Vous êtes sur la page 1sur 62

Chapter 2

Mycosis fungoides: disease evolution and prognosis of 309 Dutch patients

Arch Dermatol. 2000 Apr; 136(4): 504-10

Mycosis Fungoides

Disease Evolution and Prognosis of 309 Dutch Patients

Remco van Doorn, MD; Christian W. Van Haselen, MD; Pieter C. van Voorst Vader, MD; Marie-Louise Geerts, MD; Freerk Heule, MD; Menno de Rie, MD; Peter M. Steijlen, MD; Sybren K. Dekker, MD; Willem A. van Vloten, MD; Rein Willemze, MD

Objectives: To determine the disease course of Dutch patients with mycosis fungoides and to define factors re- lated to disease progression and survival.

all

and disease-specific survival was 80% and 89% at 5

years, and 57% and 75% at 10 years, respectively. The actuarial 5-year disease-specific survival of patients with stage Ia, Ib, and Ic disease was 100%, 96%, and

Design: A multicenter, 13-year, retrospective cohort analysis.

80%, respectively, and only 40% for patients with stage

III

disease. Using multivariate analysis, the presence of

Setting: Eight dermatology departments collaborating in the Dutch Cutaneous Lymphoma Group.

extracutaneous disease, the type and extent of skin in- volvement, the response to initial treatment, and the presence of follicular mucinosis were independently as-

Patients: Three hundred nine patients with mycosisfun- goides registered between October 1985 andMay 1997,in- cluding 89 patients with limited patches or plaques (stage Ia), 135 with generalized patches or plaques (stage Ib), 46 with skin tumors (stage Ic),18withenlargedbutuninvolved lymph nodes (stage II), 18 with lymph node involvement (stage III), and 3 with visceral involvement (stage IV).

sociated with higher disease progression and mortality rates. The calculated risks of disease progression at 5 and 10 years gradually increased from 4% to 10% for those with stage Ia disease, from 21% to 39% for those with stage Ib disease, and from 32% to 60% for those with stage Ic disease; for those with stage III disease, the risk remained at 70% at 5 and 10 years. The overall risk

of

disease progression at 5 and 10 years was 24% and

 

38%, respectively, for the total study group.

Main Outcome Measures: Response to initial treat- ment, sustained complete remission, actuarial disease pro- gression, and overall and disease-specific survival per clini- cal stage.

Conclusion: At least within the first 10 years after di- agnosis, disease progression and mycosis fungoides– related mortality occur in only a subset of patients gen- erally presenting with advanced disease.

Results: The median follow-up was 62 months (range, 1-113 months). For the entire group, the actuarial over-

Arch Dermatol. 2000;136:504-510

From the Departments of Dermatology, Free University Hospital (Drs van Doorn and Willemze) and Academic Medical Center (Dr de Rie), Amsterdam, University Medical Center, Utrecht (Drs Van Haselen and van Vloten), University Hospital Groningen, Groningen (Dr van Voorst Vader), University Hospital Rotterdam, Rotterdam (Dr Heule), University of Nijmegen, Nijmegen (Dr Steijlen), and Leiden University Medical Center, Leiden (Drs Dekker and Willemze), the Netherlands; and University Hospital Gent, Gent, Belgium (Dr Geerts). Dr Willemze is now with the Department of Dermatology, Leiden University Medical Center, Leiden, the Netherlands.

M YCOSIS fungoides (MF) is the most common type of cutaneous T- celllymphoma (CTCL), with an estimated in-

cidence of 0.5 per 100 000 per year in the western world. 1 According to the major textbooks, MF is an indolent type of CTCL that slowly evolves through patch, plaque, and tumor stages before lymph nodes and visceral organs become involved, and ul- timately a rapidly progressive and fatal dis- ease develops. Long-term follow-up stud- ies 2-14 on large groups of patients with MF are rare, and most come from a few US- based centers. Comparison of published series is often difficult, because of differ- ent inclusion criteria (eg, inclusion or ex- clusion of patients with large-plaque para- psoriasis) and an inconsistent use of the terms MF and CTCL. Several studies, in- cluding one of the largest European stud-

33

ies of 92 Dutch patients published by Ham- minga et al 4 in 1982, included not only patients with classic MF but also patients with Se´zary syndrome and other types of CTCL defined more recently. For in- stance, patients withCTCL presenting with tumors with the histological appearance of a diffuse, large, T-cell lymphoma and without prior or concurrent patches or plaques were designated previously as hav- ing “MF d’emble´e,” whereas such pa- tients are now classified as having either CD30 + or CD30 large-cell CTCL, which are considered distinct disease entities sepa- rate from MF. 15,16 It is well recognized that the evolu- tion from skin-limited to widespread dis- seminated disease in patients with MF may take years or even decades. However, clini- cal experience also suggests that only a pro- portion of patients with MF presenting with only skin lesions will develop extracuta-

neous and ultimately fatal disease.Whereas previous stud- ies mainly focused on prognostic variables and survival

neous and ultimately fatal disease.Whereas previous stud- ies mainly focused on prognostic variables and survival data in the different stages of MF, data regarding the fre- quency of disease progression have been published only recently. 10-13 Obviously, clinicalinformation to patients with MF should not only include the message that disease pro- gression may occur but also how often and after which pe- riod such a development can be expected. In the present study, clinical and follow-up data of all patients with MF included between October 1985 and May 1997 in the registry of the Dutch Cutaneous Lymphoma

Group were evaluated. This study determines disease- specific and overall survival and the risk of disease pro- gression for patients with different stages of MF and de- fines variables predictive of survival and disease progression.

RESULTS
RESULTS

RESULTS

RESULTS
RESULTS

CLINICAL CHARACTERISTICS AT PRESENTATION

Of the 309 patients included in this study, 72.5% had ei- ther stage Ia or Ib MF at the time of diagnosis, whereas

34

Table 1. Clinical Stage of 309 Patients With MF at the Time of Diagnosis*

Patches and Plaques Covering the Skin Surface

Stage

 10% (a)  10% (b)

10% (a)

10% (b)

Skin

Tumor (c)

Erythroderma (d)

Total

MF confined to the skin (I) MF with dermatopathic lymphadenopathy (II) MF with lymph node involvement (III) MF with visceral involvement (IV) Total

89

135

46

0

270

0

9

7

2

18

1

7

8

2

18

0

0

3

0

3

90

151

64

4

309

*The clinical stage is given according to the modified Fuks classification. 4 Translation into the TNM classification 18 is as follows; Ia, T1 N0 M0; Ib, T2 N0 M0; Ic, T3 N0 M0; Id, T4 N0 M0; IIa through IId, T1 through T4 N1 M0; IIIa through IIId, T1 through T4 N3 M0; and IVa through IVd, T1 through T4 N0 through N3 M1. MF indicates mycosis fungoides.

Table 2. Patient Characteristics and Disease Outcome per Clinical Stage*

Stage

Variable

Ia

Ib

Ic

II

III

IV

All

No. of patients† Age at diagnosis, median (range), y Male-female ratio Duration of skin lesions before diagnosis, median (range), mo Complete remission on initial therapy Duration of follow-up, median (range), mo Disease course Sustained CR Continued disease Progression Risk of disease progression, % At 5 y At 10 y Current status Alive without disease Alive with disease Died of other cause Died of MF Disease-specific survival, % At 5 y At 10 y Overall survival, % At 5 y At 10 y

89 (28.8)

135 (43.7)

46 (14.9)

18 (5.8)

18 (5.8)

3 (1.0)

309 (100)

58.0 (19-90)

61.0 (14-92)

67.5 (35-88)

62.5 (37-82)

57.5 (29-84)

67.0 (53-69)

61.0 (14-92)

 

59:30

83:52

29:17

10:8

13:5

2:1

 

196:113

60

(1-372)

48 (1-600)

48 (2-600)

48 (10-648)

24 (5-300)

24 (10-72)

48 (1-648)

42

(47)

41 (30)

12 (26)

2 (11)

1 (6)

0 (0)

 

98 (32)

71

(12-203)

70 (12-313)

48 (6-249)

45 (14-184)

49 (8-239)

2 (1-9)

62 (1-313)

16 (18)

10 (7)

5 (11)

1 (6)

1 (6)

0 (0)

 

33 (11)

69 (78)

92 (68)

23 (50)

8 (44)

6 (33)

1 (33)

199 (64)

4 (4)

33 (24)

18 (39)

9 (50)

11 (61)

2 (67)

77 (25)

4

21

32

65

70

100

24

10

39

60

65

70

.

.

.

38

39 (44)

29 (21)

5 (11)

1 (6)

1 (6)

0 (0)

75 (24)

41 (46)

71 (53)

14 (30)

10 (56)

5 (28)

0 (0)

141 (46)

7 (8)

22 (16)

12 (26)

4 (22)

1 (6)

1 (33)

45 (15)

2 (2)

13 (10)

15 (33)

3 (17)

11 (61)

2 (67)

47 (15)

100

96

80

68

40

0

89

97

83

42

68

20

0

75

99

86

65

49

40

0

80

84

61

27

49

20

0

57

*Data are given as number (percentage) of patients within each column unless otherwise indicated. Percentages may not total 100 because of rounding. The clinical stages are explained in Table 1. CR indicates complete remission; MF, mycosis fungoides; and ellipses, data not applicable. The row total was used to obtain the percentages.

14.9% presented with 1 or more skin tumors in addi- tion to patches and plaques, but no evidence of extracu- taneous disease. Of the 309 patients, 270 (87.4%) had only skin lesions at the time of diagnosis; 18 (5.8%), en- larged but histologically uninvolved lymph nodes; and 21 (6.8%), nodal and/or visceral involvement (Table 2). Considering the entire group of patients, the age at diagnosis varied between 14 and 92 years (median, 61 years). Only 2 patients (0.6%) were younger than 20 years at the time of diagnosis. Patients presenting with stage Ic MF were significantly older than patients with stage

Ia MF (67.5 vs 58.0 years; P.001). There was a male predominance, with a male-female ratio of 196:113, which is consistent with that of other large series. 2,3,13 The du- ration of skin lesions before a definite diagnosis could be made varied between 1 month and more than 50 years (median, 48 months) and was significantly shorter in the 21 patients presenting with extracutaneous disease (me- dian, 24 months) compared with patients with only skin lesions at presentation (median, 48 months) (P = .006). Of the 309 patients with MF, 32 (10.4%) had asso- ciated follicular mucinosis at the time of diagnosis. This

35

Table 3. Initial Treatment per Clinical Stage*

Initial Treatment

Stage

All

Ia (n = 89) Ib (n = 135) Ic (n = 46) II (n = 18) III (n = 18) IV (n = 3) (N = 309)

Topical corticosteroids PUVA therapy UV-B therapy Topical mechlorethamine hydrochloride Total skin electron beam irradiation Radiotherapy with or without skin-directed therapy† Polychemotherapy with or without skin-directed therapy Other‡ Complete remission on initial treatment, %

15 (17)

11 (8)

0

0

0

0

26 (8)

51 (57)

89 (66)

9 (20)

7 (39)

0

0

156 (51)

14 (16)

15 (11)

0

0

0

0

29 (9)

6 (7)

10 (7)

4 (9)

0

1 (6)

0

21 (7)

0

7 (5)

6 (13)

1 (6)

4 (22)

0

18 (6)

3 (3)

2 (2)

21 (46)

5 (28)

2 (11)

1 (33)

34 (11)

0

0

4 (9)

2 (11)

10 (56)

2 (67)

18 (6)

0

1 (1)

2 (4)

3 (17)

1 (6)

0

7 (2)

47

30

26

11

6

0

32

*Data are given as number (percentage) of patients unless otherwise indicated. Column percentages may not total 100 because of rounding. The clinical stages are explained in the footnote to Table 1. PUVA indicates psoralen–UV-A. Skin-directed therapies include topical corticosteroids, PUVA therapy, UV-B therapy, topical mechlorethamine hydrochloride, radiotherapy, or total skin electron beam irradiation. Other therapies include monochemotherapy, retinoids, interferons, or combinations of these with skin-directed therapy.

group included 28 patients with stage I, 3 with stage II, and 1 with stage IV MF. The combination of MF—stage Ia in 2 and Ib in 6 patients—and lymphomatoid papu- losis was noticed in 8 (2.6%) of the 309 patients. Asso- ciated B-cell lymphoproliferations were documented in 5 patients with stage Ia or Ib MF, including 4 with B-cell chronic lymphocytic leukemia and 1 with nodal follicu- lar lymphoma.

