
Putative cholesterol, common GAME17 (UDP-glucosyltransferase)
3βHSD1 (3β-hydroxysteroid dehydrogenase/C4-decarboxylase 1)
(cholesterol and phytosterol), HMGR (Hydroxymethylglutaryl-CoA reductase)
and core SGAs (GAMEs)- 8,7 SI (Sterol 8,7 isomerase)
associated cluster CYP51 (Sterol C-14 demethylase)
SMO1 (C-4 sterol methyl oxidase 1)

Putative cholesterol
Phytosterol
−2 0 2
Putative common cholesterol and phytosterol
Relative expression MVA
(Z-score) Core SGAs (GAMEs)

Figure 2 | A transcriptomics and proteomics-based co-expression approach reveals a set of putative cholesterol pathway genes. a, A scheme representing
the two-stage co-expression analysis using SSR2 as a bait. In the first stage, 117 transcripts were found to be co-expressed with SSR2 (see Supplementary
Data 1, correlation coefficient; r-value ≥ 0.75) and divided into functional groups (coloured bars). In the second stage, out of the 117 genes, 33 corresponding
proteins were found to be co-expressed with SSR2, all of which were represented in the heat map. b, Global heat map showing transcripts and protein levels
in different tomato tissues at different developmental stages corresponding to genes encoding enzymes involved in MVA, cholesterol, phytosterol and SGA
biosynthesis. Missing data points are represented by grey fields. IG, immature green; MG, mature green; Br, breaker; Or, orange; R, red ripe. The transcriptomics
and proteomics data details are described in the Methods section.

NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants 3

© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
ARTICLES NATURE PLANTS

99 Nt SMO1
a 98 Sl 7-DR2 c 92 Nb SMO1 d
82 St 7-DR2 99 Sl SSR2
99 Ca SMO1
99 Ca 7-DR2 90 St SSR2
47 Sl SMO1
99 Sm 7-DR2 82 St SMO1 89 Ca SSR2-1
Nb 7-DR2-1 70 80 Sm SSR2-1
Vv SMO1
99 98 Nb 7-DR2-2
At SMO1-3 89 Nb SSR2-1
Ca 7-DR1 94 Nb SSR2-2
At SMO1-1
27 93 Ca SSR2-2
97 Sm 7-DR1 73 At SMO1-2
56
81 Sl 7-DR1 99 Sm SSR2-2
59 Ca SMO3
93 St 7-DR1 30 Vv SSR1
Nb SMO3
Mt 7-DR1 27 100 Sl SMO3 Mt SSR1
19
50 Vv 7-DR1 74 St SMO3 98 Nb SSR1-1
91 Sb 7-DR1 Nb SSR1-2
99 Pp SMO1-1 61
93 Zm 7-DR1 Ca SSR1
39 Pp SMO1-2
99 Os 7-DR1 78 Sl SSR1
S. moellendorffii SMO1-1
58 Bd 7-DR1-1 100 S. moellendorffii SMO1-2 100 St SSR1
76
99 Bd 7-DR1-2 70 Bd SSR1
Sb SMO1-1
72 At DWARF5 Os SSR1
99 83 Bd SMO1-2
100
S. Moellendorffii 7-DR1 35 Os SMO1 93 Zm SSR1
86
Pp 7-DR1-1 96 Sb SSR1
55 Bd SMO1-4
Pp 7-DR1-2 37 Arabidopsis DWARF1
Bd SMO1-3
100 H. sapiens S. moellendorffii SSR1
Bd SMO1-1
Danio rerio 70 Pp SSR1-1
67 Sb SMO1-3
O. lucimarinus SR 86 Pp SSR1-2
48 Sb SMO1-5
Chlamydomonas reinhardtii SR H. sapiens
100 51 Sb SMO1-2
100 Volvox carteri SR 100 Sb SMO1-4 S. cerevisiae ERG4
0.2 67
60 Zm SMO1
1
77 Zm SMO2
b 99 Sl C5-SD2 97 Sb SMO2
87 St C5-SD2 99
Os SMO2
95 Ca C5-SD2
Bd SMO2
74 Nb C5-SD2
99 Pp SMO2-1
96 Nt C5-SD2
40 Pp SMO2-2
65 Sl C5-SD1
55 S. moellendorffii SMO2-2
St C5-SD1 97
21 83 Nb C5-SD1 S. moellendorffii SMO2-1
99 S. moellendorffii SMO2-3
89 Nt C5-SD1
100 Sl SMO4
Vv C5-SD1-2 90 St SMO4
51
A. thaliana DWARF7
7 46 45 Ca SMO4
Vv C5-SD1-1 99
14 Nb SMO4
84 Os C5-SD1
34 Nt SMO2
Bd C5-SD1
99 49 Vv SMO2-1
Zm C5-SD1-2
40
48 38 Vv SMO2-2
41 94 Sb C5-SD1 At SMO2-1
85 Zm C5-SD1-1
99 At SMO2-2
Mt C5-SD1-1
66 Ca SMO2
89 99 Mt C5-SD1-2
Nb SMO2
S. moellendorffii C5-SD1-1 96 Sl SMO2
99 100 S. moellendorffii C5-SD1-2
99 St SMO2
Pp C5-SD1
Ostreococcus tauri SMO1
Volvox carteri C5-SD1
99 Ostreococcus tauri SMO2
92 Chlamydomonas reinhardtii C5-SD1
S. cerevisiae (ERG25)
Ostreococcus tauri C5-SD1
Chlamydomonas reinhardtii FAH
73 S. cerevisiae (ERG3) 100 Volvox carteri FAH
73 T. cruzi C5-SD
0.5
O. lucimarinus FAH
0.5

Figure 3 | Phylogenetic analysis suggests that some of the cholesterol biosynthesis enzymes evolved by duplication and divergence from the phytosterol
biosynthesis enzymes. a–d, Phylogenetic relationship among 7-DR (a), C5-SD (b), SMO (c) and SSR (d) plant proteins. Sequences from the following
species were represented: tomato (Sl), potato (St), tobacco (Nt), N. benthamiana (Nb), Capsicum annuum (Ca), eggplant (Sm), rice (Os), Medicago truncatula (Mt),
maize (Zm), Arabidopsis thaliana (At), Physcomitrella patens (Pp), Sorghum bicolor (Sb), Vitis vinifera (Vv), Brachypodium distachyon (Bd), Selaginella moellendorffii,
Ostreococcus tauri, Ostreococcus lucimarinus, Chlamydomonas reinhardtii, Volvax carteri, Homo sapiens and S. cerevisiae. The evolutionary history was inferred
using the maximum-likelihood method in MEGA6 (ref. 44). Numbers are bootstrap values in percentage of 1,000 replicates. Tomato cholesterol and
phytosterol biosynthesis genes forming distinct clades and characterized in this study are marked in green and red triangles, respectively. Details of the amino
acid sequences used for phylogenetic analysis are given in Supplementary Data 2. Blue circles indicate duplication fork in respective phylogenetic tree, while
red circles show clade separation from phytosterol enzymes. In phylogenetic trees, FAH, fatty acid hydroxylase; SR, sterol reductase.

2,3-oxidosqualene, the terpenoid precursor shared with the phytosterol Based on sequence homology, these candidates putatively encode
pathway (Fig. 1). CAS, sterol methyl oxidase 3 (SMO3), 3β-hydroxysteroid dehydro-
genase/C4-decarboxylase 2 (3βHSD2), side chain oxidoreductase
Uncovering plant cholesterogenesis-associated genes (SDR), cyclopropyl sterol isomerase (CPI), sterol C-14 demethylase
The prospective structural similarity of intermediates and the (CYP51), sterol C-14 reductase (C14-R), sterol 8,7 isomerase (8,7 SI),
requirement for analogous enzyme activities has suggested that sterol methyl oxidase 4 (SMO4), 7-dehydrocholesterol reductase 2
plant cholesterogenesis enzymes might have evolved from those (7-DR2), sterol C24-methyltransferase 1 (SMT1) and erg28-like
acting in phytosterol metabolism. Alternatively, promiscuity might protein (ERG28T). Based on the predicted activities of the corre-
permit common enzymes to act in the two pathways. Having in sponding enzymes including those previously reported (that is, SSR2
mind the possible occurrence of these two major evolutionary and C5-SD2), a ten-step pathway starting from 2,3-oxidosqualene
mechanisms, a two-stage co-expression analysis using tomato and comprising 12 enzymes was proposed (Fig. 1).
transcriptomics and proteomics data was launched to probe for The second stage of the analysis integrated shot-gun proteomics
cholesterogenesis gene candidates. data that was derived from two tissues of tomato fruit, skin and
First, transcript co-expression analysis performed using SSR2 as flesh, at five stages of development and was anticipated to corrobo-
bait revealed 117 co-expressed transcripts (r-value ≥ 0.75) (Supplementary rate the transcriptome-based selection of candidate cholestero-
Data 1). These included 10 and 8 genes linked with the mevalonic acid genesis genes. Out of the 117 genes co-expressed with SSR2,
(MVA) based isopentenyl pyrophosphate pathway and the core SGA 75 corresponding proteins could be effectively quantified in the pro-
biosynthesis16 (that is, GAME (GLYCOALKALOID METABOLISM)), teomics assay. Clustering of this protein set according to their
respectively (Fig. 2a). Furthermore, a set of 13 sterol metabolism expression profile revealed 33 proteins that were co-expressed
related genes including C5-SD (termed here C5-SD2), thus poten- with SSR2 and displayed high expression in the immature green
tially involved in cholesterogenesis, were co-expressed with SSR2. stage of fruit development (in both skin and flesh tissues; Fig. 2a),

