Vous êtes sur la page 1sur 44

Quelques exemples d'applications de la

transgenèse chez Arabidopsis

Mutagenèse d'insertion chez Arabidopsis


et utilisation pour la génétique inverse
Recombinaison homologue chez la mousse
Quelques exemples d'application à l'étude du cytosquelette

David Bouchez (bouchez@versailles.inra.fr)


http:// www-ijpb.versailles.inra.fr/

Mutagenèse
d'insertion chez
Arabidopsis
thaliana
Mutagenèse insertionelle

taggcctttccatccaatattataatctaagaaggagcgattgc
ccttgatctgacccaacttgcgagtggaaaatctaatgcttattt
gttcattcgttttctgagattctatatcaaataatagtcagtcatca
ctagaaaatgctcaaacaactaatatgattcaacacatttcat
atcatatgcttggcaatattggaccgaacttcatgatttttctgtc
catgaatgcaaat

Mutagenèse : saturation

La distribution des mutations suit une loi de Poisson :


f(k) = e-m mk/k!
(m : nombre moyen de mutations par cible)
m
1 2 3 4 5
0 36,8% 13,5% 5,0% 1,8% 0,7%
f(0) = e-m 1 36,8% 27,1% 14,9% 7,3% 3,4%
2 18,4% 27,1% 22,4% 14,7% 8,4%
f(>0)=1-e-m 3 6,1% 18,0% 22,4% 19,5% 14,0%
90% saturation : m = 3 k 4
5
1,5%
0,3%
9,0%
3,6%
16,8%
10,1%
19,5%
15,6%
17,5%
17,5%
99% saturation : m = 4.6 6 0,1% 1,2% 5,0% 10,4% 14,6%
7 0,0% 0,3% 2,2% 6,0% 10,4%
8 0,0% 0,1% 0,8% 3,0% 6,5%
9 0,0% 0,0% 0,3% 1,3% 3,6%
10 0,0% 0,0% 0,1% 0,5% 1,8%
La saturation varie avec la taille des gènes-cibles

100% 0.5 kb
1 kb
90%
2 kb
2.5 kb
80%
3 kb
70% 4 kb
5 kb
60% 10 kb

50%

40%

30%

20%

10%

0%

103500
109500
115500
121500
127500
133500
139500
145500
13500
19500
25500
31500
37500
43500
49500
55500
61500
67500
73500
79500
85500
91500
97500
1500
7500

mutagenèse insertionelle chez Arabidopsis : saturation

Distribution aléatoire des insertions


Taille du génome 120 Mb
Gène moyen : 2 kb (introns + exons) 60,000 cibles

140,000 insertions pour une saturation de 90%


180,000 insertions pour une saturation de 95%
280,000 insertions pour une saturation de 99%
Mutagenèse d’insertion : agents mutagènes

Insertional mutagenesis

• Transposons
• T-DNA

• Vectors can be engineered for gene trapping


• Allow gene tagging
Gene trapping

• Promoter trap ATG


reporter

• Enhancer trap
reporter

• Gene trap
reporter

GUS Kan R Basta R


RB LB
uidA nos 3' ocs 3' npt II P nos P 35S bar 3' g7

Kan R

ori pRiA4 pGKB5


20.1 kb

pBGS

1 kb
Mutagenèse d’insertion : agents mutagènes
Transposons

Mobile DNA
Transposons (Ac/Ds, En/Spm, …) DNA
- short inverted repeat termini
- insertion in gene-rich regions
- low-copy number (except MITEs)
cut & paste

Retrotransposons RNA
- LTR, up to 15 kb long
- high copy number, nested
blocks between genes
- can make up the majority copy & paste
of large genomes (barley, lily, maize…)
Transposons

•Two types of approaches:

•High copy number of active transposons per genome


• Fast genome coverage with small populations (Mutator:
200 insertions/plant)
•Single or low copy number of a given transposon per genome
• Genetic analysis and molecular cloning easier
• Integration of reporter genes to observe gene expression

Two-components systems
Transposons : advantages

- Possibility of excision from the the disrupted gene in


presence of transposase (reversion)

- Generation of mosaïcs (somatic excision)

- Transposon inserted near a desired gene can be


used as a «launch pad» for local mutagenesis
(remobilization)

Mutagenèse d’insertion : agents mutagènes


T-DNA
T-DNA
Plant Cell
Vir
Ti Transfer

Agrobacterium
Catabolism Auxin Cytokinin

Opines
Synthesis

T-DNA Transfer

T-DNA Mutagenesis

Stable insertions in genomic DNA

Low copy number (1-2 insertion loci, 1-2 T-DNA copies)

Random T-DNA insertions

Easily engineered

Easy Agrobacterium transformation of Arabidopsis


T1 seeds

T0 plants
Infiltration with transfer to soil,
Agrobacterium culture, selfing
Basta resistance screen

Basta Resistant
T1 plants

Basta sensitive
selfing T1 Plants
1/4 1/2 1/4
wt wt mutant ?
greenhouse + in vitro screening
T2 seeds DNA Pools
Bulk propagation for T3 seeds

