Molecular Human Reproduction Vol.12, No.5 pp.

321–333, 2006
Advance Access publication April 5, 2006 doi:10.1093/molehr/gal036

D9-Tetrahydrocannabinol inhibits cytotrophoblast cell

proliferation and modulates gene transcription

Manjiri Khare1, Anthony H.Taylor1,2,3, Justin C.Konje1,2 and Stephen C.Bell1,2

1
Clinical Division of Obstetrics & Gynaecology, Leicester Royal Infirmary, University Hospitals of Leicester NHS Trust and
2
Reproductive Sciences Section, Department of Cancer Studies and Molecular Medicine, Leicester Medical School, University
of Leicester, Leicester, UK
3
To whom correspondence should be addressed at: Reproductive Sciences Section, Department of Cancer Studies and Molecular
Medicine, Robert Kilpatrick Clinical Sciences Building, Leicester Royal Infirmary, P.O. Box 65, Leicester, Leicestershire, LE2 7LX,
UK. E-mail: aht3@le.ac.uk

Cannabis use in pregnancy is associated with a range of obstetrical conditions. The molecular mechanisms underlying these
effects have not been elucidated but are attributed to the actions of delta-9-tetrahydrocannabinol (D9-THC). In this study, concen-
trations of D9-THC equivalent to those found in the serum of cannabis users, i.e. ~20 mM, inhibited proliferation and activated a
restricted tight transcriptional programme in the BeWo trophoblast cell line. Employing genome-wide expression profiling meth-
ods, we found that the pattern of gene expression differs from that described in the placenta of patients with fetal growth restric-
tion (FGR), associated with either hypoxia or discordant dichorionic twins, or of patients with pre-eclampsia. It was also dissimilar
to the patterns obtained from the transcriptome of other tissues, such as the mouse brain, treated with D9-THC. The expression of
transcription factors, such as thyroid hormone receptor-b1 (TRb1), and transcriptional co-repressors, such as histone deactylase
3 (HDAC3), was affected by D9-THC in a dose-dependent manner, whereby 15 mM D9-THC caused a 2.8-fold inhibition of TRb1
expression, but a 3.5-fold increase in HDAC3 expression. These data were confirmed by end-point RT–PCR analyses and under-
pin the observed D9-THC-induced inhibition of BeWo cell proliferation. Genes encoding for growth, apoptosis, cell morphology
and ion exchange pathways were modulated by 15 mM D9-THC. This study may provide insight into the mechanisms underlying
the effects of D9-THC and cannabis use upon placental development during pregnancy.

Key words: cannabis/cytotrophoblast/marijuana/microarray/tetrahydrocannabinol

Introduction influences the development of many organs, (Harclerode, 1980) espe-

Marijuana is one of the most commonly used illicit drugs in the UK
and USA (Hutchings and Dow-Edwards, 1991; Parliamentary Office
of Science and Technology, 1996), and its use appears to be increasing
(Knight et al., 1994; King, 1997). It is difficult to quantify the risks of
marijuana use in pregnancy, as there are likely to be many confounding
variables such as the use of other drugs and associated lifestyle factors.
However, marijuana use has been associated with low birthweight,
fetal growth restriction (FGR) (Zuckerman et al., 1989), placental
abruption, preterm birth, stillbirths and spontaneous miscarriages
(Conner, 1984; Hatch and Bracken, 1986; Felder and Glass, 1998).
The most psychoactive agent in marijuana is delta-9-tetrahydrocan-
nabinol (Δ9-THC). Δ9-THC is highly lipophilic (Leuschner et al.,
1986) and has a half-life of about 8 days in fat deposits, and conse-
quently, it may take up to 1 month for it to be eliminated entirely from
the body after a single dose (Hatch and Bracken, 1986). In fact, fol-
lowing inhalation from a single marijuana cigarette, blood levels of
Δ9-THC may remain detectable for up to 30 days (Jones, 1980). These
pharmacokinetic characteristics pose a particular risk to the fetus,
because maternal tissues may act as a reservoir for Δ9-THC (Hatch
and Bracken, 1986; Leuschner et al., 1986); Δ9-THC readily crosses
the placenta (Hatch and Bracken, 1986), and this, combined with a
slow fetal clearance, (Bailey et al., 1987) means prolonged fetal exposure,
even when smoking is discontinued. Therefore, Δ9-THC potentially
cially in the first trimester.
Δ9-THC has been found to have several cellular-binding sites (Felder
and Glass, 1998), including one on DNA (Porcella et al., 1998), and can
bind to the G-coupled endocannabinoid receptors CB1 and CB2. The
endometrium and myometrium possess the cannabinoid receptors CB1
and CB2 and thus are potential targets for the action of Δ9-THC during
implantation, early pregnancy (Paria et al., 2001) and labour (Dennedy
et al., 2004). However, cannabinoid receptors are also expressed by pla-
cental tissue at term (Park et al., 2003), and although when they are first
acquired during pregnancy is unknown, expression has been detected in
early first trimester placental tissues (Helliwell et al., 2004). Interest-
ingly, levels of the endogenous cannabinoid, anandamide, fall progres-
sively during pregnancy (Habayeb et al., 2004), supporting other
evidence that low systemic levels are required for normal pregnancy
progression (Maccarrone et al., 2002). Therefore, exposure to the exo-
cannabinoid Δ9-THC could lead to inappropriate activation of the CB-
mediated pathways in the placental trophoblast. At least one action of
Δ9-THC upon placental transport, i.e. mediated by the serotonin recep-
tor and of α-amino isobutyric acid, has been proposed to be through the
CB1 receptor (Fisher et al., 1987; Kenney et al., 1999).
The BeWo cell line, derived from human gestational choriocarcinoma,
has been widely used as an in vitro model for trophoblast intercellular
fusion and differentiation (Burres and Cass, 1986; Hohn et al., 1992;