4 NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants

© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
NATURE PLANTS
where SGA biosynthesis and cholesterogenesis is most prevalent.
Among the 33 proteins, we found three cholesterogenesis candidates
(that is, CAS, 7-DR2 and SDR) together with seven core SGA
enzymes (GAME1, 6, 7, 11, 12, 17, 18) and squalene epoxidase.
We subsequently examined the transcript and protein expression
patterns across different tissue types representing (i) known MVA
pathway genes, (ii) known phytosterol pathway genes, (iii) putative
cholesterol pathway genes, (iv) core SGA pathway (GAME) genes
and (v) putative common cholesterol and phytosterol genes
(Fig. 2b). Two major gene expression clusters were detected that
were also evident at the protein level. The cholesterogenesis and
shared cholesterogenesis and phytosterol biosynthesis gene candidates
clustered with GAME genes that produce the cholesterol-derived α-
tomatine. The reduced transcript levels of the putative cholesterol
and GAME genes later in fruit development correlates with the
typical reduction of α-tomatine levels during fruit development and
ripening17. The second expression cluster was mainly composed of
known MVA and phytosterol biosynthetic pathway genes (Fig. 2b).
Diverged and concurrently acting enzymes
Characterization of side chain reductase (SSR) proteins revealed that
SSR1 functions specifically in phytosterol production whereas SSR2
evolved from SSR1 acts explicitly in cholesterogenesis14.
Phylogenetic analysis indicated that SSR1 and SSR2 proteins from
tomato and potato represent two distinct clades in the SSR
family14. We assumed that the divergence of new cholesterogenesis
enzymes from phytosterol synthesis enzymes might have occurred
multiple times in plants. Indeed, we found two distinct sterol C-5
desaturases (C5-SD1, a DWARF7/STE1 homologue and C5-SD2),
two sterol Δ7-reductases (7-DR1, a DWARF5 homologue and
7-DR2) and two pairs of sterol methyl oxidases (SMO1 and
SMO3 versus SMO2 and SMO4). Phylogenetic analysis demon-
strated that, as for the SSR proteins, we could distinguish protein
pairs splitting into two different clades for each of these enzymes
(Fig. 3a–c). This suggested divergence of the potential cholestero-
genesis proteins C5-SD2, 7-DR2, SMO3 and SMO4 from the
earlier phytosterol synthesis associated C5-SD1, 7-DR1, SMO1
and SMO2, respectively (Fig. 3a–c). The distinguishing pairs of
tomato proteins, especially 7-DR1/7-DR2, C5-SD1/C5-SD2 and
SSR1/SSR2, formed a separate clade from the known plant
phytosterol pathway proteins (for example, DWARF5, DWARF7
and DWARF1 from Arabidopsis), and showed a clear duplication
fork and were monophyletic in their branching clade (Fig. 3a,b,d).
Phylogenetic analysis of parted SMO3 and SMO4 proteins from
known phytosterol (SMO1 and SMO2) ones also supported the
scenario that we propose (Fig. 3c). SMOs are known to function
in a multi-enzyme complex in eukaryotes with two additional
enzymes, 3βHSD and sterone reductase (SR)18. Accordingly, we could
also find two distinct putative 3βHSD proteins (3βHSD1 and
3βHSD2) that split into two different clades (Supplementary Fig. 1a)
and a single SDR, which might function as a SR in plants.
Four candidate genes, CPI, CYP51, C14-R and 8,7 SI, appear as a
single copy in the tomato genome, similar to Arabidopsis ortholo-
gous genes that were known to function in phytosterol biosynthetic
pathway19–22. We envisaged that these might correspond to shared
enzymes between the cholesterol and phytosterol pathways.
Altogether, we propose that starting from 2,3-oxidosqualene, the
tomato cholesterogenesis pathway involves ten enzymatic steps
(Fig. 1). Details of the genes investigated in this study are given in
Supplementary Table 1a.
CAS-dependent cholesterol and phytosterol biosynthesis
To investigate the role of the tomato CAS in the cholesterogenesis
pathway, we silenced CAS using virus induced gene silencing
(VIGS; Supplementary Fig. 2a). CAS-silenced tomato leaf and
green fruit tissue showed a significant decrease in α-tomatine
NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants
© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
ARTICLES
(Supplementary Fig. 2b). They also displayed a drastic reduction
in cholesterol, stigmasterol, β-sitosterol, isofucosterol and cycloarte-
nol levels, whereas β-amyrin, which also depends on 2,3-oxidosqualene
as a precursor (Fig. 1), was significantly increased (Supplementary
Fig. 2c). Expression of CAS in a yeast strain engineered for high,
inducible production of 2,3-oxidosqualene23 (Supplementary
Fig. 2d,f; Supplementary Table 1b) or in a LAS (ERG7) deficient
yeast strain24 (Supplementary Fig. 2e; Supplementary Table 1b)
led in both cases to the accumulation of cycloartenol. Together,
these results confirm that CAS encodes the cycloartenol synthase
enzyme providing the common precursor for tomato cholesterol
and phytosterol metabolism (Fig. 1).
Minimal role of LAS in cholesterol and sterol biosynthesis
In higher plants, the committed sterol precursor is cycloartenol
although a few reports have suggested a limited contribution of
lanosterol as an alternative precursor for sterol biosynthesis11. To
investigate the precise role of lanosterol synthase (LAS) in cholester-
ogenesis, the tomato LAS gene was functionally characterized. LAS-
silenced leaf tissue (through VIGS) showed no major change in the
levels of the cholesterol-derived SGAs, α-tomatine and dehydroto-
matine (Supplementary Fig. 3a,b). Moreover, when compared to
control plants, LAS-silenced leaves did not show a major change
in sterol composition or in the accumulation of 2,3 oxidosqualene
or β-amyrin (Supplementary Fig. 3c). The activity of LAS was
also assessed in the same yeast strains used for CAS characterization
(see above). Expression of LAS in yeast strain TM1 did not lead to an
altered triterpenoid composition (Supplementary Fig. 3d,f );
however, when expressed in GIL77, minimal amounts of lanosterol
were detected. In addition, GIL77 expressing LAS accumulated high
amounts of ergosterol and was able to grow on a medium lacking
ergosterol (Supplementary Fig. 3e,g), implying functional comple-
mentation of erg7 by lanosterol synthase enzyme activity of LAS.
These findings suggested a minimal or a lack of LAS contribution
in generating lanosterol as a precursor for cholesterol and phytos-
terol biosynthesis in tomato and imply that cholesterol and sterol
metabolism in tomato is most likely CAS-dependent.
Role of proteins from the C-4 demethylation complex
The C-4 demethylation of sterol intermediates is a crucial step in sterol
biosynthesis in plants, mammals and fungi. The removal of two methyl
groups at the C-4 position of sterol precursors involves an enzyme
complex containing an SMO producing the 4α-carboxyl derivative, a
3βHSD converting the 4α-carboxyl derivative to the 3-oxosteroid
and a SR reducing the oxosteroid to the corresponding 3β-hydroxy
demethylated sterols1. In mammals and yeast, both methyl groups at
C-4 are removed successively by a single SMO18. In plant phytosterol
biosynthesis, SMO1 and SMO2 were reported to remove the first
(24-methylene cycloartanol to cycloeucalenol) and second (24-methyl-
enelophenol to episterol and 24-ethylidenelophenol to Δ7 avenasterol
respectively) C-4 methyl groups of phytosterol precursors (Fig. 1)20,25.
Co-expression and phylogenetic analysis in tomato suggested
that SMO3 and SMO4 participate in the C-4 demethylation of
cholesterol precursors (Figs 1 and 3c). SMO3 and SMO4 VIGS-
silenced tomato leaf and green fruit displayed a significant reduction
in α-tomatine levels, whereas no change in α-tomatine content was
observed when silencing SMO1 and SMO2 in the same tissues
(Fig. 4a; Supplementary Fig. 1b). Yet, silencing SMO1 and SMO2
resulted in α-tomatine accumulation in the red fruit (Fig. 4a). In
terms of sterol composition, SMO3- and SMO4-silenced leaves
showed a marked decrease in cholesterol with an apparent increase
in β-sitosterol, isofucosterol, cycloartenol and 24-ethylidenelophe-
nol (Fig. 4b,c). Silencing of SMO1 and SMO2, on the other hand,
resulted in a sharp decrease in β-sitosterol, isofucosterol and
24-ethylidenelophenol, whereas cholesterol levels remained unaffected
and cycloartenol levels increased (Fig. 4b,c).
5
ARTICLES