TREATMENT AND FOLLOW-UP

The initial therapies at the different stages of MF are listed in Table 3, and reflect the approach used in the treat- ment of MF in the Netherlands. The treatment modality most commonly used for stage Ia or Ib disease was pso- ralen–UV-A therapy (140 [62.5%] of 224 cases); less frequently used modalities included topical corticoste- roids, UV-B therapy, topical mechlorethamine hydro- chloride, and, in case of extensive skin lesions, total skin electron beam irradiation. Patients with stage Ic disease were treated similarly, often with additional local radio- therapy for persistent tumors (Table 3). Systemic poly- chemotherapy consisting of cyclophosphamide, vincris- tine sulfate, doxorubicine, and prednisone was mainly given to patients presenting with nodal (stage III) or vis- ceral (stage IV) involvement, often in combination with or followed by skin-directed therapies. Initial treatment resulted in clinical complete re- missions in 98 (31.7%) of 309 patients. However, in most patients, these complete remissions were short-lived. Sus- tained complete remissions on initial treatment were ob- served in only 33 (10.7%) of the 309 patients, among whom 26 had stage Ia or Ib disease. The disease-free sur- vival in these 33 patients varied between 10 and 163 months (median, 68 months). In 199 (64.4%) of the 309 patients, there was continued disease without progres- sion, typically having a fluctuating course, while in the remaining 77 (24.9%), disease progression, including death due to MF, occurred. The median follow-up was 62 months (range, 1-313 months). During that period, 92 of the 309 patients died, including 47 of MF. The disease-specific survival at 5 and

36

10 years for the whole group of 309 patients was 89% and 75%, respectively; the 5- and 10-year overall sur- vival was 80% and 57%, respectively. The survival rates according to clinical stage are presented in Table 2, Figure 1, and Figure 2. Consistent with prior re- ports, 23,24 patients with MF and lymphomatoid papulo- sis had an excellent prognosis. None of these patients showed disease progression after a median follow-up of 158 months (range, 23-244 months).

PROGNOSTIC VARIABLES

Univariate analysis of variables possibly influencing dis- ease-specific survival in the entire group of 309 patients showed that the following factors were statistically sig- nificant: stage at diagnosis (P.001), including the pres- ence of extracutaneous disease (P.001) and the type and extent of skin involvement (P.001); no complete re- mission on initial treatment (P.001); associated fol- licular mucinosis (P = .005); and older age (P = .01). Sex (P = .69) and duration of skin lesions before diagnosis (P = .34) were not significantly related to survival, when the total group was considered. Univariate analysis of the prognostic variables per clinical stage showed that only complete remission on initial treatment within the group of patients with stage Ib MF was significantly related to survival (P = .04) (Figure 3). Multivariate analysis revealed that—in or- der of predictive value—presence of extracutaneous dis- ease, type and extent of skin involvement, no complete response to initial treatment, and presence of follicular mucinosis were independently associated with MF- related mortality. The relative risks for MF-related mor- tality are presented in Table 4. Regarding clinical stage, patients with stage Ia and stage Ib MF had a significantly better survival than pa- tients with stage Ic MF (P.001). However, no signifi- cant difference in survival was found between patients with stage Ia and stage Ib disease (P = .11). Notably, not only patients with histologically documented lymph node involvement (stage III) but also patients with enlarged, but histologically uninvolved, lymph nodes (stage II) had

Figure 1. Actuarial disease-specific survival of 309 patients with mycosis fungoides (MF). The differences between

Figure 1. Actuarial disease-specific survival of 309 patients with mycosis fungoides (MF). The differences between the patients with each stage of MF are as follows: stage I vs stage II, P = .02; stage I vs stage III, P.001; stage II vs stage III, P = .13; and stage III vs stage IV, P.001.

III, P = .13; and stage III vs stage IV, P  .001. Figure 2. Actuarial

Figure 2. Actuarial disease-specific survival of 270 patients with stage I mycosis fungoides (MF). The differences between the patients with each variation of stage I MF are as follows: stage Ia vs stage Ib, P = .11; stage Ia vs stage Ic, P.001; and stage Ib vs stage Ic, P.001.

a significantly lower survival compared with patients with stage I MF (P.001 and P = .02, respectively).

DISEASE PROGRESSION

One of the goals of this study was to assess the risk of disease progression, including death due to MF, for pa- tients with different stages of MF. The calculated risks of disease progression at 5 and 10 years gradually in- creased from 4% to 10% for those with stage Ia disease, from 21% to 39% for those with stage Ib disease, and from 32% to 60% for those with stage Ic disease; for those with stage III disease, the risk remained at 70% at 5 and 10 years (Table 2). Table 5 shows the actual frequency of disease progression in the group of 309 patients after a median follow-up of 62 months. It also shows that the higher the clinical stage at diagnosis, the shorter the du- ration until disease progression. Multivariate analysis revealed that—as for disease- specific survival—the presence of extracutaneous dis- ease, the type and extent of skin involvement, the re-

37

ease, the type and extent of skin involvement, the re- 37 Figure 3. Actuarial disease-specific survival

Figure 3. Actuarial disease-specific survival of patients with stage Ib mycosis fungoides with or without complete remission after initial treatment. The difference between those with complete remission vs those without complete remission was significant ( P = .05).

Table 4. Factors Independently Influencing Disease-Specific Survival*

 

Relative

95% Confidence

 

Factor

Risk

Interval

P

Extracutaneous involvement

 

I (absent)†

1.0

.

.

.

.

.

.

II (LN enlargement)

3.3

1.1-9.5

.02

III (LN involvement)

7.3

3.6-14.8

.001

IV (visceral involvement)

227.0

31.3-1646.3 .001

Type and extent of skin lesions

 

Ia

(limited plaques)†

1.0

.

.

.

.

.

.

Ib

(generalized plaques)

3.2

0.7-14.4

.11

Ic

(skin tumors)

Complete remission after initial treatment Yes† No Follicular mucinosis Absent† Present

20.9

4.7-92.0

.001

1.0

.

.

.

.

.

.

7.0

2.2-22.5

.001

1.0

.

.

.

.

.

.

2.3

1.1-5.0

.001

*Factors are presented in order of predictive value. The relative risk of different types and extents of skin lesions has been calculated for stage I only. LN indicates lymph node; ellipses, data not applicable. Referent value.

sponse to initial treatment, and the presence of follicular mucinosis were independently associated with disease progression.

COMMENT
COMMENT

COMMENT

COMMENT
COMMENT

In the present study, the main clinical characteristics, dis- ease evolution, and survival of 309 Dutch patients with MF, included in the Dutch registry for cutaneous lym- phomas between October 1985 and May 1997, were evalu- ated. In addition, prognostic variables and the risk of dis- ease progression for those with different stages of MF were analyzed. The median age at diagnosis of 61 years and the male-female ratio of 196:113 were similar to those given in the few other large series studied. 2,3,13 At the time of first presentation, 93.2% of the patients with MF had only skin lesions, including 5.8% with concurrent en-

Table 5. Actual Disease Progression in 309 Patients With MF After a Median Follow-up of 62 Months*

 

Lymph Node

Visceral

Death Due

Duration Until Disease Progression, mo‡

Stage at Diagnosis

Skin Tumors

Involvement

Involvement

to MF

Progression†

Ia

(n = 89)

3 (3)

2 (2)

1 (1)

2 (2)

4 (4)

73 (49-96)

Ib

(n = 135)

28 (21)

19 (14)

5 (4)

13 (10)

33 (24)

45 (8-109)

Ic

(n = 46)

0

11 (24)

7 (15)

15 (33)

18 (39)

37 (1-242)

II

(n = 18)

3 (17)

5 (28)

2 (11)

4 (22)

9 (50)

24 (14-51)

III

(n = 18)

2 (11)

0

3 (17)

11 (61)

11 (61)

32 (8-56)

IV

(n = 3)

0

0

0

2 (67)

2 (67)

6 (2-9)

Total (N = 309)

36 (12)

37 (12)

18 (6)

47 (15)

77 (25)

40 (1-242)

*Data are given as number (percentage) of patients unless otherwise indicated. The clinical stages are explained in the footnote to Table 1. MF indicates mycosis fungoides. Total number (percentage) of patients showing disease progression. Data are given as the median (range).

larged but histologically uninvolved lymph nodes, whereas only 6.8% presented with concurrent nodal or visceral involvement. In the Netherlands, patients with MF are treated tra- ditionally with skin-directed therapies, including topi- cal corticosteroids, psoralen–UV-A therapy, UV-B therapy, or topical mechlorethamine hydrochloride, and addi- tional radiotherapy in case of concurrent skin tumors, whereas multiagent chemotherapy is generally only used in patients with extracutaneous localizations. Initial treat- ment according to this classic approach resulted in a com- plete remission in almost one third of the patients (98 of the 309 patients). As expected, in most patients, this complete remission was short-lived. However, in 33 (34%) of the 98 patients achieving complete remission on ini- tial treatment, and not receiving any type of mainte- nance treatment, there was no subsequent relapse. Eigh- teen of these 33 patients, including 9 with stage Ia, 5 with stage Ib, 3 with stage Ic, and 1 with stage IIb MF, have been in complete remission for more than 5 years, and, since most relapses occur within 5 years after achieving complete remission, 10,13 may be considered as potential cures. The present retrospective study does not allow a representative comparison of the effects of the different treatment modalities, since treatment selection may have been affected by disease severity. It is, therefore, not sur- prising that we did not find a relation between the re- sults of initial treatment and the type of treatment given (data not shown). The complete response of only 10 (55.6%) of the 18 patients to total skin electron beam ir- radiation at initial therapy may be explained by the fact that 4 of 18 patients had stage III disease, and 8 of the 14 remaining patients had MF-associated follicular mu- cinosis, a combination known to be rather refractory to total skin electron beam irradiation. 25 The disease-related and overall survival for the whole group of 309 patients was 89% and 80% at 5 years, and 75% and 57% at 10 years, respectively. For the survival rates for the different stages of MF, the over- all and disease-specific survival rates at 5 and 10 years for patients with stage Ia and Ib MF (Table 2) were simi- lar to those reported in previous studies. 4,5,10-14 In this study, we did find a difference in survival between those with stage Ia and those with stage Ib MF, but this did not reach statistical significance. The fact that disease

progression was much more frequent in patients with stage Ib MF than in those with stage Ia MF suggests that with longer follow-up, the difference in survival might become statistically significant. Our study did not include patients with large- plaque parapsoriasis, characterized by the presence of patches or slightly infiltrated plaques but with histologi- cal changes not diagnostic of MF. While we consider such lesions as a potential precursor of MF, other groups 26 have expressed the view that large-plaque parapsoriasis, and even small-plaque parapsoriasis, should be considered as MF, and not as precursors of MF. However, in view of the excellent prognosis of patients with stage Ia MF— similar to that of a race-, age-, and sex-matched control population 10 —and the low tendency to progress, it is ques- tionable which patient with small-plaque parapsoriasis will benefit from being marked as a patient with CTCL. Because of this ongoing controversy and the inconsis- tent use of the terms large-plaque parapsoriasis and small- plaque parapsoriasis, it is perhaps better to abandon these terms. The only question that really matters is the fol- lowing: is it MF or is it not MF? Tumor stage MF is often associated with a poor prog- nosis. However, this and other studies 11,12,14 clearly indi- cate that patients with skin tumors without concurrent extracutaneous disease (stage Ic) still have a disease- related 5-year survival of approximately 70% to 80%. Whether patients with enlarged, but histologically unin- volved, lymph nodes (stage II) have a more unfavorable prognosis compared with patients without clinically en- larged lymph nodes is a matter of controversy. 4,11,13 In the present study, patients with stage II disease had a signifi- cantly lower survival rate than patients with stage I MF (P.001). Previous studies 27 suggested that T-cell recep- tor gene rearrangement analysis is a more accurate and objective method of diagnosing early lymph node in- volvement in patients with MF than routine histological features. However, in prior studies, 28 which included lymph nodes of 7 of the 18 patients with stage II MF in- cluded in this study, no clonal T-cell populations were found in any of the dermatopathic, but noninvolved, lymph nodes. There is, therefore, no evidence that the lymph nodes of these patients with stage II MF were ac- tually involved, which leaves the more unfavorable prog- nosis of this group unexplained.

38

In the literature, the following prognostic variables have been described: stage of disease, 3-5,11-14 age, 2,10,12,13 race, 2 response to initial treatment, 3,10,13 and prior ma- lignant neoplasm. 2 In the present study, stage at diagno- sis (ie, the presence of extracutaneous disease and the type of skin involvement), complete remission after ini- tial treatment, and the presence of follicular mucinosis proved independently predictive of disease-specific sur- vival and disease progression. In the group of 32 patients with MF-associated fol- licular mucinosis, disease progression occurred more often and disease-specific survival rates were signifi- cantly lower than in the 277 patients without follicular mucinosis. In the 32 patients with follicular mucinosis, disease progression was estimated to occur in 89% within 10 years after diagnosis vs 32% in the 277 pa- tients without follicular mucinosis. The disease-related survival at 5 and 10 years was 81% and 36%, and the overall survival 75% and 21%, respectively. A more de- tailed clinical and histological analysis of a group of 40 patients with MF-associated follicular mucinosis will be published separately. Older patients had significantly lower disease- specific survival rates and higher disease progression rates. However, older age was associated with more advanced stages of MF, and it appeared not to be an independent prognostic factor. Mycosis fungoides is generally depicted as a malig- nant disease that slowly evolves through patch, plaque, and tumor stages, and ultimately may develop into an extracutaneous and generally fatal disease. Because of the increased accessibility of medical literature through In- ternet services, we are confronted more frequently with patients with newly diagnosed MF who have come to be- lieve that this sequence of events invariably takes place. On the other hand, clinical experience suggests that many patients with MF, in particular those with stage Ia and perhaps also many with stage Ib disease, may have stable disease for decades, and that only a proportion of pa- tients with MF progresses and will develop extracutane- ous disease. Consistently, the results of this and other recent studies 10,12,13 indicate that the risk of disease pro- gression within the first 10 years after diagnosis is about 5% to 10% for patients with stage Ia and between 17% and 39% for patients with stage Ib disease. In patients with more advanced stages of MF, the risk of disease pro- gression was higher and the duration until progression shorter (Tables 2 and 5). These results confirm the clini- cal impression that, at least within the first 10 years af- ter diagnosis, disease progression occurs in only a few patients. Further studies are warranted to elucidate the risk factors associated with disease progression within these early stages of MF.