Mécanisme de la transformation par infiltration

Seuls des transformants hétérozygotes sont obtenus : la


transformation a lieu tard dans le développement de la fleur, la
cible de la transformation étant le(s) gamétophyte(s), avant ou
durant la double fécondation.
Des expériences de génétique montrent que c'est le
gamètophyte femelle qui est la cible cellulaire de la
transformation Bechtold et al. (2000)
Des expériences de biologie cellulaire montrent que l'embryon
comme l'endosperme sont susceptibles d'être transformés
indépendamment Bechtold et al. (2003)
Mécanisme de la transformation par infiltration :
le mutant mâle-stérile Ttd8
pollen

ovule

(Bechtold et al. (2000) Genetics)

Mécanisme de la transformation par infiltration :


re-transformation du mutant mâle-stérile Ttd8

pollen pollen
ovule
ovule

Liaison en répulsion Liaison en couplage


T-DNA infiltration transformation
Ttd8H Double Transformants

Cis-linkage Not linked Trans-linkage Multiple ?


(coupling) (repulsion) Inserts
25 128 1 24 15

The maternal chromosome set is the target for T-DNA transformation. The cellular target is
most probably the female gametophyte.

(Bechtold et al. (2000) Genetics)

L'endosperme et l'embryon peuvent


être transformés indépendament
(Bechtold et al 2003) :
Le gamétophyte femelle mature est
la cible de la transformation
The Versailles T-DNA lines

1994 12,000 lines


1995 19,000 lines
1996 25,000 lines
1997 30,000 lines
1998 40,000 lines
1999 45,000 lines
All lines kept individually 2000 50,000 lines
Average : 1.5 insert / line
2001 56,000 lines

8-10 people ; 4 x 200 m2 greenhouse

Mutations
albino 0.45%
pale 0.35%
embryo lethal 2.4%
root morphology 1.4%
long hypocotyl 0.001% GUS Expression
short hypocotyl 1.5% 9% GUS+
De-etiolated 0.006%
reduced size 1% 3% in roots
dwarf 0.09%
1,5% in stamens
reduced fertility 3%
1 % in vascular tissue
sterile 1.3%

Visible mutation in ~20% of the lines ; Tagged by full-length inserts : 20-30%


Les mutations tonneau et fass

Plantes naines, fortement compressées et


épaisses. Pas de réponse morphologique à
l'obscurité, aux hormones…
Organisation cellulaire très altérée : taille,
forme et nombre des cellules modifiés. Pas
d'élongation cellulaire, position des plans de
division aléatoire

Mais (!) :
Tous les organes sont présents à leur
position relative correcte
La différenciation cellulaire est présente

Le cytosquelette végétal : une plaque tournante

Réponses aux
Croissance et
contraintes biotiques
développement
et abiotiques
Division (mitose/méiose) Blessure
Elongation Froid
Différenciation Attaques de pathogènes
Mise en place de la paroi …

Caractéristiques uniques du cytosquelette végétal :


Absence de centre organisateur de microtubules (centrosome…)
Structures particulières : PPB, phragmoplaste, etc
Le cycle microtubulaire des cellules végétales

Mutagenèse EMS
Lignées d'insertion
Mutants de cytosquelette :
Cribles phénotypiques (défauts de développement, FTIR, …)
Gènes candidats (actines, tubulines, kinésine, myosines, etc) Lignées d'insertion
Expression modifiée
Nouveaux outils de cytologie et biologie cellulaire

35S GFP MAP4 MT BD NOS

Nouveaux outils de cytologie et biologie cellulaire

QuickTime™ et un
décompresseur TIFF QuickTime™ et un
sont requis pour visionner cette image. décompresseur Cinepak
sont requis pour visionner cette image.
Les mutants ton sont affectés dans la mise en place du
cytosquelette cortical…

WT fass (ton2-13)

25 µm 25 µm

Hypocotyl epidermal cells expressing the GFP-MBD marker

WT ton2-13
PPB
…ne forment jamais
Perinuclear d’anneau de
MTs
préprophase…

…mais toutes les structures mitotiques


sont correctement mises en place
Les gènes TON et FASS d'Arabidopsis

TON : 2 petites protéines acides (TONa et TONb), de fonction inconnue et


qu'on ne trouve que chez les plantes (y compris les mousses). Elles possèdent
un motif LisH. Elles sont localisées au niveau du cytosquelette cortical. TONb
interagit en double-hybride avec une centrine et 11 membres d’une super-
famille de protéines de plante de fonction inconnue.

FASS (TON2) est une sous-unité régulatrice de protéine phosphase 2A


(PP2As). Elle interagit en double-hybride avec une sous-unité de type A. Elle a
un homologue chez les vertébrés. Ses cibles sont inconnues.

