Vous êtes sur la page 1sur 66

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/279537440

MEMOIRE DEA BIOTECHNOLOGIE MICROBIENNE ET CELLULAIRE

Research · July 2015


DOI: 10.13140/RG.2.1.3009.6487

CITATIONS READS

0 5,690

1 author:

Georgette N. Kiethega
Université de Montréal
5 PUBLICATIONS   75 CITATIONS   

SEE PROFILE

All content following this page was uploaded by Georgette N. Kiethega on 03 July 2015.

The user has requested enhancement of the downloaded file.


Préface du Président du RA-BIOTECH.
L’école Doctorale régionale de Ouagadougou offre une formation doctorale de biotechnologie dans les
options : Biotechnologie microbienne et cellulaire, Biotechnologie Animale et Biotechnologie végétale.
Elle regroupe la plupart des Universités de l’Afrique francophone sub-saharienne en un réseau : le Réseau
Ouest Africain de Biotechnologie (RA-BIOTECH) fruit de la coopération inter-universitaire et dont le siège est
au CRSBAN, à l’Université de Ouagadougou.
Les Universités et structures de formation des pays ci-dessous constituent les membres fondateurs de ce réseau :
Bénin, Burkina Faso, Côte d’Ivoire, Guinée-Conakry, Mali, Niger, Togo et d’autres partenaires comme le Centre
International de Recherche Développement sur l’Elevage en zone Sub-humide (CIRDES)-Bobo Dioulasso ;
EISMV-Sénégal.
Ce réseau sous régional bénéficie de l’appui de plusieurs partenaires de l’enseignement supérieur
(Association des Universités Africaines -AUA, UNESCO, Banque Mondiale, CAMES, Agence Universitaire
de la Francophonie -AUF, Agence Africaine de Biotechnologie -AAB, etc).
L’école Doctorale que le réseau anime assure une formation de haut niveau à travers une recherche
utilitaire sur plusieurs thématiques touchant la vie quotidienne des populations africaines. Cette école a permis
au CRSBAN d’être érigé en pôle régional d’excellence en Biotechnologie d’une part par l’AUA et d’autre part
par l’AUF. Elle accueille des étudiants de plus de 14 pays d’Afrique centrale de l’Ouest.
Le réseau bénéficie aussi du soutien de certains spécialistes des biotechnologies des universités du Nord :
Université de la méditerranée (France), Université Louis Pasteur de Strasbourg (France), Centre de Génétique
Moléculaire de Gif-sur-Yvette-CNRS (Paris France), Université de liège (Belgique) ; Faculté Universitaire de
Gembloux (Belgique), Université de Rome, Université Agronomique de Wagenningen.
L'importance des biotechnologies dans la résolution des problèmes de développement socioéconomiques des
pays de l’Afrique sub-saharienne (Alimentation, Santé, Environnement, etc.) Justifie amplement la mise en place
de cette formation. Elle est cogérée par un comité pédagogique international africain, constitué par des
enseignants, des chercheurs, tous spécialistes dans les divers domaines des biotechnologies.
La mutualisation des expériences par toutes ces compétences est un atout majeur pour la formation des
ressources humaines de qualité au profit du continent africain et de l’humanité.

Pr. Alfred S TRAORE


Professeur titulaire de Biochimie Microbiologie
CRSBAN/UFR-SVT/Université Ouagadougou

1
Dédicace
Je dédie ce travail à feues Marie Françoise Ilboudo et Sawadogo Fatimata,

Aux parents, amis et enseignants qui m’ont apportés leur soutien.

Fragile est l’arc -en- ciel.

Ne le laisse pas disparaître,

Sans avoir contemplé ses promesses,

Les rêves fous qu’il dessine.

Saisis ta chance et crois en l’arc-en-ciel.

2
Remerciements

Je remercie le C.R.S.B.A.N. (Centre de Recherche en Sciences Biologiques,


Alimentaires et Nutritionnelles), le RABIOTECH (Réseau Africain de Biotechnologie), le
S.A.A.C. (Service de Coopération et d’Action Culturelle) de l’Ambassade de France au
Burkina Faso, le P.A.E. Sup (Projet d’Appui à l’Enseignement Supérieur), l’Université d’Aix-
Marseille II et l’I.M.T.S.S.A (Institut de Médecine Tropicale du Service de Santé des
Armées).

Mes sincères remerciements :


Au Pr Alfred S. TRAORE Directeur du C.R.S.B.A.N mon Directeur de mémoire,
Au Pr Aboubacar S.OUATTARA, au Pr Augustin BERE, au Dr Yves TRAORE, au Dr
Cheick OUATTARA, au Dr Nicolas BARRO, au Dr Souleymane SANOU , au Père Jacques
Simporé.
Au Pr Francis FUMOUX de l’Université Aix-Marseille II,
Au Pr Daniel PAYOT chef du projet P.A.E. Sup.

Ce travail a été effectué à l’I.M.T.S.S.A dans le laboratoire de Biologie Moléculaire de


l’Unité de Parasitologie dirigée par le Médecin en Chef Daniel PARZY. Je lui adresse mes
sincères remerciements pour m’avoir accueillie dans son laboratoire et avoir dirigé ces
travaux de recherche.
Je tiens à remercier particulièrement Madame Marylin MADAMET pour son
dévouement, sa disponibilité constante tout au long de ce stage.
A toutes les personnes de l’Unité pour l’atmosphère agréable, les conseils et les
encouragements.

Nous remercions les membres du jury pour avoir accepté de juger ce travail.

3
Présentation de L’I.M.T.S.S.A.

L’I.M.T.S.S.A. (Institut de Médecine Tropicale du Service de Santé des Armées) est


situé à Marseille et comprend trois unités de recherches spécialisées et un département
d’épidémiologie et de santé publique.

 L’unité de Parasitologie dont l’activité se développe sur 2 axes :


- la prophylaxie du paludisme dans les forces armées, d’une part par le renseignement
épidémiologique dans le domaine de la chimio sensibilité de Plasmodium falciparum (test in
vitro et techniques de biologie moléculaire), d’autre part par l’étude de l’observance de la
chimioprophylaxie et de son efficacité.
- l’évaluation de nouvelles molécules anti-parasitaires, la caractérisation des voies
métaboliques du parasite et le mécanisme physio-pathogénique du paludisme grave.

 L’unité de Virologie tropicale orientée selon 2 axes :


-le renseignement épidémiologique et l’impact des viroses tropicales dans les forces armées
(dengue et autres arboviroses).
- la production et la caractérisation des protéines du virus de la dengue ayant des activités
critiques dans la réplication virale et pouvant constituer des cibles thérapeutiques et l’étude
des mécanismes engendrant une dengue grave.

 L’unité du Méningocoque (centre collaborateur OMS de référence et de recherches sur


le méningocoque) met au point des techniques de biologie

4
moléculaire pour la caractérisation des souches, techniques utilisables pour tester
l’efficacité du nouveau vaccin anti-méningococcique A+C couplé à l’anatoxine
diphtérique.
L’I.M.T.S.S.A. accueille régulièrement des étudiants étudiants pour des stages de Maîtrise,
de DEA et de Thèse de doctorat.

5
Sommaire

Présentation de l’I.M.T.S.S.A…………………………………………………………..Page 4
1. Introduction…………………………………………………………………………. Page 10
2. Revue bibliographique……………………………………………………………….Page 11
2.1. Epidémiologie du paludisme………………………………………………………Page12
2.2 Taxonomie et génome……………………………………………………………...Page12
2.3. Cycle de développement de Plasmodium falciparum……………………………...Page13
2.3.1. Cycle chez l’anophèle ou développement sporogonique………………………...Page13
2.3.2. Cycle chez l’homme………………………………………………………….. …Page 14
2.3.3. Cycle sanguin sexué ou gamétocytogénèse ………………………………….. ...Page 15
2.4. Protéines de la gamétocytogénèse et leurs fonctions………………………………Page16
2.4.1. Le gène pf11-1……………………………………………………………………Page 16
2.4.2. Le gène pfs16…………………………………………………………………….Page 17
2.4.3. Le gène pfg27/25………………………………………………………………....Page 17
2.4.4. Les protéines Pfs48/45 et Pfs230 ………………………………………. ………Page 17
2.4.5. Le gène pfs77………………………………………………………………….. ..Page 17
2.4.6. Le gène pfg377 …………………………………………………………………..Page 18
2.4.7. La protéine -tubuline II………………………………………………………... Page 18
3. Matériel et Méthodes……………………………………………………………. …..Page 21
3.1. Matériel…………………………………………………………………………….Page 21
3.2. Méthodes ………………………………………………………………………. …Page 21
3.2.1. Préparation des inserts……………………………………………………………Page 21
3.2.1.1. Extraction d’ADN génomique de Plasmodium falciparum 3D7………………Page 21
3.2.1.2. PCR spécifique de pfs16 et pfg27/25……………………………………….. ...Page 21
3.2.1.3. Purification du produit PCR ………………………………………………… ..Page 22
3.2.1.4. Migration des amplicons……………………………………………………… Page 22
3.2.1.5.Clonage des gènes pfs16 et pfg27/25 dans le vecteur d’expression eucaryote
pIZ/V5-His……………………………………………………………………………..Page 22
3.2.1.6. Transformation d’E. coli JM109 …………………………………………….. Page 23
3.2.1.7. Criblage des clones bactériens recombinants par PCR ………………………..Page 23
3.2.1.8. Amplification et purification du vecteur recombinant dans E. coli JM109…...Page 23
3.2.1.9. Vérification des inserts par séquençage………………………………………..Page 24

6
3.2.1.10. Amplification et purification du vecteur recombinant dans E. coli JM109… Page 24
3.2.2 .Culture de cellules MimicTM……………………………………………………...Page 25
3.2.2.1. Mise en culture des cellules MimicTM………………………………………… .Page 25
3.2.2.2. Test de sensibilité à la zéocine ……………………………………………….. Page 25
3.2.2.3. Transfection stable des cellules MimicTM…………………………………….. Page 26
3.2.2.4. Clonage des cellules MimicTM transfectées………………………………….. ..Page 26
3.2.3 Contrôle de l’expression des cellules MimicTM transfectées……………………..Page 27
3.2.3.1. Vérification par PCR spécifique de l’intégration des gènes pfs16 et pfg27/25. Page 27
3.2.3.2. Analyse de l’expression des protéines sur gel de polyacrylamide……………. Page 27
3.2.3.3. Analyse de l’expression des protéines sur le bio analyseur…………………. Page 28
3.2.3.4. Purification de Pfg27/25 et Pfs16 par F.P.L.C ……………………………. . ..Page 28
4. Résultats et Discussion ………………………………………………………….. ... .Page 30
4.1. Amplification des gènes codant pour les protéines Pfs16 et Pfg27/25 par PCR spécifique
à partir de l’ADN 3D7 de Plasmodium falciparum…………………………………… Page 31
4.2. Clonage des gènes pfs16 et pfg27/25 dans le vecteur d’expression eucaryote
pIZ/V5-His…………………………………………………………………………. …Page 32
4.3. Séquençage des gènes pfs16C-His, pfs16N-His, pfg27/25C-His et
pfg27/25N-His …………………………………………………………………….. …..Page 33
4.4. Expression des protéines recombinantes Pfs16 et Pfg27/25 dans
les cellules Mimic transfectées…………………………………………………… ….. Page 34
4.4.1. Amplification par PCR spécifique des gènes pfs16 et pfg27/25 dans
l’ADNg des cellules transfectées…………………………………………………….….Page 34
4.4.2. Résultats obtenus sur gel de polyacrylamide………………………………….. ..Page 35
4.4.3. Résultats obtenus sur le bio analyseur…………………………………………... Page 36
4.4.4. Purification de Pfs16 et Pfg27/25 par F.P.L.C…………………………………...Page 37
6. Conclusion et Perspectives ……………………………………………………….. ..Page 40