Accepted for publication October 26, 1999. We thank P. D. Bezemer, PhD, P. J. Kostense, PhD, and J. J. Oudejans, MD, for their statistical advice. Reprints: Rein Willemze, MD, Department of Derma- tology, B1-Q-93, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, the Netherlands (e-mail:

willemze.dermatology@lumc.nl).

39

REFERENCES
REFERENCES

REFERENCES

REFERENCES
REFERENCES

1. Weinstock M, Horm J. Mycosis fungoides in the United States: increasing inci- dence and descriptive epidemiology. JAMA. 1988;260:42-46.

2. Weinstock M, Horm J. Population-based estimate of survival and determinants of prognosis in patients with mycosis fungoides. Cancer. 1988;62:1658-1661.

3. Lamberg S, Green S, Byar D, et al. Status report of 376 mycosis fungoides pa- tients at 4 years: Mycosis Fungoides Cooperative Group. Cancer Treat Rep. 1979;

63:701-707.

4. Hamminga L, Hermans J, Noordijk E, Meijer C, Scheffer E, van Vloten W. Cuta- neous T-cell lymphoma: clinicopathological relationships, therapy and survival in ninety-two patients. Br J Dermatol. 1982;107:145-155.

5. Sausville E, Eddy J, Makuch R, et al. Histopathological staging at initial diagnosis

of mycosis fungoides and the Se´zary syndrome: definition of three distinctive prog-

nostic groups. Ann Intern Med. 1988;109:372-382.

6. Hoppe R, Wood G, Abel E. Mycosis fungoides and the Se´zary syndrome: pathol- ogy, staging and treatment. Curr Probl Cancer. 1990;14:293-371.

7. Hermann J, Roenigk H, Hurria A, et al. Treatment of mycosis fungoides with photochemotherapy (PUVA): long-term follow-up. J Am Acad Dermatol. 1995;

33:234-242.

8. Zackheim H. Topical carmustine (BCNU) for patch/plaque mycosis fungoides. Semin Dermatol. 1994;13:202-206.

9. Quiros P, Kacinski B, Wilson L. Extent of skin involvement as a prognostic indi- cator of disease free survival and overall survival of patients with T3 cutaneous T-cell lymphoma treated with total skin electron beam radiation therapy. Can- cer. 1996;77:1912-1917.

10. Kim Y, Jensen R, Watanabe G, Varghese A, Hoppe R. Clinical stage IA (limited patch and plaque) mycosis fungoides. Arch Dermatol. 1996;132:1309-1313.

11. Toro J, Stoll H, Stomper P, Oseroff A. Prognostic factors and evaluation of mycosis fungoides and Se´zary syndrome. J Am Acad Dermatol. 1997;37:58-67.

12. Vonderheid E, Ekbote S, Kerrigan K, et al. The prognostic significance of delayed hypersensitivity to dinitrochlorobenzene and mechlorethamine hydrochloride in cutaneous T cell lymphoma. J Invest Dermatol. 1998;110:946-950.

13. Kim Y, Chow S, Varghese A, Hoppe R. Clinical characteristics and long-term outcome of patients with generalized patch and/or plaque (T2) mycosis fungoi- des. Arch Dermatol. 1999;135:26-32.

14. Zackheim H, Amin S, Kashani-Sabet M, McMillan A. Prognosis in cutaneous T- cell lymphoma by skin stage: long-term survival in 489 patients. J Am Acad Der- matol. 1999;40:418-425.

15. Beljaards R, Meijer C, Scheffer E, et al. Prognostic significance of CD30 (Ki-1/ Ber-H2) expression in primary cutaneous large-cell lymphomas of T-cell origin:

a clinico-pathological and histochemical study in 20 patients. Am J Pathol. 1989;

135:1169-1178.

16. Willemze R, Kerl H, Sterry W, et al. EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the Eu- ropean Organization for Research and Treatment of Cancer. Blood. 1997;90:

354-371.

17. Nickoloff BJ. Light-microscopic assessment of 100 patients with patch/plaque stage mycosis fungoides. Am J Dermatopathol. 1988;10:469-477.

18. Fuks Z, Bagshaw M, Farber E. Prognostic signs and the management of the my- cosis fungoides. Cancer. 1973;32:1385-1395.

19. Bunn P, Lamberg S. Report of the Committee on Staging and Classification of Cutaneous T-Cell Lymphomas. Cancer Treat Rep. 1979;63:725-728.

20. Scheffer E, Meijer C, Van Vloten W. Dermatopathic lymphadenopathy and lymph node involvement in mycosis fungoides. Cancer. 1980;45:137-148.

21. Kaplan E, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc. 1958;53:475-480.

22. Cox D, Snell E. Analysis of Binary Data. New York, NY: Chapman & Hall; 1989.

23. Beljaards R, Willemze R. The prognosis of patients with lymphomatoid papulosis associated with other types of malignancies. Br J Dermatol. 1992;126:596-602.

24. Basarab T, Fraser-Andrews E, Orchard G, et al. Lymphomatoid papulosis in as- sociation with mycosis fungoides: a study of 15 cases. Br J Dermatol. 1998;139:

630-638.

25. Wilson L, Cooper D, Goodrich A, et al. Impact of non-CTL dermatologic diagno- sis on cutaneous T-cell lymphoma patients treated with total skin electron beam radiation therapy. Int J Radiat Oncol Biol Phys. 1994;28:829-837.

26. King-Ismael D, Ackerman AB. Guttate parapsoriasis/digitate dermatosis (small plaque parapsoriasis) is mycosis fungoides. Am J Dermatopathol. 1992;14:518-530.

27. Weiss LM, Hu E, Wood GS, et al. Clonal rearrangements of T-cell receptor genes

in mycosis fungoides and dermatopathic lymphadenopathy. N Engl J Med. 1985;

313:539-544.

28. Bakels V, van Oostveen JW, Geerts ML, et al. Diagnostic and prognostic signifi- cance of clonal T-cell receptor beta gene rearrangements in lymph nodes of pa- tients with mycosis fungoides. J Pathol. 1993;170:249-255.

Chapter 3

Follicular mycosis fungoides, a distinct disease entity with or without associated follicular mucinosis:

a clinicopathologic and follow-up study of 51 patients

Arch Dermatol. 2002 Feb: 138(2):191-8

41

Follicular Mycosis Fungoides, a Distinct Disease Entity With or Without Associated Follicular Mucinosis

A Clinicopathologic and Follow-up Study of 51 Patients

Remco van Doorn, MD; Erik Scheffer, MD; Rein Willemze, MD; for the Dutch Cutaneous Lymphoma Group

Objective: To determine the clinicopathologic fea- tures and the disease course of patients with follicular mycosis fungoides (MF).

severe pruritus. Characteristic histologic findings were the presence of perifollicular neoplastic infiltrates with a variable degree of folliculotropism, but generally no epi- dermotropism, follicular mucinosis (49 of 51 cases), and often a considerable admixture of eosinophils and plasma cells. Response on initial treatment, risk of disease pro- gression (development of extracutaneous disease and/or

Design: A multicenter, 14-year, retrospective cohort analysis.

Setting: Dutch Cutaneous Lymphoma Group.

Patients: Fifty-one patients with the clinicopathologic features of follicular MF with (n=49) or without (n=2) associated follicular mucinosis. Follow-up data were com- pared with those of 158 patients with the classic epider- motropic type of MF, including 122 patients with gen- eralized plaque-stage MF (T2 N0 M0) and 36 patients with tumor-stage MF (T3 N0 M0).

Observations: Characteristic clinical features not or rarely observed in classic MF were the preferential lo- calization of the skin lesions in the head and neck re- gion (45 of 51 patients), the presence of follicular pap- ules, alopecia, acneiform lesions, mucinorrhoea, and often

death from lymphoma), and disease-specific and over- all survival of patients with follicular MF were worse than in classic MF patients. The actuarial disease-specific sur- vival was 68% at 5 years and 26% at 10 years.

Conclusions: Follicular MF shows distinctive clinico- pathologic features, is more refractory to treatment, and has a worse prognosis than the classic type of MF; it should be considered a distinct type of cutaneous T-cell lym- phoma. Based on these results and those of other stud- ies, we suggest the term follicular MF for cases with or without associated follicular mucinosis.

Arch Dermatol. 2002;138:191-198

M YCOSIS fungoides (MF) is the most common type ofcutaneousT-cell lymphoma, character- ized clinically by an

indolent clinical course with the subse- quent evolution of patches, plaques, and tumors, and histologically by the infiltra- tion of the epidermis by medium-sized to large atypical T cells with cerebriform nuclei. 1

From the Departments of Dermatology (Dr van Doorn) and Pathology (Dr Scheffer), Vrije Universiteit Medical Center, Amsterdam, and Department of Dermatology (Dr Willemze), Leiden University Medical Center, the Netherlands. A complete list of the participants in the Dutch Cutaneous Lymphoma Group is available from the authors.

See also pages 182 and 244

In thefirst 10 years after diagnosis, dis- ease progression, including development of extracutaneous disease and disease- related deaths, occurs in only a minority of patients. 2 Apart from this so-called classic Alibert-Bazin type of MF, many clinical and histologic subtypes have been reported, including hypopigmented, vesicular, pustular, granulomatous, and other types of MF. Since these variant types of MF have the same clinical course and clinical

43

behavior and require the same therapeu- tic approach as the classic type of MF, they are generally not considered separate entities. In both the EORTC (European Organization for Research on the Treat- ment of Cancer) 1 classification for pri- mary cutaneous lymphomas and in the WHO (World Health Organization) clas- sification, 3 only pagetoid reticulosis and MF-associated follicular mucinosis have been categorized as separate entities. Hereinafter, the latter condition will be referred to as follicular MF, a term also used in the WHO classification for cases with or without associated follicular mucinosis. Follicular MF has been classified as a separate entity because it has distinctive clinical and histologic features, is more re- fractory to standard treatment, and has a worse prognosis than classic MF. How- ever, this observation is particularly based on clinical experience of members of the classification committee of the EORTC Cu- taneous Lymphoma Group and is not sub-

stantiated sufficiently in the literature. In fact, pub- lished reports on follicular MF are relatively

stantiated sufficiently in the literature. In fact, pub- lished reports on follicular MF are relatively scarce, generally concern case reports or small series of pa- tients, and have mainly been focused on differentiation between MF-associated follicular mucinosis and alope- cia mucinosa, the benign idiopathic form of follicular mucinosis. 4-9 In a recent study by members of our group 2 on 309 patients with MF, the 32 patients with follicular MF seemed to have significantly higher disease progression and mortality rates than the 277 patients without fol- licular mucinosis. These observations prompted us to re- view all cases of follicular MF registered at the Dutch Cu- taneous Lymphoma Group between 1985 and 1998.

RESULTS
RESULTS

RESULTS

RESULTS
RESULTS

CLINICAL CHARACTERISTICS

The main clinical features and relevant follow-up data have been summarized in Table 1. Fifty-one patients, including 42 male and 9 female, were included in this study. Four (8%) of 51 patients were younger than 40 years at the time of diagnosis. At the time of diagnosis,

44

49 patients (96%) had disease confined to the skin, in- cluding 4 patients with enlarged but histologically un- involved lymph nodes, whereas 1 patient had concur- rent lymph node involvement and another, concurrent visceral involvement. At the time of diagnosis, 34 of 51 patients had only patches, plaques, or (grouped) follicular papules, often associated with alopecia; 14 had (concurrent) nodules or tumors; and 3 had erythroderma (Figure 1). Acne- iform lesions, including comedolike lesions and epider- mal cysts, were a prominent feature in 4 patients. Mucinorrhea (ie, discharge of mucinous substance from the follicular orifices) was noted in 3 patients. During the course of their disease, 2 patients developed a leo- nine face (Figure 2). In 45 of 51 patients, the skin le- sions were preferentially localized in the head and neck region at the time of diagnosis. A characteristic finding in 25 of these 45 patients was the presence of plaques or tumors on the head or neck, whereas the trunk and ex- tremities showed only patches or slightly infiltrated plaques and/or grouped follicular papules (Figure 1A-B). Infiltrated plaques in the eyebrows with concurrent alo- pecia were a common finding. Most patients had mod- erate to severe pruritus.