Génétique inverse chez les plantes

Mutagenèse d'insertion chez Arabidopsis


taggcctttccatccaatattataatctaagaaggagcgattgcccttgatctgacccaacttgcgagtggaaaatctaatgcttatttgttcattcgttttctgagattctatatcaaataatagtcagtcatcactagaaaatgctcaaacaactaatatgattcaacacatttcatatcatatgcttggcaatattggaccgaacttca
tgatttttctgtccatgaatgcaaatgtgttgtgatctctgagttacatctcaaaatgtgaacttgacatcatattctcgttcaaaaaaggaagataagacaaaacatttaagaaacatttcacaatcatagggggcaaaagatcaaaatttaaaatttcggacgagagtggaaactatcaatctttaaggggatgatttggcaaa
agtgttgtttttatttttcttttactgttttcgttttatcatctttcaacgtctttctctcccgacggccaaaaaccccaattttgccaaatccaattttacacccagaaaccctaattttccttactttgatttgattttgtgatggacgattatacaagagagatgatggatctcaagactttggtcactcgaaccctagagaagaaaggtgtcct
cgctaagatccgggtaaattccctctacttctctaccatacattattcgcagaaatttttgagtggaaatgagaacagagaagtgattcgtttgaaatacatacattactctttttctagggttcctgctattcagatcgaaatgctcgatattgttaattgcctatgcatctggaatcttgctgatagtttatttgtgtttgtaggctgagctcc
gtgcaagtgtgtttgaagcaattgaagaagaggatagagtgatagagaacaatgaaggaccgcctccagctctgttgggaagctgtaatgatcgtgcaaggaagcttcatgcttctccttcaggttttttcttcacaagtttttgcttttatccttttaaatctttcctctatgaatggtttggttctaaatggcatctcttggtttgaaaattt
tgttgaaatgcaggaaggttactatctgcgttgatttgtgaatacttggactgggcacaacttaatcacacgctcatagtttatcaacctgaaagcaatttggtaatcaatataatcccgttttcttttgctatgtttcattaagaagatgttgatgaatttttctcactaatctggtgaactcctgcaaaacctattcaaagccaaaagatt
cgtggaagtctgagttacgcgactttaataggcaacaatggtttgagctcaatagaaatggagatagtggaccactccttctcgaagttcttgaagggttcttggagtttgaggtattctttctttttttccccctgaagatgtttgcaggcaagtgtgaaactgaactttactatctataacttcttctcttagtttacaatctttacaaccat
actctaaacaaattacaatagtccacctgtagtatgtgtgatttatgagttgtagtgttaacagttcctattatgtaagtgaagatgatcaatactttacacccaagctttacaaacaccaacttacataaaatcttggtactctgtcctcgcaaccaagagaagaagttatagatagtaaaattcagttttccaagaaaaataaagt
ctcttagtagagattagagttcttcagagatttgaaaaacacgtttagcaaatttcctagcctcaagttctcttcacatctaagaatcatgtttccatcctatcatagttaaaaccattatcatctgtttttgccgtatgctcctcagatgtagtgatcaacttttttttgtaatgaattttttcttcagagcatgacgcagggcatgggtagtagt
tcaaggagagattcagaaacagagtcgtcatcaagccttgagtccagaaatcctcctcgcagatcatctgcttctgatagcttacctcctcaacgaaggtacacatatcttcaacttcttattattatgccaaatcaaagatccttactcttcgacatgattgctttatttaccttcaaataaatgggcaggccggtttctgcatctcaa
gcatcgggtgagtcatcatttccctagtttcttgaagtattggttgaaatacgtatgcttcattattttttgataccaaataaatatgacaagatgttacagatagaagagtcgggttgtctacatctgggtacagaaaagatgaattcaactggagacaaggtaaccaagatacacatgaagaggtaacaagagctccagcgg
cgctggaaaatctacagcttgataggaagactcggaacttaacatcgtcttggagataagctttcaaggaagtctcattgaatcccacattgaaatgaaaacaaagcaagttgtggtaaatctgacccatcgggcttgcttgtgttgtaggaatgtgagggatggaacaaatgaagaagaagggagagattgatttaggct
ttggataaacatttcagcttctggattagtagagtaatggtttgtgtacgtgatatatgtatgtttctcctttattcgcaactgcgttttcaattagccttttttttaacgcacgaacctctgtctccttgagaacaaaaaacatgaaacagtaaaatgttttcttctgagatttgttatgggaagagaagagttcagaaagaagaatcaaag
aaagcacaatgtggttgaatattttcattcacttgcttcttattttagtgtctccaaaattattatgtctctagtaataaacaaggtttttgaacgatgtgttcactgtttgttttactcgtactttttttttgttttccctttagtcttctctctctctctcgcttcttcgtttaaaactttaaacgaaagtatcgaagaagccaactctggatgacgcaaaa
gcttctctcagaacggcattgtagaattctccggtgaccaaataatccgattgcattagtagggaatctgttattttgatctgatccgtcaaatcggcggtaagaacaatggacgattatacaagagagatgatggatctcaagaccttagtcactcgaaccctagagaagaaaggtgttctcgctaagatccgggtatatttgtt
tttctcttgccacgattcctctggttctgtgacatacttcattcaaattccgtagagagatttgagtacggagaagaagagaaaacatacattgcttttctagggttcgtgcttccagatctactttatgcatctggaatcatgtgaattcccagtttttgtcgtactttgaaattgagtctgtgaaaaaattgtaccttctcagctgaattgga
ttctttaacatttggtttggagattgaagatttgtttttttttctctatattcttctgctggaaatttagttgtttctgtaggctgaactccgtgcaagtgtgtttgaggcaaccgaagaagaggatagagtgatagagaacaatgaaggactgcctccagctttgttgggaagctgcaatgatcgtgcaaggcagcttcatgcttctccttca
ggtctttctcaatttttatccttcatatcttctcttcacttttacccttcagagaccttttctctttgaatggtatggttctaaatggcatgtcttggtttggaaatactttcttgatacttagatatattcgcttgttcgaaatgtgtctccttgtttttttcgggtgaaactttgcttgcttctattcttaggcgatatgaacattgagattttgtgtagttgagta