Références bibliographiques……………………………………………………………Page 42

Annexes …………………………………………………………………………….…..Page 48

7
Abréviations

ADN : Acide DésoxyriboNucléique


pb : paire de base
Mb : Mégabase
kDa : kilo Dalton
PCR : Polymerase Chain Réaction
dNTPs : désoxyNucléotidesTriPhosphates
ddNTPs :didésoxyNucléotides TriPhoshates
ROX : 6-carboxy-X-Rhodamine
R6G : 2-[6 (ethylamino) –3- (ethylimino-2,7-dimethyl –3H-xanthen-9-yl] –benzoic acid
ethyester,chloride
R110 : Rhodamine 110
TAMRA : carboxyl- Tétra Méthyl RhodAmine
DMSO : Di-Méthyl Sulfoxide
FBS: Foetal Bovine Serum
TAE : Tris-Acétate-EDTA
PBS : Phosphate Buffered Saline
BET : Bromure d’Ethidium
EDTA : Ethylène Diamino-Tétra Acétate
TEMED : N ,N, N ‘, N’-Tétra Méthyl Ethylène Diamine
SDS : Dodécyl Sulfate de Sodium
CAT : Chloramphenicol Acétyl Transférase
DTT : DiThioThréitiol
6xHis : His-His-His-His-His-His
LB : Luria Bertani
TBS-T : Tris-Buffered-Saline Tween 20
DDT : dichlorodiphenyl trichloroethane
HCH : gamma hexa chlorocyclohexane
UV : ultra violet
DS : Destaining solution
rpm : rotation par minute

8
Introduction

9
1. Introduction
Le paludisme est la maladie parasitaire la plus répandue dans le monde. Il cause 300 à
500 millions de cas cliniques et est responsable de 2 à 3 millions de victimes par an surtout
des enfants de moins de 5 ans (OMS, 2000) .C’est une des plus grandes maladies infectieuses
dans le monde tout comme le SIDA et la tuberculose.
Des quatre espèces de Plasmodium infectant l’homme (P. falciparum, P. vivax, P.
malariae, P. ovale), Plasmodium falciparum est la seule mortelle et responsable de la quasi-
totalité des décès. Le paludisme sévit essentiellement en Afrique Subsaharienne, ainsi que
dans certaines régions de l’Amérique du sud, de l’Asie orientale et de l’Océanie. Les
infections persistantes et récurrentes de P. falciparum sont dues à sa capacité à développer
une importante variation antigénique en plus de son polymorphisme génétique.
Son incidence due à sa résistance aux antipaludiques majeurs, l’échec des moyens de
luttes anti-vectoriels du à la résistance des vecteurs de P. falciparum aux différents
insecticides orientent la recherche vers de nouvelles cibles thérapeutiques(Wernsdorfer et al.
, 2003). Le séquençage du génome de la souche 3D7 de P. falciparum (Gardner et al., 2002),
le développement de technologies de transfections stables (Crabb et al., 1997; Skinner-
Adams., 2003) procurent l’opportunité d’exprimer des gènes de P. falciparum et facilitent les
différentes approches chimio-prophylactiques ou vaccinales.
Le principal objectif de cette étude est d’exprimer deux protéines de la
gamétocytogénèse de P. falciparum Pfs16 et Pfg27/25 qui apparaissent 30 heures après
invasion des érythrocytes par les mérozoïtes quand les jeunes gamétocytes ne sont pas encore
morphologiquement différentiables (Lobo et al., 1994 ;Dechering et al., 1997). Il s’agit donc
de cloner les deux gènes pfs16 et pfg27/25 dans un plasmide d’expression eucaryote pIZ/V5-
His. Le système d’expression permet d’exprimer des protéines recombinantes avec une
étiquette 6xHis dans des cellules d’insectes MimicTM.
Les protéines recombinantes obtenues seront purifiées et utilisées pour produire des

anticorps monoclonaux anti-Pfs16 et anti-Pfg27/25. Ces anticorps seront par la suite utilisés

comme traceurs des stades précoces de la gamétocytogénèse dans l’étude des mécanismes

biologiques régulant le cycle de développement de P. falciparum.

Ils permettront ainsi l’identification d’un stade précis de la gamétocytogénèse.

10
Revue bibliographique

11
2 .1. Epidémiologie du paludisme
Le paludisme sévit dans plus de 100 pays (figure 1) et 90% des malades se retrouvent
en Afrique sub –tropicale.

Figure 1 : Répartition du paludisme dans le monde

2.2.Taxonomie et génome
P. falciparum est un microorganisme unicellulaire appartenant à l’embranchement des
Eucharyota, à l’ordre des Apicomplexa, à la famille des Hemosporidae et au genre
Plasmodium. Son génome d’une taille d’environ 24 Mb est réparti sur 14 chromosomes et
est constitué d’environ 5300 gènes. Ces 5300 gènes codent pour une multitude de protéines
(Lasonder et al., 2002; Florens et al., 2002) dont les fonctions demeurent inconnues pour
nombre d’entre elles.

2.3. Cycle de développement de Plasmodium falciparum


Le cycle de développement de P. falciparum (figure 2) fait appel à un hôte
intermédiaire : l’homme et un hôte définitif : l’anophèle femelle.

12
Figure 2 : Cycle de développement de Plasmodium falciparum

2.3.1. Cycle chez l’anophèle ou développement sporogonique

Lors d’un repas sanguin sur un individu infecté, l’anophèle femelle ingère des
gamétocytes mâles et femelles. Ceux-ci parviennent dans l’estomac du moustique et se
transforment en gamètes. Les micro-gamètes mâles subissent un processus d’ex-flagellation à
la suite duquel les gamètes femelles ou macro-gamètes sont fécondés. Il en résulte un zygote
qui se transforme en une forme allongée mobile appelé ookinète. Celui-ci s’implante sous la
paroi stomacale en formant l’oocyste sphérique au sein duquel s’effectuent plusieurs mitoses.
L’oocyste mûr éclate et libère dans l’hémolymphe les sporozoïtes, éléments mobiles et
haploïdes qui passeront ensuite au niveau des glandes salivaires. Les sporozoïtes seront
injectés avec la salive lors d’une piqûre infestante.

13
2.3.2. Cycle chez l’homme
2.3.2.1. Cycle exo-érythrocytaire
Les sporozoïtes injectés transitent dans la circulation sanguine et envahissent très vite
les hépatocytes. Ils vont se transformer en masses multi nucléées appelés schizontes. Ces
derniers une fois mûrs éclatent et libèrent de nombreux mérozoïtes qui envahissent les
érythrocytes
2.3.2.2. Cycle intra -érythrocytaire
Dans l’érythrocyte, les mérozoïtes se différencient en anneau puis en trophozoïtes. Les
trophozoïtes donneront naissance aux schizontes qui éclatent pour libérer de nombreux
mérozoïtes qui rapidement réinfectent des érythrocytes sains et le cycle continue : c’est le
cycle sanguin asexué.

2.3.3. Le cycle sanguin sexué ou gamétocytogénèse


Il s’agit d’un processus spontané qui accompagne une infection palustre et nécessite
le passage régulier d’un hôte intermédiaire à un hôte définitif.
Cependant, toutes modifications environnementales occasionnant une situation de
stress pour les formes asexués circulantes peuvent être à l’origine d’une forte poussée
gamétocytaire. Les facteurs de risque de la gamétocytogénèse sont variés : les fortes charges
parasitaires asexuées (Robert et al., 2003), les traitements à doses sub-curatives (Buckling et
al., 1999) et l’anémie (Von Seidlen et al., 2001). Les traitements avec certains antipaludiques
à action lente comme le Proguanil ou la Pyriméthamine ou l’association Sulfadoxine et
Pyriméthamine (Sokhna et al., 2001) et le retard dans le traitement du paludisme favorisent
également la gamétocytogénèse.
En culture, la gamétocytogénèse s’étale sur 10 jours à 14 jours et comprend 5 stades
(Kariuki et al., 1998; J.L. Williams., 1999) :

 Stade I : Les gamétocytes à ce stade (figure 3) ne sont pas intrinsèquement


différents des jeunes trophozoïtes.

14
Figure 3 : jeunes trophozoites

Stade II : Il apparaît au 4ème jour de culture et les gamétocytes ressemblent à


des flocons d’avoine ( figure 4).

Figure 4 : gamétocytes au stade II

 Stade III : A ce stade (figure 5), les gamétocytes sont en forme de sphère
segmentée généralement au 7ème jour de culture. La différenciation en gamétocytes mâle et
femelle a lieu avec l’apparition de protéines sexuelles Pfg377, Pfs77 et l' tubuline II
(Severini et al. , 1999). On peut noter à ce stade, la présence de nombreux ribosomes et de
vésicules endoplasmiques chez le gamétocyte femelle.

Figure 5 : gamétocytes de stade III

15
 Stade IV : Au 10ème jour de culture (figure 6), les gamétocytes sont
fusiformes et orientés vers les pôles de la cellule.

Figure 6 : gamétocytes fusiformes

 Stade V : Les gamétocytes apparaissent sous forme de croissant de lune


(figure 7) vers le 14ème jour de culture. Ils sont visibles dans la circulation sanguine
périphérique et sont infectants pour l’anophèle. Le pourcentage de gamétocytes femelles est
supérieur à celui des gamétocytes mâles (Smith et al., 2000).

Figure 7 : gamétocytes de stade V.

2.4 .Protéines de la gamétocytogénèse et leurs fonctions


La gamétocytogénèse est marquée par la synthèse de protéines spécifiques telles que
Pf11-1, Pfs16, Pfg27/25, Pfs48/45, Pfs77, Pfg377 et Pfs230.
2.4.1. Le gène pf11-1
Le gène pf11-1 est transitoirement exposé sur la membrane de la vacuole
parasitophore à l’intérieur de l’érythrocyte parasité par des gamétocytes (Feng et al., 1993).
Il code une énorme protéine de 2400 kDa présente dès le stade I du gamétocyte. Elle
joue un rôle dans la rupture de l’hématie hôte et dans la gamétogenèse (Sherf et al., 1992).

16
2.4.2. Le gène pfs16
Le gène pfs16 est localisé sur le chromosome 4 du génome de P. falciparum (NF54).
Il est constitué de 641pb (Accession Number : M64705) codant une protéine de 16,6 kDa
localisée sur la membrane de la vacuole parasitophore (Moelans et al., 1991; Baker et al.,
1994; Bruce et al., 1994). Elle apparaît très tôt au cours de la gamétocytogénèse aux stades I
et II. C’est le premier marqueur du début de la gamétocytogénèse, le signal de la
différenciation sexuée (Bruce et al., 1994; Dechering et al., 1997 ; Dechering et al.,1999 ;
Niederwieser et al., 2000). Cette protéine n’est pas indispensable à la transcription des autres
protéines de la gamétocytogénèse mais joue un rôle dans la différenciation en gamétocytes
mâle et femelle et dans la production des gamétocytes (Kongkasuriyachai et al., 2004).
2.4.3. Le gène pfg27/25
Le gène pfg27/25 est localisé dans la région sub-télomérique du chromosome 13 de la
souche 3D7 de P. falciparum (Sharma et al., 2003 ; Sallicandro et al., 2000). Il est constitué
de 2108 pb (Accession Number : X84904) codant une protéine de 217 acides aminés.
Pfg27/25 est une protéine cytoplasmique très hydrophile de 27 kDa ( Alano et al., 1991). Sa
transcription apparaît aux stades I et II et disparaît dans les derniers stades de la
gamétocytogénèse (Lobo et al., 1994). Elle joue un rôle important dans la maturation des
gamétocytes (Laura G .Pologe., 1994; Alano et al.,1995b ; Alano et al., 1996; Lobo et al.,
1999).
2.4.4. Les protéines Pfs48/45 et Pfs230
Pfs48/45 et Pfs230 sont deux protéines exprimées dans les derniers stades de la
gamétocytogénèse et chez le gamète. Les gènes codant ces deux protéines sont situés
respectivement sur les chromosomes 13 et 2 de la souche 3D7 de P. falciparum.
Pfs48/45 est une protéine membranaire de 45/48 kDa, essentielle à la fertilité des
gamètes (Kocken et al., 1993; Van Dijk et al., 2001).
La lyse in vitro de gamètes de P. falciparum, dépendante du système du complément
serait liée à la présence d’anticorps anti-Pfs230 (Healer et al., 1997).
2.4.5. Le gène pfs77
Le gène pfs77 est localisé au niveau du chromosome 6 de P . falciparum (Souche
3D7A); il est constitué de 2157 pb codant une protéine hydrophile de 77 kDa présente
uniquement chez le gamétocyte femelle (Baker et al., 1995).