HISTOLOGIC FEATURES

A total of 74 representative skin biopsy specimensfrom these

51 patients were reviewed. These included the 51 diagnos- tic specimens, 8 prediagnostic specimens obtained 4 to 30 months (median, 12 months) prior to diagnosis, and 15 specimens obtained during follow-up at the time of re- lapse or disease progression. Characteristically, the diag- nostic specimens showed perifollicular and perivascular-

to-diffuse dermal infiltrates with variable infiltration of the follicular epithelium by medium-sized to large atypical T cells with cerebriform nuclei (Figure 3). Pautrier micro- abscesses appeared in only a minority of specimens. Infil- tration of the interfollicular epidermis by (atypical) T cells,

as in classic MF, was rare. Only 5 of 51 specimens showed

infiltration of both the epidermis (epidermotropism) and the follicular epithelium (folliculotropism). Prominent in- filtration of the eccrine sweat glands was observedin 3 speci- mens. In all but 2 cases, the skin specimens showed mu- cinous degeneration of the hair follicles, varying from focal spots of mucin deposition (which had to be searched for

in serial sections) to lakes of mucin (Figure 3B).

The number of atypical T cells infiltrating the follicu- lar epithelium was generally low and did not correlate with

the amount of mucin deposition. The perifollicular infil- trates consisted of variable numbers of medium-sized to large atypical T cells with cerebriform nuclei and blast cells and admixed small lymphocytes, histiocytes, eosinophils (which were numerous in 13 of 51 specimens), and plasma cells, in particular in patients with secondary bacterial in- fection (Figure 3C). Concurrent patches on the trunk showed essentially the same histologic features, though the number of atypical T cells was often less than in the more infiltrated lesions in the head and neck, which made a defi- nite diagnosis in these specimens more difficult or even impossible. Immunohistochemical analysis demonstrated a CD3 + -CD4 + -CD8 phenotype of the neoplastic T cells in all cases studied. Small numbers of scattered CD30 + blast cells were regularly observed, as were small clusters of ad- mixed B cells. In the initial diagnostic specimens of 7 of the 51 patients, we found a considerable number of blast cells (15%; generally a mixture of CD30 + and CD30 blast cells). Six of these 7 patients died of lymphoma 11 to 100 months (median, 40 months) after diagnosis. In follow-up specimens taken during disease pro- gression, the dermal infiltrates tended to become more diffuse, sometimes showed complete effacement of the follicular structures, and invariably showed increasing numbers of CD30 and/or CD30 + blast cells. In the 8 pre- diagnostic specimens, the dermal infiltrates were mainly confined to the perifollicular areas. Although some of these specimens already contained small numbers of atypical

T cells in the follicular epithelium and in the perifollicu-

lar infiltrates, the size and morphologic characteristics of the infiltrating T cells did not warrant a definite diag- nosis of follicular MF.

THERAPY AND FOLLOW-UP

Initial therapyconsisted ofpsoralenplusUV-A (PUVA) treat- ment in 22 patients and total skin electron beam irradia-

45

Table 1. Clinical Characteristics and Follow-up Data of 51 Patients With Follicular Mycosis Fungoides*

Characteristic

Finding

Age at diagnosis, median (range), y Male-female ratio Duration of skin lesions before diagnosis, median (range), mo Type of skin lesions at diagnosis Patches/plaques/papules Nodules/tumors Cysts/comedones Erythroderma Clinical stage at diagnosis Only skin lesions Enlarged, but uninvolved nodes (DL) Lymph node involvement Visceral involvement Folicular mucinosis Present Absent Initial treatment PUVA TSEBI Radiotherapy + other Other Complete remission on initial therapy Calculated risk of disease progression†, % At 5 y At 10 y Current status Alive without disease Alive with disease Died of other cause Died of FMF Disease-specific survival, % At 5 y At 10 y Overall survival, % At 5 y At 10 y

57 (15-84)

4.7 (42:9)

48 (4-156)

44 (86)

14 (27)

4 (8)

3 (6)

45 (88)

4 (8)

1 (2)

1 (2)

49 (96)

2 (4)

22 (43)

11 (22)

7 (14)

11 (22)

8 (16)

37

66

5 (10)

20 (39)

6 (12)

20 (39)

68

26

64

14

*Unless otherwise indicated, data are number (percentage) of patients. DL indicates histologic features of dermatopathic lymphadenopathy; PUVA, psoralen plus UV-A therapy; TSEBI, total skin electron beam irradiation; and FMF, follicular mycosis fungoides. †Disease progression means development of extracutaneous disease and/or death from lymphoma.

tion (TSEBI) in 11 patients (Table 1). Seven patients were initially treated withlocal radiotherapyin combination with other therapies, including PUVA with or without reti- noids, UV-B, topical mechlorethamine, or topical steroids. For the remaining patients treatments included topical ste- roids (3patients), topicalmechlorethamine (1patient),UV-B (1 patient), PUVA in combination with retinoids (1 pa- tient), prednisone (1 patient), azathioprine in combina- tion with topical mechlorethamine (1 patient), or poly- chemotherapy (2 patients). One patient refused treatment. Only 8 (16%) of 51 patients, each with disease con- fined to the skin, achieved complete remission on initial treatment. Six of them had been treated with TSEBI, 1 with PUVA, and 1 with a combination of PUVA, retinoids, and local radiotherapy. Two of these 7 patients were still in com- plete remission after a follow-up of 38 and 192 months, respectively, and may be considered cured.

A B C D E F
A
B
C
D
E
F

Figure 1. Clinical appearances of follicular mycosis fungoides. A, Boggy infiltrates on the cheek and neck; B, concurrent grouped follicular papules on the trunk; C, Infiltrated plaque with alopecia and cystic lesions above the left eye; D, the same patient had numerous cysts and comedolike lesions on the trunk; E, Diffuse erythema and alopecia of the eyebrows (and eyelashes, not shown); F, Infiltrated plaque on the forehead with alopecia of the left eyebrow.

The follow-up period varied between 8 and 239 months (median, 48 months; mean, 58 months). Devel- opment of lymph node or visceral involvement was docu-

mented in 14 and 7 patients, respectively. Disease pro- gression defined as the development of extracutaneous disease or death from lymphoma occurred in 20 (39%) of 51 patients, and occurred 11 to 168 months (median,

45 months) after diagnosis. The calculated risk of dis-

ease progression during the first 5 years after diagnosis

was 37%; at 10 years, 66%. At the conclusion of the study,

26 patients had died, 20 from lymphoma. The 5- and 10-

year disease-specific survival rate was 68% and 26%, re- spectively. The respective overall survival rates at 5 and 10 years were 64% and 14%. Univariate analysis dem- onstrated no association between disease-specific sur- vival and age at diagnosis, sex, duration of skin lesions before diagnosis, or response to initial treatment.

FOLLICULAR MF VS CLASSIC MF

To evaluate differences in clinical behavior and progno- sis between follicular MF and classic MF, we compared

46

A B C D
A
B
C
D

Figure 2. Sequential photographs of a 39-year-old man with follicular mycosis fungoides. A, At the time of diagnosis; B, 26 months after diagnosis with a leonine face; C, 29 months after diagnosis; and D, 35 months after diagnosis following total skin electron beam irradiation, which had not resulted in complete remission. The patient died of lymphoma 42 months after diagnosis.

relevant clinical features of the 49 patients with follicular MF who had disease confined to the skin with the fea- tures of 122 patients with generalized plaque-stage MF and 36 patients with tumor-stage MF without evidence of ex- tracutaneous disease and without associated follicular mu- cinosis (Table 2). Patients with follicular MF showed a significantly higher male-female ratio and less frequently achieved complete remission on initial treatment. The cal- culated risk of disease progression, as defined in this study, within the first 5 years after diagnosis was 36% for fol- licular MF vs 12% for classic plaque-stage MF and 24% for tumor-stage MF. Disease-specific and overall survival in patients with follicular MF were significantly lower than in patients with generalized plaque-stage MF, and were roughly similar to patients with tumor-stage MF without associated follicular mucinosis (Figure 4).

COMMENT
COMMENT

COMMENT

COMMENT
COMMENT

The results of the present study clearly demonstrate that follicular MF has distinctive clinicopathologic features and should be considered a distinct disease entity. Character- istic histologic features include the primary perifollicular localization of the dermal infiltrates, with variable infiltra- tion of the follicular epithelium by medium-sized to large

47

atypical T cells with cerebriform nuclei. In most cases the epidermis is spared (folliculotropism instead of epidermo- tropism). Mucinous degeneration of the follicular epithe- lium occurs in most cases, and a considerable admixture with eosinophils and plasma cells is frequently present. Clinical characteristics include the preferential lo- calization of the skin lesions in the head and neck area (45 of 51 patients), the presence of papules (often grouped), alopecia, frequent secondary bacterial infection, and, less commonly, the presence of acneiform lesions and muci- norrhea. Unlike in classic MF, pruritus is often severe and may represent a good parameter of disease activity: in sev- eral patients, a relapse after initial therapy was preceded by the reappearance of pruritus. In addition, patients with follicular MF proved generally more refractory to stan- dard classic MF therapies, showed more frequent disease progression, and had a less favorable prognosis (Table 2). This more unfavorable prognosis suggests a true bio- logical differencein clinical behavior between patientswith follicularMF and patients with the classic epidermotropic type of MF, which is consistent with the conclusion of a recent study. 11 The similar duration of skin lesions before diagnosis in patients with follicular MF and patients with classic-type MF indicates that the difference in survival does not simply result from a selection of patients with

A B C
A
B
C

Figure 3. Characteristic histologic features of follicular mycosis fungoides. Perifollicular infiltrates with marked folliculotropism and associated follicular mucinosis. A, Note the absence of epidermal involvement. B, Alcian blue staining of a concurrent lesion showing mucin deposits. C, Detail of perifollicular infiltrate of part A showing atypical hyperchromatic T cells, blast cells, and admixed histiocytes and eosinophils.

more advanced diseasein the present study (Table 2).Com- parison of the disease-specific and overall survival datain- dicate that patients with follicular MF have a similar (at 5 years) or worse (at 10 years) survival than patients with tumor-stage MF (Table 2). Nevertheless, under the clas- sicMF classification systems, 12,13 most of our patients with follicular MF would have been classified as stage IA (T1 N0 M0) or IB (T2 N0 M0), and only 14 of them had nod- ules or tumors at the time of diagnosis. This supports our contention that these clinical staging systems for MF are not very usefulin patients withfollicularMF. Forinstance, patients presenting with a solitary patch or plaque on the face do not have stage IA or T1 N0 M0stage disease. Be- cause of the perifollicular localization of the dermal in- filtrates, such patients should always be considered to have tumor-stage disease, regardless of the clinical appearance of the skin lesion, and should be treated accordingly.

MF-ASSOCIATED FOLLICULAR MUCINOSIS VS FOLLICULAR MF

In recent years the term follicular MF or cutaneous T-cell lymphoma (also folliculocentricMF or pilotropicMF) has been

introduced for a rare clinical variant of MF characterized by follicular papules, follicular keratoses, comedolike le- sions and epidermal cysts. Histologically, perifollicular in- filtrates are present showing marked folliculotropism, but there is generally no epidermotropism or follicular muci- nosis. 14-22 Evaluation of published reports of follicular MFdemonstrates considerable clinical heterogeneity and sug- gests that this term has been used for the diagnoses of at least 3 different groups of patients. The largest group comprises patients with clinically and histologically classic MF prior to or, less often, con- current with the development of the follicular le- sions. 17,21,22 In the present study, 3 patients with 4- to 7-year histories of classic epidermotropic MF developing skin tu- mors with the histologic features of follicular MF were ex- cluded because such cases show the clinical behavior of clas- sic MF developing tumor-stage disease. The second group includes patients presenting with acneiform lesions as the predominant or only manifesta- tion of the disease. 17,19,21,22 However, a similar clinical pre- sentation may also occur in patients with associated fol- licular mucinosis 23,24 and was a predominant feature in 4 of 51 patients in the present study. One of our patients was

48

Table 2. Characteristics of Patients With Folllicular, Generalized Plaque-Stage, and Tumor-Stage Mycosis Fungoides*

P Value (FMF vs Classic MF)

Characteristic

FMF† (n = 49)

Plaque-Stage MF† (n = 122)

Tumor-Stage MF† (n = 36)

Plaque Tumor
Plaque
Tumor
 

57 (15-84)

61 (14-92)

47 (35-88)

.61

.01

4.4 (40:9)

1.39 (71:51)

1.25 (20:16)

.004

.02

48 (4-156)

48 (1-840)

48 (2-600)

.09

.12

8 (16)

38 (31)

10 (28)

.05

.20

36

12

24

.001

.49

65

18

47

69

95

79

.001

.25

26

84

61

65

89

61

.001

.80

14

68

34

Age at diagnosis, median (range), y Male-female ratio Duration of skin lesions before diagnosis (range), mo Complete remission on initial therapy, No. (%) Risk of disease progression, % At 5 y At 10 y Disease-specific survival, % At 5 y At 10 y Overall survival, % At 5 y At 10 y Follow-up duration, median (range), mo

48 (11-239)

72 (14-313)

47 (6-249)

*FMF indicates follicular mycosis fungiodes; MF, mycosis fungoides. Columns FMF,” “Plaque-Stage MF,and Tumor-Stage MFdenote patients without extracutaneous involvement at time of diagnosis with FMF, MF with patches and plaques covering 10% or more of the skin surface (T2 N0 M0), and MF with skin tumors (T3 N0 M0), respectively.

a 16-year-old boy with a history of severely pruritic acne- iform lesions and alopecia for more than 5 years before the diagnosisMF-associatedfollicularmucinosiswasmade. De- spite radiotherapy and multiagent chemotherapy, he died

5 years after diagnosis of systemic lymphoma. Interest-

ingly, while several of his acneiform lesions showed mu- cin deposits, others did not, even after further sectioning. Finally, some of the reported cases demonstrate all of the characteristic clinical and histologic features of the cases reported herein except for the presence of follicular mucinosis. 18,20 The present study includes 2 such cases in patients who otherwise did not differ clinically or histo- logically from the 49 patients with associated follicular mucinosis. Based on these observations, we do not be-

lieve that it is useful to differentiate between follicular MF with and without associated follicular mucinosis in these

2 latter groups. From a biological point of view, the most

relevant feature in follicular MF with or without follicu- lar mucinosis is the deep, perifollicular localization of the neoplastic infiltrates, which makes them less accessible to skin-targeted therapies. On the basis of our own observa- tions and the available literature, 11 we are inclined to be- lieve that follicular MF with or without follicular muci- nosis should not be considered separately, and that cases

with a preferential (peri)follicular distribution of the neo- plastic infiltrates, regardless of the presence of mucinous degeneration, should be termed follicular MF.