ggtcatcttgatcactttataaaatgttaaaatgcaggcaggttgctatctgcattgatttgtgaatatttggactgggcgcaattaaatcacacgcttaaagtttatcaaccagaatgcaattcggtaatcaatatatttcattttctttgaacttctgatatttcttttaagtacgttgaagatgaactttctaactgatgctgtgatccctga
aaacctatgcaaaggcaaaagattcttggaagtctgagatacgtgactttagtatcaacaatggttatgagctcaacagaaatgaagatagtagaccgcttcttctggatgttcttgaaggattcttgaagttcgaggtatttcttctgctttctctctgaagatgtttacacatacagtatagctttttttttttctctgtttacaagctttac
aaccatatttgttacacattacaatagtccagctatggtacatgatttcagggcgttagtgtttacagttcctctattctctaagtgaagatgaccaatacctgttggttacatcgaagctttacaattaccaaattagttcaaatcttgttacattgtgctcacgacctcacattttttccaagtaaataaagtgtcttactcaagaaaaga
atttttcagagctttgaataagttcggtgaattccaagcctacaattcttgtcacacccagggattatgtttccatcctcttgtagtaaaaccattataatttgtctgctgtattcacctcatatttagtgatcaacatttttcttcagaacatgacgcaggtcatgggtggtagttcaaggagagagtcagaaaccgagtcgtcatcaagc
1/12,000 of the Arabidopsis genome
cttgacaccagaaatcctcctcgcagatcttctgcttctgatagcttacctcctcaacgacggtaaatccaactccatgttctaccaaatcaacgatctttaatcttccatgttgcttatgagtctgacatgcttaattaatgggcaggtcggtttctgcatctcaagcatcgggagccgctacctcagggtacagaaaagacgaga
gcaattggagatatgacactgaagatatgccggaagaagtcatgagagcctcaacagcacttgaaaatcttcagctagacaggaaaactcggaacctaacatcgtcttggaggtaacttggagcgtcatggctcttaccttacaagtcggattgaactgtaattaatctaatccattggttttggttgtggttcaggaatgtga
aggatggaacaagtgaagaagaagaagggaaagattgataaggctttcgttaaaatccagcttgtgaattagtatctctacatatatatgtgtgtttcttttttcatgtatggttttaaatgttgcaactttgtttcttaagtttttcgtttgtcgtgtttgagaaatccgattggaagtaaagattattgatataagatgtcaactacaattaa
gccgttaacacaaaccgttaacacaaactcaaaaactttcataaaaattctcaatattagtgtcattaaaagcattgttaatctgaggactgtatacattccaaacaattatcatttcccaaatttatttaaaataattttatgatatctaatcctaaatctttttgttgaggaaaaaaaacaaaaaaacaagtaaaccttgtttaggttt
attagggttttaaaagtatttatatttgttttctgctgcagcagactcaaaaagctaagtaaactactcaagtccctcccttttccggcgtcgctattctcagtctcattctgtctcccgtaagtcctaactaagctttctctcttcagtcttcagcctccgcccgttattgttgacaagttttagcctttttgttaattactactttactactcttgttgt
gaatttgctgctactgttgaagccatggaagctcggattttgcagtcttcttcttcctgttattcgtctctttacgctgtcaatcgatcccggttctcttctgtgtcatctccgaaacctttctccgtcagctttgctcagacgacgagaacaaggactcgtgtattatccatgtcgaagaaagatggtcgcactgataaagatgatgacact
gatagtctcaattacaaagattctggtgttgatatcgatgctggtgctgagcttgttaaacgaatcgcaaagatggctcctggaattggtggatttggtggtctctttccattaggtatatatatatatatggaaaactgcaaaattttcacctgaatgttgaaacttttggtcttctaatgaatgagtgtgtgtgagcaggtgatagttatc
ttgtagctggtacggatggtgtagggactaaattgaaattggcatttgaaactggaattcatgacaccattggaatcgacttggtatagcaaattctcttttgtgtgttttgtgatactagcccataaactcatggtttagcttattgttataggttgctatgagtgtgaatgatattattacttctggtgcaaagcctctgtttttccttgattact
ttgctactagtcgtcttgatgtagaccttgctgaaaaggtaccattgcttcatgatctctttccccttttgaatttgagattgctttaaggacttgatattgacgtatgctttgttgtcaggtcattaaagggattgttgaaggttgtcggcaatcggaatgtgctctcttagggggagaggtatgtgttaccgttttgacaatgtagtttacccat
ctttccatgattgtgtatcaatttggttttgttttgttttttttagactgcagagatgcctgacttttatgcagagggcgagtacgatctaagtgggtttgcagtaggcatagtaaagaaaacttcagttatcaacggaaaaaacattgtggccggtgatgttcttattggcctcccgtctagtggtgttcattccaatggtttttctctagtaag
aaggtaaagagttagcgatactcgaggttttaagcttctgatttcatggcttttaaccacattccaattgttgcagggtattggctcgaagcaatctttcgctgaaggatgcgcttccaggtggatcaagtacccttggtgatgctctaatggcacccactgtcatttacgtgaaacaggttggttttcttgtcaacaaatatcattccat
catcacatttgtaacaactctatgacttctctctctctgttatctcgaaggtacttgatatgatagaaaaaggaggagtgaaaggtttagctcatatcacaggcggaggtttcacagacaacattccccgagtcttcccggacggtttgggtgctgttattcacaccgatgcttgggaacttccaccgttgttcaagtggattcaaca
ggtaatgaatgaggagagaatcataaacagaacgattacgtttatacttctagaatgtttgattgtttttggtttattgtatagactgggagaatagaagacagtgagatgagaaggacgtctttacctggggatagggatggttatggtggttagtccagaggcagcttcacgaatacagaagaagtcaagaatggagacta
tgttgcgtatcgcgtaggagaggttgtcaacggtgaaggcgtaagcta
Arabidopsis : l'après-génome