17
2.4.6. Le gène pfg377
Le gène pfg377 localisé sur le chromosome 12 de P . falciparum (Souche 3D7) code
une protéine de 377 kDa, très hydrophile spécifique du gamétocyte femelle et qui est
exprimée dans les derniers stades de la gamétocytogénèse (Alano et al., 1995a; Severini et
al., 1999; Menegon et al., 2000). Elle joue un rôle dans la rupture de l’érythrocyte au cours de
la maturation des gamétocytes chez le moustique.
2.4.7. La protéine -tubuline II
L’-tubuline II est une protéine spécifique au gamétocyte mâle (Rawlings et al., 1992;
Guinnet et al., 1996) exprimée dès le stade III de la gamétocytogénèse. Elle se trouve au
niveau de l’axonème, ce qui suggère un rôle dans l’ex-flagellation et dans la mobilité du
parasite.

18
Matériel et Méthodes

19
Nous avons utilisée pour cette étude la démarche suivante (ci-dessous) :

Démarche utilisée pour la production des protéines recombinantes


Pfg 27/25 et Pfs16.

1. Préparation des amorces 2.Extraction de l’ ADN 3D7 de P . falciparum.

3. Amplification des gènes pfg27/25 et pfs16 par PCR .

4. Purification des amplicons et migration sur gel d’agarose.

5. Clonage des gènes pfg27/25 et pfs16 dans le vecteur d’expression pIZ/V5-His.

6. Transformation des bactéries E. coli JM109 avec les plasmides recombinants.

7. Criblage des clones bactériens recombinants.

8. Amplification et purification du vecteur recombinant dans les bactéries


E. coli JM109 (miniprep).

9. Séquençage des inserts.

10. Amplification et purification du vecteur recombinant dans les bactéries


E. coli JM109 (midiprep).

11. Culture des cellules Mimic TM 12.Transfection stable des cellules MimicTM.

13. Clonage des cellules MimicTM transfectées.

14. Contrôle de l’expression des cellules MimicTM transfectées.

15. Purification des protéines Pfg27/25 et Pfs16.

20
3. Matériel et Méthodes

3.1. Matériel
Le matériel biologique utilisé est le suivant : sang parasité, souche 3D7 de P. falciparum,
cellules d’insectes MimicTM, cellules d’E. coli JM109.

3.2. Méthodes

3.2.1. Préparation des inserts

3.2.1.1. Extraction d’ADN génomique de Plasmodium falciparum 3D7

Pour extraire l’ADNg de la souche 3D7 P. falciparum, une culture d’hématies avec
une parasitémie d’environ 2 à 4 % a été utilisée suivant le protocole du kit « E.Z.N.A.® Blood
DNA Kit » d’Omega Bio-tek et l’ADN g obtenu est conservé à –20°C.

3.2.1.2. PCR spécifique de pfs16 et pfg27/25

La PCR a pour but d’amplifier in vitro les deux gènes d’intérêt. Deux couples
d’amorces spécifiques ont été utilisés pour chaque gène. Ils ont été choisis selon les critères
suivants et synthétisés pour les besoins de l’étude :
- présence du site de restriction de HindIII ou EcoRI ,
- posséder un ATG au sein de la séquence d’initiation de la transcription Kosak, pour une
meilleure transcription des gènes pfs16 et pfg27/25 dans le plasmide.
- encadrer toute la séquence codante de chaque gène,
- présence d’une étiquette 6xHis en C ou en N terminal.
Les gènes pfs16 et pfg27/25 ont été amplifié selon le programme suivant:

- Dénaturation initiale : 94°C 5 mn


- 35 cycles de 3 étapes comprenant : dénaturation 94°C 30 s.

hybridation 54°C 30 s.

élongation 72°C 40 s.

- Elongation finale : 72°C 7 mn

21
3.2.1.3. Purification du produit de PCR

Le kit de purification de Roche « High Pure PCR Product Purification » a été utilisé
pour purifier les amplicons et l’ADN pure est déposé sur gel d’agarose .

3.2.1.4. Migration des amplicons sur gel d’agarose

La migration sur gel a pour but de visualiser le résultat de la PCR, de quantifier l’ADN
et de déterminer la taille de l’amplicon en paire de bases en utilisant pour référence le
marqueur de taille « Smart Ladder » d’Eurogentec. Un gel agarose à 1% est utilisé dans du
tampon TAE 1X. La révélation au BET se fait dans une chambre UV .

3.2.1.5. Clonage des gènes pfs16 et pfg27/25 dans le vecteur d’expression


pIZ/V5-His

Le plasmide pIZ/V5-His est un plasmide recombinant de 2876 paires de bases. Il


possède un promoteur OpIE2 qui permet l’expression constitutive du gène d’intérêt
(Theilmann and Stewart, 1992), un site multiple de clonage et le gène de résistance à la
zéocine, un antibiotique utilisé pour sélectionner les clones recombinants (Hegedus et al.,
1998; Pfeifer et al., 1997) . Une étiquette 6xHis permet d’identifier et de purifier la protéine
recombinante par chromatographie d’affinité sur résine Nickel.

Figure 8 : Plasmide pIZ/V5-His

22
3.2.1.5.1. Réaction de digestion

Les enzymes de restriction HindIII et EcoRI sont utilisées pour digérer le plasmide
pIZ/V5-His et les amplicons : pfs16-NHis , pfs16-CHis , pfg27/25-NHis , pfg27/25-CHis. Les
produits digérés sont purifiés sur colonne Roche à partir du kit « High Pure PCR » et
quantifiés sur gel agarose 1% en présence du marqueur de taille « Smart Ladder ».

3.2.1.5.2. Réaction de ligation


Elle consiste à liguer les différents inserts dans le plasmide pIZ/V5-His. La réaction de
ligation se fait en tenant compte du ratio vecteur/insert = 3/1. Le kit de ligation rapide de
Roche a été utilisé et les plasmides recombinants obtenus sont utilisés pour transformer des
bacréries E. coli JM109.

3.2.1.6. Transformation des E.coli JM109 compétentes par les vecteurs


recombinants

Les plasmides recombinants ( pIZ/V5-Hispfg27/25-CHis, pIZ/V5-Hispfg27/25-NHis,


pIZ/V5-Hispfs16-CHis et pIZ/V5-Hispfs16-Chis) sont introduits par choc thermique dans des
bactéries E.coli JM109. Les E.coli JM109 recombinants obtenus sont étalées sur des boîtes de
culture LB Low Salt-Agar supplémenté de la zéocine à 40 µg/mL .

3.2.1.7. Criblage des clones bactériens recombinants par PCR

Le criblage correspond à la recherche des clones contenant les plasmides recombinants


d’intérêts. En effet même après sélection, les clones obtenus sont disparates. Il faut donc
identifier les clones transformés par un vecteur avec un insert des clones transformés par un
vecteur sans insert religué sur lui-même. La réaction d’amplification se fait selon le
programme décrit au paragraphe 3.2.3.2.

3.2.1.8. Amplification et purification du vecteur recombinant dans les E.coli


JM109

Les clones de cellules E.coli recombinants positifs sont mis en culture dans du milieu
LB Low salt supplémenté de zéocine à 40 µg / mL, toute la nuit à 37°C sous agitation. Les
cultures d’une nuit sont purifiées en utilisant la méthode par centrifugation du Kit
« Wizard®Plus SV Minipreps DNA Purification System » de Promega .

23
3.2.1.9.Vérification des inserts par séquençage

Nous avons utilisé le kit ABI PRISM® BigDyeTM Terminator Cycle Sequencing Ready
Reaction de Applied Biosystems pour le séquençage de l’ADN plasmidique. La méthode
utilisée est une variante de la technique de séquençage de Sanger. En effet le réactif de
séquençage utilisé contient :
- des ddNTP couplés à quatre fluorochromes différents dérivant de dichloro-
rhodamine (A-Dye Terminator [R6G], C-Dye Terminator [ROX] , G-Dye Terminator
[R110], T-Dye Terminator [TAMRA] ).
- des dNTPs (dATP, dCTP, dITP, dUTP )
- du MgCl2+
-du tampon Tris-HCl, pH 9
- et la Taq polymérase.
La réaction de séquençage se fait selon le programme suivant :

- Dénaturation initiale 96°C 1 mn

- 25 cycles de dénaturation à 96°C 10 secondes


hybridation à 50°C 5 secondes
élongation à 60°C 4 secondes
Le produit de la réaction est précipité et séquençé sur le séquençeur automatique 3100
APPLIED BIOSYSTEM. On détermine la succession des nucléotides composant l’ADN
plasmidique des différents clones.
Les séquences sont ensuite alignés à l’aide du logiciel Vector NTI par rapport à des
séquences de référence et l’analyse se fait en se servant des électrophorégrammes.

3.2.1.10. Amplification et purification du vecteur recombinant dans les


E.coli JM109

Deux clones recombinants positifs ayant la totalité de la séquence des gènes pfs16 et
pfg27/25 (C1 pIZ/V5-Hispfg27/25C-His et C3 pIZ/V5-Hispfs16C-His) sont mis en culture
dans du milieu LB Low salt supplémenté de zéocine 40 µg/mL et incubés sous agitation à
37°C toute la nuit. Le Kit « Wizard® Plus Midipreps DNA Purification system » de Promega
est utilisé ensuite pour purifier les plasmides. La purification est vérifiée sur gel agarose 1%.

24
3.2.2. Culture des cellules MimicTM

3.2.2.1. Mise en culture


TM
Les cellules Mimic ont été choisies pour leur capacité à réaliser des modifications
post-traductionnelles proches de certaines protéines de P. falciparum.
Ce sont des cellules d’insectes transgéniques dérivées des cellules Sf9. Elles ont été
modifiées pour exprimer les glycosyl transférases de mammifères comme le  2,6-sialyl
transférase, le  2,3-sialyl transférase, le 4-galactosyl transférase I, le N-acétyl-
glucosaminyl transférase I et le N-acétyl-glucosaminyl transférase II. En effet, les cellules
d’insectes comme celles des mammifères modifient post-traductionnellement leurs protéines
par N-glycosylation, ces modifications peuvent affecter la structure et la fonction de la
TM
protéine recombinante. Les cellules Mimic sont cultivées dans du milieu spécifique
d’insecte additionné de 10% de sérum de veau fœtal et de la gentamycine à 1mg/mL (milieu
Mimic) et incubées à 27°C en absence de CO2. L’observation régulière des cellules au
microscope inversé permet d’étudier leur confluence et leur adhérence. Les cellules
confluentes et adhérentes sont soumises à un test de sensibilité à la zéocine.

3.2.2.2. Test de sensibilité à la zéocine

La zéocine est un antibiotique de la famille des Bléomycines. Elle est toxique pour les
les cellules de mammifères (Mulsant et al., 1988;Drocourt et al., 1990 ). La zéocine activée
s’intercale dans l’ADN cellulaire et le coupe entraînant la mort de la cellule.
TM
On cultive les cellules Mimic en présence de concentrations décroissantes de
zéocine pour déterminer la concentration létale.

3.2.2.3. Transfection stable des cellules MimicTM

Le réactif de transfection utilisé (Celfectin ® ) est un mélange de lipides cationiques


(N,NI,NII,NIII-Tetra méthyl-N,NI , NII,NIIItétrapalmityl spermine (TM-TPS) et dioleyl
phosphatidylethanolamine (DOPE)) et d’eau stérile. Au contact de l’ADN chargé
négativement des complexes ADN-lipides (liposomes) se forment facilitant ainsi le passage
de l’ADN plasmidique à travers la membrane cellulaire.
Deux protocoles ont été utilisés pour la mise au point de la transfection en faisant
varier le nombre de cellules à transfecter, la quantité de réactif de transfection.

25
3.2.2.3.1. Préparation des cellules MimicTM

Pour la transfection, les cellules MimicTM doivent être à une concentration de 9.105
cellules/2mL ou à 2.106 cellules /2mL, adhérentes, avoir une viabilité supérieure à 95% et
confluentes à 95%.

3.2.2.3.2. Transfection des cellules MimicTM

La technique utilisée est celle de la lipotransfection c’est-à-dire une


transformation des cellules d’insectes par des liposomes. Ces liposomes consistent en un
mélange de lipides cationiques et d’ADN qui forment des vésicules adhérentes à la membrane
cellulaire et facilitant ainsi l’entrée de l’ADN dans les cellules.
Quatre transfections ont été réalisées :
- C1 pIZ/V5-HisPfg27/25C-His.
- C3 pIZ/V5-HisPfs16C-His.
- pIZ/V5His-CAT : contrôle positif.
-milieu « Grace’s Insect » non supplémenté :contrôle positif

3.2.2.3.3 Sélection à la zéocine des cellules transfectées

On retire le milieu de transfection 24 heures après la transfection et on remet 2 mL de


milieu Mimic et de la zéocine à 500 µg/mL .Mélanger doucement et incuber à 27°C.
Le surnageant est retiré 7jours après et les cellules sont reprises avec 5 mL de milieu
Mimic additionné de zéocine à 500 µg/mL et transférées dans des flasques de 25 cm 2.Au
bout de 10 jours de transfection, on passe les cellules transfectées en flasque de 75 cm2.