© The Author 2006. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For
Permissions, please email: journals.permissions@oxfordjournals.org 321
M.Khare et al.
Cohran et al., 1996; Kudo et al., 2004) and in toxicology studies
(Burres and Cass, 1987; Thibault et al., 2000; Nomura et al., 2004).
Additionally, these cells have been used in genome-wide analyses
(Aronow et al., 2001; Saito et al., 2001; Endo et al., 2002; Kudo et al.,
2004) that have identified putative novel targets for the mechanism of
FGR that were subsequently confirmed in animal studies to be of sig-
nificant experimental and clinical value (Loiselle et al., 2004; Nomura
et al., 2004; Ohara et al., 2004). The BeWo cell line thus provides an
appropriate model in which to study some aspects of human trophob-
last physiology and pathophysiology without the aspect of inter-
patient variability and other confounding variables. In this study, we
have therefore employed this cell line to determine whether Δ9-THC
would specifically affect cytotrophoblast cell survival and gene tran-
scription and whether extrapolation of such effects may be used to
explain the reported in-vivo effects of Δ9-THC upon clinical condi-
tions affecting feto-placental development.
Materials and methods
Materials
The human choriocarcinoma cell line BeWo (ECACC 86082803, European
Collection of Cell Cultures, Salisbury, Wiltshire, UK) was maintained in
Ham’s F12 medium (Invitrogen, Paisley, UK) supplemented with 10% fetal
calf serum (FCS) (Invitrogen) and cultured at 37°C in humidified atmosphere
of 5% CO2 in air. Δ9-THC (Sigma-Aldrich, Poole, Dorset, UK) was diluted in
ethanol and stored under nitrogen at –20°C. Oligonucleotide primers were syn-
thesized (Sigma-Genosys Ltd., Haverhill, Suffolk, UK) and desalted before
reconstitution in sterile dH2O at 200 pmol/μl and stored at –20°C.
Cell culture
BeWo cells were plated into Nunc 6-well multi-well plates in triplicate for
each data point (Fisher Scientific, Loughborough, Leicestershire, UK) at a den-
sity of 8 × 105 cells per well (Nomura et al., 2004). After 48 h culture, the
medium was exchanged with one that contained 5% FCS and 15 μM Δ9-THC
[final concentration of 0.1%(v/v) ethanol]. The control consisted of culture
medium containing 0.1%(v/v) ethanol. Cells were cultured with media plus
additives for 1 h to allow non-specific binding of Δ9-THC to plastic to reach
equilibrium. The medium was then replaced and culture continued for 48 h,
with fresh medium replaced at 24 h. Photomicrographs were obtained using a
Nikon Eclipse TE2000-U inverted microscope equipped with a DN-100 digital
camera image capture system, and percentage confluency was measured by
image analysis of pixels representing cells and substratum.
To examine the effect of Δ9-THC on cell survival and cell proliferation indi-
ces, we plated BeWo cells to Nunc 96-well plates (Fisher Scientific) at either
4 × 104 or 1 × 104 cells per well, respectively, in 200 μl of normal growth medium
and allowed them to proliferate for 48 h until the higher density cultures reached
confluency. The medium was then changed to one that contained 0–30 μM
Δ9-THC for 1 h to allow for non-specific binding. The medium was then
replaced and culture continued for 48 h, with fresh medium replaced at 24 h.
After 48 h, cell numbers were assessed using the Cell Proliferation and Apop-
tosis Kit II (Roche Diagnostics Ltd., Lewes, East Sussex, UK) as per the man-
ufacturer’s instructions with measurements taken on a Multiskan Ascent
ELISA plate reader (Labsystems Oy, Helsinki, Finland) with the detection fil-
ter set at 420 nm and the reference set at 620 nm. Cell numbers were obtained
by calibration against a standard curve of untreated BeWo cell numbers grown
in parallel (Taylor et al., 2002). To make direct comparisons between cultures,
we then converted the cell numbers to a percentage of the untreated control.
The effect of Δ9-THC dose on gene expression was obtained by culturing
BeWo cells with doses of Δ9-THC ranging from 0.3 to 30 μM in 0.1% ethanol
for 48 h, as described above.
Total RNA extraction, cRNA synthesis and microarray
hybridization
Total RNA was extracted using a combination of TRIZOL reagent (Invitro-
gen), RNeasy mini kit (Qiagen Ltd., Crawley, UK) and ethanol precipitation.
Briefly, aqueous total RNA from the TRIZOL reagent procedure was mixed
322
with ethanol applied to the RNeasy mini columns, subsequently purified and
concentrated through ethanol precipitation. RNA integrity was assessed using
agarose gel electrophoresis and Agilent 2100 Bioanalyser (Agilent Technolo-
gies, UK, South Queensferry, UK). RNA from two separate experiments per-
formed in triplicate was pooled and samples submitted to the MRC
Geneservice (Babraham, Cambridge, UK) for further purification and produc-
tion of biotinylated cRNA. Biotinylated cRNA was prepared from 10 μg of
total RNA according to Affymetrix protocols. The integrity of the labelled
cRNA and fragmentation products were assessed on the Agilent 2100 bioana-
lyser. Next, 15 μg of biotinylated cRNA fragments were hybridized to human
HU133_plus 2 microarray chips overnight and then stringently washed, stained
and scanned using a GeneArray scanner (Agilent Technologies, Palo Alto, CA,
USA), according to Affymetrix protocols.
Gene expression analysis
Fluorescence data were corrected for background fluorescence, reduced in
intensity values before normalization against internal standards. All arrays
were scaled to the same target intensity and were normalized to housekeeping
genes on the U133_plus 2 arrays and analysed using dChip Analyzer software
version 1.4 (Harvard School of Public Health and Dana-Farber Cancer Research
Institute, Boston, MA, USA, 2004; http://biosun1.harvard.edu/complab/dchip/)
using a 2-fold change in expression with an a of 0.90 and a b of 0.05 being the
statistical cut-off points for real expression changes from duplicate chips.
Hierarchical clustering was used to obtain gene expression patterns and ontology
information.
End-point RT–PCR
To confirm the data from the microarray experiment, we performed end-point
RT–PCR upon the samples used in these experiments. One microgram of total
RNA was reversed transcribed with avian myeloblastosis virus-reverse tran-
scriptase (AMV-RT; Promega, Southampton, UK) at 42°C for 1 h in the pres-
ence of 5 units of RNase inhibitor (RNasin; Promega). A minus RT reaction
was obtained by omitting the AMV-RT enzyme. At the end of the reaction, the
enzymes were denatured by heating at 95°C for 5 min and the cDNA was stored
at –20°C. One microlitre of cDNA was subject to PCR using 10 pmol/μl of spe-
cific primers for histone deactylase 3 (HDAC3), thyroid hormone receptor-β1
(TRβ1) and glyceraldehyde-3-phosphatedehydrogenase (GAPDH) using the
annealing temperatures given in Table I. The RNA from the dose-ranging study
was treated with RNAse-free DNAse 1 (Promega) before reverse transcription
and PCR amplification. PCR products were resolved on 3% agarose gels and
stained with ethidium bromide (2 μg/ml; ICN Biomedicals, Basingstoke, UK)
for 15 min, before being destained with dH2O for 30 min. Gel images were cap-
tured using a Syngene GeneGenius system (Syngene, Cambridge, UK)
equipped with GeneSnap version 6 gel documentation software. Product densi-
ties were assessed using the Scion Image beta version 4.0.2 software (Scion
Corporation, Frederick, MD, USA, 1999; http://www.scioncorp.com).
Data analysis
Subtraction of the densitometry values obtained from the –RT lanes from those
from the +RT lanes, and then division by the relative GAPDH transcript levels,
was used to correct the PCR data. These data were then normalized to the
untreated control and expressed relative to the untreated controls. All data were
then analysed for differences using one-way ANOVA with Tukey’s honest sig-
nificant difference (HSD) test with the InStat version 3.0 software package
(GraphPad Software, San Diego, CA, USA, 1998; http://www.graphpad.com).
Statistical significance was accepted when P < 0.05.
Results
Effect of D9-THC on gross BeWo cell growth, survival
and morphology
BeWo cells were plated such that cultures achieved approximately
70–80% confluency after 48 h, the point at which Δ9-THC treatments
were initiated. Confluency was achieved within 24 h of the subse-
quent 48 h culture period (data not shown). Cultures treated at 48 h
with a range of Δ9-THC demonstrated an inhibitory effect on the
BeWo cell cultures (Figure 1A and B), but only at concentrations in
 Effects of D9-THC upon BeWo cells

Table I. Oligonucleotide primer sequences and expected amplicon sizes

mRNA species Oligonucleotide sequence Product size (bp) Annealing Accession number
temperature (°C)

GAPDH
671
5′ AGAACATCATCCCTGCCTC689 347 60 X01677*
1017
3′ GCCAAATTCGTTGTCATACC998
HDAC3
1576
5′ GGGACATTATTGGCAGTG1593 233 55 U75697
1808
3′ GGATTCAGGTGTTAGGGAG1790
TRβ1
59
5′ GCGATTTCCTTCTGGTTG76 314 and 168 55 NM-000461.2
372
3′ AGTGCTTCGGTTTGTCCC355

*From Hall et al. 1998.

Figure 1. The dose-dependent effect of Δ9-tetrahydrocannabinol (Δ9-THC) upon BeWo cell growth, morphology and survival. (A) Photomicrographs of BeWo
cells treated with 0.1% ethanol (control) or the indicated concentrations of Δ9-THC for 48 h. Areas not covered with cells are arrowed. Data are representative of
five experiments performed in triplicate. Scale bar = 120 μm (B) Graph showing the dose-dependent effect of Δ9-THC on BeWo cell culture confluency. Data are
mean ± SEM of four experiments performed in triplicate; *P < 0.05 one-way ANOVA with Tukey’s honest significant difference (HSD) test. (C) Graph showing
the dose-dependent effect of Δ9-THC on inhibiting BeWo cell numbers when the cells were grown to 25% confluency (sub-confluent) before treatment compared
with a lack of effect on cell numbers grown to confluency. Data are the mean ± SEM of two experiments performed in quadruplicate; **P < 0.001 one-way
ANOVA with Tukey’s HSD test.

excess of 3 μM Δ9-THC, where confluency was significantly reduced
from ∼95 to ∼70% (*P < 0.05; one-way ANOVA with Tukey’s HSD
test; n = 4). Cultures treated with 15 and 30 μM Δ9-THC did not reach
confluence (Figure 1A and B). There did not appear to be any
increased cell death or failure to attach to the substratum as evidenced
by the lack of increase of shedding of cells in the spent medium. Anal-
ysis of the effect of Δ9-THC on BeWo cell survival and proliferation
revealed that cultures that reached confluency before treatment
remained stable (1.32 ± 0.065 × 105 compared with 1.22 ± 0.063 × 105
cells per well; P = 0.37, n = 8 ANOVA with Tukey’s HSD test) and
confirmed the observation that the effect of Δ9-THC on BeWo cul-
tures was not due to increased cell death. Sub-confluent cultures
treated with Δ9-THC demonstrated a significant dose-dependent inhi-
bition of cell numbers at concentrations above 3 μM Δ9-THC after 48 h
(Figure 1C). These cultures failed to exceed the 30% confluency level
(the untreated cultures reached a cell density of 3.7 ± 0.31 × 104 cells
323
M.Khare et al.
per well from an initial density of 1 × 104 cells per well). However,
15 μM Δ9-THC inhibited cell proliferation so that the final cell density
was 2.25 ± 0.19 × 104 cells per well after Δ9-THC treatment (P <
0.001; n = 8; ANOVA with Tukey’s HSD test). Further morphological
examination of cell cultures treated with 15 μM Δ9-THC indicated
that the inhibitory effect resulted from a decrease in growth rather than
involution of the culture after achieving confluency (Figure 2).
Microarray analysis: identification of D9-THC-regulated
transcripts
The use of microarray analysis facilitates the global assessment of
transcriptional profiles of cells. A number of studies have established
Figure 2. Representative photomicrographs of (A) untreated BeWo cells or
treated with 15 μM Δ9-tetrahydrocannabinol (Δ9-THC) for (B) 24 h or (C) 48 h
(five experiments performed in triplicate). Scale bar = 120 μm.
324
the very high degree of reproducibility across replicate GeneChip
experiments (Irizarry et al., 2003; Cope et al., 2004). In this study, to
ensure consistent data, we adopted both biological (experiments per-
formed four times in triplicate) and technical replicates (hybridizations
performed twice) for these studies, whereas others adopt either bio-
logical (Hoffman et al., 2004) or technical replicates (Kudo et al.,
2004), but seldom both (Kothapalli et al., 2002). Therefore, total RNA
from two sample pools of the control and 15 μM Δ9-THC-treated cul-
tures (n = 12) were used to generate biotinylated target cRNA and
hybridized to HU133A_Plus 2 arrays, which represented approximately
56 000 characterized transcripts and expressed sequence tags (ESTs).
Scaling factors, noise and percentage of present and absent calls showed
only minor variations between arrays, an essential requirement when
comparing multiple arrays. These replicate gene chip experiments
revealed an overall correlation (r2 = 0.89) with an average of only
0.04% of probe sets showing more than a two-fold change between the
replicate experiments. The number of genes induced and repressed on
microarray 1 at the two-fold level were 304 and 105, respectively,
whereas the number induced and repressed on microarray 2 were 220
and 50, respectively, representing a mean error measurement rate of
only 0.5%. When the cut-off was reduced to 1.6-fold, the number of
genes induced and repressed on microarray 1 were 1504 and 1127,
respectively, whereas the number induced and repressed on microarray
2 were 2291 and 5670, respectively, representing a mean error measure-
ment rate of 26.3%. Under these conditions, it was considered that
26.3% error lacked precision for detailed transcriptome analysis and the
conventional two-fold cut-off point was used (Cope et al., 2004).
Focusing on genes showing an increased level of expression on both
arrays and using a two-fold change cut-off, we identified 134 genes of
which the top 20 genes are mentioned in Table II. Focusing on genes
showing a decreased level of expression on both arrays with a two-fold
(50%) change cut-off, we identified only 18 genes (Table II).
Confirmation of microarray data
To validate the microarray analysis data, we chose two candidate
genes, histone deacetylase 3 (also known as MALAT-1; HDAC3) and
TRb1, for further study as they were represented by several probe sets
on the HU133_plus 2 microarray chip and were significantly modu-
lated more than two-fold and <50% respectively on both arrays. TRb1
was of significant interest because it is associated with placental func-
tion and development (Kilby et al., 1998; Yen, 2001; Barber et al.,
2005), and direct perturbation of the maternal hypothalamic–
pituitary–thyroid–placental axis is a direct cause of multiple obstetri-
cal problems (Nickel and Cattini, 1991; Ohara et al., 2004). HDAC3 is
of potential interest because it is associated with transcriptional regu-
lation, cell cycle progression and developmental events, and perturba-
tion of its activity is potentially linked with placental development
(Jho et al., 2005).
The cycle numbers for each set of primers were obtained empiri-
cally with an untreated BeWo cell extract (Figure 3), and subsequent
reactions were performed at 35, 34 and 26 cycles for HDAC3, TRβ1
and GAPDH, respectively, with the extension step for HDAC3 and
TRβ1 starting at 1 min at 72°C and increasing by 5 s/cycle. End-point
RT–PCR with the pooled RNA extracts from the control and 15 μM
Δ9-THC-treated BeWo cells showed a 2.34-fold change in HDAC3
transcript levels from experiment 1 and 2.85-fold change from experi-
ment 2 (Figure 4A); the mean was 2.58-fold (Figure 4B). By contrast,
the mean fold change for HDAC3 on microarray 1 was 6.51-fold and
on microarray 2 was 2.45-fold with a median fold change of 3.47-fold
(Table II). The levels of transcripts for TRβ1 (Lazar, 1993), found by
combining the levels for 5′-mRNA variants ABCF (short form; 168 bp)
and variants DE (long form; 314 bp) (Mannavola et al., 2004), were
 Effects of D9-THC upon BeWo cells