Séquence génomique complète disponible depuis 4 ans, autres génomes végétaux


achevés ou en cours (riz, peuplier etc)

Un inventaire de l'ensemble des gènes et protéines présents dans les génomes


d'angiosperme

Comment assigner une fonction biologique pertinente aux quelque 26 000 gènes
identifiés chez Arabidopsis ?

(moins de 10% d'entre eux ont été caractérisés de façon expérimentale)

De la séquence à la fonction : approches de génomique fonctionnelle

Phénotypage moléculaire
– Régulation de l'expression génique
• Transcriptome (puces & microarrays)
• Protéome (électro 2D, MS)
– Métabolome
Génétique et génétique inverse
– Expression ectopique (sur- & mis-expression, …)
– Inactivation de gènes (mutants)
– Exploitation de la variabilité allélique naturelle
Caractérisation des produits protéiques
– Réseaux d'interactions protéiques (2-Hybrid, TAP…)
– Localisation tissulaire, sub-cellulaire…
– Biochimie des protéines…
Forward

De la séquence au
PHENOTYPE GENE
phénotype :
Génétique inverse Reverse

Interférer de façon ciblée avec l'activité normale d'un gène ou d'une


famille de gènes :

- Remplacement de gène par recombinaison homologue (micro-organismes,


levure, souris, mousse)
- (Sur-)expression ectopique, expression d'une forme modifiée
- La galaxie RNAi : co-suppression, antisens, VIGS, etc
- Mutagenèse d'insertion (C. elegans, Drosophila, souris, Arabidopsis &
autres plantes)

Forward
Les populations
d'insertion sont
utiles pour la PHENOTYPE GENE
génétique directe
et inverse Reverse

Directe :
crible phénotypique > mutant > gène

Inverse :
séquence de gènes > mutant > phénotype
Génétique inverse : crible d'une population d'insertion

Génétique inverse chez les plantes

Mutagenèse d’insertion : stratégies de crible


• PCR sur pools
• Séquençage systématique
PCR screening of T-DNA lines

T-DNA

Génétique inverse : crible en pools


PCR Screening Strategy
Pools (48)
Super-Pools
(8 pools, 384 lines)
Mega-Pools
(24 pools, 1152 lines)
• PCR
+ -
• Confirmation
• Sequencing

- - - - - - + -
• Confirmation
• Sequencing

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + - - - - - - - - - - - - - -

Agarose Gel

T-DNA probe

Gene probe
From super-pools to 48-line pools

- - - SP 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

PCR Screening Strategy


Pools (48)
Super-Pools
(8 pools, 384 lines)
Mega-Pools
(24 pools, 1152 lines)
• PCR
+ -
• Confirmation
• Sequencing

- - - - - - + -
• Confirmation
• Sequencing

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + - - - - - - - - - - - - - -
2-D & 3-D DNA pooling for PCR screening

2-D 3-D
A
1 2 3 4 5 6 7 8 9 10 11 12
B
A
B C
C D
D
E E
F F
G
H G
H

8 rows 8 plates
12 columns 8 rows 28 tests for 768 samples
20 tests for 96 samples 12 columns

1 2 3 4 5 6 7 8 9 10 11 12

Génétique inverse chez les plantes

Mutagenèse d’insertion : stratégies de crible


• PCR sur pools
• Séquençage systématique
Séquençage aléatoire de sites d'insertion
(FSTs - Génoplante)

Isolement des sites d'insertion par PCR (iPCR, TAIL-PCR,


…) sur pools ou lignée individuelle
Séquençage "rapide" (cf ESTs)
Cartographie sur le génome
Constitution de bases de données

http://flagdb-genoplante-info.infobiogen.fr/projects/fst/

Ressources pour la génétique inverse chez Arabidopsis

Salk T-DNA 145589


SAIL FST 48434
GABI-Kat FST 59455 Total Mapped 335662
FLAGdb FST 24594 Total in genes 60301
SM FST 23411 Unique At Genes Identified 27697
Wisc FST 10459
Insertions per identified gene 2,18
RIKEN FST 18551
CSHL FST 5169