To expand the range of our analysis, we also identified the entire
set of cholesterol pathway candidate gene homologues in the
genome of Nicotiana benthamiana, a substantial producer of
cholesterol (∼12% of total sterols)26. N. benthamiana SMO3 and
SMO4 VIGS-silenced leaves showed a significant reduction in
cholesterol levels with no major change in phytosterols apart from
reduced isofucosterol (Fig. 4f; Supplementary Fig. 1c). Silencing of
SMO1 resulted in a major decrease in the phytosterols campesterol,
stigmasterol, isofucosterol, Δ7 avenasterol and 24-ethylidenelophenol
with no change in cholesterol composition (Fig. 4d–f ).
Silencing of SMO2 resulted in the accumulation of its substrate
24-ethylidenelophenol and reduction in levels of its product Δ7
avenasterol (Fig. 4d,e), as well as decreased campesterol levels
(Fig. 4f ). These results tie SMO3 and SMO4 with cholesterogenesis,
but SMO1 and SMO2 with the phytosterol pathway (Fig. 1). In a few
cases of VIGS silencing (for example, SMO2), we detected small
changes in sterol profiles. This might be due to the VIGS exper-
iments in which genes are only partially silenced as well as marginal
redundancy, such as between SMO2 and SMO4 that possibly share
interacting complex proteins.
VIGS-silencing of the 3βHSD2 candidate, a putative component
in the C-4 demethylation complex, resulted in reduced levels of
α-tomatine in tomato leaves and green fruit as well as of esculeoside
B in red fruit (the major SGA accumulating in mature fruit;
Supplementary Fig. 4a,b). Moreover, cholesterol, campesterol,
β-sitosterol, isofucosterol and Δ7 avenasterol levels were reduced
in 3βHSD2-silenced tomato leaves (Supplementary Fig. 4c).
Accordingly, cholesterol and several phytosterol species levels
were reduced in N. benthamiana 3βHSD2 VIGS-silenced leaves
(Supplementary Fig. 4d). In previous studies, VIGS-silencing of
3βHSDs, which probably targeted both the 3βHSD1 and 3βHSD2
homologues, in N. benthamiana resulted in the accumulation of
the 4α-carboxy sterol derivative in the phytosterol branch, but the
major sterol profile remained unchanged27. Following VIGS charac-
terization, we propose that our 3βHSD2 might function as a
common enzyme in both phytosterol and cholesterogenesis. The
SR protein, a likely third component of the C-4 demethylation
complex, has not been reported in plants to date and its activity
has only been partially demonstrated28. A homology search using
the yeast ERG27 protein did not point to a clear plant homologue.
Yet, our SSR2 co-expressed genes list included a putative SDR that
might function in the C-4 demethylation complex. SDR VIGS silen-
cing resulted in reduced SGA levels in leaf and fruit tissues
(Supplementary Fig. 4e,f ). Furthermore, SDR-silenced leaves
showed decreased levels of cholesterol, campesterol, stigmasterol,
β-sitosterol and isofucosterol, inferring its likely role in both the
cholesterol and phytosterol pathways (Supplementary Fig. 4g).
Four enzymes overlap between both sterol pathways
Up to this point we have provided evidence that CAS generates
cycloartenol, the branching point to cholesterol and phytosterol
biosynthesis, whereas 3βHSD2 and SDR are probably components
of the C-4 demethylation complex acting promiscuously in both path-
ways, but with specific SMOs. It appears that four additional proteins,
that is, CPI, CYP51, C14-R and 8,7 SI, all known to catalyse specific
reactions in the phytosterol synthesis pathway19–22,29, may exhibit pro-
miscuous activity and participate in both cholesterol and phytosterol
production. Indeed, in humans, CYP51, C14-R and 8,7 SI take part
in cholesterogenesis whereas ERG11, ERG24 and ERG2 genes in
yeast partake in ergosterol biosynthesis and encode CYP51, C14-R
and 8,7 SI enzymes, respectively. In contrast, the step catalysed by
CPI is restricted to the plant kingdom. The SGA α-tomatine was
reduced considerably in leaf and green fruit tissues as was esculeoside B
in red fruit when VIGS silencing was applied for each of these
four genes (Fig. 5a; Supplementary Data Fig. 1b). Levels of
cholesterol and of most phytosterol metabolites examined were
6 NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants
© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
NATURE PLANTS
also reduced when silencing the four genes in either tomato or
N. benthamiana leaves (Fig. 5b–e; Supplementary Fig. 1c).
Cycloartenol levels were dramatically increased only in the
CPI-silenced tomato leaves.
We anticipated that CPI might be catalysing the conversion of
31-norcycloartanol to 31-nor-24(25) dihydrolanosterol (Fig. 1).
Indeed, CPI-silenced leaves showed significant accumulation of
the 31-norcycloartanol substrate (Fig. 5c). Analysis of stable trans-
genic CPI RNAi tomato lines (CPI-RNAi-#1 and CPI-RNAi-#2)
corroborated our VIGS results (Supplementary Fig. 5a–c). In the
predicted cholesterol pathway, CYP51 would be catalysing the
conversion of 31-nor-24(25) dihydrolanosterol to 4α-methylcho-
lesta-8,14-dien-3β-ol, which might be further converted to
4α-methyl-24(25)-dihydrozymosterol and finally to 4α-methyl-5α-
cholest-7-en-3β-ol by successive action of C14-R and 8,7 SI,
respectively. In tomato, CYP51-silenced leaves showed accumu-
lation of 31-norcycloartanol, the direct precursor of 31-nor-24(25)
dihydrolanosterol (predicted CYP51 substrate) (Fig. 5c). Silencing
of CYP51 in N. benthamiana resulted in major accumulation of
31-nor-24(25) dihydrolanosterol and obtusifoliol, the latter
serving as the substrate of CYP51 in the phytosterol pathway
(Fig. 5e). CYP51-silenced N. benthamiana plants displayed a
severe growth retarded phenotype (Supplementary Fig. 6a). Leaves
of the C14-R-silenced tomato plants displayed substantial accumu-
lation of 4α-methylcholesta-8,14-dien-3β-ol, an expected C14-R
substrate in cholesterogenesis (Fig. 5c). We further carried out func-
tional characterization of 8,7 SI in yeast cells deficient in ERG2,
which are viable but do not accumulate ergosterol30,31. Expression
of the tomato 8,7 SI complemented the ergosterol deficiency of
this strain (Supplementary Fig. 6b,c), further confirming the
Δ8-Δ7-sterol isomerase activity of the tomato 8,7 SI enzyme.
Diverged enzymes catalyse last steps in cholesterogenesis
Phylogenetic analysis of tomato sterol C-5(6) desaturases revealed
the presence of two proteins (C5-SD1 and C5-SD2; 88% amino
acid similarity). Recently, Cárdenas et al. 15 proposed a role for
C5-SD2 in plant cholesterogenesis. We therefore predicted that
C5-SD1, an orthologue of the Arabidopsis DWARF7/STE1, might
be catalysing the desaturation step of C-24 phytosterol intermediates
to form Δ5,7-sterols in phytosterol biosynthesis (Fig. 1). The
Arabidopsis dwarf7/ste1 mutant produces minor amounts of
Δ5,7-sterols with noticeably unaltered cholesterol levels32,33.
C5-SD1 VIGS-silenced tomato leaves displayed significant reduction
in campesterol, stigmasterol and isofucosterol whereas cholesterol
levels remained unaffected (Supplementary Fig. 7a,c). Furthermore,
levels of α-tomatine were not significantly changed in leaf and
green fruit tissue of the C5-SD1-silenced plants, whereas significant
accumulation of α-tomatine and esculeoside B was noticed in red
ripe fruit (Supplementary Fig. 7b). Cycloartenol levels were
considerably increased in VIGS-silenced leaves (Supplementary
Fig. 7c). Both C5-SD enzymes were able to restore ergosterol
production in an ERG3-deficient yeast strain implying sterol
C5(6) desaturase activity (Supplementary Fig. 8a,b).
To further corroborate the function of C5-SD2 in cholesterogen-
esis, we examined its activity using the predicted native substrate
cholesta-7-en-3β-ol (Fig. 1). The recombinant C5-SD2 enzyme
generated in insect cells efficiently produced 7-dehydrocholesterol
from cholesta-7-en-3β-ol in a NADH-dependent reaction (Fig. 6a).
We also assayed the recombinant C5-SD1 with cholesta-7-en-3β-ol
and could not detect 7-dehydrocholesterol formation suggesting its
specific activity with phytosterol pathway intermediates (Fig. 6a).
In humans, 7-dehydrocholesterol reductase catalyses the last
step in lanosterol-dependent cholesterogenesis by converting
7-dehydrocholesterol into cholesterol. In plants, DWARF5 specifically
catalyses the reduction of Δ5,7-episterol and Δ5,7-avenasterol to
24-methylenecholesterol and isofucosterol, respectively, in the
NATURE PLANTS ARTICLES
a b 0.5
40,000 Control