3.2.2.4. Clonage des cellules MimicTM transfectées


Le clonage cellulaire se fait par dilution sur des plaques de culture. Les clones visibles
sont récupérés au fur et à mesure et remis en culture dans du milieu Mimic additionné de
zéocine à 500µg/mL jusqu’à confluence.

26
3.2.3. Contrôle de l’expression des cellules MimicTM transfectées

Les différents clones cellulaires sont récupérés pour l’analyse de l’expression de Pfs16
et Pfg27/25 .

3.2.3.1.Vérification par PCR spécifique de l’intégration des gènes pfs16 et


pfg27/25

L’ADNg des cellules transfectées a été extrait et purifié à l’aide du kit « QIAmp®
DNA Mini and QIAamp DNA Blood Mini Kit Handbook ». Il est ensuite amplifié par PCR
spécifique des gènes pfs16 et pfg27/25 et déposé sur gel d’agarose 1%. Les clones positifs
sont récupérés et analysés sur gel de polyacrylamide.

3.2.3.2. Analyse de l’expression des protéines recombinantes Pfs16 et


Pfg27/25 par électrophorèse sur gel de polyacrylamide

3.2.3.2.1. Préparation du lysat cellulaire et migration

On récupère à la pipette les cellules d’une flasque de 75 cm2 et on centrifuge à


1000 rpm pendant 10 mn. Le culot cellulaire est repris avec 1 mL de tampon de lyse et
centrifugé à 1000 rpm pendant 10 mn pour récupérer le surnageant pour les tests.
Les lysats cellulaires sont analysées sur gel d’acrylamide 15%. Les protéines traitées
au SDS détergent anionique migrent en fonction de leur taille.
Les échantillons sont déposés sur gel en présence du marqueur de taille des protéines
et la migration se fait à 180V pendant 1H30 dans du tampon SDS-PAGE 1X.
3.2.3.2.2. Révélation des protéines
La révélation se fait sur le Lumi Imager de Roche après traitement avec le
TM
réactif « In vision His Tag In gel Stain » du kit « BDTM Universal His Tag Western Blot
kit » .Il est utilisé pour la détection spécifique des protéines recombinantes avec une étiquette
6xHis telles que Pfs16 et Pfg27/25.
La méthode de coloration a également été utilisée pour révéler les protéines
avec le réactif « Simply BlueTM Safe Stain ». La visualisation se fait également sur le Lumi
Imager de Roche.

27
3.2.3.4 . Analyse de l’expression des protéines recombinantes Pfs16 et
Pfg27/25 sur bio- analyseur

L’analyse a été faite avec le surnageant obtenu à partir de lysat des clones de cellules
MimicTM recombinants positifs sur Agilent 2100 bioanalyzer avec le kit «200 Plus
LabChip® ».

Préparation de la puce
Agilent Technologies

1-3 G
4-6 1
G
7-9 G
10
G DS

Protein LabChip®

Figure 9 : Schéma de la puce « Protein Lab Chip »

Les puits G sont remplis avec une solution de « gel-dye mix » , le puits « DS » avec
une solution de dénaturation et le puits avec le marqueur de taille.
Les échantillons sont déposés dans les puits 1-3 , 4-6 , 7-9 et 10 .

3.2.3.4. Purification de Pfs16 et Pfg27/25 par F.P.L.C.

Les protéines recombinantes Pfs16 et Pfg27/25 ont été purifiées à partir de


lysats des clones recombinants positifs par F.P.L.C. « Fast Protein Liquid Chromatography ».
Le principe est la séparation des constituants du lysat cellulaire par entraînement au moyen
d’une phase mobile le long d’une phase fixe. La phase fixe est une colonne de résine
(HisTrapTM 1 mL d’Amersham Biosciences) sur laquelle sont fixés des ions nickel. La phase
mobile est un tampon à 500 mM d’imidazole pH 7,4.
Les protéines recombinantes 6xHis sont fixées sur la colonne par affinité des
ions nickel pour les résidus histidines en présence d’un tampon à 5 mM d’imidazole pH 7,4.
C’est une chromatographie d’affinité. En effet l’ion Ni 2+ possède 6 liens de coordination dont
4 sont sollicités par la matrice.

28
Il en reste 2 qui vont interagir avec les atomes d’azote du cycle de la chaine latérale
de deux molécules d’hisdidine. A pH acide, les résidus histidine commencent à être réduits
et ne pourront plus se lier au Ni 2+.
La variation de concentration à 500 mM d’imidazole permet d’éluer les
protéines. L’imidazole va entrer en compétition avec les molécules d’histidine pour le Ni2+.
Les différentes fractions correspondants aux pics d’absorbance sont récupérées pour être
analysées sur gel de polyacrylamide.

29
Résultats et Discussion

30
4. Résultats et Discussion
4.1. Amplification des gènes codants pour les protéines Pfs16 et Pfg27/25
par PCR spécifique à partir de l’ADN 3D7 de P. falciparum

Nous avons amplifié chaque gène avec une étiquette 6xHis en C-terminal et en N-
terminal. La figure 10 ci-dessous correspond au gel d’agarose permettant d’analyser les
résultats de l’amplification in vitro en présence du marqueur de taille « Smart Ladder ».Nous
avons des bandes à 686 pb correspondant aux amplicons pfg27/25 et des bandes à 512 pb
correspondant aux amplicons pfs16.
Smart Ladder

pfg27 Nhis
pfg27 Chis

pfs16 Nhis
pfs16 Chis

1 2 3 4 5

686 pb
512 pb

Figure 10 : Gel d’agarose des amplicons

La migration se fait sur un gel 1% d’agarose à 90 Volt pendant 30 mn : Piste 1- Smart


Ladder, marqueur de taille de 100 pb à 10000 pb. Pistes 2 et 3 - Amplicon pfg27 de la taille
de 686 pb. Piste 4 et 5 - Amplicon pfs16 de la taille de 512 pb.

L’ADN génomique de P. falciparum a été extrait de la souche 3D7, souche de


référence du programme de séquençage. Nous avons amplifié les gènes pfs16 et pfg27/25
avec une étiquette 6x-Histidine pour faciliter la purification sur résine nickel des protéines
recombinantes et leur identification sur gel de polyacrylamide avec des anticorps anti-C
Histidine. Cette étiquette est peu immunogène et ne sera donc pas gênante pour la production

31
d’anticorps monoclonaux. Du fait de sa petite taille, elle n’influera pas sur la fonction
protéique.

4.2. Clonage des gènes pfs16 et pfg27/25 dans le vecteur d’expression


eucaryote pIZ/V5-His
Quatre constructions de vecteur recombinant ont été réalisées pIZ/V5-Hispfs16C-His,
pIZ/V5-Hispfs16N-His, pIZ/V5-Hispfg27/25C-His et pIZ/V5-Hispfg27/25N-His. Cinq
colonies ont été testées pour chacune de ces constructions et nous avons obtenu 5 clones
recombinants positifs. Le gel ci-dessus ( figure 11), montre les clones bactériens
recombinants positifs obtenus.
Smart Ladder

PIZV5/His- PIZV5/His- PIZV5/His- PIZV5/His-


pfs16Chis pfs16Nhis pfg27/25Chis pfg27/25Nhis

C1C2 C3C4C5 C1C2 C3C4C5 C1C2 C3C4C5 C1C2 C3C4C5

686pb
512pb

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

Figure 11: Gel d’agarose des clones bactériens recombinants positifs

La migration se fait sur un gel 1% d’agarose à 90 Volt pendant 30 mn : Piste 1 - Smart


Ladder, marqueur de taille de 100 pb à 10000 pb. Pistes 2 à 11 - Amplicons pfs16 de la taille
de 512 pb. Pistes 12 à 21 – Amplicons pfg27 de la taille de 686 pb.

4.3. Séquençage des gènes pfs16C-His, pfs16N-His, pfg27/25C-His et


pfg27/25N-His dans les plasmides recombinants

Les séquences obtenues sur le séquenceur 3100ABI PRISM® ont été analysées à l’aide
du logiciel Vector NTI.

32
Parmi tous les clones séquencés, C3 pIZ/V5-Hispfs16CHis, C4 pIZ/V5-
Hispfs16 CHis, C4 pIZ/V5-Hispfs16NHis, C1 pIZ/V5-Hispfg27/25CHis et C4 pIZ/V5-
Hispfg27/25NHis présentent une séquence conforme à celle de référence. La figure 12 est un
exemple d’électrophorégramme obtenu. Nous avons une subtitution d’une base T par une
base A en position 189 par rapport à la séquence du gène pfs16 de référence.

Figure 12 : Electrophorégramme du clone C4 de pfs16CHis avec l’amorce


directe

Chaque base est identifiée par un fluorochrome différent : vert pour A, noir pour G, rouge
pour T et bleu pour C. La substitution d’une base T par une base A en position 189 est
signalée par un encadré rouge.

Le séquençage du gène pfs16 de la souche 3D7 a révélé une mutation ponctuelle par
rapport à la souche de référence NF54 (Accession Number : M64705). Il s’agit de la
substitution d’une base T par une base A en position 189, ce qui correspond à une mutation
d’une Leucine CTA en une Glutamine CAA et une délétion en position 354 et 357 des
codons ATA AAG codant l’Isoleucine et la Lysine. Ces différences ont été vérifiées à trois
reprises sur des amplicons différents issus de différentes extractions d’ADNg de P.
falciparum. Ce polymorphisme de pfs16 a déjà été noté par Niederwieser en 2001.
Il avait décrit des mutations entre les souches NF54 (Accession Number : M 64705)
et 7G8 (Accession Number : AF177633).

33
4.4. Expression des protéines recombinantes Pfs16 et Pfg27/25 dans les
cellules Mimic transfectées

Les tests d’expression ont été effectués à partir de 12 clones (6 clones de cellules
MimicTM pIZ/V5-His pfs16CHis et 6 clones de cellules MimicTM pIZ/V5-His pfg27/25CHis )
de la première transfection et 10 clones (4 clones de cellules MimicTM pIZ/V5-His pfs16CHis
et 6 clones de cellules MimicTM pIZ/V5-His pfg27/25CHis ) de la deuxième transfection.

4.4.1. Amplification par PCR spécifique des gènes pfs16 et pfg27/25 dans
l’ADNg des cellules MimicTM transfectées

Nous avons obtenus au total 6 clones positifs pour les cellules transfectées avec le
gène pfs16 et 10 clones positifs pour les cellules transfectées avec le gène pfg27/25.
La figure 13 est un exemple d’analyse de nos résultats par électrophorèse sur gel d’agarose.
Smart ladder

C2Pfg27/25T1

C3Pfg27/25T1
C4Pfg27/25T1

C6Pfg27/25T1
C1Pfg27/25T1

C2Pfg27/28T2
C5Pfg27/25T1

C1Pfg27/25T2
C2Pfs16T1
C1Pfs16T1

C3Pfs16T1

C4Pfs16T1

C7Pfs16T2
C5Pfs16T1

C6Pfs16T1

512 pb 686pb
686 pb
686pb

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Figure 13 : Gel d’agarose des clones de cellules MimicTM positifs

La migration se fait sur un gel 1% d’agarose à 90 Volt pendant 30 mn : Piste 1 - Smart


Ladder, marqueur de taille de 100 pb à 10000 pb. Pistes 2 à 8 - Amplicons pfs16 de la taille
de 512 pb. Pistes 9 à 16 – Amplicons pfg27 de la taille de 686 pb.

34
4.4.2. Résultats obtenus sur gel de polyacrylamide

La migration des lysats cellulaires sur gel de polyacrylamide a donné des bandes non
spécifiques avant et après coloration . Nous obtenu le gel présenté sur la figure 14 avec 6
TM
clones positifs du gène pfs16 , les cellules Mimic sauvages et 6 clones positifs du gène
pfg27/25.