SIGnAL TDNA-Express http://signal.salk.edu/cgi-bin/tdnaexpress


GABI-Kat http://www.mpiz-koeln.mpg.de/GABI-Kat/
FST Projects (INRA Versailles) http://flagdb-genoplante-info.infobiogen.fr/cgi-
bin/projects/fst/blast/blastAccueil.pl
The Arabidopsis Information Resource : http://www.arabidopsis.org/links/insertion.jsp
Arabidopsis thaliana Insertion Database http://atidb.org/cgi-perl/index
http://flagdb-genoplante-
info.infobiogen.fr/projects/fst/
Génétique inverse chez les plantes

Mutagenèse d’insertion : analyse des mutants

Assay for mRNA size and abundance


Knock-out ? Assay for protein presence and/or activity

10 Days 5 Weeks
gad1
mRNA WT
gad1
KO
W KO
T
WT clca-1 mAb GAD1
R S R S kb
2.9 mAb GAD2
kDa
1.35 97.4
66.2
1.0

45.0 Coomassie

(C. Maurel et al., Gif) 31.0


Analysis of knock-out lines

Nothing or too little is known Something is known or suspected


about gene function (general about gene function (expression,
case) protein localization & biochemical
function, …)
Broad-based search for
phenotypic alterations in mutants Directed, hypothesis-based
compared to wt search for informative phenotypic
alterations
The dag1-1 mutant shows twisted siliques
containing undormant seeds

10.79 +/- 0.2 mm; 47.68 +/- 4.45 seeds


Fresh seeds Stored seeds
100 100

Germination %
80 80

60 60

40 40
.

20 20

0 0
0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7
Days Days
13.12 +/- 0.35 mm; 58 +/- 5.03 seeds

(Papi et al. Genes & Dev, 2000)

Phénotypage
haut-débit
type sauvage mutant homozygote

Pas de phénotype …

PHENOTYPES CONDITIONNELS
Les conditions environnementales ne permettent pas l'expression du phénotype
mutant, ou la mutation a un effet trop subtil sur le phénotype et/ou la fitness

REDONDANCE
La perte de fonction du gène est masquée par une compensation due à l'activité
d'un ou de plusieurs autres gènes dont les fonctions sont totalement ou
partiellement redondantes avec le premier.
Redundancy

60% of the Arabidopsis genome :


segmental duplications
17% of genes as tandem arrays

25,498 predicted genes in 11,600 families, only 35% unique and 37.4%
belong to gene families of >5 members
To what extent this implies functional redundancy is not yet clear

Redundant functions among duplicated genes

MADS-box regulatory
factors

shatterproof SHP1(AGL1, chr3)


and SHP2 (AGL5,chr2) genes
(87% id.). They have similar
expression patterns at the valve
margins.
They must be simultaneously
removed to suppress fruit
dehiscence
Analysis of knock-out lines

Nothing or too little is known Something is known or suspected


about gene function (general about gene function (expression,
case) protein localization & biochemical
function, …)
Broad-based search for
phenotypic alterations in mutants Directed, hypothesis-based
compared to wt search for informative phenotypic
alterations

SKOR is a Shaker-like, outwardly


rectifying K+ channel

SKOR mRNA is expressed in pc


p en c ep
roots, in the central zone x

(Gaymard et al. Cell, 1998)


Phenotype of SKOR mutant

• Decreased [K+] in aerial parts


• Decreased [K+] in xylem sap

SKOR is involved in loading the xylem sap with K+

(Gaymard et al. Cell, 1998)

11 TON interactors possess common C-terminal motifs


10 20 30 40 50 60 70 80 90
G5Pc D N N N I K E F I H E G - - K R R Q Q R S T R K L I F D R I N S I V S E T T T T R T G N G S - - - - - - - - - - - - - - L H F D L V E H V W A Q L K D W V S D E P S K R D S - -
G13Pc P S L R N S Y A D S T E - - - Q K R L G S N V K N L V F D L V N T L L L E L T P S Y L G P R S - - - - - - S P M I L S G K P L G V Y V I N R M Q E C L T G N G R V E D R W W D - -
G22Pc L L E L E L T D G I V F S S T Q L C D D K N L L Y D C I N E V L M D F C W N E F N P G P - - - - - - - W I S F V K P E V Q L I S D M E I A A K V A Q E G V Y W H L Q P L P -
G16Pc R S N Q N Q E D D D T G - - - E T T I S E E N H N I L F D L L N E V L T V V L G P L T K S G F K N - - - - - - - K L L S S S V S E S T T I R G K Y L L E S T W K I M S E Y L Y S -
G38Pc S L F E D L E K K Y S S - - - V K T S T R L E R K L L F D Q I S R E V L H M L K Q L S D P H P - - - - - - - - - - - W V K S T K V C P K W D - A N K I Q E T L R D L V T R K D - -
G20Pc F A V T S T R P R N S P - - E N L S L R C N R K L L F H L V D E I L A D I L K P H I N L K P - - - - - - - - - W V C H Y P I R S Q R N L K G S E L I D E L S R R I E R F P L - -
G8Pc S H I I E I E E D Q S E - I R A N R L F A L V K S R I I E E Q N Q L L A S H V V D N V L L D F F K - - - - - - - E N N N N E T R D E D K L V - E I V E E W V M R R Q D D E Y N - -
G21Pc K H K G R G F G Q Q Q T V N L V E R S K R K L I F D T I N E I L A H R F A A E G C T K Q P S I T L S I S T Q R T H E K S S R G E E L L - Q T L C S E I D R L Q - D N S K - -
G80Pc N K H R G R G F R Q Q - Q T N P T E T I R R K L V F D T V N E I L A R K F T A E G C I K P - - - R L I A N P L K K L E K I S K E E Q L L - Q T L C S E I D R L Q Q N N S N - -
G65Pc L F L V I E Q T K G C S - - S S S N E K I N R K L V F D A V N E M L G K K L A F V E S Y V D P - - W M K Q - - A K A R K K V L S A Q N L L - K E L C S E I E I L Q K Q A K K R S
G1Pc S S L F D E M E R S R G - - - - A A T S M K T E R K A L F D C V N Q C L A V K F E R M L I G S C - - - - - - K - - G - M M M S G G I L L E H R - D L L A E E V N R E V K G L K K - -
. . R K L . F D . N E . L . . . L E . R