DIFFERENTIAL DIAGNOSIS

Although distinctive clinical and histologic features should facilitate an early and correct diagnosis, it is our experi- ence over the last 15 years that the diagnosis of follicular MF is often overlooked. Because of the preferential in- volvement of the head and neck area, the absence of patches and plaques on the trunk or buttocks, and the absence of epidermotropic atypical T cells, the diagnosis of MF or cu- taneous T-cell lymphoma is often not considered. The fol- lowing incorrect diagnoses have been made more than once

49

lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of
lowing incorrect diagnoses have been made more than once 49 Figure 4. Actuarial disease-related survival of

Figure 4. Actuarial disease-related survival of 49 patients with follicular mycosis fungoides (FMF), 122 with generalized plaque-stage mycosis fungoides (MF) (T2 N0 M0), and 36 with tumor-stage MF (T3 N0 M0). For FMF vs plaque-stage MF, P.001; for FMF vs tumor-stage MF, P =.25.

prior to referral: seborrheic dermatitis in patients present- ing with erythematous lesions on the scalp and eye- brows; atopic dermatitis, because of the severe pruritus;

and facial granuloma with eosinophilia in patients pre-

senting with a solitary plaque on theface and an eosinophil-

rich infiltrate. Finally, it should be noted that even when follicular MF is suspected, it may require several biopsies to make a definite diagnosis. It is important that biopsy specimens be taken from the most infiltrated skin le- sions, generally in the face or neck, and not only from patches with or without follicular papules on the trunk.

THERAPY

The results of the present study confirm our clinical im- pression and the scattered data in literature that patients with follicular MF are generally less responsive to stan- dard therapies used in patients with classic MF. 11,20,25 Our retrospective study does not allow a meaningful compari- son of the effects of the different treatment methods be- cause patients were treated at differentinstitutions, and treat- ment selection may have been affected by disease severity.

Because of the perifollicular localization of the der- mal infiltrates, patients with follicular MF should always be considered to have tumor-stage disease, regardless of the clinical appearance of the skin lesions. Therefore, in patients presenting with a single plaque or tumor or a few clustered skin lesions, but without patches orfollicular pap- ules at other sites, radiotherapy is the first choice for treat- ment. In selected cases with superficial lesions present- ing at multiple sites, PUVA treatment might be attempted first. However, in most cases this approach will not result in complete remission. In the present series, complete re- mission was achieved with PUVA therapy in only 1 of 22 patients. In patients with more infiltrated skin lesions, in particular those who do not respond to PUVA therapy alone, TSEBI is the preferred method of treatment. How- ever, only 6 of 11 patients treated with TSEBI reached com- plete remission, and 3 of the 6 complete responders had a relapse within 6 months. The relative unresponsiveness of follicular MF to TSEBI has been reported. 18 In some patients relapsing skin disease may be controlled effectively by a maintenance treatment with topical nitrogen mustard. If TSEBI is not available, PUVA in combination with interferon alfa or retinoids and local radiotherapy for thick tumors may be an alternative. The same approach can be used for re- lapsing disease following TSEBI. In our experience, mul- tiagent chemotherapy does not generally result in com- plete remission in patients with skin-limited disease and should therefore be reserved for patients developing extracutaneous disease.

Accepted for publication July 2, 2001. Corresponding author and reprints: ReinWillemze, MD, Department of Dermatology, B1-Q-93, Leiden University Medical Center, Albinusdreef 2, 2333 ZA Leiden, the Neth- erlands (e-mail: willemze.dermatology@lumc.nl).

REFERENCES
REFERENCES

REFERENCES

REFERENCES
REFERENCES

1. Willemze R, Kerl H, Sterry W, et al. EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the Eu- ropean Organization for Research and Treatment of Cancer. Blood. 1997;90:

354-371.

2. Van Doorn R, Van Haselen CW, van Voorst Vader PC, et al. Mycosis fungoides:

disease evolution and prognosis of 309 Dutch patients. Arch Dermatol. 2000;

136:504-510.

3. Harris NL, Jaffe ES, Diebold J, et al. World Health Organization classification of

neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clini- cal Advisory Committee meeting, Airlie House, Virginia, November 1997. J Clin Oncol. 1999;17:3835-3849.

4. Pinkus H. The relationship of alopecia mucinosa to malignant lymphoma. Der- matologica. 1964;129:266-270.

5. Emmerson RW. Follicular mucinosis: a study of 47 patients. Br J Dermatol. 1969;

81:395-413.

6. Nickoloff BJ, Wood C. Benign idiopathic versus mycosis fungoidesassociated follicular mucinosis. Pediatr Dermatol. 1985;2:201-206.

7. Sentis HJ, Willemze R, Scheffer E. Alopecia mucinosa progressing into mycosis fungoides: a long-term follow-up study of two patients. Am J Dermatopathol.

1988;10:478-486.

8. Gibson LE, Muller SA, Leiferman KM, Peters MS. Follicular mucinosis: clinical and histopathologic study. J Am Acad Dermatol. 1989;20:441-446.

9. Mehregan DA, Gibson LE, Muller SA. Follicular mucinosis: histopathologic re- view of 33 cases. Mayo Clin Proc. 1991;66:387-390.

10. Scheffer E, Meijer CJ, Van Vloten WA. Dermatopathic lymphadenopathy and lymph node involvement in mycosis fungoides. Cancer. 1980;45:137-148.

11. Bonta MD, Tannous ZS, Demierre MF, Gonzalez E, Harris NL, Duncan LM. Rap- idly progressing mycosis fungoides presenting as follicular mucinosis. J Am Acad Dermatol. 2000;43:635-640.

12. Bunn P, Lamberg S. Report of the Committee on Staging and Classification of Cutaneous T-cell Lymphomas. Cancer Treat Rep. 1979;63:725-728.

13. Fuks Z, Bagshaw M, Farber E. Prognostic signs and the management of the my- cosis fungoides. Cancer. 1973;32:1385-1395.

14. Kim SY. Follicular mycosis fungoides. Am J Dermatopathol. 1985;7:300-301.

15. Lacour JP, Castanet J, Perrin C, Ortonne JP. Follicular mycosis fungoidesa clinical and histologic variant of cutaneous T-cell lymphoma: report of two cases.

J Am Acad Dermatol. 1993;29:330-334.

16. Goldenhersh MA, Zlotogorski A, Rosenmann E. Follicular mycosis fungoides. Am

J Dermatopathol. 1994;16:52-55.

17. Vergier B, Beylot-Barry M, Beylot C, et al. Pilotropic cutaneous T-cell lymphoma without mucinosis: a variant of mycosis fungoides? Arch Dermatol. 1996;132:

683-687.

18. Pereyo NG, Requena L, Galloway J, Sangueza OP. Follicular mycosis fungoides:

a clinicohistopathologic study. J Am Acad Dermatol. 1997;36:563-568.

19. Fraser-Andrews E, Ashton R, Russell-Jones R. Pilotropic mycosis fungoides pre- senting with multiple cysts, comedones and alopecia. Br J Dermatol. 1999;

140:141-144.

20. Klemke CD, Dippel E, Assaf C, et al. Follicular mycosis fungoides. Br J Dermatol.

1999;141:137-140.

21. Hodak E, Feinmesser M, Segal T, et al. Follicular cutaneous T-cell lymphoma: a clinicopathological study of nine cases. Br J Dermatol. 1999;141:315-322.

22. Grau C, Pont V, Matarredona J, Fortea JM, Aliaga A. Follicular mycosis fungoi- des: presentation of a case and review of the literature. J Eur Acad Dermatol Venereol. 1999;13:131-136.

23. Wilkinson JD, Black MM, Chu A. Follicular mucinosis associated with mycosis fungoides presenting with gross cystic changes on the face. Clin Exp Dermatol.

1982;7:333-339.

24. Wittenberg GP, Gibson LE, Pittelkow MR, el-Azhary RA. Follicular mucinosis pre- senting as an acneiform eruption: report of four cases. J Am Acad Dermatol. 1998;

38:849-851.

25. Gilliam AC, Lessin SR, Wilson DM, Salhany KE. Folliculotropic mycosis fungoi- des with large-cell transformation presenting as dissecting cellulitis of the scalp.

J Cutan Pathol. 1997;24:169-175.

News and Notes

T he Regional Conference on Dermatological Laser and Facial Cos- metic Surgery 2002 will be held from September 13 through Septem- ber 15, 2002, at the new wing of the Hong Kong Convention and Ex-

hibition Center. The conference is jointly organized by the University of Hong Kong, the Hong Kong Society of Dermatology and Venereology, and the Hong Kong Society of Plastic & Reconstructive Surgeons. Renowned authorities to speak at the conference include Dr Yung-lung Lai (Chang Gung Memorial Hospital, Taiwan), Dr Dieter Manstein (Harvard Medical School, United States), Prof Rolf Nordstro¨ m (Nordstro¨ m Hospital for Plastic and Reconstructive Surgery, Finland), Dr Niwat Polnikorn (Ramathi- bodi Hospital, Thailand), and Dr Woffles Wu (Woffles Wu Aesthetic Surgery and Laser Center, Singapore). For more information on the conference, please contact the secretariat at phone (852) 25278898; fax: (852) 28667530, or e-mail: cosfmshk@netvigator .com.

News and Notes

50

Chapter 4

CD8+ T cells in cutaneous T-cell lymphoma:

expression of cytotoxic proteins, Fas ligand, and killing inhibitory receptors and their relationship with clinical behaviour

J. Clin. Oncol. 2001 Dec 1;19(23):4322-9

CD8T Cells in Cutaneous T-Cell Lymphoma: Expression of Cytotoxic Proteins, Fas Ligand, and Killing Inhibitory Receptors and Their Relationship With Clinical Behavior

By Maarten H. Vermeer, Remco van Doorn, Danny Dukers, Marcel W. Bekkenk, Chris J.L.M. Meijer, and Rein Willemze

Purpose: We investigated the number, phenotype, and prognostic significance of CD8T cells in patients with mycosis fungoides (MF) and CD30primary cuta- neous large T-cell lymphoma (PCLTCL). Patients and Methods: Immunohistochemical stain- ings for CD8, granzyme B (GrB), T cell–restricted intra- cellular antigen (TIA-1), Fas ligand (FasL), and killer-cell inhibitory receptors (KIRs; CD95, CD158a, and CD158b) were performed on 83 first-diagnostic biopsy samples obtained from patients with plaque-stage MF (n 42), tumor-stage MF (n 20), and CD30PCLTCL (n 21). Results: Serial sections and double-staining experi- ments showed that the large majority of CD8T cells in MF and CD30PCLTCL expressed TIA-1 and FasL, whereas only a minority expressed GrB, which sug- gested that these CD8T cells were partly activated cytotoxic T lymphocytes (CTLs). These CD8CTLs never or rarely expressed KIRs. This phenotype was a con- stant feature of CD8CTLs and did not alter with

C UTANEOUS T-CELL lymphomas (CTCLs) are a group of non-Hodgkin’s lymphomas mainly with a

CD3CD4memory T-cell phenotype that preferentially home to the skin. 1 Mycosis fungoides (MF), the most common type of CTCL, is characterized by erythematous, scaly patches, and plaques in the early stages of disease and generally has an indolent clinical course. 2 However, in some patients, progression to tumor-stage MF is observed, which is associated with more aggressive clinical behavior. In contrast, patients with CD30primary cutaneous large T-cell lymphoma (PCLTCL) generally present with multi- ple tumors that rapidly spread to extracutaneous sites, and these patients have a poor prognosis, with a 5-year survival rate of 15%. 1 The pathophysiologic mechanisms underlying these dif- ferences in biologic behavior are largely unknown. How- ever, the protracted clinical course in most MF patients, the beneficial effect of immunomodulating therapies, and the

From the Departments of Dermatology and Pathology, Free Uni- versity Hospital, Amsterdam, the Netherlands. Submitted January 22, 2001; accepted July 23, 2001. Address reprint requests to M.H. Vermeer, MD, Department of Dermatology, Leiden University Medical Center, Albinusdreef 2 2300 RC Leiden, the Netherlands; email: m.h.vermeer@lumc.nl. © 2001 by American Society of Clinical Oncology.