Marqueur de taille
C3pfg27/25T1
C4pfg27/25T1
C5pfg27/25T1
C6pfg27/25T1
C2pfg27/25T2
C9pfg27/25T2
C11pfs16T2
C3pfs16 T1
C4pfs16T1
C5pfs16T1
C1pfs16T2
C3pfs16T2

SSSAUVAGE
Mimic TM

30 kDa

15 kDa

Figure 14 : Gel de polyacrylamide des lysats cellulaires des clones positifs

La migration se fait sur un gel de polyacrylamide 15 % d’agarose à 180 Volt pendant


1h30 mn : Piste 14 - Marqueur de taille de 10 kDa à 120 kDa. Pistes 1 à 6 –lysats cellulaires
des clones du gène pfs16(taille de la protéine 16,6kDa). Pistes 9 à 14 –lysats cellulaires des
clones du gène pfg27(taille de la protéine 27kDa). Piste 7-cellules MimicTM .
L’absence d’expression ou la faible expression des protéines peuvent s’expliquer par
l’insertion différentielle du transgène au sein de l’ADN génomique cellulaire. En effet, dans
ce type de technique, l’insertion se fait de façon aléatoire. L’insertion peut donc ne pas avoir
lieu ou avoir lieu dans des régions silencieuses ou de faible expression.
Et contrairement au système procaryote, le système eucaryote utilisé ne permet pas
une sur-expression des protéines recombinantes.

35
4.4. 3. Résultats obtenus sur le bio analyseur

Le kit 200 Plus Labchip® d’Agilent est utilisé pour l’analyse de protéines de 14 à 200
kDa à partir d’un lysat cellulaire ou de protéines purifiées. La figure 15 est obtenue en
TM
superposant les électrophorégrammes du clone C5 pfs16 et des cellules Mimic sauvages.
Nous avons un pic à 15 ,5 kDa qui n’apparaît pas sur l’électrophorégramme des cellules
MimicTM sauvages et qui correspond à la taille attendue pour la protéine Pfs16.

C5 Pfs16

15,5kDa
14,4kDa

Cellules MimicTM

Figure 15 : Electrophorégramme du clone C5pfs16 sur le bio analyseur

L’électrophorégramme bleu correspond au cellules Mimic TM sauvages.


L’électrophorégramme rouge correspond à l’échantillon Clone 5 pfs16, un pic de 15,5 kDa
ce qui correspond à la taille de la protéine attendue .
Marqueur de taille de 14,4 kDa à 210 kDa.
[S] secondes :Temps de sortie du pic échantillon.
[FU] :Fluorescence Unit relative à la concentration de l’échantillon.
Une analyse rapide sur bio analyseur nous a permis de sélectionner des clones cellulaires des
clones présentant des pics intéressants et qui pourraient exprimer les protéines d’intérêts pour

36
les purifier par F.P.L.C. Le bio analyseur a une sensibilité intéressante compte tenu du
facteur de dilution élevé de l’ordre de 1/22 de la prise d’essai.

4.4.4. Résultats de la purification sur F.P.L.C


Les clones de cellules transfectés avec les deux gènes, sélectionnés sur le bio
analyseur ont été contrôlé par F.P.L.C. Par comparaison avec les cellules Mimic TM sauvages,
on obtient l’élution d’une protéine à 50 mM d’imidazole qui pourrait correspondre à la
protéine d’intérêt comme le montre la figure 16 (un pic à 600 mAU avec le clone C5 pfs16
qui pourrait correspondre à l’absorbance de la protéine Pfs16).

Figure 16 : Résultat de la purification du clone C5pfs16Chis


Un pic d’une absorbance de 600 mAU est observé pour le clone C5 pfs16CHis (en rouge) en
comparaison à l’absorbance des cellules Mimic TM sauvage (en bleu).
Ce pic pourrait correspondre à l’absorbance de la protéine attendue.
[mAU] : milli AbsorbanceUnit relative à la concentration de l’échantillon.
Le gradient d’imidazole (en vert) variede 0 à 100% du tampon B contenant 500 mM d’
imidazole par rapport au tampon A contenant 5 mM d’ imidazole soit de 5 mM à 500 mM d’
imidazole.

37
Toutes les fractions correspondants aux pics d’absorbance ont été recueillies à environ
50mM d’imidazole . Nous avons des pics d’absorbance variant de 300 à 700 mAU pour les
clones de cellules transfectées avec pfs16 et des pics variant de 300 à 400 mAU pour les
clones de cellules transfectées avec pfg27/25 .
La purification par F.P.L.C a permis de voir que certains clones semblent présenter une
meilleure expression que d’autres.
Les deux protéines Pfs16 et Pfg27/25 exprimées dans les cellules Mimic jouent un rôle
important au cours de la gamétocytogénèse de P. falciparum (Lobo et al.,1999 ;
Kongkasuriyachai et al.,2004). Les gènes codant ces deux protéines ont été clonés dans des
systèmes procaryotes (Alano et al.,1991 ; Baker et al.,1994).
Cette étude a permis l’obtention de protéines recombinantes dans un système
eucaryote. Ce système d’expression a été choisi pour de nombreuses protéines de P.
falciparum qui subissent des modifications post-traductionnelles proches de celles qui ont lieu
dans les cellules d’insectes ( Kocken et al.,1993). La plupart des protéines ne sont actives in
vivo qu’après avoir subi des modifications post-traductionnelles telles que les méthylations,
les acétylations, les sulfonations, les phosphorylations, l’addition de lipides, les
glycosylations, la formation de ponts disulfures etc .Ces modifications ont lieu pour la plupart
dans le réticulum endoplasmique et dans l’appareil de Golgi pour donner une protéine mature.
Dans une communication parue en 1997, Nirbhay Kumar pose l’hypothèse d’une
phosphorylation de la protéine Pfg27/25.
Dans un système procaryote il est peu probable d’obtenir la protéine mature car les
modifications post-traductionnelles telles que glycosylation et phosphorylation sont rarement
réalisées chez les bactéries.
TM
Les différentes techniques utilisées pour le contrôle de l’expression des cellules Mimic
transfectées, à savoir l’électrophorèse sur gel de polyacrylamide, le bio analyseur et la
F.P.L.C seront optimisées avec d’autres techniques telles que le western-blot afin de
sélectionner les clones ayant une meilleure expression.

38
Conclusion et perspectives

39
5. Conclusion et perspectives
TM
Nous avons exprimées les protéines Pfs16 et Pfg27/25 dans des cellules Mimic .
Plusieurs clones cellulaires positifs ont été obtenus. Les clones de cellules MimicTM
performants seront sélectionnés et utilisés pour la production de ces deux protéines. Nous
obtiendront après purification une quantité importante de protéines Pfs16 et Pfg27/25. Ces
protéines seront utilisées pour produire des anticorps monoclonaux anti-Pfs16 et anti-
Pfg27/25. Ces anticorps monoclonaux serviront d’une part pour l’identification des stades
précoces de la gamétocytogénèse de P. falciparum, éléments totalement indifférenciables des
formes asexuées et d’autre part pour la quantification des gamétocytes en fonction des
différents produits ou techniques d’induction de la gamétocytogénèse. Ils constitueront un
outil intéressant dans les études in vitro des mécanismes régulateurs du cycle de
développement du parasite dans le cadre de la recherche de nouvelles cibles thérapeutiques et
vaccinales. Il est impératif d’identifier de nouvelles cibles thérapeutiques ou vaccinales car le
paludisme demeure un problème de santé publique.

40
Références bibliographiques

41
Références bibliographiques
1 - Alano P., Premawasa S., Bruce M.C., and Carter R. (1991) A stage specific expressed
at the onset of gametocytogenesis in Plasmodium falciparum. Molecular and Biochemical
Parasitology, 46, 81-88

2 - Alano P., Read D., Bruce M., Aikawa M., Kaido T., Tegoshi T., Bhatti S., Smith D.
K., Luo C., Hansra S., Carter R., and Elliot J. F. (1995a). COS cell expression cloning of
Pfg377 A Plasmodium falciparum gametocyte antigen associated with osmiophilic bodies.
Molecular and Biochemical Parasitology, 74, 143-156

3- Alano P., Roca L., Smith D., Read D., Carter R., and Day K. (1995b). Plasmodium
falciparum : Parasites Defective in Early Stages of Gametocytogenesis. Experimental
Parasitology 81, 227-235

4- Alano P., Silvestrini F., Roca L. (1996) Structure and polymorphism of the upstream
region of the pfg27/25gene, transcriptionally regulated in gametocytogenesis of Plasmodium
falciparum. Molecular and Biochemical Parasitology 79, 207-217

5- Baker D.A., Daramola O., McCrossan M.V., Harmer J., and Targett G.A.T. (1994).
Subcellular localisation of pfs16 A Plamodium falciparum gametocyte antigen. Parasitology
108, 129-137

6- Baker D.A., Thompson J., Daramola O.O., Carlton J.M.R., and Target G.A.T. (1995).
Sexual -stage -specific RNA expression of a new Plasmodium falciparum gene detected by in
situ hybridisation. Molecular and Biochemical Parasitology 72, 193-201

7- Bruce M. C., Carter R. N., Nakumura K., Aikawa M., and Carter R. (1994). Cellular
location and temporal expression of the Plasmodium falciparum sexual stage antigen Pfs16.
Molecular and Biochemical Parasitology 65, 11-22

8- Buckling A., Randford-Cartwright L.C., Milles A., and Read A.F. (1998). Chloroquine
increase Plasmodium falciparum gametocytogenesis in vitro. Parasitology 118, 339-446

9- Crabb B.S., Triglia T., Waterkeyn J.G., and Cowman A.F. (1997). Stable transgene
expression in Plasmodium falciparum. Molecular and Biochemical Parasitology 90, 131-144

10- Dechering K.J., Thompson J., Dodemont H.J., Eling W., and Konings R.N.H. (1997).
Developmentally regulated expression of pfs16, a marker for differentiation of the human
malaria parasite Plasmodium falciparum. Molecular and Biochemical Parasitology 89, 235-
244

11- Dechering K.J., Kaan A.M., Mbacham W., Wirth D.F., Eling W., Konings R.N.H.,
and Stunnenberg H.G. (1999) Isolation and Functional Characterization of Two Distinct
Sexual-Stage-Specific Promoters of the Human Malaria Parasite Plasmodium falciparum.
Molecular and Cellular Biology, 19, 967-978

42
12- Drocourt D., Calmels T.P.G., Reynes J.P., Baron M., and Tiraby G. (1990). Cassettes
of the Streptoalloteichus hindustanus ble gene for transformation of lower and higher
Eucaryotes to Phleomycin Resistance. Nucleic Acids Research 18, 4009-4010

13- Feng Z., Hoffmann R.N., Nussenzweig R.S., Tsuji M., Fujioka H., Aikawa M., and
Pologe L.G. (1993). Pfs2400 can mediate antibody -dependant malaria transmission
inhibition and may be the Pf11.1 gene product. Journal of Experimental Medecine, 177, 273-
281

14- Florens L., Washburn M.P., Raine J.D., Anthony R. M., Grainger M., Haynes J.D.,
Moch J.K., Muster N., Sacci J.B., Witney A.A., Wolters D., Wu Y., Gardner M. J.,
Holder A.A., Sinden R.E., Yates J.R., and Carucci D.J. (2002). A proteomic view of the
Plasmodium falciparum life cycle. Nature 419, 520-526

15- Gardner M.J., Hall N., Fung E., White O., Berriman M., Hyman R.W., Carlton
J.M., Pain A., Nelson K.E., Bowman S., Paulsen I.T., James K., Eisen J.A., Rutherford
K., Salzberg S. L., Craig A., Kyes S., Chan M.S., Nene V., Shallom S.J., Suh B., Peterson
J., Angiuoli S., Pertea M., Allen J., Selengut J., Haft D., Mather M.W., Vaidya A.B.,
Martin D.M.A., Fairlamb A.H., Fraunholz M.J., Roos D.S., Ralph S.A., Mcfaden G.I.,
Cummings L.M., Subramanian G.M., Mungall C., Venter J.C., Carucci D.J., Hoffman
S. L., Newbold C., Davis R.W., Fraser C.M., and Barrell B. (2002). Genome sequence of
the human malaria parasite Plasmodium falciparum Nature 419, 498-511

16- Guinet F., Dvorak J.A., Fujioka H., Keister D.B., Muratova O., Kaslow D.C.,
Aikawa M., Vaidya A.B., and Wellems T.E. (1996). A development defect in Plasmodium
falciparum male gametogenesis. Journal of Cell Biology 135, 269-278