G5Pc
G13Pc
-
-
-
-
-
-
-
-
G
-
E
E
D
D
M
G
100
D
D
A
L
N
S
S
S
-
-
-
-
-
-
-
-
-
-
-
-
110
-
-
L
L
A
A
A
V
E
N
S
K
L
V
V
V
K
R
D
I
120
E
E
I
V
V
A
G
E
R
I
T
G
W
S
T
Q
H
E
S
S
130
L
L
Q
R
V
L
E
E
I
M
D
D
D
S
F
M
G
G
I
E
140
E
E
I
L
E
E
K
L
R
K
L
L
L
L
Q
E
E
E
L
L
150
V
V
E
E
E
E
A
A
V
L
I
M
D
D
L
L
T
S
R
E
160

Q S K L F I P S I C
170 180
A super-family of ~30 Arabidopsis
G22Pc

proteins, 11 of which isolated in


- - - - - F P H T L D Q - - - - - - - I V K K D M A R T G - S W M D L R - - - - F E I G C L G S Y T S E M I L D E L V E E I I M S C R D M V Q V E P M Q E P S S D N L
G16Pc - - - - Q P E R P F C S L D G - - - - I I G W D M D R F P - - W S A L I G - - - E E V N V L G K E V E G M I M A D L V E E L V K D L R R Q I C
G38Pc - - - - - - E - K P S K - - - - - - - - - - Y D V E E K E L Q W L S L E - - - - D D I E I I G R E I E V M L T D E L I T E L V V G A I F
G20Pc - - - - A K C L V L E D - - - - - - - I D A L V A G D F P E I E S A F E - - - - E D G E G I V T E I E R G I F E T L V T E T T T D Y L A T W M V K T A P L K R N D D V S G T W G V H
G8Pc
G21Pc
G80Pc
-
-
-
-
-
-
-
-
-
M
C
C
F
I
I
M
L
L
S
D
E
W
E
D
K
D
D
V
D
E
S
E
E
E
D
D
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
L
I
-
I
I
K
W
W
R
E
E
E
D
D
I
L
L
Y
Q
Q
V
S
S
K
H
Q
E
G
S
M
M
M
K
N
N
W
W
L
G
K
K
C
E
E
I
I
F
N
E
E
G
-
-
-
-
-
-
-
-
-
-
-
D
G
G
E
E
E
K
T
T
E
P
P
Y
G
G
V
L
I
V
V
V
E
L
L
E
D
D
L
I
I
G
E
E
N
R
R
G
L
M
F
I
I
L
F
F
T
K
R
S
D
D
L
L
L
V
I
V
D
G
N
E
E
E
L
V
V
I
V
C
H
T
F
D
S
C
I
E
S
F
L
A A F P R M L S G Q P R Q L F H C our 2-hybrid screen, all possessing
G65Pc E N L L L L E E E E E E E E D F L K C I L D E D M A I Q S E K W T D F D - - - - D A I P G L V L D M E R L L F K D L V K E I V H G E I D R L Q G N S R R Q K T V L A D E
G1Pc - - - - M R E
.
M M I D
.
E
.
- - - - - - - L
.
V
.
D H D
D
M
.
S C F E G
.
R W
W
I G Y E
.
- - - - R E
E
M
.
F E E
.
G
G
I D
E
M
.
E
E
G E
.
I
I
V
.
S A
.
L
L
V
V
D
.
D
E
L
.
V
V
S D
D
I L S T S V L K R S L L
a common C-terminal motif and
four other conserved motifs.
Subdivided into 6 families of high
similarity throughout the whole
sequence. Some have a large
basic domain reminiscent of the
Microtubule Binding Domain of
human APC/ Maize tangled
proteins.
Les protéines TON interagissent
avec une nouvelle classe de
protéines associées aux
microtubules

MAP4-GFP GFP-TIM17
GFP-TIM17
GFP-TIM17

CFP-MAP4

overlay

TIM21 1 4 3

TIM17 1 4 3

TIM65 1 4 3

At1g74160
Génétique inverse chez Arabidopsis

Lignées d'insertion à saturation (1,000,000 ?)