0732-183X/01/1923-4322/$20.00

disease progression. In contrast, the median percent- age of CD8CTLs in plaque-stage MF (22%), tumor- stage MF (7%), and CD30PCLTCL (3%) differed signif- icantly (P < .0001) and was associated with a significant decrease in 5-year survival. Also within the group of tumor-stage MF, a significant relation be- tween CD8CTLs and survival was found. Multivariate analysis in the total group of MF demonstrated that both skin stage and percentage of CD8CTLs were independent parameters of survival. Conclusion: Our results demonstrated that partly activated CD8CTLs were present in CTCL and that high proportions of these cells correlated with a bet- ter prognosis. This suggested that these CD8CTLs could play an important role in the antitumor re- sponse in these conditions. J Clin Oncol 19:4322-4329. © 2001 by American Society of Clinical Oncology.

influx of CD8cytotoxic T lymphocytes (CTLs) in regress- ing MF tumors on intralesional administration of interleu- kin-12 suggest that a tumor-specific immune response may play an important role. 3 In vitro studies have consistently shown that malignant cells in MF display tumor-specific antigens that can be recognized by autologous CD8CTLs. 4-7 Taken together, these observations suggest that CD8CTLs are a critical component in the antitumor immune response in CTCL. However, studies that evaluate the number and immunophenotype of CD8CTLs in different stages of CTCL are scarce, and correlation with clinical behavior leads to contradicting results. 8,9 CD8CTL–mediated tumor-cell lysis is achieved by at least two distinct pathways: (1) by exocytosis of intracyto- plasmic granules that contain perforin, granzymes, and T cell–restricted intracellular antigen (TIA-1), and (2) by the Fas-mediated pathway in which membrane-bound Fas li- gand (FasL) expressed on cytotoxic T cells interacts with Fas (CD95/Apo-1) on target cells. 10,11 Both pathways acti- vate a cascade of subcellular events that ultimately lead to the activation of caspases and target-cell death. The avail- ability of monoclonal antibodies (MoAbs) against perforin, the serine proteases granzyme A and granzyme B (GrB), TIA-1, FasL, and Fas has enabled the study of these components involved in T cell–mediated cytotoxicity in tissue sections. 12-15 Recently, killing inhibitory receptors (KIRs) were discovered as a new class of molecules that are

53

able to modulate cytotoxic function of natural killer (NK) and T cells. At present, two groups of KIRs are known: the immunoglobulin (Ig) superfamily-like receptors (CD158a, CD158b) 16 and the lectin-like receptors (CD94). 17 These receptor molecules are expressed by subpopulations of NK cells and CD8CTLs. On ligation with MHC class I receptors on target cells, KIRs deliver inhibitory signals that impair cytolytic function. 18 Thus, expression of KIRs by CTLs might impair their capacity to effectively kill virus- infected or tumor cells. Recent in vitro studies demonstrated the expression of functional KIRs on a CD8, tumor- specic, cytotoxic, T-cell clone isolated from the peripheral blood of a patient with MF. 19 However, studies of the expression of KIRs by cytotoxic cells in skin inltrates of CTCL lesions have not yet been published, and the impor- tance of the induction of KIRs as a mechanism to evade the immune response in CTCL is presently unknown. To further characterize the role of CD8CTLs in the antitumor immune response in CTCL, we investigated the proportions of CD8T cells and the expression of TIA-1, GrB, FasL, and KIRs by CD8CTLs in 83 initial biopsy samples from patients with plaque-stage MF (n 42), tumor-stage MF (n 20), and CD30PCLTCL (n 21) obtained at the time of diagnosis and 27 follow-up biopsy samples and correlated the results with clinical behavior.

PATIENTS AND METHODS

Patients

Eighty-three parafn-embedded skin biopsy samples obtained at the time of diagnosis from 83 untreated CTCL patients, who included 62 MF patients and 21 CD30PCLTCL patients, were studied. The diagnosis of MF and CD30PCLTCL was based on a combination of clinical, histologic, and immunophenotypical data as described previ- ously. 1 The duration of skin lesions before a denite diagnosis could be made varied between 2 months and more than 10 years (median, 103 months) in MF and between 3 and 24 months (median, 12 months) in patients with CD30PCLTCL. Only cases in which the neoplastic T cells had either a CD3/ CD4/CD8(n 70) or a CD3/CD4/CD8phenotype (n 13) were included. Rare cases of MF and CD30PCLTCL with a CD3/CD4/CD8phenotype were not selected for this study because it was impossible to make a reliable estimate of the number of reactive CD8T cells in these cases. Follow-up data, including response to initial therapy and survival, were recorded in each case (Table 1). Of the 62 MF biopsy samples taken at the time of diagnosis, 42 were obtained from plaques from patients with generalized (T2N0M0) plaque-stage MF, and 20 were obtained from skin tumors from patients with tumor-stage MF without concurrent lymph node involvement (T3N0M0). For 19 of these 62 patients, 27 follow-up biopsy samples from plaques (n 9) or skin tumors (n 18) obtained at the time of relapse or disease progression 1 to 90 months (median, 24 months) after the rst diagnostic biopsy were studied as well. The results of these biopsies are not included in the statistical analyses and will be discussed separately.

Table 1. Clinical Characteristics of Patients Included in This Study

Plaque-Stage MF Tumor-Stage MF CD30-Negative

Diagnosis

(T2N0M0)

(T3N0M0)

PCLTCL

No. of patients Age, years

42

20

21

Median

65

67

71

Range

33-93

47-92

31-88

Male/female

2.0

1.0

1.7

Follow-up, months Median

64

24

12

Range

12-176

3-117

1-56

5-year survival rate, %

85

55

0

Current status, n Alive without disease

0

0

1

Alive with disease

35

8

2

Died of unrelated disease

3

2

1

Died of lymphoma

6

12

17

Frozen sections obtained from the same excision biopsy sample or another biopsy sample from a similar concurrent lesion were used for KIR staining in 18 cases, including seven MF plaques, nine MF tumors, and two CD30PCLTCL biopsy samples.

Immunohistochemistry

Paraffin sections. Immunostaining on formalin-xed, parafn-em- bedded skin sections with MoAbs against CD8 (DAKO, Glostrup, Denmark), GrB, 20,21 TIA-1 (Coulter Immunology, Hialeah, FL), 4 FasL (clone 33; Transduction Laboratories, Lexington, United Kingdom), and CD4 (Novocastra, Newcastle on Tyne, United Kingdom), Ber-H2/ CD30 (DAKO) and polyclonal antibodies against CD3 (DAKO) was performed using a standard three-step streptavidin-biotin-peroxidasebased technique after antigen retrieval with microwave heating as described previously. 22,23 In 10 cases, which included four patients with MF plaques, four with MF tumors, and two with CD30PCLTCL, double staining for CD8 with GrB and CD8 with TIA-1 was performed as described previously. 24 Frozen sections. Snap-frozen specimens were stored in liquid nitrogen until use. NK cells were identied by their staining for CD56 (IgG1 subtype; Beckton and Dickinson, Poole, United Kingdom). Expression of KIR was studied using MoAbs against CD94 (IgG2 subtype), CD158a, and CD158b (Coulter Immunology), as described previously. 25 Double staining for CD94 with CD56 or CD8 was performed in eight cases, which included three patients with MF plaques, three with MF tumors, and two with CD30PCLTCL, by simultaneous incubation with primary antibodies followed by incuba- tion with horseradish peroxidaseconjugated goat antimouse IgG1 and biotinylated goat antimouse IgG2a for the detection of CD56 or CD8 and CD94, respectively. The horseradish peroxidase was visualized by uorescein-conjugated tyramine, 26,27 whereas the biotin label was detected with cy3-conjugated streptavidin.

Interpretation of Immunohistochemical Staining

The percentages of CD8T cells were expressed as a percentage of the total number of skin-inltrating cells (both reactive and neoplastic). Percentages of CD8T cells were independently estimated by two observers (M.H.V. and R.W.) to the nearest 5% for the entire tissue section in a blinded fashion. In the few cases in which there was disagreement, sections were read jointly by the two investigators, and

54

Table 2. Percentages of CD8T Cells in MF and CD30-Negative PCLTCL

Diagnosis

No. of Patients

CD8 T Cells (%)*

Median

Range

MF plaque

42

22†

2-50

MF tumor

20

10†

2-20

CD30PCTLCL

21

3†

1-25

*The percentage of CD8T cells is taken as a percentage of the total number of skin-infiltrating cells (reactive cells and tumor cells). †Difference between MF plaques versus MF tumors and MF tumors versus CD30PCTLCL is significant (Student’s t test, P .0001).

consensus was reached. The percentages of CD8T cells positive for TIA-1, GrB, FasL, and KIR were studied on serial parafn sections stained with antibodies against CD3, CD4, CD8, GrB, TIA-1, and FasL and serial frozen sections stained with antibodies against CD56, CD8, CD94, CD158a, and CD158b. Stainings were scored as follows:

negative, no or occasional (10%) CD8T cells stained; positive, 10% to 50%; and double positive, more than 50%. To determine whether and to what extent TIA-1, GrB, FasL, and KIRs are expressed by inammatory cells other than CD8cells, we performed double- staining experiments as described above.

Statistical Analysis

Comparison of proportions of CD8T cells and the proportions of CD8T cells that express TIA-1, GrB, and FasL between patients with plaque-stage MF, tumor-stage MF, and CD30PCLTCL was per- formed using the two-tailed Students t test. Univariate analysis of possible prognostic factors was performed using the log-rank test for categorical variables (stage) and Cox proportional regression analysis for continuous variables (percentage of CD8T cells, age). To assess independence of prognostic value, multivariate analysis was performed by entering the variables of interest in Cox proportional hazards regression analysis. Actuarial survival curves in MF were calculated from the time of the initial diagnostic biopsy until death from disease or end of follow-up using the Kaplan-Meier method. P values below .05 were considered statistically signicant. All analyses were performed using Statistical Products and Services Solutions Software (SPSS Inc, Chicago, IL).

RESULTS

Percentage of CD8CTLs in CTCL

The proportions of CD8CTLs in the MF and CD30- negative PCLTCL biopsy samples taken at the time of

diagnosis are presented in Table 2. Major differences were found between MF plaques and tumors. Percentages of 20%

or more CD8T cells were observed in 21 (50%) of 42 MF plaques but not in any of the 20 MF tumors. The median number of CD8T cells in MF was 17% (range, 2% to 50%). CD30PCLTCL showed low percentages of CD8

T cells, with a median value of 3% and less than 5% of

CD8T cells in 12 (55%) of 21 cases. The differences in the proportions of CD8T cells between plaque-stage and tumor-stage MF and tumor-stage MF and CD30PCLTCL

were statistically signicant (Students t test, P .0001 and P .018, respectively). The results of the proportions of CD8T cells in 27 MF biopsy samples obtained during follow-up are summarized

in

Table 3. Taken together, the percentages of CD8T cells

in

nine MF plaques (median, 22%; range, 15% to 27%) and

18 MF tumors (mean, 10%; range, 2% to 17%) were similar

to the percentages observed in plaques and tumors present at

the time of diagnosis. Interestingly, examination of plaques

in three MF patients who had concurrent tumors demon-

strated high percentages of CD8T cells in the plaques (median, 25%) compared with the concurrent tumors (me- dian, 10%; range, 7% to 15%).

Expression of Cytotoxic Proteins GrB, TIA-1, and FasL by CD8T Cells

Expression of GrB, TIA-1, and FasL was detected as a clear, granular, cytoplasmic staining in all cases. Because a reliable estimation of the percentages of CD8T cells that express cytotoxic proteins might be hampered by the fact that these proteins are expressed not only by CD8CTLs but also by the neoplastic T cells of some types of CTCL 28,29 and perhaps by rare reactive CD4T cells, 30 double-staining experiments for CD8 with GrB or CD8 with TIA-1 were rst performed in 10 cases, including four patients with MF plaques, four with MF tumors, and two with CD30PCLTCL. These experiments demonstrated that TIA-1 and GrB are not or are rarely expressed by inammatory cells other than CD8T cells (Fig 1).

Table 3. Percentages of CD8T Cells in 27 MF Biopsy Samples Obtained During Follow-Up

Initial Biopsy Samples

Type of Skin Lesion

No. of Patients

CD8T Cells (%)

Median

Range

Follow-Up Biopsy Samples

Type of Skin Lesion

No. of Patients

CD8T Cells (%)

Median

Range

Time Interval (months)

Range

Median

MF plaque

5*

19

15-50

MF plaque

6

20

15-25

12

3-36

MF plaque

9†

20

12-40

MF tumor

11

7

2-17

36

18-90

 

MF plaque

3‡

25

25-27

MF tumor

5

7

2-15

MF tumor

7

7

2-10

7

1-16

*Patients with plaque-stage MF who developed only new plaques during follow-up. †Patients with plaque-stage MF who showed disease progression to tumor-stage MF during follow-up. ‡MF plaques in patients with concurrent skin tumors.