17- Healer J., McGuinness D., Hopcroft P., Haley S., Carter R., and Riley E. (1997).
Complement-Mediated Lysis of Plasmodium falciparum Gametes by Malaria-Immune
Human Sera Is Associated with Antibodies to the Gamete Surface antigen Pfs230. Infection
and Immunity, 65,8,3017-3023

18- Hegedus D.D., Pfeifer T.A., Hendry J., Thelmann D.A., and Grigliatti T.A. (1998). A
series of broad host range shuttle vectors for constitutive and inducible expression of
heterologous proteins in insect cell lines. Gene 207, 241-249

19- Kariuki M.M., Kiaira J.K., Mulaa F.K., Mwangi J.K., Wasunna M.K., and Martin
S.K. (1998). Plasmodium falciparum : Purification of the various gamétocyte developmental
stages from in vitro-cultivated parasites. American Journal of Tropical Medecine and hygiene
59, 505-508

20- Kocken C.H.M., Jansen J., Kaan A.M., Beckers P.J.A., Ponnudurai T., Kaslow D.C.,
Konings R. N.H., and Schoenmakers J. G.G. (1993). Cloning and expression of the gene
coding for the transmission blocking target antigen Pfs48/45 of Plasmodium falciparum.
Parasitology 61, 59-68

21- Kongkasuriyachai D., Fujihoma H., and Kumar N. (2004). Functional analysis of
Plasmodium falciparum parasitophorous vacuole membrane protein (Pfs16) during
gametocytogenesis and gametogenesis by target gene disruption. Molecular and Biochemical
Parasitology 133, 275-285

43
22-Kumar Nirbhay (1997). Protein phosphorylation during sexual differentiation in the
malaria parasite Plasmodium falciparum. Molecular and Biochemical Parasitology 87, 205-
210

23- Lasonder E., Ishihama Y., Andersen J.S., Vermunt A.M.W., Pain A., Sauerwein
R.W., Eling W., Hall N., Waters A.P., Stunnenberg H.G., and Mann M. (2002). Analysis
of the Plasmodium falciparum proteosome by high-accuracy mass spectrometry. Nature 419,
537-542

24- Lobo C.A., Konings R.N.H., and Kumar N. (1994). Expression of early gametocyte-
stage antigens Pfg27/25 and Pfs16 in synchronized gametocytes and non gametocytes
producing clones of Plasmodium falciparum. Molecular and Biochemical Parasitology 68,
151-154

25- Lobo C.A., Fujihoma H., Aikawa M., and Kumar N. (1999). Disruption of the
Pfg27/25 Locus by Homologous Recombinaison Leads to Loss of the Sexual Phenotype in
Plasmodium falciparum. Molecular Cell, 3, 793-798

26- Menegon M., Severini C., Sannella A., Paglia G.M., Sangare D., Abdel-Wahab A.,
Babiker H., Walliker D., Alano P. (2000)Genotyping of Plasmodium falciparum
gametocytes by reverse transcriptase polymerise chain reaction. Molecular and Biochemical
Parasitology 111,153-161

27- Moelans I.I.M.D., Meis J.F.G.M., Kocken C.H.M., Konings R.N.H., and
Schoenmakers J. G.G. (1991). A novel protein antigen of the malaria parasite Plasmodium
falciparum, located on the surface of gametes and sporozoites. Molecular and Biochemical
Parasitology, 45, 193-204

28- Mulsant P., Tiraby G., Kallerhoff J., and Perret J. (1988). Phleomycin Resistance as a
dominant selectable marker in CHO cells. Somatics Cell and Molecular Genetics 14, 243-252

29- Niederwieser I., Felger I., and Beck H.P. (2000). Plasmodium falciparum : Expression
of Gametocyte-Specific Genes in Monolayer Cultures and Malaria - Positive Blood Samples.
Experimental Parasitology 95, 163-169

30- Niederwieser I., Felger I., and Beck H.P. (2001). Limited Polymorphism in
Plasmodium falciparum Sexual-Stage Antigens. American Journal of Tropical Medecine and
Hygiene, 64, 9-11

31- Pfeifer T.A., Hegedus D.D., Grigliatti T.A., and Theilmann D.A. (1997). Baculovirus
immediate early promoter mediated expression for the zéocine resistance gene for use as a
dominant selectable marker in dipteran and lepidopteran insect cell lines. Gene 188, 183-190

32- Pologe L.G. (1994). Aberant transcription and the failure of Plasmodium falciparum to
differentiate into gametocytes. Molecular and Biochemical Parasitology 68, 35-43

33- Rawlings D.J., Fujioka H., Fried M., Keister D.B., Aikawa M., and Kaslow D.C.
(1992). -tubulin II is a male-specific protein in Plasmodium falciparum. Molecular and
Biochemical Parasitology 56, 239-250

44
34- Robert V., et Boudin C. (2003).Biologie de la transmission du Plasmodium
Parasitologie 2454a, 6-20

35- Sallicandro P., Paglia M.G., Hashim S.O., Silvestrini F., Picci L., Gentile M., Mulaa
F., and Alano P. (2000). Repetitive sequences uptream of the pfg27/25 gene determine
polymorphism in laboratory and natural lines of Plasmodium falciparum. Molecular and
Biochemical Parasitology 110, 247-257

36- Scherf A ., Carter R., Petersen C., Alano P., Nelson R., Aikawa M., Mattei D., Da
Silva L.P., and Leech J. (1992). Gene inactivation of pf11-1 of Plasmodium falciparum by
chromosome breakage healing : identification of a gametocyte-specific protein with a
potential role in gemetogenesis. The EMBO Journal 11, 2293-2301

37- Severini C., Menegon M., Sanella A.R., Paglia M.G., Gradoni L., and Alano P.
(1999). Presence of Length Polymorphism in Repeat Regions of the Plasmodium falciparum
pfg377 Gene, Coding for a Macrogametocyte-specific Protein. The Journal of Eukaryotic
Microbiology , 8-9.

38- Severini C., Silvestrini F., Sannella A., Barca S., Gradoni L., and Alano P. (1999).
The production of the osmophilic body protein pfg377 is associated with stage of maturation
and sex in Plasmodium falciparum gametocytes. Molecular and Biochemical Parasitology
100, 247-252

39- Sharma A., Sharma I., Kongkasuriyachai D., and Kumar N. (2003). Structure of a
gametocyte protein essential for sexual development in Plasmodium falciparum. Nature
Structural biology, 10, 3, 197-203

40- Skinner-Adams T.S., Lawrie P.M., Hawthorne P.L., Gardner D.L., and Trenholme
K.R. (2003). Comparaison of Plasmodium falciparum transfection methods. Malaria Journal,
2(1) : 19 -24

41 - Smith T.G., Lourenço P., Carter R., Walliker D., and Randford-Cartwright L.C.
(2000). Commitment to sexual differenciation in the human malaria parasite, Plasmodium
falciparum. Parasitology, 121, 127-133

42- Sokhna C.S., Trape J.F., and Robert V. ( 2001). Gametocytaemia in Senegalese
children with uncomplecated falciparum Malaria treated with chloroquine, amodiaquine or
sulfadoxine + pyrimethamine. Parasite, 8, 243-250

43-Theilmann D.A., and Stewart S. (1992). Molecular analysis of the trans-activating IE-2
gene of Orygyia sugata multicapsid nuclear polyhedrosis virus. Virology 187 , 84-96

44- Van Dijk M., Janse C.J., Thompson J., Waters A.P., Braks J.A.M., Dodemont H. J.,
Stunnenberg H.G., Van Gemert G.J., Sauerwein R.W., and Eling W. (2001). A central
Role for P48/45 in Malaria Parasite Male Gamete Fertility. Cell, 104, 153-164

45
45- Wernsdorfer W.H., and Noedl H. (2003). Molecular markers for drug resistance in
malaria : use in treatement, diagnosis and epidemiology. Current Opinion in Infectious
Diseases 16, 553-558

46-Williams J.L. (1999). Stimulation of Plasmodium falciparum gametocytogenesis by


conditioned medium from parasite cultures . American Journal of Tropical Medecine and
Hygiene 60, 7-13

47-Von Seidlein L., Drakely C., Greenwood B., Walraven G., and Targett G.A.T.
(2001). Risk Factors For Gametocyte Carriage in Gambian Children . American Journal of
Tropical Medecine and Hygiene 65, 523-527

46
ANNEXES

47
Annexes

Protocoles

Extraction de l’ADN g de P. falciparum

Mélanger dans un tube de 1,5 mL :


- 250 µL de sang,
- 25 µL de protéinase K à 20 mg / mL,
- 250 µL de tampon B,
- Vortexer pendant 10 s.
- Incuber à 55°C pendant 30 mn (vortexer brièvement toutes les 10 mn pendant
l’incubation).
- Ajouter 260 µL d’isopropanol.
- Transférer le lysat dans une colonne et centrifuger à 13000 rpm pendant 1 mn.
- Placer la colonne dans un deuxième tube de collection et laver avec 650 µL de
tampon de lavage préalablement dilué dans de l’éthanol, centrifuger à 13000 rpm pendant
1 mn, puis de nouveau avec 650 µL de tampon de lavage et centrifuger à 13000 rpm pendant
2 mn.
- Placer la colonne dans un tube de 1,5 mL et éluer avec 100 µL d’H2O ultra-pure à
55°C, incuber 2 mn à température ambiante, puis centrifuger à 13000 rpm pendant 1 mn.
-Enlever la colonne et stocker l’ADNg à – 20°C.

Préparation des amorces spécifiques de pfs16 et pfg27/25

Ils ont été choisis selon les critères suivants et synthétisés pour les besoins de l’étude :
- présence du site de restriction de HindIII ou EcoRI (en rose),
- posséder un ATG (en rouge) au sein de la séquence d’initiation de la transcription
Kosak (en gras) pour une meilleure transcription des gènes Pfs16 et Pfg27/25 dans le
plasmide,
- encadrer toute la séquence codante de chaque gène,
- présence d’une étiquette 6xHis (en bleue) en C ou en N terminal.

48
Gène pfg27/25

pfg27/25-D-HindIII
5’ CCAAGCTTGGGATGGCAAGTAAGGTACAAAAGGATAG 3’

pfg27/25-CHis-EcoRI
5’ CGGAATTCCGGTCAATGGTGATGGTGATGATGAATATTGTTGTGATGTGG 3’

pfg27/25-DHis-HindIII
5’ CCAAGCTTGGGATGGCACATCATCACCATCACCATAGTAAGGTACAAAAGG 3’

pfg27/25-C-EcoRI
5’ CGGAATTCCGGTCAAATATTGTTGTGATGTGGTTC 3’

Gène pfs16

pfs16-D-HindIII
5’ CCAAGCTTGGGATGGCAAATATTCGAAAGTTCATA 3’

pfs16-CHis-EcoRI
5’ CGGAATTCCGGTCAATGGTGATGGTGATGATGAGAATCATCTCCTTCGTC 3’

pfs16-DHis-HindIII
5’CCAAGCTTGGGATGGCACATCATCACCATCACCATAATATTCGAAAGTTCAT
A 3’

pfs16-C-EcoRI
5’ CGGAATTCCGGTCAAGAATCATCTCCTTCGTC 3’

Réaction d’amplification des gènes pfs16 et pfg27/25


Réaction de PCR :
- tampon 10X (Eurogentec) 5 µL 1X
- dNTPs à 10 mM 1 µL 0,2 mM
- amorce directe à 16µM 1 µL 0,32µM
- amorce complémentaire à 16µM 1 µL 0,32µM
- MgCl2+ à 25mM 4 µL 2mM
- ADNg souche 3D7P. falciparum 5 µL 50 ng
- Taq DNA Polymérase Eurogentec 5U/µL 0.5 µL 0,05U
- H2O ultra-pure 32.5 µL
Volume Total 50 µL

49
Purification du produit de PCR

- Reprendre le produit de PCR avec 500 µL de « Buffer Binding », transférer le


mélange dans une colonne, centrifuger à 13000 rpm pendant 1 mn.
«
- Laver la colonne avec 500 µL de Wash buffer », centrifuger à 13000 rpm pendant
1mn.
- Laver de nouveau la colonne avec 200 µL de « Wash buffer » , centrifuger à 13000
rpm pendant 1mn.
- Remettre la colonne dans un tube de 1,5 mL , éluer avec 30 µL d’H20 ultra-pure.
- Centrifuger à 13000 rpm pendant 1mn pour récupérer le produit d’amplification
purifié et le conserver à- 20°C.