Bases de données FSTs disponibles (335,662)


Ce qui est mutable est disponible
Souvent plusieurs allèles

Mais : l'analyse phénotypique est longue et difficile, et non automatisable dans une
large mesure
La redondance fonctionnelle est un frein à l'analyse génétique

Génétique inverse chez les plantes

Recombinaison homologue
Physcomitrella patens as a model

• Development under control of


environmental factors and hormonal Leafy
Diploid
shoot
interactions model system to study capsule

plant development. Haploid


spores
• Moss morphology is simple studies
at the cellular level are facilitated Chloronema
• Moss life cycle (10 to 12 weeks) has cells
Initial cell
a major haploid gametophytic stage
detection of recessive mutations is
more direct
caulonema cells
- High homologous recombination
frequencies possibility of gene
knock-out
(adapted from Schumaker and Dietrich, Annu. Rev. Plant Physiol. Plant Mol. Biol. 49: 501-523, 1998)

Frequency of homologous recombination in different organisms (>10 % in Saccharomyces cerevisiae,


10-2 to 10-5 in mammalian cells, 10-3 to 10-5 in higher plants)

Gene targeting in P. patens


3’
in vitro
KanR 3’

1 - protonema 2 - protoplasts
3 - Transformation by PEG fusion


4 - Selection of transformants
Gene replacement

vector KanR 3’

chromosome 3’

Recombinant
KanR 3’
locus

Physcomitrella patens TON1


At TON1b 257 aa, 29 kDa

10 20 30 40 50 60
At TON1b MD DY TR EM MD LKT LV TR TL EK KG VL AKI RA EL RA SV FE AI EEE DR VI EN NE GL PP ALL GS
Pp TON1 MD DY MR EM VD LKT LV TK TL EK KG VL ARI RA EL RA NV FQ AM EEQ DH EA ES NG ST SF SLL GT
Pp TON1 414 aa, 45 kDa

70 80 90 100 110 120


At TON1b CN DR AR QL HA SPS GR LL SA LI CE YL DWA QL NH TL KV YQ PE CNS AK DS WK SE IR DF SIN NG
Pp TON1 CN ER AK QL HN SPS GK LL MA LV CD YM EWC EL EH TL KV YM PE LNQ PR AY DR SE LE DI LGL MG

130 140 150 160 170 180


At TON1b YE LN RN ED SR PLL LD VL EG FL KF EN MTQ VM GG SS RR -- -- --- -- -- -- -- -- ES ETE SS
Pp TON1 DP NP VS HD SR PLL LT IV EA YL NE KK ETS GS GS IV ES KS TR NGA TG GS RQ SG GS TS NLD SS

190 200 210 220 230 240


At TON1b LS LD TR NP -- --- -- -- -- -- -- -- --- -- -- -- -- -- -- --- -- -- -- -- -- -- --- PR
Pp TON1 EA LE TR GP TT KKV SE KP MG GS HD CS FQS RS ET DF VG VA ND AAI SP GS YD DN QK LY QKS SR

250 260 270 280 290 300


At TON1b RS SA SD SL PH QRR S- -- -- -- VS AS QAS -- -- -- -- -- -- --- -- -- -- -- -- -- --- --
Pp TON1 AQ SQ LA EL PQ HRR SS GL PA FS GA SR SAS NN RG SN GT AN DQ QSG SR DR DT DG KR RD HCW KE

310 320 330 340 350 360


At TON1b -- -- -G AA TS GYR KD ES NW R- -- -- --- -- -- -- YD TE D- --- -- -- -- -- -- MP EEV MR
Pp TON1 ED ES PG GS FS NRK KD N- AW RD QD YD NPY TN PS PR TD KG DG KSQ RS EH ST SQ IR RT SSL EA

370 380 390 400 410 420


At TON1b AS TA LE NL QL DRK TR NL TS SW RN VK DGT SE EE EG KD
Pp TON1 PS KA LG NL QL DDD SA SE FG SG LN PG SRA PP TA SA GN KK QA SAY FY SD SE EE NV LE
KO
±KO wt

Valse à trois ton (courtesy Didier Schaefer)

•Marchantiophytes

Embryophytes •Anthocerophytes
"Bryophytes"
Stomatophytes

•Bryophytes
Hemitracheophytes

•Lycophytes
Polysporangiophytes

Moniliformopses

"Ptéridophytes"
•Sphénophytes
Ordovicien moyen (- 460 mA) •Filicophytes
Euphyllophytes

(macro-fossile Cooksonia : - 410 mA)

270 000 espèces


Coniférophytes

• Archégones/Anthéridies •Gingkophytes
• Phase diploïde multicellulaire
Spermatophytes

•Pinophytes "Gymnospermes"
• Sporanges
• Spores à sporopollénine •Cycadophytes
• Cuticule épidermique
Anthophytes

• Spermatozoïdes : centrosome à double centriole •Gnetophytes


• Anneau de préprophase
•Angiospermes "Angiospermes"
• Géne tufA nucléaire
The functional genomics nebula

mRNA levels
(transcriptional regulation) bioinformatics &
comparative genomics

GENE FUNCTION
protein levels
protein localization gene knock-out and/or
protein modifications deregulation
protein structure
biochemical activity Mutant analysis
protein/protein interactions
QTL studies