Summary and Results

Results

The HVSI mitochondrial DNA (mtDNA) sequence of Mary Joe belongs to the Eurasian
haplogroup N1a (see page 5 for background information on haplogroup N1a) and
matched sequences from numerous Eurasian populations.

Method

We determined your haplogroup* by sequencing a segment of several hundred base

pairs of DNA found in the mitochondrial genome, referred to as the “Hypervariable
Segment I” or HVSI (nucleotide positions 16024 through 16383). This segment was
sequenced and systematically compared to a database consisting of HVSI sequences of
individuals worldwide. The results of this comparison identify those sequences around
the world that exactly or closely match your own.

Your sequence was also compared to the Cambridge Reference Sequence or CRS.1
The CRS was the first human mitochondrial genome published in 1981. By comparing
your sequence to the CRS, we can identify the name of the lineage to which you belong.
These lineages are also called haplogroups. Many haplogroups are continent specific
and subdivisions of these haplogroups are often regionally specific.

Haplogroup Assignment

The HVSI sequence for Mary Joe differed from the CRS at positions np (nucleotide
position) 16147, np 16172 and np 16223 examined within the first hypervariable region
of the mitochondrial DNA (mtDNA). Ms. Poole’s sequence carries a transversion at np
16147 from a cytosine (C) to a guanine (G). This sequence is consistent with the
Eurasian haplogroup N1a.

*Words in BOLD are defined in the Glossary starting on page 13.

3
 Mary Joe’s HVSI mtDNA Sequence
The DNA sequence below is Mary Joe’s HVSI DNA sequence from np 16,001 to 16,383.
The sequence is read from left to right with the first nucleotide at position 16,001. The
electropherogram of this sequence is presented below.

ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCAC
CCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATAC
TTGAGCACCTGTAGTACATAAAAACCCAACCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAG
CAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAA
ACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCC
TTCTCGTCCCCATGGATGACCCCCCTCA

*The nucleotide positions highlighted in red represent differences between this sequence and the CRS.

Electropherogram of mtDNA sequence

for Mary Joe

4
 Background of Haplogroup N1a

Haplogroups and Geographic Specificity

Because haplogroups are continent specific and often times regionally specific, we can identify
each haplogroup with a particular geographical region. However, if an individual’s mtDNA
sequence is categorized into a more common and widely distributed haplogroup, it is extremely
difficult to distinguish common genetic ancestry with a specific geographic location or group of
peoples. The geographic specificity to which we can identify common ancestry simply depends
on the distribution and frequency of the haplogroup or haplotype themselves.

Haplogroup N1a

Haplogroup N1a is specifically found in Europe and West Asia 2 in relatively low frequencies 4.

Haplogroup N1a belongs to the West Asian limb of macrohaplogroup N. Macrohaplogroup N is

divided into East Asian and west Asian limbs. Since the West Asian and East Asian specific
haplogroups do not share common mutations with each other, it is suggestive that the two limbs
(east and west Asian) separated from one another relatively early.3

Your particular sequence (also called a haplotype) is unique and does not perfectly match any
individual sequences reported in our databases. However, your sequence is two mutational
steps (has two nucleotide differences) from an individual’s sequence reported from India, and is
only one mutational step from a sequence reported from the Russian Uralic region.

5
References

1 Anderson S, Bankier AT, Barrell BG, de Bruijn MHL, Coulson AR, Drouin J, Eperon IC, Nierlich B,
Roe A, Sanger F, Schrier PH, Smith AJH, Staden R, and Young C (1981) Sequence and organization of
the human mitochondrial genome. Nature 290:457-465.

2 Derenko MV, Grzybowski T, Malyarchuk BA, Dambueva IK, Denisova GA, Czarny J, Dorzhu CM,
Kakpakov VT, Miscicka-Sliwka D, Wozniak M, and Zakharov IA (2003) Diversity of Mitochondrial
DNA Lineages in South Siberia. Annals of Human Genetics 67: 391-411.