Réactions de digestion
Pour chaque insert, la réaction de digestion est :
- 15 µL de chacun des amplicons
- 1 µL d’enzyme de restriction (10U/µL) Hind III Roche
- 1 µL d’enzyme de restriction (10U/µL) EcoRI Roche
- 2 µL de tampon de digestion B 10X Roche
- 1 µL d’H2O ultra-pure
Volume total 20 µL

Pour le plasmide, la réaction de digestion est :


- 10 µL de vecteur pIZ/V5-His
- 1 µL d’enzyme de restriction (10U/µL) HindIII Roche
- 1 µL d’enzyme de restriction (10U/µL) EcoRI Roche
- 2 µL de tampon de digestion B 10X Roche
- 6 µL H2O ultra-pure
Volume total 20 µL
Incuber les réactions de 1 à 2 heures à 37°C.

50
Réaction de ligation

Mélanger dans un tube de 1,5 mL :


- 2 µL de tampon de dilution 5X
- 1 µL d’insert (70 ng d’insert de pfg27/25 ou 50 ng d’insert de pfs16)
- 2 µL de pIZ/V5His (100 ng)
- 10 µL de tampon de ligation 10X
- 1 µL de T4 DNA ligase
- 4 µL de H2O ultra-pure
Incuber 2 heures à température ambiante

Réaction de transformation

Pour chaque vecteur recombinant :


- Aliquoter sous la hotte 50 µL de bactéries compétentes E.coli JM109 dans un tube de 1,5
mL et le maintenir dans la glace.
- Ajouter 3 µL de la réaction de ligation, mélanger et laisser 40 mn dans la glace.
- Chauffer ensuite les bactéries 45 secondes à 42°C puis les refroidir immédiatement
dans la glace pendant 2 mn.
- Ajouter 950 µL de milieu LB Low salt et incuber 1 heure à 37°C sous agitation.
- Etaler 200 µL du mélange de transformation sur les boites de culture LB Low Salt-
Agar supplémenté de la zéocine à 40 µg/mL puis incuber une nuit à 37°C.

Criblage des clones bactériens

Après avoir repéré au marqueur sur les boites de culture une dizaine de colonies,
prélever sous la hotte chaque colonie avec une pointe de 10 µL et la mélanger dans 10 µL
d’H20 ultra-pure dans un tube PCR, mettre ensuite la pointe dans un tube de 1,5 mL contenant
1 mL de milieu LB Low Salt.
Chauffer le tube de PCR à 99°C pendant 10 mn puis ajouter à ce lysat bactérien :
- 5 µL de Tampon 10X

51
- 4 µL de MgCl2+ à 25 mM
- 1 µL de dNTPs à 10 mM
- 1 µL d’amorce D à 16 µM
- 1 µL d’amorce C à 16 µM
- 0,5 µL de Taq Eurogentec à 5U/µL
- 27,5 µL de H2O ultra-pure
Volume total 50 µL
Amplification et purification des plasmides
Les clones positifs sur PCR sont cultivés sur LB low salt additionné de zéocine à
40µg/Ml toute une nuit.
- Centrifuger les cultures d’une nuit à 3000 rpm pendant 10 mn à 4°C, éliminer le
surnageant, reprendre le culot dans 250 µL de solution de resuspension cellulaire.
- Transférer le mélange dans les tubes de 1,5 mL.
- Ajouter 250 µL de solution de lyse, inverser les tubes 4 fois et attendre jusqu’à lyse
complète des cellules puis ajouter 10 µL de protéase alcaline, inverser les tubes 4 fois,
incuber pendant 5 mn.
- Ajouter 350 µL de solution de neutralisation, inverser 4 fois le tube et centrifuger à
13000 rpm, pendant 15 mn.
- Récupérer le surnageant et le passer sur une colonne de silice.
- Centrifuger la colonne pendant 1 mn.
- Ajouter sur la colonne 750 µL de solution de lavage (préalablement dilué dans de
l’éthanol 95%) et centrifuger à 13000 rpm pendant 1mn.
- Ajouter de nouveau 250 µL de solution de lavage, centrifuger à 13000 rpm pendant 2
mn.
- Mettre la colonne dans un nouveau tube de 1,5 mL et éluer l’ADN plasmidique avec
80 µL H2O ultra-pure laisser 1 mn puis centrifuger à 13000 rpm pendant 1 mn.
Conserver l’ADN plasmidique à -20 °C.

Réaction de séquençage de l’ADN plasmidique :


- 4 µL du réactif « Big Dye TM Terminator V3.1 cycle »
- 4 µL amorce à 0.8 µM
- 4 µL d’ADN plasmidique
- 8 µL d’H2O ultra-pure

52
Volume final de 20 µL
Précipitation des produits de séquençage
Mélanger la réaction de séquençage avec :
- 2 µL d’acétate de sodium 3M pH 4,6
- 2 µL d’EDTA 125 mM
- 50 µL d’éthanol 100% et laisser 15 mn à température ambiante.
- Centrifuger à 13000 rpm pendant 30 mn, reprendre le culot avec 100 µL d’éthanol
70%.
- Centrifuger à 13000 rpm pendant 15 mn, laisser sécher le culot à température
ambiante.
- Reprendre le culot sec avec 10 µL de formamide pour dénaturer les structures
secondaires, laisser 10 mn à température ambiante puis agiter pendant 15 mn.
- Transférer le mélange dans une plaque de séquençage de 96 puits
- Chauffer à 96°C 2 mn pour dénaturer l’ADN et immédiatement après chauffage
refroidir pour éviter toute renaturation à 4°C.

Purification des plasmides pIZ/V5-Hispfg27/25C-His et pIZ/V5-Hispfs16C-


His
Les cultures sont centrifugées à 4000 rpm pendant 30 mn à 4°C, et reprises avec 3 mL
de solution de resuspension cellulaire et 3 mL de solution de lyse. Après lyse complète des
cellules, ajouter 3 mL de solution de neutralisation et centrifuger le lysat à 13000 rpm
pendant 30 mn. Récupérer le surnageant et ajouter 10 mL de résine. Passer la solution sur une
colonne, appliquer le vacuum et laver la colonne deux fois de suite avec 15 mL de solution de
lavage. Mettre la colonne dans un tube de 1,5mL, centrifuger à 13000 rpm pendant 2 mn,
changer de tube et éluer l’ADN plasmidique avec 300µL d’H20 ultra-pure. Centrifuger à
13000 rpm pendant 5 mn et conserver l’ADN plasmidique à -20°C.
Culture des cellules Mimic TM

Les milieux de culture sont préparés suivant le manuel « Growth and Maintenance of
Mimic Insect Cells™ » de Invitrogen.
Dans 500 mL de « Grace’s Insect Medium » supplémenté d’acides aminés, ajouter 10
% de sérum de veau fœtal, de la gentamycine à 1 mg/mL (milieu Mimic). Aliquoter 4 mL de
milieu ainsi préparé dans une flasque de 25 cm2. Décongeler les cellules Mimic™ conservées
dans de l’azote liquide et les laver avec 4 mL de milieu Mimic pour éliminer le DMSO qui

53
inhibe la croissance cellulaire. Centrifuger à 1000 rpm pendant 5 mn, reprendre le culot de
cellules avec 1 mL de milieu Mimic et le rajouter aux 4 mL de milieu de la flasque de
25cm 2 . Répartir les cellules dans la flasque et incuber à 27°C en absence de CO2 et en
atmosphère humide. Observer les cellules au microscope inversé 24 heures après et noter
l’adhérence et la confluence.
Récupérer les cellules après 48 heures d’incubation et les remettre dans une flasque de
75 cm2 contenant 10 mL de milieu Mimic neuf , incuber à 27°C. Diviser ensuite les cellules
tous les 2 jours pour avoir en permanence des cellules Mimic confluentes et adhérentes.
Test de sélection à la zéocine

Récupérer les cellules par pression du milieu à l’aide d’une pipette, les transférer dans
des tubes stériles et centrifuger à 1000 pendant 10 mn. Reprendre les cellules de chaque tube
dans 2 mL de milieu Mimic. Diluer au ½ la suspension cellulaire dans du Bleu Trypan
colorant vital et compter le nombre de cellules blanches à partir de 10 µL de ce mélange à la
cellule de Malassez. Aliquoter 500 µL à 2.105cellules/mL de suspension dans 8 puits d’une
plaque de culture cellulaire Multiwell™ 24 puits et incuber à 27°C jusqu’à ce que les
cellules soient confluentes et adhérentes à la plaque. Ajouter ensuite dans chaque puits, 500
µL de milieu Mimic et des concentrations décroissantes de zéocine : 800 µg/mL, 700 µg/mL,
600 µg/mL, 500 µg/mL, 400 µg/mL, 300µg/mL, 200 µg/mL, 100µg/mL et incuber 1 semaine
à27°jusqu’àlamorttotaledescellules.
Transfection stable des cellules MimicTM

Compter les cellules MimicTM à la cellule de Malassez, mélanger ensuite 1 mL de


cellules et 1 mL de milieu Mimic dans une plaque de culture cellulaire de 6 puits et incuber à
27°C toute la nuit.

Protocole 1

Préparer sous la hotte les deux solutions suivantes :


- Solution A : 1 µg d’ ADN plasmidique dilué dans 100 µL de milieu « Grace’s
Insect » non supplémenté.
- Solution B : 6 µL de « Cellfectin® Reagent d »’Invitrogen dans 100 µL de milieu
« Grace’s Insect » non supplémenté.
Mélanger les deux solutions et incuber à température ambiante 45 mn.

54
Prendre la plaque de culture de 6 puits contenant les cellules MimicTM, retirer le
milieu et vérifier l’adhérence et la confluence au microscope inversé, laver ensuite les cellules
avec 2 mL de milieu « Grace’s Insect » non supplémenté puis retirer le milieu de lavage.
Dans chaque tube de transfection, ajouter 800 µL de milieu « Grace’s Insect » non
supplémenté, mélanger doucement et répandre goutte à goutte la solution sur les cellules
MimicTM. Placer ensuite la plaque dans un sac plastique scellé avec un essui tout imbibé d’eau
pour éviter l’évaporation et incuber à 27°C toute la nuit.
Protocole 2

Mélanger sous la hotte dans un tube stérile de 1,5 mL :


- 1 mL de « Grace’s Insect » non supplémenté
- 10 µg de plasmide
- 20 µL de « Cellfectin® Reagent » d’Invitrogen, vortexer le mélange de transfection
10 secondes et incuber à température ambiante pendant 15 mn.
Retirer délicatement le milieu des plaques de culture cellulaire de 6 puits sans
perturber la monocouche cellulaire, répandre le milieu de transfection goutte à goutte et
incuber la plaque à température ambiante sous agitation (2 trs/mn) pendant 4 H. Ajouter
ensuite 2 mL de milieu « Grace’s Insect » non supplémenté et incuber la plaque à 27°C dans
un sac plastique scellé avec un essui tout imbibé d’eau pour éviter toute évaporation.

Clonage des cellules transfectées

- Décoller les cellules MimicTM transfectées dans une flasque de 75 cm2 à la pipette et
les transférer dans un tube de 50 mL.
- Centrifuger à 1600 rpm pendant 5 mn.
- Reprendre le culot cellulaire dans 2 mL de milieu Mimic.
- Compter les cellules à la cellule de Malassez.
- Diluer les cellules à des concentrations d’ environ 104 , 103 , 102 cellules/mL dans
une plaque de 6 puits avec du milieu Mimic additionné de zéocine à 500µg/mL.
- Incuber à 27°C jusqu’à ce que des clones apparaissent.
- Réensemencer le reste des cellules MimicTM confluentes dans une flasque de 25 cm 2
contenant du milieu Mimic additionné de zéocine à 500 µg/mL puis en flasque de 75 cm2
contenant du milieu Mimic additionné de zéocine à 500 µg/mL jusqu’à confluence et les
congeler en azote liquide.

55
- Le clonage cellulaire s’effectue en récupérant à l’aide d’une pipette de 100, les
clones visibles à l’œil nu.
- Transférer chaque clone récupéré dans une plaque de 96 puits avec du milieu Mimic
additonné de zéocine à 500 µg/mL.

- Incuber à 27°C jusqu’à confluence.