Tomato-silenced leaves relative sterol level

Relative α-tomatine level (peak area)
30,000 SMO3
0.4
SMO4
20,000 ** **
SMO1
**
SMO2 0.3
6,000 * *
***
*** 0.2
4,000

** 0.1
2,000 *

0 0.0
Leaves Green fruit Red fruit Cholesterol Stigmasterol

c d β-sitosterol Isofucosterol 24-ethylidene lophenol

N. benthamiana-silenced leaves relative sterol level

5 Cycloartenol

Control
4

Relative abundance (EIC)

3

*
** * SMO3-silenced
2
* *
**
**
1
***
SMO4-silenced
0
l

ol

ol

ol
ro

ro
er

er

er
te

te

SMO1-silenced
st

st

st
es

as
pe

co
ito
m
ol

fu
m

s
Ch

ig

β-

Iso
Ca

St

SMO2-silenced

14.5 15.0 15.5 16.0 16.5 17.0 17.5 18.0 18.5

Time (min)

f
e Control
Δ avenasterol
7
Relative abundance (EIC)

Relative abundance (EIC)

Control SMO1-silenced

SMO1-silenced
24-ethylidene
lophenol
SMO2-silenced

SMO2-silenced
15.5 16.0 16.5 17.0
Time (min) 17.0 17.5 18.0 18.5
Time (min)

Figure 4 | Distinct pairs of SMOs are involved in cholesterol and phytosterol biosynthesis. SMO1, SMO2, SMO3 and SMO4 were silenced in tomato and
N. benthamiana using VIGS. a, Levels of α-tomatine in leaves, green and red fruit of SMO-silenced tomato plants compared to control (plants infected with
the pTRV2 vector harbouring Del/Ros sequences). b,c, Levels of cholesterol and phytosterols in SMO-silenced tomato (b) and N. benthamiana (c) leaves
compared to controls. For N. benthamiana, plants infected with the pTRV2 empty vector were used as a control. Relative metabolite levels are expressed as
ratios of peak areas compared to internal standard (epicholesterol). d, Sterol content changes in SMO-silenced tomato leaves compared to control. Extracted
ion chromatograms (EICs) are shown. e,f, Levels of Δ7 avenasterol (e) and 24-ethylidene lophenol (f) in VIGS-silenced SMO1 and SMO2 N. benthamiana
leaves. Values in panels a,b,c represent mean ± s.e.m. (n = 3). Asterisks indicate significant changes from control plants as calculated by Student’s t-test
(*P-value < 0.05; **P-value < 0.01; ***P-value < 0.001).

phytosterol biosynthesis pathway2,34. It has already been proposed (7-DR1 and 7-DR2; 83% amino acid similarity) led us to hypoth-
that DWARF5 could also act on 7-dehydrocholesterol to form esize that, as for SSR, SMO and C5-SD proteins, one 7-DR, that
cholesterol6. Finding two related Δ5,7-sterol-Δ7 reductase enzymes is, 7-DR1/DWARF5, would act in phytosterol biosynthesis

NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants 7

© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
ARTICLES NATURE PLANTS

a α-tomatine α-tomatine b 3.0

40,000 Control ***

Tomato-silenced leaves relative sterol level

2.5
CPI
30,000 2.0
CYP51
Relative SGA level (peak area)
** 1.5
20,000 ** ** *** C14-R
**
** 8,7 SI
10,000 ***
*** 0.4

0.3
300 Esculeoside B *
0.2 *
200 *** ** ** †
*** *
** 0.1 *
100 ** ** **
** ***
****** ** *
0.0 *** ****
0

ol

ol

ol

ol

ol

l
no
es

it

it

er

er

er
te

te
fru

fru

te
av

st

st

st
as

os

ar
e

pe

co
Le

m
ol

sit

clo
ee

Re

fu
m
Ch

ig

β-
Gr

Cy
Iso
Ca

St
c 4α-methylcholesta-8,14-dien-3β-ol d
5.0

N. benthamiana-silenced leaves relative sterol level

Stigmasterol β-sitosterol
Cycloartenol 4.5
Isofucosterol 4.0
3.5
C14-R 3.0 *
Tomato-silenced leaves (EIC)

2.5 *
* **
CYP51 2.0 ** *
***
31-norcycloartanol 1.5 ** *
*** ***
1.0 ****
‡ **
0.5
CPI **
*
*
0.1 ***
***
***
0.0
l

ol

ol

l
ro

ro

ro

ro
Control
er

er
te

te

te

te
st

st
es

as

os

as
pe

co
m

en
ol

sit

fu
m
Ch

ig

av
β-

Iso
Ca

13.5 14.0 14.5 15.0 15.5 16.0 16.5 17.0

St

Δ7
Time (min)

e 31-nor-24(25) dihydrolanosterol
Stigmasterol
Campesterol
Obtusifoliol
Cholesterol
Isofucosterol
N. benthamiana-silenced leaves (EIC)

‡
CYP51
β-sitosterol

CPI

β-sitosterol

Control

12 13 14 15 16 17
Time (min)

Figure 5 | Common enzymes in the cholesterol and phytosterol biosynthetic pathways. a, Levels of the predominant steroidal glycoalkaloid (α-tomatine)
in leaves and green fruit, and esculeoside B in red (ripe) fruit of CPI-, CYP51-, C14-R- and 8,7 SI-silenced tomato plants as compared to control plants.
b, Reduced cholesterol and phytosterols levels in leaves upon silencing of CPI, CYP51, C14-R and 8,7 SI in tomato (†not detected). c, Changes in sterol content
detected in CPI-, CYP51-, C14-R-silenced tomato leaves. EICs are displayed. CPI- and C14-R-silenced tomato leaves showed accumulation of the predicted
corresponding cholesterogenesis precursors, 31-norcycloartanol and 4α-methylcholesta-8,14-dien-3β-ol, respectively. CYP51-silenced plants also showed
accumulation of 31-norcycloartanol. **indicates the presence of a different sterol but not isofucosterol, although showing the same retention time. The GCMS
spectra of noted metabolites are provided in Supplementary Fig. 11. d, Altered cholesterol and phytosterol profile observed in CPI-, CYP51-, C14-R- and
8,7 SI-silenced N. benthamiana leaves. e, Levels of 31-nor-24(25) dihydrolanosterol, the predicted intermediate in the cholesterol pathway and obtusifoliol,
a known precursor in phytosterol biosynthesis in CYP51-silenced N. benthamiana leaves. ‡Obtusifoliol shows overlapping retention time with β-sitosterol.
A GCMS spectrum for obtusifoliol is given in Supplementary Fig. 11. Values in panels a, b and d indicate mean ± s.e.m. (n = 3). Asterisks indicate significant
changes as calculated by a Student’s t-test (*P-value < 0.05; **P-value < 0.01; ***P-value < 0.001). Controls used for tomato and N. benthamiana VIGS
experiments are already mentioned in Fig. 4.

8 NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants

© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
NATURE PLANTS ARTICLES
a b

Cholesterol std.
Cholesta-7-en-3β-ol std.

7-dehydrocholesterol std.
7-dehydrocholesterol std.

Relative abundance (EIC)

Relative abundance (EIC)

7-DR1 assay
C5-SD1 assay

C5-SD2 assay
7-DR2 assay

No NADH
No NADPH

Sf9 control Sf9 control

11 12 13 14 15 16 11 12 13 14 15 16
Time (min) Time (min)

c d
25

20
Sterol concentration (μg g−1)

***
***
15

WT CHO-#1
10

0
5.0 cm WT CHO-#1 CHO-#2

Figure 6 | C5-SD2 and 7-DR2 catalyse the last two steps in plant cholesterogenesis. a, Desaturation of cholesta-7-en-3β-ol to 7-dehydrocholesterol by
C5-SD2. The tomato C5-SD1 and C5-SD2 genes were expressed in Sf9 insect cells and their activity with cholesta-7-en-3β-ol was examined. GCMS EICs are
displayed. b, Reduction of 7-dehydrocholesterol to cholesterol by 7-DR2. The tomato 7-DR1 and 7-DR2 genes were expressed in sf9 insect cells and their
activity with 7-dehydrocholesterol was examined. c, Metabolic engineering of ‘high-cholesterol’ Arabidopsis plants. A binary vector (pCHOLESTEROL),
harbouring 11 genes of the tomato cholesterogenesis pathway was introduced in Arabidopsis plants. Compared to wild-type (WT) plants, a clear
morphological phenotype, that is, growth retardation, shorter petiole, smaller and serrated leaves margin, was observed in two independent transgenic lines
that expressed ten genes (SDR showed low transcript expression and might not have been contributed here in cholesterogenesis) in planta (that is, CHO-#1
and CHO-#2; see Supplementary Fig. 10a). d, Absolute concentrations (μg per gram of leaf tissue) of cholesterol determined with gas chromatography–mass
spectrometry in the CHO-#1 and CHO-#2 pCHOLESTEROL-expressing Arabidopsis lines (compared to WT). Values represent mean ± s.e.m. (n = 7 for WT
and n = 3 for individual transgenic lines). Asterisks indicate significant changes from WT plants as calculated by the Student’s t-test (*P-value < 0.05;
**P-value < 0.01; ***P-value < 0.001).

whereas the other, that is, 7-DR2, would generate cholesterol from
7-dehydrocholesterol. Indeed, levels of α-tomatine and esculeoside B
were significantly reduced in green tissues and red fruit of 7-DR2-
silenced tomato plants, respectively (Supplementary Fig. 7d,e).
Cholesterol content decreased in addition to there being an
unexpected decline in stigmasterol and β-sitosterol levels
(Supplementary Fig. 7f ) as well as a large build-up of obtusifoliol
and cycloartenol in 7-DR2 VIGS-silenced tomato leaves
(Supplementary Fig. 7f ). Leaves of 7-DR2-silenced N. benthamiana
displayed a similar sterol profile as observed for tomato VIGS

NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants 9

© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
ARTICLES
silencing apart from the isofucosterol levels being unaffected
(Supplementary Fig. 7g), suggesting that 7-DR2 might still be
involved in phytosterol biosynthesis as well.
Both 7-DRs proteins were examined for Δ7-reductase activity
through a yeast complementation assay in an erg5erg6 double
mutant strain expressing the tomato SSR2 enzyme (Supplementary
Fig. 8c–f). Cholesterol accumulated in either case confirming that
these proteins possess Δ7-reduction activity. In vitro assays using
recombinant proteins produced in insect cells were subsequently per-
formed to examine whether the 7-DR enzymes possess 7-dehydro-
cholesterol reductase activity. Whereas 7-DR2 was able to efficiently
convert 7-dehydrocholesterol to cholesterol in a NADPH-dependent
manner, the 7-DR1 did not show such activity (Fig. 6b). These
results establish that 7-DR2 but not 7-DR1 catalyses the last com-
mitted step in the plant cholesterol pathway.
Subcellular localization for the cholesterol pathway enzymes
In animals, post-squalene cholesterogenesis is well known to occur
in the endoplasmic reticulum (ER) membrane35,36. Recently, the
Arabidopsis phytosterol enzymes DWARF7, DWARF5 and
DWARF1 were reported to be localized predominantly in the ER
membrane as well, and to some extent also at the plasma membrane
and in lipid particles37. Transient expression assays of seven of the
cholesterogenesis proteins, that is, SSR2, 3βHSD2, CYP51, 8,7 SI,
SMO4, C5-SD2, and 7-DR2, revealed that their principal subcellular
location was also the ER membrane (Supplementary Fig. 9).
However, as for the Arabidopsis phytosterol synthesis enzymes,
some of the tomato cholesterogenesis proteins were also located in
the plasma membrane whereas others could be also detected in
lipid body-like structures (Supplementary Fig. 9).
Engineering the cholesterol pathway in Arabidopsis
To examine the prospect of enhancing cholesterol production in
plants, we attempted the metabolic engineering of the entire set of
cholesterol pathway genes reported here in Arabidopsis. To this
end, Arabidopsis plants were stably transformed with the
pCHOLESTEROL vector construct that contained 11 tomato
cholesterol pathway genes, that is, SSR2, 3βHSD2, SMO4, CPI,
SDR, CYP51, C14-R, 8,7 SI, SMO3, C5-SD2 and 7-DR2, each
driven by the CaMV35S promoter (Supplementary Fig. 10a, see
Methods for vector assembly). As shared enzymes (for example,
CPI, CYP51, C14-R, 8,7 SI) between cholesterogenesis and phytos-
terol metabolism are innately available in Arabidopsis, we cannot
rule out the possibility that endogenous activities of these
enzymes may possibly contribute to cholesterol production in trans-
genic pCHOLESTEROL plants. Two independent lines (CHO-#1
and CHO-#2) showed high transcript levels for 10 out of 11 intro-
duced genes. The SDR gene showed low transcript expression and
probably did not contribute to cholesterogenesis (Supplementary
Fig. 10b). Leaves of CHO-#1 and CHO-#2 transgenic plants
accumulated ∼15-fold higher amounts of cholesterol compared to
the typically trace levels of wild type leaves (Fig. 6d). They also
showed a reduction in phytosterols (Supplementary Fig. 10c), indi-
cating an increased metabolic flux of cycloartenol towards cholester-
ogenesis at the expense of C-24 alkyl phytosterols. Furthermore,
these transgenic lines showed a clear dwarf, growth retardation
phenotype with shorter petioles, serrated leaf margins and smaller
rosettes (Fig. 6c). These phenotypes resembled those observed in
the Arabidopsis sterol methyl transferase 1 (smt1) mutants that
accumulate cholesterol and showed decreased phytosterol levels12.
Discussion
Plants are renowned for their enormous chemodiversity that
requires multi-step metabolic pathways producing a large chemical
space mostly represented by specialized, secondary metabolites.
Understanding how such complex traits emerge in evolutionary
10
© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
NATURE PLANTS
terms is a fundamental question in metabolic biology that is not
restricted to the plant kingdom. Most of our knowledge regarding
how chemical diversity is formed is based on studies of single
enzyme evolution. The findings here provide a remarkable view
on how a complete, multi-step pathway evolved from a more
ancient one while sharing a common precursor metabolite.
The suggestion that the cholesterol biosynthesis pathway evolved
from the more common phytosterol pathway is strongly supported
by the phylogenetic analysis of protein pairs. In the phylogenetic
analysis, the pairs of tomato proteins (for example, 7-DR1/7-DR2,
SSR1/SSR2 and C5-SD1/C5-SD2) are evidently located in a separate
clade from the known plant phytosterol pathway proteins (for
example, DWARF5, DWARF1 and DWARF7 from Arabidopsis),
while forming a clear duplication fork and being monophyletic in
their branching clade (Fig. 3a,b,d). This snapshot of the plant
cholesterogenesis pathway might reflect an intermediary state in
the evolution of a complex pathway in which part of the enzymes
remained common between the ancestral and the evolved
pathways whereas others duplicated and gained a more specific
function in the new pathway. Hence, the evolutionary scenario
here supports the ‘patchwork’ hypothesis38,39 in which (i) an ances-
tral enzyme having low substrate specificity binds multiple sub-
strates to generate multiple products, (ii) the enzyme duplicates
and diverging enzymes display increased and narrowed specificity
forming a separate pathway and (iii) further duplication events
result in more and more specific enzymes and pathways. Up to
the point of complete separation of these pathways, they remain
with some common enzymatic steps. Even though gene duplication
and enzyme promiscuity played a crucial role in the entire process, it
is likely that pre-existing protein folds and catalytic machineries
have been exploited.
During the past few decades, nearly all steps and enzymes of the
phytosterol pathway have been studied and characterized in detail,
largely in Arabidopsis 1–4. Whereas plants of the Solanaceae family
(for example, tomato, potato, tobacco and N. benthamiana)
produce considerably high levels of cholesterol, most other plant
species synthesize it in low levels. Thus, we suggest that in the
case of minor cholesterol producers, phytosterol pathway enzymes
are likely to act in a promiscuous manner with low substrate speci-
ficity on analogous cholesterol substrates and this allows low-level
cholesterol production.
The elucidation of the plant pathway nearly 240 years after
cholesterol was first discovered by French chemists in human
gallstones1 opens new avenues for both basic and applied research.
Cholesterol and pathway intermediates serve as precursors for many
thousands of metabolites, some of them representing high-value
chemicals such as the steroidal saponin diosgenin and its derivative
progesterone, the steroidal alkaloid solamargine as well as pro-vitamin D3,
that is, 7-dehydrocholesterol. Engineering these molecules in plants
requires a significant amount of cholesterol precursor. Whereas
expression of the ten genes performed here generated a substantial
level of cholesterol it is likely that introducing only the cholesterol
pathway-specific genes will be sufficient for generating a large pool
of cholesterol precursors for further metabolism. Finally, ‘high-
cholesterol’ plants such as those produced here provide the base for
using synthetic biology strategies to engineer tailored sterol profiles
for commercial production in plants and algae.
Methods
Plant materials. Tomato (Solanum lycopersicum) cv. Micro Tom plants expressing
Del/Ros1 transcription factors (Del/Ros MT) were grown in a climate-controlled
greenhouse at 24 °C during the day and 18 °C during the night, with natural light.
N. benthamiana plants were grown in a growth room maintained at 23 ± 2 °C at
required light intensity with 16-h day/8-h night.
Co-expression analysis. A two-step co-expression analysis was performed using a
transcriptome and proteome data set. In the first step, RNA-seq transcriptome data
from 12 wild tomato accessions (S. cheesmaniae (LA1306, LA1412), S. chmiliewskii
NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants
NATURE PLANTS
(LA1028, LA1318, 5589 (unidentified accession), S. hirsutum (LA0407, LA1777),
S. peruvianum (PI126431, PI126926), S. pimpinellifolium (LA1586 and LA1589) and
S. pennellii (LA716) in four fruit developmental stages (immature green, mature
green, breaker and red ripe) was obtained. A co-expression analysis with SSR2 as bait
was performed using Pearson correlation on log-scaled transcript count values and a
threshold of r-value ≥ 0.75. In the second step, protein level co-expression has been
performed using log-scaled protein levels measured for five developmental stages in
skin and flesh tissue (immature green, mature green, breaker, orange and red ripe) of