3 Kivisild T, Tolk HV, Parik J, Wang Y, Papiha SS, Bandelt HJ, and Villems R (2002) The Emerging
Limbs and Twigs of the East Asian mtDNA Tree. Mol. Biol. Evol. 19(10): 1737-1751.

4 Richards M, Macaulay V, Hickey E, Vega E, Sykes B, Guida V, Rengo C, Sellitto D, Cruciani F,

Kivisild T, Villems R, Thomas M, Rychkov S, Rychkov O, Rychkov Y, Golge M, Dimitrov D, Hill E,
Bradley D, Romano V, Cali F, Vona G, Demaine A, Papiha S, Triantaphyllidis C, Stefanescu G, Hatina
J, Belledi M, Di Rienzo A, Novelletto A, Oppenheim A, Norby S, Al-Zaheri N, Santachiara-Benerecetti
S, Scozzari R, Torroni A, and Bandelt HJ (2000) Tracing European founder lineages in the near eastern
mtDNA pool. American Journal of Human Genetics 67:1251-1276.

6
 General Background Information

About Mitochondrial DNA (mtDNA)

Mitochondrial DNA (mtDNA) is found in a mitochondrion, an extra-nuclear (found outside the nucleus)
structure responsible for energy production in a cell. Mitochondrial DNA is approximately 16,569 base
pairs in length, which is relatively small compared to the 3.5 billion base pairs found in an individual’s
23 chromosome pairs of the nucleus. Mitochondrial DNA is a circular genome containing 37 genes
and a section called the D-loop, which contains the Hypervariable Segment I (HVSI) region. The HVSI
region of mtDNA is very informative for providing information about human ancestry. The analyses we
perform focus on identifying mutations in the HVSI region. These mutations allow us to characterize
your mtDNA into a specific haplogroup.

Circular structure of mtDNA

with the genes and the D-loop
labeled. The mitochondrial
genome contains 16,569 base
pairs, which make up 37 genes
and the D-loop. The D-loop is a
section of mtDNA that contains
the HVSI region and is very
informative for providing
information about human
ancestry.

7
Inheritance of Mitochondrial DNA

Nuclear DNA is inherited from both parents (see diagram in the Glossary under nucleus). A
person gets half of their chromosomes from their mother and half from their father. Unlike
nuclear DNA, mtDNA is inherited strictly from the mother.

Because this DNA is uniquely maternally inherited and, unlike nuclear DNA does not recombine
to create something original, all changes in the mtDNA sequence are the result of accumulated
changes inherited from mother to offspring. Sons and daughters will inherit their mtDNA from
their mother. However, a son’s mtDNA will not be passed down to his own offspring (since it is
maternally inherited), and so the mtDNA lineage will end with the son (see the diagram below).

Most of these changes that occur in the mtDNA are selectively neutral, meaning that they have
no effect on the individual who carries them and do not produce any noticeable differences
between individuals. These changes can be used to track particular lineages of mitochondrial
DNA by comparing specific single nucleotide polymorphisms (SNPs) with other HVSI
sequences of individuals from around the world.

Diagram of the mode of inheritance of mtDNA

mtDNA is passed from mother to offspring.

Paternal Lineage
Maternal Lineage
The mtDNA lineage is only continued through
time if passed from mother to daughter,
because a daughter will pass their mtDNA to
their daughters, and so on and so forth. If
passed only to sons, the mtDNA lineage will
not continue because males do not pass on
their mtDNA.

= Female **Reading the diagram: A line between a square (male)

and a circle (female) represents a mating event, and
= Male
their offspring are represented as offshoots from the
= Maternal Lineage
uniting branch.
= Paternal Lineage

8
Mutation and Migration

During cell division and replication the mitochondrial genome is copied nearly perfectly.
However, the molecular machinery that reproduces DNA does occasionally make a mistake.
This change is called a mutation.