- Récupérer les cellules des puits confluents et les passer en plaque de 24 puits avec du
milieu Mimic additonné de zéocine à 500 µg/mL.
- Incuber à 27°C jusqu’à confluence.
- Récupérer les cellules des puits confluents et les passer en plaque de 6 puits avec du
milieu Mimic additionné de zéocine à 500 µg/mL.
- Incuber à 27°C jusqu’à confluence.
- Récupérer les cellules des puits confluents et les passer en flasque 25 cm2 avec du
milieu Mimic additionné de zéocine à 500µg/mL.
- Incuber à 27°C jusqu’à confluence.
- Récupérer les cellules des puits confluents et les passer en flasque 75cm 2 avec du
milieu Mimic additionné de zéocine à 500µg/mL.
- Incuber à 27°C jusqu’à confluence.
A ce stade , les milieux des flasques de 75 cm2 contenant les clones pour l’expression
des protéines Pfs16 et Pfg27/25 peuvent être récupérés, centrifugés à 1000 rpm pendant 10
mn et stockés à -20°C pour des tests ultérieurs.

Extraction de l’ADN génomique des cellules clonées


- Récupérer le milieu d’une flasque de 75 cm2, centrifuger à 1000 rpm pendant 10 mn.
- Reprendre le culot cellulaire avec 20 µL de protéinase K dans un tube de 1,5 mL et
incuber à 56°C pendant 3 H.
- Vortexer régulièrement et centrifuger à la fin de l’incubation.
- Ajouter 4 µL de RNase A (100 mg/mL), vortexer 15 s, incuber 2 mn à température
ambiante et centrifuger brièvement.
- Ajouter 200 µL de Buffer AL, vortexer 15 s, incuber à 70°C pendant 10 mn et
centrifuger brièvement.
- Ajouter 200 µL d’éthanol 100%, vortexer 15 s, centrifuger brièvement.
- Transférer le contenu du tube dans une colonne et centrifuger à 8000 rpm pendant 1
mn.

56
- Placer la colonne dans un nouveau tube collecteur, laver avec 500 µL de « Buffer »
AW1 et centrifuger à 8000 rpm pendant 1 mn.
- Placer la colonne dans un nouveau tube collecteur, laver avec 500 µL de « Buffer »
AW2 et centrifuger à 13000 rpm pendant 3 mn.
- Placer la colonne dans un tube de 1,5 mL et éluer l’ADN avec 200 µL d ‘H2O ultra-
pure
- Incuber à température ambiante pendant 5 mn et centrifuger 1mn à 8000 rpm.
Conserver l’ADN à -20°C.

Amplification des gènes pfs16 et pfg27/25 par PCR spécifique

La réaction d’amplification est la suivante :


- Tampon 10X 5 µL
- dNTPs à 10 mM 1 µL
- Amorce directe à 16 µM 1 µL
- Amorce complémentaire à 16 µM 1 µL
- MgCl2+ à 25mM 4 µL
- ADNg cellulaire 5 µL
- Taq DNA Polymérase Eurogentec 0.5 µL
- H2O ultra-pure 32.5µL
Volume total 50µL

Programme d’amplification comme précédemment décrit dans le paragraphe 3.2.3.2.

Electrophorèse sur gel de polyacrylamide

Préparation des gels à 15%

Pour 2 gels de migration, préparer :

Gel de séparation (20mL) Gel de tassement (10mL)


Acryl/Bis 30% 10 mL 1,3 mL
H2O 3,2 mL 6,1 mL
Tampon S 6,6 mL -
Tampon T - 2 ,5 mL
SDS 10% 200 µL 100 µL

57
Persulfate à 150 mg/mL 100 µL 50 µL
Temed commercial 10 µL 10 µL

Incuber 15 mn à 37°C puis éliminer la phase supérieure liquide.

Tampon S de séparation : Tris-HCl à 1,5 M, pH 8,8.


Tampon T de tassement : Tris-HCl à 0,5 M, pH 6,8.

Préparation des échantillons et du marqueur de taille

Ajouter à 25 µL de chaque lysat


- 5 µL de tampon échantillon 5X SDS-PAGE.
- 2 µL de SDS 10 %
- 2 µL de DTT 10X (2,5M)
Incuber 4 mn à 96°C et déposer 34 µL dans les puits.

Pour le marqueur de taille , prélever 5 µL du marqueur de taille Invitrogen et ajouter :


-5 µL de tampon échantillon 5X SDS-PAGE.
- 2 µL de SDS 10 %
- 2 µL de DTT 10X (2,5M)
Incuber 4 mn à 96°C et déposer 14 µL sur le gel .

Migration des échantillons


Elle se fait à 180V pendant une 1H30mn dans du tampon SDS-PAGE 1X.

Révélation du gel

Après électrophorèse SDS PAGE, le kit « BDTM Universal His Tag Western Blot kit »
est utilisé pour la détection spécifique des protéines recombinantes avec une étiquette 6xHis
telles que Pfs16 et Pfg27/25.
- Fixer le gel avec 100 mL de la solution de fixation Tris-Glycine pendant une heure.
- Laver le gel avec 100 mL d’eau ultra-pure pendant 10mn, répéter l’opération une
fois.
TM
- Incuber sous agitation le gel dans 25 mL du réactif « In vision His Tag In gel
Stain ».

58
- Laver le gel avec 100 mL de tampon phosphate 20 mM, pH 7,8 pendant 10mn,
répéter l’opération.
- Révéler le gel sur Lumi-Imager de Roche.
- Prendre une photo du gel.

La méthode de coloration a été également utilisée pour la révélation des protéines.


- Laver gel dans de l’eau ultra-pure, incuber sous agitation 5 mn, répéter l’opération 3
fois.
- Incuber sous agitation le gel dams 100 mL du réactif « Simply BlueTM Safe Stain »
pendant 1h.
- Laver le gel dans de l’eau ultra-pure.
-Prendre une photo du gel sur Lumi-Imager de Roche.

Préparation des solutions pour le bio analyseur

Solution de gel
- Mélanger 25 µL de « dye concentrate® » avec 650 µL de « gel matrix® ».

Solution de décoloration
- Prendre un tube contenant 650 µL de « gel matrix® ».
Vortexer ces deux solutions puis les transférer dans des colonnes et centrifuger à 5200
rpm pendant 15S
Solution de dénaturation
Ajouter 7 µL de DTT dans 200 µL de tampon d’échantillon et vortexer pendant 5 s.

Préparation des échantillons et du marqueur de taille


- Mélanger 4 µL de chaque échantillon ( Pfs16T1C3, Pfs16T1C4, Pfs16T1C5,
Pfg27/25T1C3, Pfg27/25T1C4, Pfg27/25T1C5, Pfg27/25T1C6,C2Pfg27/25T2, PIZ /V5His-
CAT, cellules MimicTM sauvages) avec 2 µL de solution de dénaturation dans un tube de 500
µL, vortexer 15 s.
- Pipeter 6 µL de marqueur de taille dans un nouveau tube de 500 µL.
- Chauffer les échantillons et le marqueur de taille à 95°C pendant 5 mn puis refroidir
immédiatement à 4°C pendant 10 s.
-Vortexer et ajouter dans chaque tube 84 µL d’eau ultra-pure et vortexer.

59
Préparation de la puce

- Remplir les puits G de la puce avec 12 µL de « gel-dye mix » et pour s’assurer


d’un bon remplissage des canaux exercer une pression sur le puits « G »,
- Remplir le puits « DS » avec 12 µL de solution de décoloration et le puits avec 6
µL de marqueur de taille.
- Remplir les puits restants avec 6 µL des différents échantillons et placer la puce dans
le bio- analyseur.

Purification de Pfs16 et Pfg27/25 : Mise en route du FPLC

- Mettre chaque tubules A et B dans leur tampon respectif (Tampon A 500 mM


imidazol et Tampon B 5 mM imidazol)
- Lavage des boucles du système et de la boucle d’injection 2 mL
- quand les paramètres sont stables, positionner la colonne HisTag
- Placer la colonne HisTag en prenant soin de ne pas faire de bulles dans la colonne
pour cela laisser tomber quelques gouttes avant de viser les embouts. Mettre des embouts
réducteurs.
- Laisser un peu de débit pour équilibrer la colonne
- Mettre les tubes d’échantillons sur le portoir
- Lancer la méthode His (PurifNickellinéaire)
- Vérifier si OK - RUN
- Resélectionner la méthode
- Entrer les références de l’échantillon et tampons
- Avant de faire START, injecter l’échantillon ( 1mL)dans la boucle sans bulles
- Récupérer les fractions qui correspondent à un pic d’absorbance
- Normalement après le run, un lavage de la colonne s’effectue. Si l’absorbance n’est
pas revenue au niveau de base, nettoyer la colonne avec un flow 1 mL/mn pendant un
moment.
On peut alors relancer un nouveau run.
Attention : Préférable de garder la même colonne pour une protéine donnée.
- A la fin, lavage de la colonne à l’H2OUP

60
Milieux

Low Salt LB

- 1% Tryptone
- 5% Yeast Extract
- 0,5% Nacl
pH 7,5

Low Salt LB agar

- Low Salt LB
- 15 g/L d’Agar
Autoclaver

Milieu de congélation

- 60 % de milieu Grace’s insect unsupplemented


- 30 % de FBS
- 10 % de DMSO filtré sous 0.22µM

Solutions et tampons

Solution de lyse
- 50 mM Tris
- 150 mM NaCl
- 1 % de Nonidet P-40
pH 7,8

Buffer 5X SDS-Page
- Glycérol 50 %
- -mercaptoéthanol 15 %
- SDS 15 %
- Bleu de bromophénol 1,5 %

61
PBS
- NaCl 137 mM
- KCl 2,7 mM
- Na2HPO4 10 mM
- KH2PO4 1,8 mM
Ajuster le pH à 7,4
Autoclaver

Tampon de transfert
- Tris 0.3 %
- Glycine 1.44 %
- Méthanol 10 %
pH 8.3

TBS-T
- TBS 10X
- Tween 20 0,1 %
pH 8

Phosphate Buffer 100 mM


- Phosphate de sodium monobasic 13 g
Ajuster le pH à 7,8 avec du NaOH 3 M

Solution de fixation
- Ethanol 100 mL
- Acide acétique 20 mL
Compléter avec de l’eau ultra-pure à 200 mL

Tampon Séparation :
- Tris-HCl à 1,5 M
pH 8,8

Tampon de lavage (A) :


- Imidazole 5 mM
-NaCl 300 Mm
- NaH2PO4 50 mM

Tampon d’élution (B) :


- Imidazole 500 mM
- NaCl 300 mM
- NaH2PO4 50 mM

62
SMART LADDER

Taille de l’ADN en paire de base

Quantité d’ADN estimée en ng

Zéocine

63
Définitions

Gène :

Plasmides : petites molécules d’ADN bicatenaires, circulaires, extra-chromosomiques,


susceptibles de se répliquer de façon autonome. Ils sont présents dans le cytoplasme de
nombreuses espèces bactériennes.
Les plasmides utilisés en génie génétique renferment généralement :
- un site ORI (origine de réplication)
- un site multiple de clonage
- un ou plusieurs gènes de sélection

Plasmides d’expression : plasmides ayant des signaux d’expression (promoteur de forte


affinité pour l’ARN polymérase, site de fixation des ribosomes, ATG ).

Enzyme de restriction : enzyme reconnaissant des sites particuliers sur l’ADN et qui coupe
la molécule au niveau de ces sites ou plus loin.

Bactéries compétentes : bactéries dont la membrane est fragilisée pour faciliter l’entrée
du plasmide.
Clone : le clone correspond à un grand nombre de molécules ou de cellules identiques
provenant d’un seul ancêtre (cellule ou molécule).

Transfection stable : c’est l’identification et la sélection de cellules ayant intégré l’ADN


recombinant de façon permanente dans leur génome.

Clonage : sur le plan moléculaire, isoler et amplifier un gène d’intérêt et sur le plan
cellulaire, isoler une cellule pour en obtenir un grand nombre de copies identiques.

Espèce : ensemble de souches bactériennes présentant un grand nombre de similitudes


phénotypiques et génotypiques avec des relations ADN-ADN se traduisant à la fois par des
valeurs d’hybridation supérieures ou égales à 70% et un T m (e) inférieur ou égal à 5°C.

Maturation des protéines : ce sont des modifications post-traductionnelles qui ont lieu
dans le réticulum endoplasmique et l’appareil de Golgi telles que :
- méthylation, acétylation
- sulfatation
- phosphorylation
- addition de lipides

64
- glycosylation
- formation de ponts disulfures
Ces modifications peuvent être d’une grande importance en ce qui concerne la fonction de la
protéine.

65

View publication stats