Table II. Putative target genes of Δ9-tetrahydrocannabinol (Δ9-THC) identified by microarray analysis

Probe set Gene listing Fold 1 Fold 2 Median fold % Change Accession
change number

Up-regulated genes
227062_at Trophoblast-derived non-coding RNA/plectin 1 6.81 2.07 5.23 423 AU155361
229713_at cDNA FLJ13267 fis, clone OVARC1000964 7.79 3.00 3.69 269 AW665227
224726_at DAPK-interacting protein 1 5.63 2.57 3.58 258 W80418
224568_x_at Metastasis associated in lung adenocarcinoma transcript 1/ 6.51 2.45 3.47 247 AW005982
MALAT-1/HDAC3
244804_at Sequestosome 1 4.74 2.63 3.44 244 AW293441
208610_s_at Serine/arginine repetitive matrix 2 4.93 2.13 3.42 242 AI655799
225640_at Hypothetical gene supported by AK091718 (LOC401504), mRNA 4.94 2.56 3.38 238 AA875998
239451_at Tumour rejection antigen (gp96) 1 4.49 2.33 3.38 238 AI684643
234605_at Homo sapiens cDNA: FLJ21233 fis, clone COL00789 3.51 3.15 3.37 237 AK024886
239274_at Transcribed sequence with weak similarity to protein 4.99 2.18 3.29 229 AV729557
NP_062553.1 hypothetical protein FLJ11267
1554178_a_at Hypothetical protein MGC39518 5.11 2.69 3.26 226 BC039295
1558080_s_at Hypothetical protein LOC144871 3.88 2.17 3.21 221 BG913589
213593_s_at Transformer-2α 3.50 2.15 3.20 220 AW978896
239742_at Tubby like protein 4 4.14 2.59 3.19 219 H15278
1561097_at Clone IMAGE:5270855, mRNA 2.48 3.84 3.14 214 BC040602
237469_at Unknown protein; UG = Hs.242998; EST 3.23 2.52 3.07 207 T96523
233819_s_at Zinc finger protein 294 4.79 3.27 3.04 204 AK023499
236524_at cDNA FLJ37319 fis, clone BRAMY2018027 3.20 2.16 3.03 203 AA737437
242528_at cDNA FLJ31668 fis, clone NT2RI2004916 2.08 5.98 3.03 203 AI473887
212468_at Sperm-associated antigen 9 4.28 2.63 2.99 199 AK023512
223940_x_at Metastasis associated in lung adenocarcinoma transcript 1/ 5.93 2.21 2.96 196 AF132202
MALAT-1/HDAC3
227740_at Kinase interacting with leukemia-associated gene (stathmin) 4.91 3.32 2.95 195 AW173222
236327_at Transcribed sequences 3.56 2.75 2.94 194 AA767373
201730_s_at Translocated promoter region (to activated MET oncogene) 4.31 3.42 2.93 193 BF110993
201996_s_at SMART/HDAC1-associated repressor protein 4.88 2.09 2.87 187 AL524033
222413_s_at Myeloid/lymphoid or mixed-lineage leukemia 3 4.46 3.09 2.87 187 AW137099
222576_s_at Eukaryotic translation initiation factor 2C, 1 4.70 4.08 2.86 186 AW071829
213067_at Myosin, heavy polypeptide 10, non-muscle 5.76 2.41 2.85 185 AI382123
211944_at HbxAg transactivated protein 2 3.65 2.41 2.80 180 BE729523
216550_x_at Ankyrin repeat domain 12 3.61 2.87 2.78 178 X80821
Down-regulated genes
211106_at Suppressor of Ty 3 homolog (S. cerevisiae) −3.49 −218.65 −89.12 98.8 AF064804
204133_at RNA, U3 small nucleolar interacting protein 2 −2.49 −152.67 −69.80 98.6 NM_004704
214729_at TWIST neighbour −2.06 −62.76 −22.89 95.6 AA400421
216588_at Ribosomal protein L7 −2.62 −4.87 −4.07 75.4 AL031577
212444_at Retinoic acid induced 3 −3.20 −1.92 −3.80 73.7 AA156240
212838_at Dynamin-binding protein −2.25 −4.83 −3.15 68.3 AB023227
209907_s_at Intersectin 2 −3.06 −4.41 −2.80 64.3 AF182198
229657_at Thyroid hormone receptor, b [erythroblastic leukemia viral –5.28 –2.98 –2.79 64.2 BF431989
(v-erb-a) oncogene homolog 2, avian]
242229_at N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D .2.06 −5.39 −2.66 63.4 W01715
241617_x_at EST moderately similar to 810024C cytochrome oxidase I −3.86 −4.27 −2.64 62.1 BE961949
1555433_at Solute carrier family 39 (zinc transporter), member 14 −2.90 −3.07 −2.64 62.1 BC015770
234179_at Homo sapiens cDNA: FLJ23200 fis, clone KAIA38871. .2.67 −7.00 −2.57 61.1 AK026853
238493_at Zinc finger protein 506 −2.05 −4.71 −2.53 60.5 AI559570
244752_at Hypothetical protein LOC220929 −2.09 −4.63 −2.49 59.8 AI563915
238283_at Hypothetical protein LOC151658 −2.07 −3.84 −2.42 58.7 AI685344
222341_x_at Transcribed sequences −3.50 −2.71 −2.10 52.4 AW973235
224321_at Transmembrane protein with EGF-like and two follistatin-like −2.11 −2.00 −2.07 51.7 AB004064
domains 2
207350_s_at Vesicle-associated membrane protein 4 −2.00 −2.04 −2.02 50.5 NM_003762

LOC, LocusLink; UG, Unigene; EST, expressed sequence tag; fold 1, mean fold change array 1; fold 2, mean fold change array 2; median fold change, median fold
change for both arrays; % change, % movement from 100%. The top 20 most up-regulated and the 18 down-regulated probe sets are shown. Genes studied to
confirm the microarray data are shown in bold.