55

Fig 1. Double staining demonstrates that expression of TIA-1 is limited to CD8 � T

Fig 1. Double staining demonstrates that expression of TIA-1 is limited to CD8T cells. Expression of TIA-1 (black dot) was observed on the majority of CD8T cells, indicated by the arrows, but not on CD8cells. Streptavi- din-biotin-peroxidase technique; hematoxylin counterstain; magnification,

400.

Moreover, because of the superior morphology in parafn sections, the differentiation between CD8T cells and neoplastic T cells was generally not difcult. Examination of serial sections stained for CD8, GrB, TIA-1, and FasL showed a similar topographic distribution for CD8T cells and TIA-1and/or GrBcells. In plaque-stage MF, tumor-stage MF, and CD30PCLTCL, most (60% to 90%) CD8T cells expressed TIA-1, whereas only a minority (generally less than 25%) of CD8T cells expressed GrB (Table 4; Fig 2). Staining for FasL showed granular intracytoplasmic staining in more then 50% of the CD8T cells in all but a few cases. Taken together, no signicant differences in the relative propor- tions of CD8T cells that express TIA-1, GrB, or FasL

were detected between MF plaques, MF tumors, and CD30PCLTCL.

Expression of KIR by CD8T Cells

To investigate whether the cytotoxic function of CD8T cells is possibly modulated by KIR, the expression of CD94, CD158a, and CD158b was studied. All antibodies demon- strated a membranous staining. CD94, CD158a, or CD158bcells comprised up to 5% of the total number of reactive cells. In all cases, the number of CD94cells was higher than the number of CD158bcells, which in turn outnumbered the CD158acells. No differences were observed in the number of reactive cells that expressed CD94, CD158a, and CD158b between MF plaques, MF tumors, and CD30PCLTCL. Double-staining experi- ments for CD56 or CD8 with CD94 demonstrated coexpres- sion of CD56 with CD94 in more than 95% of CD94cells, whereas colocalization of CD8 with CD94 was limited to a few scattered cells (Fig 3).

Correlation of CD8T Cells With Clinical Characteristics

Cox proportional hazards regression analysis in the total group of 62 MF patients demonstrated that survival in MF patients declined with lower numbers of CD8T cells (P

.001). Also, within tumor-stage MF, high numbers of CD8T cells correlated with an increased survival (P .003). In plaque-stage MF, the relation between the percent- ages of CD8T cells and survival did not reach signi- cance, although a trend was observed toward a better survival in patients with higher numbers of CD8T cells. Univariate analysis demonstrated that stage of disease (P .0004) and the percentage of CD8T cells (P .001) but not age (P .57) correlated with survival. Multivariate analysis showed that both stage of disease and the number

of CD8T cells were independent prognostic parameters.

The actuarial survival curves for all MF patients divided the

patients into two groups using the median number of CD8

T cells (17%) as the cutoff point (Fig 4).

Table 4. Expression of TIA-1, GrB, and FasL by CD8T cells in MF and CD30PCLTCL

 

TIA-1

GrB

FasL

Diagnosis

No. of Patients

��

��

��

MF plaque

40

0

5

35

17

20

3

0

2

38

MF tumor

17

0

1

16

4

11

2

0

0

17

CD30PCLTCL

16

0

0

16

1

11

4

0

0

16

NOTE. The expression of cytotoxic proteins by reactive cells is presented as a percentage of the number of CD8T cells. Abbreviations: , 10% positive CD8T cells; , 10%-50% positive CD8T cells; ��, 50% positive CD8T cells.

56

Fig 2. Expression of cytotoxic proteins by CD8 � T cells in an MF plaque.

Fig 2. Expression of cytotoxic proteins by CD8T cells in an MF plaque. Serial sections demonstrate (A) localization of inltrating CD8T cells and (B) TIA-1 expression by these cells. Inset: the granular staining of TIA-1positive cells. Streptavidin-biotin-peroxidase technique; hematoxylin counterstain; magnication, 400; inset, 1,000.

DISCUSSION

In the present study, the expression of cytotoxic proteins by CD8T cells and the relation between the percentages of CD8T cells and clinical behavior was studied in MF and CD30PCLTCL. We demonstrated that, in all types of CTCL, the large majority of CD8T cells expressed TIA-1 and FasL, whereas a minority was GrB positive. These results are consistent with the results of a previous study that demonstrated that the majority of CD8T cells expressed TIA-1 but not granzymes. 31 Similarly, the neo- plastic cells in CD8epidermotropic cytotoxic T-cell lymphomas, which may be considered the neoplastic equiv- alents of these reactive CD8cytotoxic T cells, also showed constant expression of TIA-1 but rarely expressed GrB or perforin. 32 With respect to the cytotoxic phenotype of these CD8T cells, in vitro studies demonstrated that, although TIA-1 is expressed on both resting and activated CTLs, 33 perforins and granzymes are only expressed after activation 34 and might therefore be a more reliable marker for activated

CTLs. Because TIA-1 was expressed by most CD8T cells

and GrB was expressed by only a minority of these cells (5% to 10%) in all groups studied, one may wonder whether these cells are functionally active CTLs. One possible explanation for the low GrB expression is that most CD8

T cells had already secreted their GrB as has been demon-

strated in skin biopsy samples of lichen planus. 35 Interest- ingly, recent studies of our group demonstrated that, in skin biopsy samples of lichen planus, lupus erythematosus, and

graft-versus-host disease, the majority of CD8T cells expressed TIA-1, whereas GrB was expressed by only a small number of these cells (unpublished data). Epidermal injury and apoptotic keratinocytes were a constant nding in

these biopsy samples, illustrating the presence of function- ally active CTLs. Thus, these ndings illustrated that the low expression of GrB compared with TIA-1 by the CD8

T cells in these CTCLs does not exclude the possibility that

they are functionally active CTLs directed at the neoplastic

T cells.

Tumor cells use various escape mechanisms to evade an effective antitumor response. Recent studies of our group

57

Fig 3. (A) Double stainings for CD56 (red) and CD94 (green) demonstrate a low proportion

Fig 3. (A) Double stainings for CD56 (red) and CD94 (green) demonstrate a low proportion of CD56/CD94 double-positive cells stained yellow. (B) On double staining for CD8 (red) and CD94 (green), no double-stained cells are observed. Immunouorescence technique; hematoxylin counterstain; mag- nication, 400.

demonstrated that the loss of Fas expression by the neoplastic cells in aggressive types of CTCL may be one of these mechanisms. 36 Another mechanism to evade the immune response may be the inhibition of cytolytic function through KIRs. Expression of KIRs was demonstrated on tumor-specic CD8CTLs in melanoma patients, and functional studies showed that tumor-specic lysis was inhibited by these KIRs. 37 Recent in vitro studies demonstrated the expression of functional KIRs on a CD8tumor-specic cytotoxic T-cell clone isolated from the peripheral blood of an MF patient. 19 Whether the in vitro expansion of T cells may lead to the induction of KIRs is presently unknown. In the present study, KIRs were expressed only by a few scattered NK cells but never or rarely by CD8T cells, which argues against a role for these KIRs in tumor progression in CTCL. Correlation of the percentages of CD8CTLs and clinical behavior in MF and CD30PCLTCL showed that the proportions of CD8CTLs were signicantly higher in MF plaques than in MF tumors, which in turn outnumbered the

MF plaques than in MF tumors, which in turn outnumbered the Fig 4. Actuarial survival of

Fig 4. Actuarial survival of patients with MF, plaque and tumor stage, stratied according to the median percentage of CD8T cells. Large numbers of CD8T cells correlate with a favorable prognosis in MF.

percentages of CD8T cells in CD30PCLTCL. The decline in the percentage of CD8CTLs was associated with a less favorable prognosis. Also, within tumor-stage MF, a relation between higher percentages of CD8CTLs and better survival was found. Multivariate analysis demonstrated that both skin stage and the proportion of CD8T cells were independent parameters of survival. Examination of 27 addi- tional follow-up skin biopsy samples of MF patients showed similar percentages of CD8CTLs in plaques and tumors when compared with plaques and tumors biopsied at the time of diagnosis. Interestingly, MF plaques in patients who had concurrent skin tumors contained considerable proportions of CD8CTLs (median, 25% v 10% in the concurrent tumors), as seen in MF patients with plaque lesions only. Taken together, these observations suggest that, in patients who have already progressed to tumor-stage MF, an effective antitumor response is still functioning in concurrent MF plaques that prevents tumor progression at those sites. Previous studies that address the relation between the proportions of CD8CTLs and clinical behavior in CTCL are few, have mainly been focused on MF, and have reached conicting conclusions. 8,9 Consistent with our results, Hoppe et al 9 also described a relation between high propor- tions of CD8CTLs and a better survival in MF. However, no statistically signicant difference in the percentage of CD8CTLs between MF plaques and tumors was found. In contrast, in a study by Vonderheid et al, 8 the percentages of CD8CTLs decreased from 11.9% to 6.4% to 3.8% in MF patches, plaques, and tumors, respectively, but no relation between the percentages of CD8CTLs and survival was found in this study. In the group of CD30PCLTCL, characterized by an extremely poor prognosis, low percentages of CD8CTLs (median, 3%) were found. Taken together, high proportions

58

of CD8CTLs were found in the patient group with a favorable prognosis (plaque-stage MF) and low proportions of CD8CTLs in groups with a poor prognosis (tumor- stage MF, CD30PCLTCL), which suggests that CD8CTLs play an important role in the antitumor immune response in CTCL. This notion is in line with earlier studies that demonstrated that malignant cells in MF express tumor-specic antigens that can be recognized by autolo- gous CD8CTLs in vitro. 4-6 In conclusion, we demonstrated that reactive CD8T cells in CTCL had the phenotype of partly activated

cytotoxic T cells (TIA-1, GrB/, FasL) but did not express KIRs. Moreover, we demonstrated that high per- centages of inltrating CD8CTLs were associated with a better prognosis. Taken together, these observations suggest that CD8CTLs could play an important role in the antitumor response in CTCL.

ACKNOWLEDGMENT

We thank Els de Vries and Wim Vos for their excellent technical assistance.

REFERENCES

1. Willemze R, Kerl H, Sterry W, et al: EORTC classication for

primary cutaneous lymphomas: A proposal from the Cutaneous Lym-

phoma Study Group of the European Organization for Research and Treatment of Cancer. Blood 90:354-371, 1997

2. van Doorn R, Van Haselen CW, van Voorst-Vader PC, et al:

Mycosis fungoides disease evolution and prognosis of 309 Dutch patients. Arch Dermatol 136:504-510, 2000

3. Rook AH, Yoo EK, Grossman DJ, et al: Use of biological

response modiers in the treatment of cutaneous T-cell lymphoma. Curr Opin Oncol 10:170-174, 1998

4. Berger CL, Wang N, Christensen I, et al: The immune response

to class I-associated tumor-specic cutaneous T-cell lymphoma anti-

gens. J Invest Dermatol 107:392-397, 1996

5. Berger CL, Longley BJ, Imaeda S, et al: Tumor-specic peptides

in cutaneous T-cell lymphoma: Association with class I major histo-

compatibility complex and possible derivation from the clonotypic T-cell receptor. Int J Cancer 76:304-311, 1998

6. Bagot M, Echchakir H, Mami-Chouaib F, et al: Isolation of

tumor-specic cytotoxic CD4and CD4CD8dimT-cell clones

inltrating a cutaneous T-cell lymphoma. Blood 11:4331-4341,

1998

Echchakir H, Bagot M, Dorothee G, et al: Cutaneous T-cell

lymphoma reactive CD4cytotoxic T lymphocyte clones display a

Th1 cytokine prole and use a fas-independent pathway for specic tumor cell lysis. J Invest Dermatol 115:74-80, 2000

8. Vonderheid EC, Tan E, Sobel EL, et al: Clinical implications of

immunologic phenotyping in cutaneous T-cell lymphoma. J Am Acad Dermatol 17:40-52, 1987

9. Hoppe RT, Medeiros LJ, Warnke R, et al: CD8-positive

tumor-inltrating lymphocytes inuence the long-term survival of patients with mycosis fungoides. J Am Acad Dermatol 32:448-453,

7.

1995

10.