Micro Tom tomato fruits (ten sample types in three biological replicates). Clustering
of the protein data was performed using the partitioning around medoids algorithm
and the number of clusters was estimated using GAP statistics method (‘cluster’ R
package)40. Complete linkage hierarchical clustering and row-wise Z-normalization
were used to present heat maps. All calculations, data processing and visualization
were performed using R41. Functional enrichment analysis was done using binomial
statistics and Bonferroni multiple testing corrections (PANTHER release 20150430)42
on the GO Ontology database (release 2015-08-06).
Phylogenetic analysis. Sequence alignments were performed in MEGA6 using
ClustalW243,44. The Maximum Likelihood tree was inferred in MEGA6 using
1,000 bootstrap replications. Evolutionary distances are in units of number of amino
acid substitutions per site. Accession numbers for amino acid sequences used in the
phylogenetic analysis are provided in Supplementary Data 2.
VIGS in tomato and N. benthamiana. Vectors (pTRV2) containing fragments of
cholesterol or phytosterol candidate genes were generated and VIGS experiments
were performed in Del/Ros Micro Tom tomato plants as described previously45.
Tomato plants infected with Agrobacterium, containing the pTRV2 vector
harbouring Del/Ros sequences, were used as control. The tomato VIGS vector
pTRV2 includes a fragment of the sterol candidate gene as well as the Del/Ros
sequences allowing visualization of virus infected regions by the appearance of green
patches on leaf or fruit tissues compared to non-silenced purple tissues. In addition,
due to the co-silencing of the desired gene and Del/Ros transcription factors, clearly
visible red sectors appeared on the background of purple fruit upon maturation.
Silenced leaves and fruit tissues were collected at 4- and 6- or 7-weeks post-infection,
respectively, and analysed by liquid chromatography mass spectrometry (LCMS)
and gas chromatography mass spectrometry (GCMS). VIGS inoculations were
conducted in 3–4-week-old N. benthamiana plants using a needleless syringe by the
agroinfiltration method described earlier46. N. benthamiana plants infected with
Agrobacterium, containing the pTRV2 (empty) vector, were used as control. Young
leaves emerging from the apical shoot were collected after 3–4 weeks of infection and
analysed for sterols by GCMS.
Sterol analysis. Sample preparation and GCMS analysis for sterol profiling in
tomato and N. benthamiana tissues were carried out as described previously15,17.
Sterol and triterpene compounds were identified by comparing the retention time
and mass spectrometry spectra of trimethylsilyated authentic standards analysed on
the same instrument: β-amyrin, β-sitosterol, 7-dehydrocholesterol, cholesta-7-en-
3β-ol, cholesterol, stigmasterol (Sigma Aldrich), cycloartenol (Steraloids),
cycloartanol, 24-methylenecycloartanol and cycloeucalenol (ChemFaces).
Isofucosterol, Δ7 avenasterol, obtusifoliol and 24-ethylidenelophenol were
tentatively identified based on their trimethylsilyated spectra compared with
previously published spectra and relative retention times47–50.
Targeted profiling of tomato steroidal glycoalkaloids. Preparation of extracts and
the profiling of SGAs in various tomato plant tissues (leaves, green and red fruit)
were performed with same methods as described by Itkin et al. 17 and Cardenas et al.15.
Relative quantification of the compounds was carried out using TargetLynx (Waters).
Quantitative real-time PCR analysis. Total RNA was isolated from tomato (leaf and
green fruit) and N. benthamiana (leaf ) tissues using the Trizol method (Sigma-
Aldrich). DNase I (Sigma-Aldrich)-treated RNA was reverse transcribed using a
high-capacity complementary DNA reverse transcription kit (Applied Biosystems).
Gene-specific oligonucleotides were designed with Primer Express 3 software
(Applied Biosystems). The TIP41 gene was used as a reference gene for tomato
samples51 and the EF-2 gene was used for N. benthamiana 52.
Generation of CPI transgenic tomato plants. The CPI-RNAi construct was
generated by introducing a 240 bp CPI fragment (forward primer:
GCGGCCGCATGAAAGGCAATAAAGTGAATAGTGC, reverse primer:
GGCGCGCCGTCAGCCTTCCCGACAAATATC) to pENTR/D-TOPO
(Invitrogen) (by NotI and AscI) and further cloning to the pK7GWIWG2 (II) binary
vector using the Gateway LR Clonase II enzyme mix (Invitrogen)53. The vector was
transformed into tomato as described previously17. Positive CPI-downregulated
lines were selected by quantitative PCR and further used for LCMS and
GCMS analysis.
Heterologous expression in baculovirus infected Sf9 insect cells. C5-SD1, C5-SD2,
7-DR1 and 7-DR2 genes were cloned into the pVL1393 baculovirus expression
vector. Each expression vector construct was co-transfected with the ProGreen green
NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants
© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
ARTICLES
fluorescent protein (GFP) linearized baculovirus DNA (AB vector) into Spodoptera
frugiperda (Sf9) insect cells. Viruses were produced for each construct, and were
used to infect Sf9 cells for protein expression. Infection efficiency was monitored by
fluorescence of recombinant GFP viruses infected cells. For C5-SD1 and C5-SD2
protein expression, cells were grown in ESF921 protein free culture medium
(Expression Systems). Additionally, cells were grown in ESF921 supplemented with
200 μM 5-aminolevulinic acid and 200 μM ferrous citrate for the expression of the
7-DR1 and 7-DR2 proteins. Three days post-infection, cells were collected and
washed twice in phosphate buffered saline. Microsomal fractions were isolated by
resuspension of the cell pellet in 20 mM potassium phosphate buffer pH 7.25,
20% (v/v) glycerol, 1 mM EDTA and 1 mM DTT. The cells were sonicated and the
cell debris was removed by centrifugation at 10,000 g for 15 min. The supernatant
was further centrifuged at 100,000 g for 60 min. The pellet containing the
microsomal fraction was homogenized with the lysis buffer.
In vitro activity of the recombinant C5-SD1 and C5-SD2 enzymes. In vitro
enzyme activities for the C5-SD1 and C5-SD2 enzymes were performed under
standard assay conditions as described earlier54. The incubation mixture contained
microsomal fractions of Sf9 cells expressing C5-SD1 or C5-SD2 (1.0 mg) mixed
aerobically with cholesta-7-en-3β-ol (150 μM) and nicotinamide adenine
dinucleotide reduced (NADH) (250 μM) at 30 °C for 90 min. The reaction was
stopped by addition of 500 μl of 6% ethanolic KOH and n-hexane extracts of the
incubated samples were derivatized and analysed by GCMS. Control assay reaction
was performed using Sf9 cells (without baculovirus vector) microsomes. Cofactor
control assay was done with all enzyme reaction components under standard
conditions without adding NADH.
In vitro assays of the recombinant 7-DR1 and 7-DR2 enzymes. In vitro enzyme
activity for 7-DR1 and 7-DR2 was performed as previously reported55. Briefly,
microsomal fractions of Sf9 cells expressing 7-DR1 and 7-DR2 (0.5 mg) were
separately incubated with 7-dehydrocholesterol (100 μM) and nicotinamide adenine
dinucleotide phosphate reduced (NADPH) (150 μM) at 37 °C for 60 min. The
reaction was stopped by addition of 500 μl 1N ethanolic NaOH, and n-hexane
extracts of the incubated samples were derivatized and analysed by GCMS. Sf9 cells
(without the baculovirus vector) microsomes were used for control enzymatic
reaction. An additional control was performed in which the enzymatic reaction was
performed without NADPH.
Generation of the multi-gene construct. The pCHOLESTEROL multi-gene
construct used for Agrobacterium-mediated Arabidopsis plant transformation was
built using the GoldenBraid cloning56. Briefly, we used the Golden Braid system for
generating CaMV35S promoter-GOI-CaMV35S terminator as a one transcriptional
unit (GOI refers to individual cholesterol gene). An example of a single transcription
unit is shown for SSR2 gene (CaMV35S promoter-SSR2-CaMV35S terminator) in
Supplementary Fig. 10a. Similar transcriptional units were generated for all
remaining cholesterol genes. We combined these individual transcription units to
produce multipartite assemblies of ten cholesterol genes, finally giving a single
binary vector pCHOLESTEROL. Two additional genes, Kanamycin resistance gene
and p19 gene (suppressor of gene silencing), under the control of CaMV35S
promoter and CaMV35S terminator were also incorporated into pCHOLESTEROL
(Supplementary Fig. 10a). Arabidopsis ecotype Columbia was transformed with
the pCHOLESTEROL construct using the floral dip method as described earlier57.
Schematic presentation of the pCHOLESTEROL binary overexpression vector
for metabolic engineering of cholesterol in Arabidopsis is given in
Supplementary Fig. 10a.
Subcellular localization and confocal microscopy analysis. Transient expression of
individual cholesterol genes fused to the RFP fluorescent reporter was performed in