shown to be decreased by 4.61-fold (78.3%) in experiment 1 and by
3.36-fold (70.2%) in experiment 2 (Figure 4C); the mean was 3.90-
fold (74.3%), which compared favourably with the 5.28-fold (81.1%)
and 2.98-fold (66.5%) reductions in the two microarrays, respectively.
The median change in TRβ1 levels was 2.79-fold (64.1%; Table II).
Variant G (Frankton et al., 2004) was not observed in any BeWo extract.
Effect of D9-THC dose on HDAC3 and TRb1 mRNA levels
Treatment of BeWo cells with Δ9-THC did not show a dose-dependent
increase on HDAC3 mRNA expression, but a threshold effect at 3 μM
(Figure 5). At this dose, HDAC3 mRNA levels increased by 1.55-fold
and reached a maximum of 1.70-fold change at 15 μM (Figure 5). By
contrast, there was a dose-like effect on the repression of TRβ1 that
325
M.Khare et al.
Figure 3. Optimization of cycle numbers for HDAC3 and TRβ1 end-point
RT–PCR assays. RNA extracts from BeWo cells was reverse transcribed into
cDNA and subjected to PCR with gene-specific primers (Table I) and resolved
on 3% agarose ethidium bromide-stained gels. The relative levels of amplicon
were determined as described in the Methods section. Data are the mean of the
two experiments.
only reached a significant 75.3% decrease at 15 μM Δ9-THC (Figure 5)
that was not further suppressed by 30 μM Δ9-THC.
Grouping of genes on the microarray by function
K-means and hierarchical clustering of the 134 up-regulated and 18
down-regulated genes identified by the microarray analysis identified
nine major groupings: growth and apoptosis genes; cell morphology and
contraction genes; transcription factors; transcription regulation genes;
326
RNA processing and translation genes; protein trafficking genes; ion
channels and transducers genes; lipid metabolism genes; and hypothetical
proteins and EST genes. These groups are identified where possible in
Table III. Because morphologically the BeWo cell cultures appeared to be
affected by either failure to proliferate, or increased apoptosis, or contrac-
tion of cultures, and because the microarray is a measure of the transcrip-
tional activity of the BeWo treated cultures, analyses of the modulation of
transcripts implicated in these pathways were performed.
The analyses revealed that several genes implicated in the control
of cell cycle progression were affected by 48 h Δ9-THC treatment.
These included insulin-like growth 1 receptor, which has been
implicated in cancer cell survival through p53-dependent pathways
(Girnita et al., 2003), cyclin-dependent kinase 11, which associates
with cyclin type L and initiates pre-mRNA splicing events (Hu
et al., 2003), and HDAC1-associated repressor protein (also known
as SMART/Msx1/SHARP/SMART/SPEN), which is involved in
zebrafish neurogenesis (Cunliffe, 2004) and murine neuromuscu-
loskeletal development (Ishii et al., 2003). By contrast, transcripts
that are involved with apoptosis tended to be pro-apoptopic rather
than anti-apoptopic, e.g. death-associated protein kinase (DAPK)-
interacting protein 1 (Dip1), which antagonizes the anti-apoptotic
function of DAPK in Hela cells to promote caspase-dependent apop-
tosis (Jin et al., 2002) and cell division and apoptosis regulator 1
(CARP-1), which promotes retinoid-stimulated cell apoptosis (Rishi
et al., 2003) (Table III).
Although the major cell contraction genes actin and myosin were not
regulated by Δ9-THC, non-muscle myosin (heavy polypeptide 10) and
protein phosphatase 1, which are predicted to function in a similar
manner to myosin, were both up-regulated (Table III), as were several
genes that regulate cell morphology by providing or destroying
cytoskeletal frameworks, e.g. plectin (trophoblast-derived non-coding
RNA/Hemidesmosomal protein 1 intermediate filament-binding pro-
tein 500 kDa) (Uitto and Pulkkinen, 1996), whereas intersectin 2 and
dynamin-binding protein (McGavin et al., 2001) were down-regulated.
The main effect of Δ9-THC was to regulate transcription factors and
regulators of transcription with 50 up-regulated and five down-
regulated genes (Table III). Transcripts for the ‘orphan’ nuclear receptors
(NR1D2/EAR-1R/Rev-erb-beta/RVR and Nor-1) and the β-isoform
of the TR that interact with receptors for retinoic acid to control gene
transcription (Wolf, 2002) were up-regulated as were several tran-
scriptional co-regulators, such as histone deacetylase 3 (MALAT-1/
HDAC3/PRO1073) that interacts with TRs and other nuclear recep-
tors to enhance transcriptional activity and interacts with Phox2 to
regulate the dopamine β hydroxylase promoter (Xu et al., 2003).
Ribosomal subunit expression was also represented on the microarray
chips and several of these genes such as U3 small nucleolar inter-
acting protein 2 and RNA motif-binding protein 25 (Table III) were
regulated. Additionally, the transcripts for several ‘initiation of trans-
lation’ proteins were increased.
A number of other transcripts for genes involved in trophoblast
function were noted to be affected by Δ9-THC treatment, e.g. solute
carrier family 40 also known as ferroportin 1 (Wallace et al., 2002),
which is involved in iron transport and solute carrier family 4 member
7 (SLC4A7) which is involved in bicarbonate and small anion trans-
port (Loiselle et al., 2004). The most down-regulated membrane pro-
tein was the orphan G-protein coupled receptor family-related retinoic
acid-induced protein, RAIG3/GPRC5C (Robbins et al., 2000), that
may be involved in calcium sensing (Brauner-Osborne et al., 2001).
Interestingly, an enzyme involved in the synthesis of the endocan-
nabinoid, anandamide, N-acyl-phosphatidylethanolamine-hydrolyzing
Phospholipase D (NAPE-PLD; Habayeb et al. 2002) and an uncharac-
terized lipoprotein lipase, associated with fatty acid transport (Garnica
and Chan, 1996), were both down-regulated.
 Effects of D9-THC upon BeWo cells

Figure 4. Comparison of the transcript levels in the microarray and the end-point RT–PCR of the pooled RNA samples used in the microarray experiments.
HDAC3 mRNA levels determined by RT–PCR (A) from control Array 1 and Array 2 (+RT; lanes 1 and 5), control Array 1 and Array 2 (–RT; lanes 2 and 6), 15 μM
Δ9-tetrahydrocannabinol (Δ9-THC) Array 1 and Array 2 (+RT; lanes 3 and 7), 15 μM Δ9-THC Array 1 and Array 2 (–RT; lanes 4 and 8). (B) Graphical representa-
tion of HDAC3 transcript levels in the microarray (fluorescence) compared with those of the end-point RT–PCR (corrected for GAPDH levels). TRβ1 mRNA levels
determined by RT–PCR (C) from control Array 1 and Array 2 (+RT; lanes 3 and 5), control Array 1 and Array 2 (–RT; lanes 4 and 6), 15 μM Δ9-THC Array 1 and
Array 2 (+RT; lanes 1 and 7), 15 μM Δ9-THC Array 1 and Array 2 (–RT; lanes 2 and 8). (D) Graphical representation of TRβ1 transcript levels in the microarray
(fluorescence) compared with those of the end-point RT–PCR (combined long and short-form transcripts, corrected for GAPDH levels). Data are mean ± SD from
15 fluorescence points in duplicate (microarray) and two data points for the end-point RT–PCR (C).

The microarray analysis also revealed the regulation of several tran-
scripts for which the predicted protein has no known function (Table III).
Discussion
Employing concentrations of Δ9-THC that are detected in patients
using cannabis for recreational use (Cherlet and Scott, 2002), we have
demonstrated that 3–30 μM Δ9-THC inhibited BeWo cell proliferation
in a dose-dependent manner. Conversely, the same doses of Δ9-THC
showed no significant effect on confluent cell cultures indicating no
toxic or pro-apoptopic effect of Δ9-THC upon BeWo cells. Through
microarray analysis, we have also demonstrated distinct changes in
the pattern of transcription by the BeWo cells in response to 15 μM
Δ9-THC. However, only a relatively low number of transcripts were
consistently modulated that suggested a tight transcriptional control
be manifested in the Δ9-THC-treated BeWo cultures. The reason for
this is not readily apparent but may be part-way due to the conven-
tional two-fold cut-off point used in microarray analyses. However,
although ‘raising the bar’ to 1.6-fold increased the number of tran-
scripts that were regulated by Δ9-THC in the BeWo cell, an unaccept-
able significant increase in the amount of experimental variability
from 0.5 to 26.3% was also introduced which would lead to false-
positive identification of non-regulated transcripts. These data mean
that several transcripts that might be considered relevant could have
been omitted from these analyses in an attempt to obtain precision and
identify the most likely mediators involved in Δ9-THC-induced BeWo
cell-growth inhibition. The tight regulation of the transcriptome is not
limited to this study, as similar tight transcriptional control mecha-
nisms have been demonstrated in neurons undergoing apoptosis that
do not modulate ‘classical’ apoptosis proteins (Desagher et al., 2005).
The effects of Δ9-THC upon BeWo cells also appeared to be cell
specific in that although expression of CPNE6 (copine VI), the lipid
metabolizing, neuronal form of the copine vesicle transport family of
calcium-sensing proteins, and LlGI 1, a cytoskeletal protein that
associates with non-muscle myosin II heavy chain to control asym-
metrical cellular polarization in neuroblasts (Klezovitch et al., 2004),
was repressed in both BeWo cells and the brain of Δ9-THC-treated
mice (Parmentier-Batteur et al., 2002), no overlap in the expression
pattern of other genes was noted. The altered transcripts belonged to
seven functional groups with the largest number being transcriptional
regulators, such as TRβ1, their co-regulators, such as HDAC3 (Table III),
suggesting that one of the major effects of Δ9-THC on the BeWo cell
is the regulation of gene transcription and RNA processing.
As cannabis use during pregnancy is associated with FGR, the present
microarray data were compared with such data derived from placental
tissue obtained from conditions associated with FGR. Interestingly,