As people spread throughout the world, different mutations occasionally occurred in different
populations over time, allowing us to reconstruct human natural history and allowing us to
identify the origin of a person’s lineage.

Map of the emergence of Homo sapiens sapiens in Africa 100,000 years ago
and the spread and peopling of the world.

n addition, mtDNA mutates faster (in order of magnitude) than nuclear DNA, with certain regions
changing at an even greater rate. This fact makes mtDNA particularly useful for analyses at
shallow time depths, like those within the time span of the emergence of modern Homo sapiens,
because the changes accumulate more quickly.

9
As the normal process of mutation produces variability and diversity in mtDNA lineages, certain
lineages, also known as haplogroups, will appear in certain geographical regions. The
distribution of these haplogroups can be used to trace prehistoric population movements and
demographic phenomena. Haplogroups are labeled from A-Z and the genetic relationships
among haplogroups are diagramed as a genetic tree. In a genetic tree, haplogroups that are on
proximate branches are more closely related. On page 11 is a diagram of the major branches
and haplogroups of the Human mtDNA tree.

4
4

2 1
5

MtDNA lineages MtDNA lineages MtDNA lineages

MtDNA macro-lineages
MtDNA macro-lineage L H, I, J, K, T, N A, B, C, D, E
is predominant
M and N are found A, B, C, D, and X
U, V, W, and X F, G, M, P, Q, and Z
throughout Eurasia are found in the
In Africa are predominant are predominant in
and Australia Americas
in West Eurasia Asia and Oceania

10
 Major Branches and Haplogroups of the
Human mtDNA Tree

In a genetic tree, haplogroups that are on proximate branches are more closely related. Therefore,
haplogroups separated by fewer branches share a more recent common ancestry. This tree also allows
you to identify the region of origin of a haplogroup, with each geographical region distinguished by a
different color.

11
 Laboratory Procedures for mtDNA Analysis

We have extracted DNA from the cheek swab you provided us with. Cheek swabs generally
provide 0.5 to 5.0 µg of genomic DNA. A fraction of this is DNA from mitochondria, which are
extra-nuclear (outside the nucleus) organelles that contain their own DNA. DNA is extracted
from the cheek swab by placing the swab in a lysis buffer, which breaks down cell membranes,
releasing the DNA within the cell. The swab and lysis are then treated with a proteinase, an
enzyme that digests or breaks apart proteins, further freeing the DNA for later analysis. The
DNA is then purified from the digested proteins and other residue and stored in an aqueous
solution, ready to be analyzed.

To analyze the DNA, we utilize a process called the Polymerase Chain Reaction (PCR). PCR is
a technique whereby we amplify a specific region of DNA, in this case the HVSI region of
mtDNA. Through a chemical process identical to the one that replicates DNA in your own body,
we can replicate a segment of DNA many times over, in a process called DNA synthesis.

For our mtDNA analysis, we screen a region known as the first hypervariable segment (HVSI),
chosen because it contains more variation per nucleotide than other regions. Once we amplify
this region, we sequence the actual nucleotides in the DNA fragment (using a process called
cycle sequencing) and read the sequence on an automatic genetic sequencer. The results are
visible as an electropherogram, a series of peaks on a graph that indicate the exact position of
each nucleotide within the sequence. Your electropherogram is displayed on page 4.

Once your sequence is obtained, we align it with the Cambridge Reference Sequence (CRS)
(see page 3) and compare the variable nucleotide positions in order to determine the specific
lineage to which your mtDNA belongs. We also compare your sequence with a database of
several thousand to find identical or similar sequences.
GLOSSARY

ALLELE: the specific nucleotide (A,T,G,C) found at a location on the chromosome.