N. benthamiana epidermal cells as described earlier58. The plasma membrane
(CD3-1003) marker was used for co-infiltration together with individual cholesterol
gene-RFP constructs59. A bacterial absorbance A600 nm of 0.2 was used for infiltrating
each Agrobacterium culture. Unless stated, 48–72 h after infiltration, leaf discs
were collected and stained with ER-Tracker (blue, Thermo Fisher Scientific) for
co-localization in the ER membrane. Stained leaf discs ∼0.4 cm were analysed for
fluorescence with confocal microscopy using the following parameters: Fluorescence
was observed by a Nikon eclipse A1 microscope with laser at 488 nm for excitation
and images were acquired for GFP (plasma membrane marker), 405 nm for cyan
fluorescent protein (ER marker), 640 nm for chlorophyll and 561 nm for red
fluorescent protein (RFP) signals. Laser illumination was in sequential order as
cyan fluorescent protein (Em = 482 ± 17.5 nm), GFP (Em = 525 ± 25 nm), RFP
(Em = 595 ± 25 nm) and chlorophyll (Em > 640 nm). To increase signal-to-noise
ratio, each scan pixel was sampled four times and averaged.
Generation of plasmids for CRISPR/Cas9 in yeast. All oligonucleotides used for
generating gene knockout in yeast are listed in Supplementary Table 2. The plasmid
for CRISPR/Cas9 in yeast constructed in this study was based on the system
published earlier60. The constructs containing Cas9 (p414-TEF1p-Cas9-CYC1t;
#43802) and the gRNA cassette (p426-SNR52p-gRNA.CAN1.Y-SUP4t; #43803)
were acquired from Addgene. To generate a plasmid that contains both Cas9 and the
11
ARTICLES
gRNA cassette, the Cas9 expression cassette was first PCR-amplified from
p414-TEF1p-Cas9-CYC1t using primers combi3244 and combi3247, each
containing a HpaI restriction site at their 5′ terminus, and sub-cloned into pJET1.2
(CloneJET PCR Cloning Kit, Thermo Fisher Scientific). The Cas9 cassette was cut
out using HpaI and gel-purified. Subsequently, the cassette was cloned into the
vector backbone of a PvuII-treated, dephosphorylated and gel-purified pESC-URA
(Agilent), thereby giving pCAS1. Then, the Gateway ccdB cassette was
PCR-amplified from pDEST14 (Invitrogen) using primers combi1715 and
combi2287. The fragment was treated with XbaI and NheI, gel purified and cloned
into the NheI-linearized and dephosphorylated pCAS1, yielding pCAS-ccdB. For the
generation of knockout constructs, SNR52p was PCR-amplified with the generic
primer combi3245 and a target specific primer (TRP1: crispr014, ERG5: crispr001,
ERG5: crispr002, ERG2: crispr181), and crRNA-CYC1t was amplified with combi3246
and a target specific primer (TRP1:crispr031, crisprERG5: crispr018, ERG5: crispr019,
ERG2: crispr182). The individual fragments were fused by overlap extension PCR,
sub-cloned into pDONR221 (Invitrogen) and finally cloned into pCAS-ccdB, thereby
creating pCAS-TRP1, pCAS-ERG5, pCAS-ERG6 and pCAS-ERG2.
Gene knockout in yeast using CRISPR/Cas9. Yeast strains were transformed
following a standard lithium acetate transformation method61. Two hundred
nanograms of plasmid DNA and double-stranded oligonucleotides as homologous
recombination donor were co-transformed as described previously7. After
transformation, cells were plated on synthetic defined media (SD media lacking
uracil or uracil and tryptophan, ClonTech). Resulting colonies were analysed for
positive CRISPR events by replica plating on SD media containing and lacking
tryptophan for the knockout of TRP1 and by colony PCR and restriction fragment
length polymorphism analysis for the remaining genes (ERG5: gain of a HpaI
recognition site, ERG6: XmnI loss, ERG2: DraI gain). Positive clones were cured of
pCAS by counterselection on 1 mg/mL 5-fluoroorotic acid (Zymo Research).
Generation and culturing of yeast strains. TM1-derived yeast strains were
cultivated in the presence of methyl β-cyclodextrins (MβCD) as described23.
Y12667-derived yeast strains and strains derived from CRISPR knockout strains
were cultivated as described15. GIL77-derived yeast strains were cultivated in the
presence of hemin and ergosterol as described24.
Yeast metabolite extractions and GCMS analysis. When cultured in the presence
of MβCD, 1 ml of the spent medium was extracted thrice with 500 µl of hexane.
When cultured without addition of MβCD, 4 ml of the yeast culture was centrifuged
and the resulting yeast pellet was saponified for one hour with 20% KOH in 25%
ethanol and subsequently extracted thrice with 500 µl of hexane. After evaporation
and derivatization with 10 μl of pyridine and 50 μl of N-methyl-N-(trimethylsilyl)
trifluoroacetamide, the extracts were analysed by GCMS as reported23.
Data availability. The data that support the findings of this study are available from
corresponding author upon request.
Received 16 July 2016; accepted 23 November 2016;
published 22 December 2016
References
1. Nes, W. D. Biosynthesis of cholesterol and other sterols. Chem. Rev. 111,
6423–6451 (2011).
2. Benveniste, P. Biosynthesis and accumulation of sterols. Annu. Rev. Plant Biol.
55, 429–457 (2004).
3. Piironen, V., Lindsay, D. G., Miettinen, T. A., Toivo, J. & Lampi, A. M.
Plant sterols: biosynthesis, biological function and their importance to
human nutrition. J. Sci. Food Agric. 80, 939–966 (2000).
4. Schaller, H. The role of sterols in plant growth and development. Prog. Lipid Res.
42, 163–175 (2003).
5. Behrman, E. J. & Gopalan, V. Concepts in biochemistry cholesterol and plants.
J. Chem. Educ. 82, 1791–1793 (2005).
6. Jäpelt, R. B. & Jakobsen, J. Vitamin D in plants: a review of occurrence, analysis,
and biosynthesis. Front. Plant Sci. 4, 136 (2013).
7. Milner, S. E. et al. Bioactivities of glycoalkaloids and their aglycones from
Solanum species. J. Agric. Food Chem. 59, 3454–3484 (2011).
8. Dinan, L. Phytoecdysteroids: biological aspects. Phytochemistry 57, 325–339 (2001).
9. Cárdenas, P. D. et al. The bitter side of the nightshades: genomics drives
discovery in Solanaceae steroidal alkaloid metabolism. Phytochemistry 113,
24–32 (2014).
10. Bloch, K. The biological synthesis of cholesterol. Science 150, 19–28 (1965).
11. Ohyama, K., Suzuki, M., Kikuchi, J., Saito, K. & Muranaka, T. Dual biosynthetic
pathways to phytosterol via cycloartenol and lanosterol in Arabidopsis. Proc. Natl
Acad. Sci. USA 106, 725–730 (2009).
12. Diener, A. C. et al. STEROL METHYLTRANSFERASE 1 controls the level of
cholesterol in plants. Plant Cell 12, 853–870 (2000).
13. Arnqvist, L., Dutta, P. C., Jonsson, L. & Sitbon, F. Reduction of cholesterol and
glycoalkaloid levels in transgenic potato plants by overexpression of a type 1
sterol methyltransferase cDNA. Plant Physiol. 131, 1792–1799 (2003).
12 NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants
© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
NATURE PLANTS
14. Sawai, S. et al. Sterol side chain reductase 2 is a key enzyme in the biosynthesis of
cholesterol, the common precursor of toxic steroidal glycoalkaloids in potato.
Plant Cell 26, 3763–3774 (2014).
15. Cárdenas, P. D. et al. GAME9 regulates the biosynthesis of steroidal alkaloids
and upstream isoprenoids in the plant mevalonate pathway. Nat. Commun. 7,
10654 (2016).
16. Itkin, M. et al. Biosynthesis of antinutritional alkaloids in Solanaceous crops is
mediated by clustered genes. Science 341, 175–179 (2013).
17. Itkin, M. et al. GLYCOALKALOID METABOLISM1 is required for steroidal
alkaloid glycosylation and prevention of phytotoxicity in tomato. Plant Cell 23,
4507–4525 (2011).
18. Rahier, A. Dissecting the sterol C-4 demethylation process in higher plants from
structures and genes to catalytic mechanism. Steroids 76, 340–352 (2011).
19. Rahier, A. & Karst, F. Plant cyclopropylsterol-cycloisomerase: key amino acids
affecting activity and substrate specificity. Biochem. J. 459, 289–299 (2014).
20. Kushiro, M. et al. Obtusifoliol 14-α-demethylase (CYP51) antisense Arabidopsis
shows slow growth and long life. Biochem. Biophys. Res. Commun. 285,
98–104 (2001).
21. Schrick, K. et al. FACKEL is a sterol C-14 reductase required for organized cell
division and expansion in Arabidopsis embryogenesis. Genes Dev. 14,
1471–1484 (2000).
22. Souter, M. et al. Hydra mutants of Arabidopsis are defective in sterol profiles and
auxin and ethylene signaling. Plant Cell 14, 1017–1031 (2002).
23. Moses, T. et al. Combinatorial biosynthesis of sapogenins and saponins in
Saccharomyces cerevisiae using a C-16α-hydroxylase from Bupleurum falcatum.
Proc. Natl Acad. Sci. USA 111, 1634–1639 (2014).
24. Kushiro, T., Shibuya, M. & Ebizuka, Y. β-Amyrin synthase-cloning of
oxidosqualene cyclase that catalyzes the formation of the most popular
triterpene among higher plants. Eur. J. Biochem. 256, 238–244 (1998).
25. Darnet, S. & Rahier, A. Plant sterol biosynthesis: identification of two distinct
families of sterol 4α-methyl oxidases. Biochem. J. 378, 889–898 (2004).
26. Suza, W. P. & Chappell, J. Spatial and temporal regulation of sterol biosynthesis
in Nicotiana benthamiana. Physiol. Plant. 157, 120–134 (2016).