327
M.Khare et al.
Figure 5. Dose effect of Δ9-tetrahydrocannabinol (Δ9-THC) on HDAC3 (A)
and TRβ1 (B) mRNA transcript levels. Cell extracts from BeWo cells treated
with the indicated concentrations of Δ9-THC were subjected to RT–PCR and
amplicon levels corrected for input GAPDH levels. Data are normalized to the
control (0) levels. Data are mean ± SEM of five experiments performed in tripli-
cate. *P < 0.05, **P < 0.01 one-way ANOVA with Tukey’s HSD test.
expressions of genes that were altered in placental tissue from
hypoxia-induced FGR, such as adipophilin and vascular endothelial
growth factor (VEGF) (Roh et al., 2005), or from discordant dichori-
onic twins-associated FGR, (Endo et al., 2002) such as SMAD4 and
CDC46 (Endo et al., 2002), were not altered in Δ9-THC-stimulated
BeWo cells. Similarly, many of the changes found in our analyses
were not present or found on cDNA arrays used in these related
genome-wide studies, providing an incomplete analysis. Although
expressions of genes that were altered in association with in vitro syn-
cytial formation, such as integrin-α1 (Reimer et al., 2002), or in pla-
cental tissue in association with pre-eclampsia, such as hCG (Kudo et al.,
2004), were elevated by Δ9-THC-stimulation, this increase did not
achieve the two-fold cut-off value used for selection (data not shown)
but could be of biological significance in that several genes only
require a modest increase in transcript levels to provide a more sub-
stantial increase in protein product (Storey and Storey, 2004). These
data, if reflective of the in vivo situation, may suggest that the mecha-
nisms underlying FGR associated with hypoxia and/or pre-eclampsia
328
are fundamentally different to the mechanisms involved in the FGR
associated with in vivo Δ9-THC exposure.
In addition to the robust approach to microarray analysis (Li et al.,
2004), we validated the results from the microarray analysis by exam-
ining the expression of two identified transcripts, TRβ1 and HDAC3,
that are both regulators of transcriptional programming and are impli-
cated in cell growth and development. The effect of Δ9-THC on
HDAC3 mRNA levels was not dose-dependent but appeared to show
a hormetic effect (Calabrese, 2005) that exceeded control levels at
∼3 μM Δ9-THC. HDAC3 is a transcriptional co-regulator protein that
interacts with other members of the histone deacetylase family of
genes, such as HDAC7 or HDAC10. It is a subfamily 1 member which
contains proteins that regulate the G1-phase of the cell cycle and is
known to complex with NCOR1 and NCOR2, TBL1X, TBL1R,
CORO2A and GPS2 to form large multi-protein complexes that con-
stitute the N-Cor repressor complex, responsible for the deacetylation
of lysine residues on the N-terminal part of the core histones (H2A,
H2B, H3 and H4) (Guenther and Lazar, 2003). Histone deacetylation
in turn gives a tag for epigenetic repression and plays an important
role in transcriptional regulation, cell cycle progression and develop-
mental events. The observed increase of HDAC3 expression in
response to Δ9-THC may underlie its effects upon BeWo cell cultures
(Figure 3) and if present in vivo suggests it may be linked to an inhibi-
tion of cytotrophoblast cell-cycle progression and subsequent placental
development.
Of significance in this study was the observed Δ9-THC suppression
of TRβ1 expression, which was repressed in a dose-dependent man-
ner. Linear-trend analysis of the TRβ1 mRNA levels (data not shown)
indicated that this effect reached significance at 15 μM Δ9-THC. Tri-
iodothyronine (T3) plays a key role in the developing placenta and
fetus (Ohara et al., 2004), and loss of its action by maternal hypothy-
roidism, placental deiodinase deficiency or mutations in the TRs may
lead to FGR and placental insufficiency (Ohara et al., 2004). TR is
involved in the normal proliferation and function of the trophoblast
cell (Ohara et al., 2004), and although all four TR isoforms, TRα1,
TRα2, TRβ1 and TRβ2 are found in the human placenta (Kilby et al.,
1998), expression of only TRβ1 has been consistently reported (Chan
et al., 2004), indicating that TRβ1 may be the most important TR in
the placenta. Although there are multiple TRβ1 5′-untranslated region
(UTR) transcripts (Frankton et al., 2004), they produce two main tran-
scripts, a short form and a long form (Mannavola et al., 2004). We
designed PCR primers that would distinguish between these two
isoforms and thus determined whether there was any differential regu-
lation of the long and short forms and found that both the long and
short forms of the TRβ1 mRNA transcripts were repressed by Δ9-THC
(Figure 5), indicating a common mechanism of action, presumably
through the TRβ1 promoter, although other intermediary molecules
may be involved.
Other functions proposed for T3 in the placenta have included stim-
ulation of placental lactogen production as demonstrated in normal
trophoblast (Stephanou and Handwerger, 1995) and BeWo cell cul-
tures (Nickel and Cattini, 1991) and increased progesterone produc-
tion by early placental tissue (Maruo et al., 1991). Therefore,
repression of TRβ1 expression may lead to loss of T3-regulated func-
tions in the trophoblast. Additionally, any loss of TRβ1 would allow
its promiscuous partners RXR and RAR (Stephanou and Handwerger,
1995) to interact with retinoid-induced genes such as the two pro-
apoptotic genes, retinoic acid induced 3 (RAIG3/GPRC5C) and
CARP-1, the expression of which were both found to be up-regulated
by Δ9-THC in this study. If caused in vivo, this may manifest as
increased apoptosis, and hence compromised placental growth and
function in patients.
 Effects of D9-THC upon BeWo cells

Table III. Classification of differentially expressed genes and their putative functions

Putative classification and ID Accession number Fold change % Change

Apoptosis and growth genes

DAPK-interacting protein 1 NM_020774 3.58 258
Sperm-associated antigen 9 AK023512 2.99 199
Kinase interacting with leukemia-associated gene (stathmin) AW173222 2.95 195
SMART/HDAC1-associated repressor protein AL524033 2.87 187
Mortality factor 4 like 2 AI700608 2.67 167
Insulin-like growth factor 1 receptor H05812 2.34 134
Hypothetical protein FLJ14624 BC018707 2.32 132
Cyclin-dependent kinase (CDC2-like) 11 AA994004 2.25 125
Cell division cycle and apoptosis regulator 1 W73136 2.19 119
TRK-fused gene AI908188 2.15 115
Splicing factor, arginine/serine-rich 2, interacting protein W084759 2.06 106
M-phase phosphoprotein, mpp8 BF678375 2.03 103
Hypothetical protein FLJ11362 (similar to BCL-6 interacting corepressor isoform 1) NM_021946 2.01 101
Splicing factor, arginine/serine-rich 2, interacting protein AW084759 2.06 106
Suppressor of Ty 3 homolog (S. cerevisiae) AF064804 −89.12 98.9
Transcription factors
Hypothetical protein F23149_1 NM_019088 137.09 —
Sequestosome 1 AW293441 3.44 244
Tubby-like protein 4 H15278 3.19 219
Zinc finger protein 294 AK023499 3.04 204
Nuclear factor of activated T-cells 5, tonicity-responsive NM_006599 2.77 177
Bobby sox homolog (Drosophila) BF448315 2.59 159
Myeloid/lymphoid or mixed-lineage leukemia AF272384 2.44 144
Zinc finger, CCHC domain containing 2 BE676543 2.41 141
Hypothetical protein LOC200933 BF590021 2.21 121
Zinc finger protein 21 (KOX 14) T67481 2.18 118
CTD-binding SR-like protein rA9 BC004950 2.16 116
Zinc finger protein 198 AL136621 2.14 114
Zinc finger protein 91 homolog (mouse) AA758013 2.09 109
Ubinuclein 1 T70262 2.04 104
Basic transcription element binding protein 1 AI690205 2.03 103
Nuclear receptor subfamily 1, group D, member 2 N32859 2.01 101
Hypothetical protein LOC220929 AI563915 −2.49 59.9
Thyroid hormone receptor, beta BF431989 −2.79 64.2
TWIST neighbour AA400421 −22.89 95.6
Transcription co-regulators
PRO1073 protein (Histone deacetylase 3/HDAC3) AL037917 2.47 147
Hypothetical protein MGC39518 BC039295 3.26 226
Metastasis associated in lung adenocarcinoma transcript 1 (MALAT-1/HDAC3) AW005982 3.47 247
Serine/arginine repetitive matrix 2 AI655799 3.42 242
Myeloid/lymphoid or mixed-lineage leukemia 3 AW137099 2.87 187
Ankyrin repeat domain 12 X80821 2.78 178
Homeodomain interacting protein kinase 1 AI393355 2.39 139
Transcriptional coactivator tubedown-100 NM_025085 2.23 123
Nuclear receptor coactivator 3 NM_006534 2.11 111
Hypothetical protein FLJ25778 AW967956 2.10 110
Topoisomerase (DNA) II alpha 170 kDa AU159942 2.05 105
RNA processing and translation
tRNA nucleotidyl transferase, CCA-adding, 1 BC005184 322.97 —
Tumour rejection antigen (gp96) 1 AI684643 3.38 238
Eukaryotic translation initiation factor 2C, 1 AW071829 2.86 186
Hypothetical protein FLJ14281 BF590675 2.62 162
Eukaryotic translation initiation factor 2C, 2 AI832074 2.58 158
Poly(rC)-binding protein 2 AW103422 2.58 158
Tetratricopeptide repeat domain 3 AI652848 2.56 156
U2-associated SR140 protein BE464843 2.44 144
Natural killer-tumour recognition sequence AI688640 2.44 144
Spinocerebellar ataxia 1 (ataxin 1) AW235612 2.39 139
Full length insert cDNA YQ11E04 AI076351 2.32 132
DnaJ (Hsp40) homolog, subfamily C, member 3 AL119957 2.27 127
Golgi apparatus protein 1 NM_012201 2.25 125
Quaking homolog, KH domain RNA binding (mouse) AA935633 2.23 123
RNA-binding motif protein 25 BE466128 2.22 122
NP220 nuclear protein AI308174 2.21 121
Hypothetical protein MGC12103 BE328312 2.20 120
RNA-binding motif protein 4 NM_002896 2.20 120
Ribosome-binding protein 1 homolog 180 kDa (dog) BE646396 2.13 113
Kinase interacting with leukemia-associated gene (stathmin) AI249980 2.12 112
Protein kinase, interferon-inducible double stranded RNA dependent activator AA279462 2.11 111
Aldehyde dehydrogenase 6 family, member A1 AF130089 2.03 103