Kagi D, Vignaux F, Ledermann B, et al: Fas and perforin

pathways as major mechanisms of T-cell-mediated cytotoxicity. Sci- ence 265:528-530, 1994

11. Peter ME, Krammer PH: Mechanisms of CD95 (APO-1/Fas)-

mediated apoptosis. Curr Opin Immunol 10:545-551, 1998

12. Anderson P, Nagler-Anderson C, OBrien C, et al: A monoclo-

nal antibody reactive with a 15-kDa cytoplasmic granule-associated protein denes a subpopulation of CD8T lymphocytes. J Immunol 144:574-582, 1990

13. Anderson P: TIA-1 structural and functional studies on a new

class of cytolytic effector molecule. Curr Top Microbiol Immunol 198:131-143, 1995

14. Grifths GM, Mueller C: Expression of perforin and granzymes

in vivo: Potential diagnostic markers for activated cytotoxic cells. Immunol Today 12:415-419, 1991

15. Krahenbuhl O, Rey C, Jenne D, et al: Characterization of

granzymes A and B isolated from granules of cloned human cytotoxic T lymphocytes. J Immunol 141:3471-3477, 1988

16. Moretta A, Sivori S, Vitale M, et al: Existence of both inhibitory

(p58) and activatory (p50) receptors for HLA-C molecules in human natural killer cells. J Exp Med 182:875-884, 1995

17. Moretta A, Vitale M, Sivori S, et al: Human natural killer cell

receptor for HLA-class I molecules: Evidence that the Kp43 (CD94)

molecule functions as a receptor for HLA-B allele. J Exp Med 180:545-555, 1994

18. Mingari MC, Schiavetti F, Ponte M, et al: Human CD8T

lymphocyte subsets that express HLA I-specic inhibitory receptors

represent oligoclonally or monoclonally expanded cell populations. Proc Nat Acad Science 93:12433-12438, 1996

19. Bagot M, Martinvallet H, Echchakir H, et al: Functional

inhibitory receptors expressed by a cutaneous T cell lymphoma- specic cytolytic clonal T cell population. J Invest Dermatal

115:994-999, 2000

20. Kummer JA, Kamp AM, van Katwijk M, et al: Production and

characterization of monoclonal antibodies raised against recombinant human granzymes A and B showing cross reactions with the natural proteins. J Immunol Methods 163:77-83, 1993

21. Kummer JA, Kamp AM, Tadema TM, et al: Localization and

identication of granzymes A- and B-expressing cells in normal human

lymphoid tissue and peripheral blood. Clin Exp Immunol 100:164-172,

1995

22.

Oudejans JJ, Kummer JA, Jiwa NM, et al: Granzyme B

expression in Reed-Sternberg cells of Hodgkins disease. Am J Pathol 148:233-240, 1996

23. Zoi-Toli O, Meijer CJLM, Oudejans JJ, et al: Prognostic

signicance of Fas and Fas-ligand expression in cutaneous B-cell

lymphomas. J Pathol 189:533-538, 1999

24. Oudejans JJ, Jiwa NM, Kummer JA, et al: Activated cytotoxic

T-cells as prognostic marker in Hodgkins disease. Blood 89:1376- 1382, 1997

25. Dukers DF, Vermeer MH, Jaspars LH, et al: Expression of killer

cell inhibitory receptors is restricted to true NK cell lymphomas and a

subset of intestinal enteropathy-type T cell lymphomas with a cytotoxic phenotype. J Clin Pathol 54:224-228, 2001

26. Raap AK, van der Corput MPC, Vervenne RAW, et al: Ultra-

sensitive FISH using peroxidase-mediated deposition of biotin or uorochrome tyramides. Hum Mol Genet 4:529-534, 1995

59

27. Dukers DF, ten Berge RL, Oudejans JJ, et al: A cytotoxic

phenotype does not predict clinical outcome in anaplastic large-cell lymphomas. J Clin Pathol 52:129-136, 1999

28. Vermeer MH, Geelen FAMJ, Kummer JA, et al: Expression of

cytotoxic proteins by neoplastic T cells in mycosis fungoides increases

with progression from plaque stage to tumor stage disease. Am J Pathol 154:1203-1210, 1999

29. Kummer JA, Vermeer MH, Dukers DF, et al: Most primary

cutaneous CD30 positive lymphoproliferative disorders have a CD4- positive cytotoxic T-cell phenotype. J Invest Dermatol 109:636-640, 1997

30. Hahn S, Gehri R, Erb P: Mechanism and biological signicance

of CD4-mediated cytotoxicity. Immunol Rev 146:57-79, 1995

31. Wood GS, Edinger A, Hoppe RT, et al: Mycosis fungoides skin

lesions contain CD8tumor-inltrating lymphocytes expressing an

activated: MHC-restricted cytotoxic T-lymphocyte phenotype. J Cutan Pathol 21:151-156, 1994

32. Berti E, Tomasini D, Vermeer MH, et al: Primary cutaneous

CD8-positive epidermotropic cytotoxic T-cell lymphomas: A distinc-

tive clinicopathological entity with an aggressive behavior. Am J Pathol 155:483-492, 1999

33. Podack ER: Execution and suicide: Cytotoxic T cells enforce

Draconian laws through separate molecular pathways. Curr Opin Immunol 7:11-16, 1995

34. Grifths GM: The cell biology of CTL killing. Curr Opin

Immunol 7:343-348, 1995

35. Shimizu M, Higaki T, Kawashima M: The role of granzyme

B-expressing CD8-positive T cells in apoptosis of keratinocytes in

lichen planus. Arch Dermatol Res 289:527-532, 1997

36. Zoi-Toli O, Vermeer MH, de Vries E, et al: Expression of Fas

and Fas-ligand in primary cutaneous T-cell lymphoma: Association between lack of Fas expression and aggressive types of CTCL. Br J Dermatol 143:313-319, 2000

37. Speiser DE, Pittet M, Valmori D, et al: In vivo expression of

natural killer cell inhibitory receptors by human melanoma-specic

cytolytic T lymphocytes. J Exp Med 190:775-782, 1999

60

Chapter 5

A novel splice variant of the Fas gene in patients with cutaneous T-cell lymphoma

Cancer Res. 2002 Oct. 1;62(19):5389-92

A Novel Splice Variant of the Fas Gene in Patients with Cutaneous T-Cell Lymphoma

Remco van Doorn, 1,2 Remco Dijkman, 1 Maarten H. Vermeer, Theo M. Starink, Rein Willemze, and Cornelis P. Tensen 3

Department of Dermatology, Vrije Universiteit Medical Center, 1081 HV Amsterdam, the Netherlands, and Department of Dermatology, Leiden University Medical Center, 2333 AL Leiden, the Netherlands

Abstract

Defective apoptosis signaling has been implicated in the pathogenesis of primary cutaneous T-cell lymphomas (CTCLs), a group of malignancies derived from skin-homing T cells. An important mediator of apoptosis in T cells is the Fas receptor. We identified a novel splice variant of the Fas gene that displays retention of intron 5 and encodes a dysfunctional Fas protein in 13 of 22 patients (59%) in both early and advanced CTCL. Impairment of Fas-induced apoptosis resulting from aberrant splicing potentially contributes to the development and progression of CTCL by allowing continued clonal expansion of activated T cells and by reducing susceptibility to antitumor immune responses.

Introduction

CTCLs 4 are a group of clinically heterogeneous malignancies of mature skin-homing T cells (1). The low mitosis index in the early stages of MF, the most common type of CTCL, and resistance to treatment with genotoxic agents suggest that defective apoptosis sig- naling plays a role in the pathogenesis of CTCL (2). One of the key regulators of apoptosis in mature T cells is Fas, a homotrimer cell surface receptor that mediates apoptosis upon cross-linking to Fas ligand. The Fas protein contains an intracellular region essential for transduction of the apoptotic signal termed the death domain; muta- tions in this domain dominantly interfere with Fas function (3, 4). Fas is a critical mediator of activation-induced cell death, a propriocidal mechanism involved in homeostasis of activated T cells (5). In addi- tion, Fas signaling renders neoplastic cells susceptible to antitumor immune responses executed by cytotoxic T cells through cross-linking with Fas ligand. We previously reported loss of Fas protein expression in aggressive types of CTCL (6). In non-Hodgkin’s lymphoma, del- eterious mutations of the Fas gene have been identified in 11% of patients (7). In the present study, we examined the occurrence of splice variants and mutations of the Fas gene as well as Fas protein expression in lesional skin biopsy specimens from patients with CTCL.

Materials and Methods

Lesional skin biopsy specimens were obtained from 15 patients with advanced CTCL, including 7 patients with tumor-stage MF (T 3 N 0 M 0 ) and

Received 7/23/02; accepted 8/19/02. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 R. v. D. and R. D. contributed equally to this study.

2 R. v. D. is supported by a grant from the Dutch foundation “De Drie Lichten.”

3 To whom requests for reprints should be addressed, at Department of Dermatology, Leiden University Medical Center, Wassenaarseweg 72, 2333 AL Leiden, the Nether- lands, Phone: 31-71-5271903; Fax: 31-71-5271910; E-mail:c.p.tensen@lumc.nl.

4 The abbreviations used are: CTCL, cutaneous T-cell lymphoma; MF, mycosis fungoides; PCLTCL, primary cutaneous large T-cell lymphoma.

63

8 patients with CD30PCLTCL. For the detection of splice variants in early CTCL, skin biopsy specimens from 7 patients with plaque-stage MF (T 2 N 0 M 0 ; Ref. 8) were obtained. Cultured keratinocytes, phytohemag- glutinin-activated CD4and CD8T cells, and skin biopsy specimens from patients with benign cutaneous lymphocytic infiltrates (atopic derma- titis, graft-versus-host-disease, and chronic discoid lupus erythematosus) were used as controls. Total cellular RNA was extracted from homogenized samples before treatment with RQ1 DNase (Promega, Madison, WI). cDNA synthesis was performed using Expand Reverse Transcriptase (Roche, Mannheim, Germany) after priming with an oligo(dT) 1218 primer (Invitrogen, Breda, the Netherlands). PCR amplification of cDNA was performed with five overlapping primer pairs (FAS I-V) covering the entire coding region of the Fas gene used previously (9) and an additional primer pair encompassing intron 5 (FAS intron: sense, 5TCAAGGAATGCA- CACTCACC 3; antisense, 5CCAAACAATTAGTGGAATTG 3). PCR was performed under the following conditions: denaturing for 30 s at 94°C; annealing for 60 s at 58°C for primer pairs I and II and at 50°C for primer pairs III, IV, and V, and intron 5; and extension for 60 s at 72°C; for 35 cycles. PCR products were separated by electrophoresis on a 2% agarose gel containing ethidium bromide and on a 12.5% acrylamide gel stained using PlusOne DNA Silver Staining Kit (Amersham Pharmacia, Uppsala, Sweden). PCR products were extracted from agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) for reampli- fication under identical conditions and direct sequence analysis using the dideoxy chain termination method. The presence of transmembrane helices was predicted using TMHMM version 2.0 software (CBS, Denmark). Snap-frozen skin biopsy specimens were stained with a monoclonal anti- body to Fas (Fas6 antibody; kindly provided by Dr. L. A. Aarden) as described previously (6).

Results and Discussion

In three of seven (43%) patients with tumor-stage MF and four of eight (50%) patients with CD30PCLTCL, an aberrantly spliced transcript of the Fas gene was identified that has not been described previously. Sequence analysis revealed that this splice variant displays selective retention of intron 5, a 152-bp sequence, leading to frameshift and formation of a truncated protein (Figs. 1 and 2). Aberrant splicing of Fas pre-mRNA was not due to splice site mutations because none were detected in intron 5 or in its boundaries. The presence of this particular splice variant was confirmed by using a different primer set designed to amplify the exonic sequences flanking intron 5 and cannot be due to contam- ination with genomic DNA because this would have generated a larger PCR product containing not only intron 5 but also intron 4. Subsequent examination of an additional group of seven patients with early patch/plaque-stage MF for this splice variant revealed that it was also present in six of seven (85%) patients. It could not be demonstrated in benign cutaneous lymphocytic infiltrates, ke- ratinocytes (Fig. 1A), or phytohemagglutinin-activated CD4and CD8T cells (data not shown). This indicates that the aberrant

Fig. 1. Detection and analysis of Fas transcripts. A, reverse transcription-PCR analysis of human Fas mRNA using primer pair FAS III. In addition to the expected PCR product of 240 bp, a second PCR product of 392 bp (indicated by the arrow) was detected. Input cDNA template was synthesized from RNA isolated from the following sources. A 1 :

Lane 1, H 2 O (no cDNA) control; Lane 2, cultured primary keratinocytes; Lanes 3, 5, 6, 7, 11, and 12, MF tumor-stage biopsies; Lanes 4, 8, 9, and 13–17, PCLTCL biopsies; Lane 10, benign lymphocytic skin infiltrate biopsy. A 2 : Lane 1, H 2 O (no cDNA) control; Lanes 2– 6, benign lymphocytic skin infil- trate biopsies; Lanes 7–13, patch/plaque-stage bi- opsies. Lane M, molecular size marker (Generuler; MBI Fermentas, St. Leon-Rot, Germany). B, se- quence analysis of reverse transcription-PCR prod- ucts of 240 and 392 bp demonstrating the wild-type transcript and the alternative transcript that exhibits retention of a 152-bp sequence corresponding to intron 5.

retention of a 152-bp sequence corresponding to intron 5. Fig. 2. Top, schematic representation of the
retention of a 152-bp sequence corresponding to intron 5. Fig. 2. Top, schematic representation of the

Fig. 2. Top, schematic representation of the FAS-encoding exons, the FAS protein, and amplified regions of FAS cDNA in this study. Bottom, location of retained intron found in cDNA synthesized from RNA isolated from CTCL biopsies and schematic representation of altered protein encoded by mRNA with retained intron 5. CRD, cysteine-rich domains; TM, transmembrane domain. Nucleotides are numbered starting with the ATG encoding the initiating methionine as 1 (taken from GenBank accession number M67454).

64

Table 1 Clinical features, Fas mutations and alternative transcripts, and Fas protein expression of 15 patients with advanced CTCL

 

Fas protein

Patient no.