27. Rahier, A., Darnet, S., Bouvier, F., Camara, B. & Bard, M. Molecular and
enzymatic characterizations of novel bifunctional 3β-hydroxysteroid
dehydrogenases/C-4 decarboxylases from Arabidopsis thaliana. J. Biol. Chem.
281, 27264–27277 (2006).
28. Pascal, S., Taton, M. & Rahier, A. Plant sterol biosynthesis: identification of a
NADPH dependant plant sterone reductase involved in the sterol-4-
demethylation. Arch. Biochem. Biophys. 312, 260–271 (1994).
29. Rahier, A., Pierre, S., Riveill, G. & Karst, F. Identification of essential amino acid
residues in a sterol 8,7-isomerase from Zea mays reveals functional homology
and diversity with the isomerases of animal and fungal origin. Biochem. J. 414,
247–259 (2008).
30. Ashman, W. H., Barbuch, R. J., Ulbright, C. E., Jarrett, H. W. & Bard, M. Cloning
and disruption of the yeast C-8 sterol isomerase gene. Lipids 26, 628–632 (1991).
31. Palermo, L. M., Leak, F. W., Tove, S. & Parks, L. W. Assessment of the essentiality
of ERG genes late in ergosterol biosynthesis in Saccharomyces cerevisiae.
Curr. Genet. 32, 93–99 (1997).
32. Husselstein, T., Schaller, H., Gachotte, D. & Benveniste, P. Δ7-sterol-C5-
desaturase: molecular characterization and functional expression of wild-type
and mutant alleles. Plant Mol. Biol. 39, 891–906 (1999).
33. Choe, S. et al. The Arabidopsis dwf7/ste1 mutant is defective in the Δ7-sterol C-5
desaturation step leading to brassinosteroid biosynthesis. Plant Cell 11,
207–221 (1999).
34. Choe, S. et al. Lesions in the sterol delta reductase gene of Arabidopsis cause
dwarfism due to a block in brassinosteroid biosynthesis. Plant J. 21, 431–443 (2000).
35. Gaylor, J. L. Membrane-bound enzymes of cholesterol synthesis from lanosterol.
Biochem. Biophys. Res. Commun. 1146, 1139–1146 (2008).
36. Caldas, H. & Herman, G. E. NSDHL, an enzyme involved in cholesterol
biosynthesis, traffics through the Golgi and accumulates on ER membranes and
on the surface of lipid droplets. Human Mol. Genetics 12, 2981–2991 (2003).
37. Silvestro, D., Andersen, T. G., Schaller, H. & Jensen, P. E. Plant sterol
metabolism. Δ7-Sterol-C5-desaturase (STE1/DWARF7), Δ5,7-sterol-Δ7-reductase
(DWARF5) and Δ24-sterol-Δ24-reductase (DIMINUTO/DWARF1) show
multiple subcellular localizations in Arabidopsis thaliana (Heynh) L. PLoS ONE
8, e56429 (2013).
38. Ycas, M. On earlier states of biochemical systems. J. Theor. Biol. 44, 145–160 (1974).
39. Jensen, R. A. Enzyme recruitment in evolution of new function. Annu. Rev.
Microbiol. 30, 409–425 (1976).
40. Maechler, M. et al. Cluster: Cluster Analysis Basics and Extensions. R package
v.1.15.1 (CRAN, 2014); http://cran.r-project.org/web/packages/cluster/index.html
41. Ihaka, R. & Gentleman, R. R: a language for data analysis and graphics. J. Comp.
Graph. Stat. 5, 299–314 (1996).
42. Mi, H., Muruganujan, A. & Thomas, P. D. PANTHER in 2013: modeling the
evolution of gene function, and other gene attributes, in the context of
phylogenetic trees. Nucleic Acids Res. 41, D377–D386 (2013).
43. Larkin, M. A. et al. Clustal W and Clustal X version 2.0. Bioinformatics 23,
2947–2948 (2007).
NATURE PLANTS
44. Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. MEGA6:
molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30,
2725–2729 (2013).
45. Itkin, M. et al. TOMATO AGAMOUS-LIKE is a component of the fruit ripening
regulatory network. Plant J. 60, 1081–1095 (2009).
46. Senthil-Kumar, M. & Mysore, K. S. Tobacco rattle virus–based virus-induced
gene silencing in Nicotiana benthamiana. Nat. Protoc. 9, 1549–1562 (2014).
47. Wretensjö, I. & Karlberg, B. Characterization of sterols in borage oil by GC-MS.
J. Am. Chem. Oil Soc. 79, 1069–1074 (2004).
48. Zhang, X. et al. Separation of Δ5-and Δ7-phytosterols by adsorption
chromatography and semipreparative reversed phase high-performance liquid
chromatography for quantitative analysis of phytosterols in foods. J. Agric. Food
Chem. 54, 1196–1202 (2006).
49. Yang, B., Karlsson, R. M., Oksman, P. H. & Kallio, H. P. Phytosterols in sea
buckthorn (Hippophae rhamnoides L.) berries: identification and effects of
different origins and harvesting times. J. Agric. Food Chem. 49,
5620–5629 (2001).
50. Kamal-Eldin, A., Appelqvist, L. A., Yousif, G. & Iskander, G. M. Seed lipids of
Sesamum indicum and related wild species in Sudan. The sterols. J. Sci. Food
Agric. 59, 327–334 (1992).
51. Expósito-Rodríguez, M., Borges, A. A., Borges-Pérez, A. & Pérez, J. A. Selection
of internal control genes for quantitative real-time RT-PCR studies during
tomato development process. BMC Plant Biol. 8, 131–142 (2008).
52. Rotenberg, D., Thompson, T. S., German, T. L. & Willis, D. K. Methods for
effective real-time RT-PCR analysis of virus-induced gene silencing. J. Virol.
Methods 138, 49–59 (2006).
53. Karimi, M., Inzé, D. & Depicker, A. GATEWAYTM vectors for Agrobacterium-
mediated plant transformation. Trends Plant Sci. 7, 193–195 (2002).
54. Taton, M., Husselstein, T., Benveniste, P. & Rahier, A. Role of highly conserved
residues in the reaction catalyzed by recombinant Δ7-sterol-C5(6)-desaturase
studied by site-directed mutagenesis. Biochemistry 39, 701–711 (2000).
55. Zou, L., Li, L. & Porter, T. D. 7-dehydrocholesterol reductase activity is
independent of cytochrome P450 reductase. J. Steroid Biochem. Mol. Biol. 127,
435–438 (2011).
56. Sarrion-Perdigones, A. et al. Goldenbraid 2.0: a comprehensive DNA assembly
framework for plant synthetic biology. Plant Physiol. 162, 1618–1631 (2013).
57. Clough, S. & Bent, A. Floral dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743 (1998).
58. Sparkes, I. A., Runions, J., Kearns, A. & Hawes, C. Rapid, transient expression of
fluorescent fusion proteins in tobacco plants and generation of stably
transformed plants. Nat. Protoc. 1, 2019–2025 (2006).
59. Nelson, B. K., Cai, X. & Nebenführ, A. A multicolored set of in vivo organelle
markers for co-localization studies in Arabidopsis and other plants. Plant J. 51,
1126–1136 (2007).
NATURE PLANTS 3, 16205 (2016) | DOI: 10.1038/nplants.2016.205 | www.nature.com/natureplants
© 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
ARTICLES
60. DiCarlo, J. E. et al. Genome engineering in Saccharomyces cerevisiae using
CRISPR-Cas systems. Nucleic Acids Res. 41, 4336–4343 (2013).
61. Schiestl, R. H. & Gietz, R. D. High efficiency transformation of intact yeast cells
using single stranded nucleic acids as a carrier. Curr. Genet. 16, 339–346 (1989).
Acknowledgements
We are grateful to D. Twafik for useful suggestions in phylogenetic analysis. A.A. is the
incumbent of the Peter J. Cohn Professorial Chair. We thank the Adelis Foundation, the
Leona M. and Harry B. Helmsley Charitable Trust, the Jeanne and Joseph Nissim
Foundation for Life Sciences, Tom and Sondra Rykoff Family Foundation Research and the
Raymond Burton Plant Genome Research Fund for supporting the laboratory activity of
A.A. The work was supported by the Israel Science Foundation (ISF Grant No. 1805/15)
and the European Research Council (ERC; SAMIT-FP7) personal grants to A.A. P.D.S. is
grateful to the Planning and Budgeting Committee of the Council for Higher Education,
Israel for the VATAT fellowship. The research in the laboratory of A.G. was financially
supported by the VIB International PhD Fellowship Program (fellowship to P.A.) and the
Research Foundation Flanders (postdoctoral fellowships to J.P. and L.P.). A.K was
supported by a short-term EMBO fellowship (EMBO-ASTF-146-2014). The research in the
laboratories of A.A. and A.G. was supported by the European Union Seventh Framework
Program FP7/2007–2013 under grant agreement no. 613692–TriForC.
Author contributions
P.D.S. designed experiments, performed the research and wrote the paper. J.P., P.A., L.P.
and A.G. designed part of the experiments and performed all yeast complementation assays
and wrote the paper. S.P. assisted in the VIGS experiments. J.S. and E.S. assisted in the
co-expression data analysis. H.M. performed the confocal imaging experiments for
localization studies. I.R. and S. Meir assisted with metabolomics data analysis and operated
the LCMS. S. Malitsky assisted with GC-S metabolomics data analysis and operated the
GCMS. M.Y. and T.U. performed recombinant protein expression in insect cells and
isolated microsomes fractions. P.D.C. assisted in wild tomato accessions RNA sequencing.
A.M. assisted in sterol extractions and tissue culture work. A.K. and A.P.G. designed part of
the research and wrote the paper. H.S. assisted in data analysis and manuscript preparation.
A.A. designed the research and wrote the paper.
Additional information
Supplementary information is available for this paper.
Reprints and permissions information is available at www.nature.com/reprints.
Correspondence and requests for materials should be addressed to A.A.
How to cite this article: Sonawane, P. D. Plant cholesterol biosynthetic pathway overlaps with
phytosterol metabolism. Nat. Plants 3, 16205 (2016).
Competing interests
The authors declare no competing financial interests.
13