329
M.Khare et al.

Table III. Continued

Putative classification and ID Accession number Fold change % Change

Ribosomal protein L7 AL031577 −4.07 75.4

RNA, U3 small nucleolar interacting protein 2 NM_004704 −69.80 98.6
Protein trafficking
Translocated promoter region (to activated MET oncogene) BF110993 2.93 193
Sorting nexin family member 27 NM_030918 2.20 120
Vesicle-associated membrane protein 4 NM_003762 −2.02 50.5
Intersectin 2 AF182198 −2.80 64.3
Dynamin-binding protein AB023227 −3.15 68.3
Structural and morphogenesis proteins
Trophoblast-derived non-coding RNA (plectin) AU155361 5.23 423
Myosin, heavy polypeptide 10, non-muscle AI382123 2.85 185
PTPRF interacting protein, binding protein 1 (liprin beta 1) AI962377 2.64 164
Protein phosphatase 1, regulatory (inhibitor) subunit 12 A BE737620 2.42 142
Caldesmon 1 AU145225 2.26 126
Serine/threonine protein kinase TAO1 homolog (microtubule affinity regulating kinase kinase) AB037782 2.07 107
Membrane proteins, ion channels, transducers
Solute carrier family 40 (iron-regulated transporter), member 1 AU156956 10.17 917
Intracellular hyaluronic acid-binding protein 4 AK024886 3.37 237
Protein tyrosine phosphatase, receptor type, F AU158443 2.56 156
Sideroflexin 1 AA960991 2.45 145
Casein kinase 1 alpha 1 AI377389 2.44 144
Myozenin 2 AI475544 2.40 140
Dual-specificity tyrosine-(Y)-phosphorylation-regulated kinase 2 NM_006482 2.36 136
Fetal Alzheimer antigen NM_004459 2.33 133
KIAA0152 gene product BC000371 2.30 130
Guanine nucleotide-binding protein (G protein), beta polypeptide 4 AW504458 2.28 128
Rap guanine nucleotide exchange factor (GEF) 6 BF677986 2.27 127
v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog BF673699 2.24 124
Activin A receptor, type IIB NM_001106 2.24 124
Polymerase (DNA directed), eta AW665155 2.22 122
TBC1 domain family, member 8 (with GRAM domain) AI034387 2.16 116
Protein kinase C-like 2 AI633689 2.14 114
Solute carrier family 4, sodium bicarbonate cotransporter, member 7 NM_003615 2.13 113
Small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta BE671098 2.11 111
Leucyl/cystinyl aminopeptidase (oxytocinase) AA767440 2.06 106
Putative NFkB-activating protein HNLF AI472339 2.01 101
Transmembrane protein with EGF-like and two follistatin-like domains 2 AB004064 −2.07 52.0
Solute carrier family 39 (zinc transporter), member 14 BC015770 −2.64 62.1
Retinoic acid induced 3 AA156240 −3.80 73.7
Lipid metabolism
N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D W01715 −2.66 62.4
Homo sapiens cDNA: FLJ23200 fis, clone KAIA38871 AK026853 −2.57 61.1
(uncharacterized membrane bound lipoprotein lipase)
Hypothetical proteins
Hypothetical gene supported by AK091718 (LOC401504), mRNA AA875998 3.38 238
Hypothetical protein LOC144871 BG913589 3.21 221
Clone IMAGE:5270855, mRNA BC040602 3.14 214
HBxAg transactivated protein 2 BE729523 2.80 180
Hypothetical protein FLJ21924 AW195525 2.69 169
Hypothetical protein FLJ13456 N21008 2.68 168
MRNA; cDNA DKFZp586E2317 (from clone DKFZp586E2317) AL117451 2.58 158
FLJ35934 protein BC033201 2.49 149
KIAA0776 AW298092 2.42 142
Expressed in hematopoietic cells, heart, liver AB019490 2.39 139
Hypothetical protein FLJ11273 AV705186 2.36 136
Transcribed sequences BF508843 2.35 135
Hypothetical protein FLJ10287 AK001149 2.31 131
CDNA FLJ42565 fis, clone BRACE3007472 AI478268 2.27 127
Adult retina protein AI307750 2.24 124
Hypothetical protein FLJ22557 AU144048 2.23 123
Hypothetical protein FLJ10613 NM_019067 2.14 114
LOC392730 (LOC392730), mRNA AK021477 2.13 113
Cartilage-associated protein BC008745 2.06 106
KIAA0888 protein AB020695 2.03 103
CDNA FLJ12005 fis, clone HEMBB1001565 AK022067 2.01 101
Hypothetical protein LOC151658 AI685344 −2.42 58.7
ESTs
CDNA FLJ13267 fis, clone OVARC1000964 AW665227 3.69 269
Transcribed sequence with weak similarity to protein ref:NP_062553.1 (H.sapiens) AV729557 3.29 229
hypothetical protein FLJ11267

330
 Effects of D9-THC upon BeWo cells

Table III. Continued

Putative classification and ID Accession number Fold change % Change

Gi:735147/DB_XREF=ye49c09.s1/CLONE=IMAGE:121072/Hs.242998 T96523 3.07 207

CDNA FLJ37319 fis, clone BRAMY2018027 AA737437 3.03 203
CDNA FLJ31668 fis, clone NT2RI2004916 AI473887 3.03 203
Transcribed sequences AA767373 2.94 194
gi:11593079/DB_XREF=UI-H-BI4-apg-f-05-0-UI.s1/CLONE=IMAGE:3087488/ BF509781 2.64 164
Hs.137551
Transcribed sequences AI569482 2.55 155
Hypothetical protein FLJ10618 AW514168 2.51 151
Transcribed sequences BF512491 2.50 150
Transcribed sequence with weak similarity to protein sp:P39194 (H. sapiens) H57111 2.46 146
ALU7_HUMAN Alu subfamily SQ sequence contamination warning entry
gi:2719066/DB_XREF=zf98g04.s1/CLONE=IMAGE:385014/Hs.140963.0/Weakly similar to AA709148 2.37 137
ALUC_HUMAN ALU CLASS C WARNING ENTRY !!! (H.sapiens)
CDNA FLJ41762 fis, clone IMR322004768 AW968465 2.34 134
Transcribed sequences AA007336 2.32 132
Transcribed sequence with weak similarity to protein sp:P39191 (H. sapiens) BE156563 2.32 132
ALU4_HUMAN Alu subfamily SB2 sequence contamination warning entry
Transcribed sequences AI656728 2.26 126
Hypothetical protein FLJ38348 BG251692 2.16 116
Transcribed sequences AI860360 2.13 113
Transcribed sequence with weak similarity to protein ref:NP_060312.1 (H. sapiens) AW629289 2.13 113
hypothetical protein FLJ20489 (H. sapiens)
Chromosome 14 open reading frame 106 AW103300 2.13 113
KIAA1961 protein AW263086 2.12 112
Transcribed sequences AW511239 2.12 112
Transcribed sequence with moderate similarity to protein ref:NP_071385.1 AW382006 2.12 112
(H. sapiens) hypothetical protein FLJ20958 (H. sapiens)
Transcribed sequences BE219036 2.09 109
Transcribed sequence with weak similarity to protein sp:P39191 (H. sapiens) AA579047 2.07 107
ALU4_HUMAN Alu subfamily SB2 sequence contamination warning entry
Chromosome 6 open reading frame 111 BF591408 2.05 105
Gi:10821309/DB_XREF=7k77g10.x1/CLONE=IMAGE:3481554/Hs.202042.0 BF062399 2.04 104
Transcribed sequences W86781 2.02 102
Transcribed sequences BF508288 2.02 102
Transcribed sequence with moderate similarity to protein pir:I60307 (E. coli) I60307 AI823917 2.01 101
beta-galactosidase, alpha peptide—Escherichia coli
Transcribed sequences BF433200 2.01 101
Transcribed sequences AW973235 −2.10 52.4
Zinc finger protein 506 (possible transcription factor) AI559570 −2.53 60.5
gi:11764352/DB_XREF=601655369R1/CLONE=IMAGE:3845872/Hs.295011/Moderately BE961949 −2.64 62.1
similar to 810024C cytochrome oxidase I (H.sapiens)

LOC, LocusLink; UG, Unigene; EST, expressed sequence tag; fold 1, mean fold change array 1; median fold change, median fold change for both arrays;
% change, % movement from 100%.