CAMBRIDGE REFERENCE SEQUENCE (CRS): The reference sequence to which all human
mtDNA sequences are compared. The CRS was the first complete human mtDNA sequence,
published in 1981.
CHROMOSOME: Condensed DNA. This “compact packaging” allows DNA to fit in the nucleus
of a cell. The human genome contains 23 pairs of chromosomes for a total of 46. We receive 23
from our mother and 23 from our father. Each chromosome is a single strand of DNA containing
genes. Genes provide information for the structure and function of proteins, the building blocks
of life.
23 Chromosome Pairs

ELECTROPHEROGRAM: The output of an automated genetic analyzer that shows the

sequence of a sample through fluorescent detection (your electropherogram is displayed on
page 4).
HAPLOGROUP: A group of lineages defined by linked diagnostic mutations. Human mtDNA
haplogroups are labeled A-Z and are often regionally specific. See diagram on pg.11

HAPLOTYPE: A more specific subgroup of a haplogroup. For example, your mtDNA sequence
and the sequences of other individuals whose mtDNA sequence exactly matches your own, are
considered a haplotype. Many different haplotypes are grouped together to form a more
generalized unit, called a haplogroup.
LOCUS: The position of a gene on a chromosome.

MITOCHONDRION: An extra-nuclear (outside the nucleus) organelle responsible for energy

production within the cell.
MITOCHONDRIAL DNA (mtDNA): A circular genome located in the mitochondrion that
contains different information than DNA found in the nucleus. It is approximately 16,569 base
pairs in length.

13
MUTATION: The process of a change in the genome through a mistake in the cellular
machinery that copies DNA.
NUCLEUS: The membrane bound organelle containing the genome of humans organized into
chromosomes. Note that mtDNA is located in the mitochondrion, outside of the nucleus.

The Eukaryotic Cell

extra-nuclear nucleus
space
DNA from
both parents

mitochondrion

NUCLEOTIDE: Informational sub-units, when strung together in a specific sequence make-up

DNA. There are four different sub-units: Adenine (A), Guanine (G), Thymine (T), and Cytosine
(C). Adenine and Thymine normally pair together and Guanine and Cytosine normally pair
together. Nucleotides are also referred to as bases.
NUCLEOTIDE POSITION (np): The position of each nucleotide in a genome is called the
nucleotide position (np).

POINT MUTATION: one nucleotide is exchanged for another nucleotide by mistake at a specific
location.
Original DNA strand
C

New copy
C

T
T
A
G

A T G
C

mutation: should be a ‘G’

T A C but it’s been exchanged with a ‘T’
G
C T
A C
G New copy
C

Original DNA strand

POLYMERASE CHAIN REACTION (PCR): A powerful method that exploits certain features of
DNA replication for amplifying specific DNA segments. The method amplifies specific DNA
segments by cycles of template denaturation; primer addition; primer annealing and replication
using thermostable DNA polymerase. The degree of amplification achieved is set at a
theoretical maximum of 2N, where N is the number of cycles, e.g. 20 cycles gives a theoretical
1048576 fold amplification.

PROTEINASE: An enzyme that digests or breaks apart proteins.

PURINE: A type of nucleotide or base, the information subunits of DNA. Adenine (A) and
guanine (G) are purines.
PYRIMIDINE: A type of nucleotide or base, the information subunits of DNA. Thymine (T) and
cytosine (C) are pyrimidines.
14
SNP: Single Nucleotide Polymorphism. A specific type of point mutation.
TRANSITION: A type of nucleotide-pair mutation involving the replacement of a purine with
another purine, or of a pyrimidine with another pyrimidine (e.g. GC with AT. This type of
mutation is much more common than a transversion.
TRANSVERSION: A type of nucleotide-pair mutation involving the replacement of a purine with
a pyrimidine, or vice versa for example GC with TA. This type of mutation is much less
common than a transition.

Transition Transversion

C T G T

G A C A

Y-CHROMOSOME: Humans each have one pair of sex chromosomes. The Y-chromosome is
associated with male characteristics in mammals. Females normally do not have a Y-
chromosome, but instead have two X-chromosomes (XX). Males have one X-chromosome and
one Y-chromosome (XY).

15