Of note was the down-regulation in expression of N-acyl-
phosphatidylethanolamine-hydrolyzing Phospholipase D, the enzyme
responsible for the production of anandamide, the principal endog-
enous cannabinoid with major effects on human reproductive function
(Wenger et al., 1999; Habayeb et al., 2002; Maccarrone et al., 2002).
As anandamide and the exocannabinoid Δ9-THC exhibit different
affinities for the cannabinoid and vanilloid receptors, in vivo exposure
to Δ9-THC may further exacerbate its effects by switching from anan-
damide to Δ9-THC action. Also of note was the suppression of expression
of an uncharacterized lipoprotein lipase (Garnica and Chan, 1996),
because recently it has been suggested that lipoprotein lipase defi-
ciency can lead to FGR (Magnusson et al., 2004) or fetal death (Tsai
et al., 2004).
We have identified a restricted alteration in the expression of genes
in BeWo cells exposed to Δ9-THC. The alterations in the expression
of a number of characterized genes are consistent with its effects upon
the morphology of cells in culture, whereby the cultures were pre-
vented from achieving confluency not through increased syncytial
formation or culture involution, but through inhibition of cell prolifer-
ation. Because BeWo cells are considered an appropriate model for
human in vivo trophoblast action and function (Sullivan, 2004) and
similar effects are observed in vivo, these data suggest that Δ9-THC
use during human pregnancy may similarly inhibit trophoblast prolif-
eration and that placentae during early development when the cytotro-
phoblastic populations predominate may be more sensitive to the
adverse effects of marijuana use and lead to a failure to achieve full
placental development, and hence fetal growth. The lack of cell prolif-
eration and migration associated with early placental development
might therefore go some way to explain some of the clinical observa-
tions of miscarriage and placental abruption associated with marijuana
use in early pregnancy and also explain why marijuana use in late
pregnancy is not anti-gestational (Conner, 1984; Hatch and Bracken,
1986; Zuckerman et al., 1989). Although the regulatory network that
underlies the temporal control of transcript expression and gene
function remains to be determined, the identification of Δ9-THC-
modulated trophoblast transcripts is likely to shed light on the mechanisms
underlying trophoblast response to marijuana use in pregnancy.
Acknowledgements
The authors thank H. Longland and E. Beighton of the RNA Laboratory, MRC
Geneservice, Babraham Bioincubator, Babraham, Cambridge, for the produc-
tion of cRNA, hybridization of probes to Affymetrix genechips and the

331
M.Khare et al.
production of scanned images and Dr E. Halligan, Genomic Instability
Research Group, Department of Cancer Studies and Molecular Medicine, for
assistance with the dChip software.
References
Aronow BJ, Richardson BD and Handwerger S (2001) Microarray analysis of
trophoblast differentiation: gene expression reprogramming in key gene
function categories. Physiol Genomics 6,105–116.
Bailey JR, Cunny HC, Paule MG and Slikker W (1987) Fetal disposition of
delta 9-tetrahydrocannabinol (THC) during late pregnancy in the rhesus
monkey. Toxicol Appl Pharmacol 90,315–321.
Barber KJ, Franklyn JA, McCabe CJ, Khanim FL, Bulmer JN, Whitley GS and
Kilby MD (2005) The in vitro effects of tri-iodothyronine on epidermal
growth factor-induced trophoblast function. J Clin Endocrinol Metab
90,1655–1661.
Brauner-Osborne H, Jensen AA, Sheppard PO, Brodin B, Krogsgaard-Larsen P
and O’Hara P (2001) Cloning and characterization of a human orphan family C
G-protein coupled receptor GPRC5D. Biochim Biophys Acta 1518,237–248.
Burres NS and Cass CE (1986) Density-dependent inhibition of expression of
syncytiotrophoblastic markers by cultured human choriocarcinoma BeWo
cells. J Cell Physiol 128,375–382.
Burres NS and Cass CE (1987) Inhibition of methotrexate-induced differentia-
tion of cultured human choriocarcinoma BeWo cells by thymidine. Cancer
Res 47,5059–5064.
Calabrese EJ (2005) Challenging dose–response dogma. The Scientist
19,22–23.
Chan S, Murray PG, Franklyn JA, McCAbe CJ and Kilby MD (2004) The use
of laser capture microdissection (LCM) and quantitative polymerase chain
reaction to define thyroid hormone receptor expression in human ‘term’
placenta. Placenta 25,758–762.
Cherlet T and Scott JE (2002) Tetrahydrocannabinol (THC) alters synthesis
and release of surfactant-related material in isolated fetal rabbit type II cells.
Drug Chem Toxicol 25,171–190.
Cohran V, Fang J, Milio L, Smith CH and Fant M (1996) Type I insulin-like
growth factor receptors in the BeWo choriocarcinoma cell during cell differ-
entiation. Placenta 17,313–320.
Conner CS (1984) Marijuana and alcohol use in pregnancy. Drug Intell Clin
Pharm 18,233–234.
Cope LM, Irizarry RA, Jaffee HA, Wu Z and Speed TP (2004) A benchmark
for Affymetrix GeneChip expression measures. Bioinformatics 20,323–331.
Cunliffe T (2004) Histone deacetylase 1 is required to repress Notch target
gene expression during zebrafish neurogenesis and to maintain the produc-
tion of motoneurones in response to hedgehog signalling. Development
131,2983–2995.
Dennedy MC, Friel AM, Houlihan DD, Broderick VM, Smith T and Morrison
JJ (2004) Cannabinoids and the human uterus during pregnancy. Am J
Obstet Gynecol 190,2–9.
Desagher S, Severac D, Lipkin A, Bernis C, Ritchie W, Le Digarcher A and
Journot L (2005) Genes regulated in neurons undergoing transcription-
dependent apoptosis belong to signaling pathways rather than the apoptotic
machinery. J Biol Chem 280,5693–5702.
Endo H, Okamoto A, Ozawa M, Shinya M, Akiyama Y and Tanaka T (2002)
Expression profile of intrauterine growth restriction (IUGR). Placenta
23,A1–A53,P97.
Felder CC and Glass M (1998) Cannabinoid receptors and their endogenous
agonists. Annu Rev Pharmacol Toxicol 38,179–200.
Fisher SE, Atkinson M and Chang B (1987) Effect of delat-9-tetrahydrocan-
nibinol on the in vitro uptake of alpha-amio isobutyric acid by term placen-
tal slices. Pediatr Res 21,104–107.
Frankton S, Harvey CB, Gleason LM, Fadel A and Williams GR (2004) Multi-
ple messenger ribonucleic acid variants regulate cell-specific expression of
human thyroid hormone receptor β1. Mol Endocrinol 18,1631–1642.
Garnica AD and Chan WY (1996) The role of the placenta in fetal nutrition
and growth. J Am Coll Nutr 15,206–222.
Girnita L, Girnita A and Larsson O (2003) Mdm2-dependent ubiquitination
and degradation of the insulin-like growth factor 1 receptor. Proc Natl Acad
Sci USA 100,8247–8252.
Guenther MG and Lazar MA (2003) Biochemical isolation and analysis of a
nuclear receptor corepressor complex. Methods Enzymol 364,246–257.
Habayeb OMH, Bell SC and Konje JC (2002) Endogenous cannabinoids:
Metabolism and their role in reproduction. Life Sci 70,1963–1977.
332
Habayeb OMH, Taylor AH, Evans MD, Cooke MS, Taylor DJ, Bell SC and
Konje JC (2004) Plasma levels of the endocannabinoid anandamide in
women – a potential role in pregnancy maintenance and labor? J Clin
Endocrinol Metab 89,5482–5487.
Hall LL, Bicknell GR, Primrose L, Pringle JH, Shaw JA and Furness PN
(1998) Reproducibility in the quantification of mRNA levels by RT-PCR-
ELISA and RT competitive-PCR-ELISA. Biotechniques 24,652–658.
Harclerode J (1980) The effect of marijuana on reproduction and development.
NIDA Res Monogr 31,137–166.
Hatch EE and Bracken MB (1986) Effect of marijuana use in pregnancy on
fetal growth. Am J Epidemiol 124,986–993.
Helliwell RJ, Chamley LW, Blake-Palmer K, Mitchell MD, Wu J, Kearn CS
and Glass M (2004) Characterization of the endocannabinoid system in
early human pregnancy. J Clin Endocrinol Metab 89,5168–5174.
Hoffman K, Dixon DN, Greene WK, Ford J, Taplin R and Kees UR (2004) A
microarray model system identifies potential new target genes of the proto-
oncogene HOX11. Genes Chromosomes Cancer 41,309–320.
Hohn HP, Parker CR Jr, Boots LR, Denker HW and Hook M (1992) Modula-
tion of differentiation markers in human choriocarcinoma cells by extracel-
lular matrix: on the role of a three-dimensional matrix structure.
Differentiation 51,61–70.
Hu D, Mayeda A, Trembley JH, Lahti JM and Kidd VJ (2003) CDK11
complexes promote pre-mRNA splicing. J Biol Chem 278,8623–8629.
Hutchings DE and Dow-Edwards D (1991) Animal models of opiate, cocaine,
and cannabis use. Clin Perinatol 18,1–21.
Irizarry RA, Bolstad BM, Collin F, Cope LM, Hobbs B and Speed TP (2003)
Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res
31,e15.
Ishii M, Merrill AE, Chan Y-S, Gitelman I, Rice DPC, Sucov HM and Maxson
REJ (2003) Msx2 and Twist cooperatively control the development of the
neural crest-derived skeletogenic mesenchyme of the murine skull vault.
Development 130,6131–6142.
Jho SH, Vouthounis C, Lee B, Stojadinovic O, Im MJ, Brem H, Merchant A,
Chau K and Tomic-Canic M (2005) The Book of Opposites: the role of the
nuclear receptor co-regulators in the suppression of epidermal genes by retin-
oic acid and thyroid hormone receptors. J Invest Dermatol 124,1034–1043.
Jin Y, Blue EK, Dixon S, Shao Z and Gallagher PJ (2002) A death-associated
protein kinase (DAPK)-interacting protein, DIP-1, is an E3 ubiquitin ligase
that promotes tumor necrosis factor-induced apoptosis and regulates the
cellular levels of DAPK. J Biol Chem 277,46980–46986.
Jones R (1980) Human effects: an overview. NIDA Res Monogr 31,54–80.
Kenney SP, Kekuda R, Prasad PD, Leibach FH, Devoe LD and Ganapathy V
(1999) Cannabinoid receptors and their role in the regulation of the serot-
onin transporter in human placenta. Am J Obstet Gynecol 181,491–497.
Kilby MD, Verhaeg J, Gittoes N, Somerset DA, Clark PMS and Franklyn JA
(1998) Circulating thyroid hormone concentrations and placental thyroid
hormone receptor expression in normal pregnancy and pregnancy complicated
by intrauterine growth restriction. J Clin Endocrinol Metab 83,2964–2971.
King JC (1997) Substance abuse in pregnancy. A bigger problem than you
think. Postgrad Med 102,135–150.
Klezovitch O, Fernandez TE, Tapscott SJ and Vasioukhin V (2004) Loss of
cell polarity causes severe brain dysplasia in Lgl1 knockout mice. Genes
Dev 18,559–571.
Knight EM, James H, Edwards CH, Spurlock BG, Oyemade UJ, Johnson AA,
West WL, Cole OJ, Westney LS and Westney OE (1994) Relationships of
serum illicit drug concentrations during pregnancy to maternal nutritional
status. J Nutr 124,973S–980S.
Kothapalli R, Yoder SJ, Mane S and Loughran TP Jr (2002) Microarray
results: How accurate are they? BMC Bioinformatics 3,22.
Kudo Y, Boyd CAR, Sargent IL, Redman CWG, Lee JM and Freeman TC (2004)
An analysis using DNA microarray of the course of gene expression during
syncytialization of a human placental cell line (BeWo). Placenta 25,479–488.
Lazar MA (1993) Thyroid hormone receptors: multiple forms, multiple possi-
bilities. Endocr Rev 14,184–193.
Leuschner JT, Harvey DJ, Bullingham RE and Paton WD (1986) Pharmacoki-
netics of delta-9-tetrahydrocannabinol in rabbits following single or multi-
ple intravenous doses. Drug Metab Dispos 14,230–238.
Li H, Wood CL, Getchell TV, Getchell ML and Stromberg AJ (2004) Analysis
of oligonucleotide array experiments with repeated measures using mixed
models. BMC Bioinformatics 5,209.
Loiselle FB, Morgan PE, Alvarez BV and Casey JR (2004) Regulation of the
human NBC3 Na+/HCO3- cotransporter by carbonic anhydrase II and PKA.
Am J Physiol Cell Physiol 286,C1423–C1433.

Maccarrone M, Bisogno T, Valensise H, Lazzarin N, Fezza F, Manna C,
Di Marzo V and Finazzi-Agro A (2002) Low fatty acid amide hydrolase and
high anandamide levels are associated with failure to achieve an ongoing
pregnancy after IVF and embryo transfer. Mol Hum Reprod 8,188–195.
Magnusson AL, Waterman IJ, Wennergren M, Jansson T and Powell TL
(2004) Triglyceride hydrolase activities and expression of fatty acid binding
proteins in the human placenta in pregnancies complicated by intrauterine
growth restriction and diabetes. J Clin Endocrinol Metab 89,4607–4614.
Mannavola D, Moeller LC, Beck-Peccoz PB, Persani L, Weiss RE and Refetoff
S (2004) A novel splice variant involving the 5′ untranslated region of thyroid
hormone receptor β1 (TRβ1). J Endocrinol Invest 27,318–322.
Maruo T, Matsuo H and Mochizuki M (1991) Thyroid hormone as a biologi-
cal amplifier of differentiated trophoblast function in early pregnancy.
Acta Endocrinol 125,58–66.
McGavin MK, Badour K, Hardy LA, Kubiseski TJ, Zhang J and Siminovitch
KA (2001) The intersectin 2 adaptor links Wiskott Aldrich Syndrome pro-
tein (WASp)-mediated actin polymerization to T cell antigen receptor
endocytosis. J Exp Med 194,1777–1787.
Nickel BE and Cattini PA (1991) Tissue-specific expression and thyroid-
hormone regulation of the endogenous placental growth hormone variant
and chorionic sommatomammotropin genes in a human choriocarcinoma
cell line. Endocrinology 128,2353–2359.
Nomura K, Saito S, Ide I, Kamino Y, Sasahara H, Nakamoto T and Abiko Y
(2004) Caffeine suppresses the expression of the Bcl-2 mRNA in BeWo cell
culture and rat placenta. J Nutr Biochem 15,342–349.
Ohara N, Tsujino T and Maruo T (2004) The role of thyroid hormone in tro-
phoblast function, early pregnancy maintenance, and fetal neurodevelop-
ment. J Obstet Gynaecol Can 26,982–990.
Paria BC, Song H, Wang X, Schmid PC, Krebsbach RJ, Schmid HHO,
Bonner TI, Zimmer A and Dey SK (2001) Dysregulated cannabinoid sig-
naling disrupts uterine receptivity for embryo implantation. J Biol Chem
276,20523–20528.
Park B, Gibbons HM, Mitchell MD and Glass M (2003) Identification of the
CB1 cannabinoid receptor and fatty acid amide hydrolase (FAAH) in the
human placenta. Placenta 24,990–995.
Parliamentary Office of Science and Technology, U.K. (1996) Common illegal
drugs and their effects: Cannabis, Ecstacy, Amphetamines and LSD. House
of Commons, London.
Parmentier-Batteur S, Jin K, Xie L, Mao XO and Greenberg DA (2002) DNA
microarray analysis of cannabinoid signaling in mouse brain in vivo. Mol
Pharmacol 62,828–835.
Porcella A, Gessa GL and Pani L (1998) Delta9-tetrahydrocannabinol
increases sequence-specific AP-1 DNA binding activity and fos-related anti-
gens in the rat brain. Eur J Neurosci 10,1743–1751.
Reimer T, Koczan D, Gerber B, Richter D, Thiesen HJ and Friese K (2002)
Microarray analysis of differentially expressed genes in placental tissue of pre-
eclampsia: up-regulation of obesity-related genes. Mol Hum Reprod 7,674–680.
Rishi AK, Zhang L, Boyanapalli M, Wali A, Mohammad RM, Yu Y, Fontana
JA, Hatfield JS, Dawson MI, Majumdar AP and Reichert U (2003) Identifi-
cation and characterization of a cell cycle and apoptosis regulatory protein-1
as a novel mediator of apoptosis signaling by retinoid CD437. J. Biol.
Chem. 278,33422–33435.
Effects of D9-THC upon BeWo cells
Robbins MJ, Michalovich D, Hill J, Calver AR, Medhurst AD, Gloger I,
Sims M, Middlemiss DN and Pangalos MN (2000) Molecular cloning and
characterization of two novel retinoic acid-inducible orphan G-protein-cou-
pled receptors (GPRC5B and GPRC5C). Genomics 67,8–18.
Roh C-R, Budhraja V, Kim H-S, Nelson DM and Sadovsky Y (2005) Microarray-
based identification of differentially expressed genes in hypoxic term human
trophoblasts and in placental villi of pregnancies with growth restricted
fetuses. Placenta 26,319–328.
Saito S, Nomura K, Tanuma A and Abiko Y (2001) Identification of altered
gene expression in the trophoblast model BeWo cells by caffeine using
cDNA microarray technology. Med Biol 143,171–173.
Stephanou A and Handwerger S (1995) Retinoic acid and thyroid hormone
regulate placental lactogen expression in human trophoblast cells. Endo-
crinology 136,933–938.
Storey KB and Storey JM (2004) Metabolic rate depression in animals:
Transcriptional and translational controls. Biol Rev Camb Philos Soc
79,207–233.
Sullivan MH (2004) Endocrine cell lines from the placenta. Mol Cell Endocri-
nol 228,103–119.
Taylor AH, Al-Azzawi F, Pringle JH and Bell SC (2002) Inhibition of
endometrial carcinoma cell growth using antisense estrogen receptor oligo-
deoxyribonucleotides. Anticancer Res 22,3993–4003.
Thibault C, Lai C, Wilke N, Duong B, Olive MF, Rahman S, Dong H, Hodge
CW, Lockhart DJ and Miles MF (2000) Expression profiling of neural cells
reveals specific patterns of ethanol-responsive gene expression. Mol
Pharmacol 52,1593–1600.
Tsai EC, Brown JA, Veldee MY, Anderson GJ, Chait A and Brunzell JD
(2004) Potential of essential fatty acid deficiency with extremely low fat diet
in lipoprotein lipase deficiency during pregnancy: a case report. BMC
Pregnancy Childbirth 4,27.
Uitto J and Pulkkinen L (1996) Molecular complexity of the cutaneous
basement membrane zone. Mol Biol Rep 23,35–46.
Wallace DF, Pedersen P, Dixon JL, Stephenson P, Searle JW, Powell LW and
Subramaniam VN (2002) Novel mutation in ferroportin1 is associated with
autosomal dominant hemochromatosis. Blood 100,692–694.
Wenger T, Toth BE, Juaneda C, Leonardelli J and Tramu G (1999) The
effects of cannabinoids on the regulation of reproduction. Life Sci
65,695–701.
Wolf G (2002) The regulation of the thyroid-stimulating hormone of the
anterior pituitary gland by thyroid hormone and by 9-cis-retinoic acid. Nutr
Rev 60,374–377.
Xu H, Firulli AB, Zhang X and Howard MJ (2003) HAND2 synergistically
enhances transcription of dopamine-beta-hydroxylase in the presence of
Phox2a. Dev Biol 262,183–193.
Yen PM (2001) Physiological and molecular basis of thyroid hormone action.
Physiol Rev 81,1097–1142.
Zuckerman B, Frank DA, Hingson R, Amaro H, Levenson SM, Kayne H,
Parker S, Vinci R, Aboagye K, Fried LE et al. (1989) Effects of maternal
marijuana and cocaine use on fetal growth. New Engl J Med 320,762–768.
Submitted on May 25, 2005; resubmitted on December 15, 2005; accepted on
March 1, 2006
333
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.