Vous êtes sur la page 1sur 38

Plan du cours : première partie

Qu’est ce que la biologie moléculaire ?


A : rappels sur le
génome
Les acides nucléiques
Le DNA circulaire
La chromatine
B: Les outils de la biologie moléculaire
Enzymes qui coupent les acides nucléiques
Enzymes qui changent les contraintes des AN
Enzymes qui travaillent sur les phosphates
Enzymes qui recopient les acides nucléiques

C: Les techniques de la biologie moléculaire


Purification des acides nucléiques
Dosage spectrophotométrique des AN
Dénaturation thermique des acides nucléiques
Electrophorèse sur gel
Plan du cours : deuxième partie
D : Réplication de l’ADN
Définitions élémentaires
Mécanismes de la réplication chez EColi
Mécanisme de la réplication chez les eucaryotes
Mécanismes de la réparation

E: La Transcription
Les prokaryotes
Les eucaryotes

F: La Traduction
Le Code génétique
L’initiation
L’élongation
La terminaison

G : De l ’ADN aux protéines


Comment cela a-t-il commencé ? !! /??
Du gène à la protéine
Du gène à l’organisme
Décryptage d’un texte en écriture hiéroglyphique
Structure des riboses

En solution aqueuse le groupe


aldehyde du ribose réagit avec
un groupe hydroxyle de la même
molécule pour former un cycle
Furanose.

5' 5'

HO CH2 O OH HO CH2 O OH

4' C H H C 1' 4' C H H C 1'


C 3' C C C
H 2' H H 2' H
OH OH OH H

Ribose 2'-déoxyribose
Structure des bases
La cytosineest
Lacytosine est
6
4 formée d’un noyau
formée d’un noyau
5 N N3 5 Purine
Purinedont
dontlele
N1 7
carbone
8 2 6 carbone44estest
L’adenine
L’adenineest
estformée
formée
2
3
9 L’uracile
L’uracileest
est
1 Substitué
Substitué parune
par une
N
4 N formée d’un N fonction
d’un
d’un noyau purinedont
noyau purine dontlele formée d’un fonctionamine
amineetet
lelecarbone
carbone noyau
noyaupyrimidine carbone22parpar
carbone66est
estsubstitué
substituépar
par Purine dont
pyrimidine Pyrimidine une
unefonction
fonctioncétone
une dont lescarbones
les carbones cétone
unefonction
fonctionamine
amine 22et
et 4 portentdes
4 portent des
fonctions cétones
fonctions cétones

O O O NH2
NH2
N CH3 4
6 N HN
6
HN
4
HN
4
5 N
N
2
2 2 2

N H2N N N O N O N O N
N H H H H H

Adenine Guanine Uracile Thymine Cytosine


La guanineest
Laguanine estformée
forméed’un
d’un
noyau
noyau purine dont le carbone22
purine dont le carbone La thymine: :un
Lathymine unnoyau
noyaupyrimidique
pyrimidique
est dont
dont les carbones 2 et 4portent
les carbones 2 et 4
estsubstitué
substituéparparune
unefonction
fonction une
portent
amine
amineetetlelecarbone
carbone66parparune
une une fonction cétone maisdont
fonction cétone mais dontlele
carbone
carbone55estestsubstitué
substituépar
par
fonction
fonctioncétone
cétone par un methyl
par un methyl
Structure des bases

6 4
5 N N3
N1 7 5
8 6
2 9 2
1
3
N
4 N N

Purine Pyrimidine
Tautomérie des Bases

Les
Lesbases
basessont
sontsujettes
sujettesààlalatautomérisation.
tautomérisation.
amino vers ou vers
amino vers imino ou keto versenol
imino keto enol

Cette
Cettetautomérisation
tautomérisationentraîne
entraînedes
desmodifications
modifications
du
dupotentiel
potentielde
deformation
formationdedeliaisons
liaisonshydrogènes
hydrogènes
donc des possibilités d’appariements
donc des possibilités d’appariements

Dans
Dans desdes conditions
conditions physiologiques
physiologiques
les
les formes
formes amino
amino etet keto
keto ou
ou lactam
lactam
sont
sont présentes
présentes àà 99,99%.
99,99%.
Liaisons hydrogènes entre bases
Les bases peuvent s’associer
entre elles par formation de
4
liaisons hydrogènes. 3

A T ou A U 1

G C
N6 O4
A T 4
N1 N3
2 3

N6 O4 6
A U
N1 N3 2
1

O6 C4
G N1 N3 C
N2 02
UN NUCLÉOSIDE

BASE PURIQUE OU PYRIMIDIQUE + OSE


(RIBOSE OU 2'-DÉSOXYRIBOSE)
O O O
N
O O N
N N
N

O O
O O
O O
C ytidine U ridine
Les nucléosides puriques
C H3
N O N O N
O O N O O
O N N N
N O N
O N
O
O N N N N
O O
O O O O O
D ésoxycytidine D ésoxythym idine N
Adenosine Guanosine
N
N O
Les nucléosides pyrimidiques O N
N
O N
O
O N N
N N O
O
N
Désoxyadenosine Désoxyguanosine
Liaison glycosidique

La liaison ose – base est une liaison


glycosidique qui se forme avec
l’élimination d’une molécule d’eau
entre la base et la fonction hydroxyle
située en C’1 de l’ose.
Conformations SYN et ANTI

La formation de la liaison glycosidique peut


Conduire à deux types de conformation :
SYN et ANTI
Le passage d’une forme à l’autre implique
de très fortes contraintes stériques
NUCLÉOTIDE

NUCLÉOSIDE + ACIDE PHOSPHORIQUE

Un nucléotide est un nucléoside


lié à un acide phosphorique par
une liaison ester.

Nucléotide monophosphate
Nucléotides di- et tri- phosphates

Un nucléotide composé est une molécule


composée d’un nucléoside liè par une
fonction ester à un acide phosphorique
suivi de deux autres phosphates liés par
des liaisons anhydride d’acide.

Les nucléotides triphosphates sont des


molécules riches en énergie.
Ex: TTP
Liaisons phosphodiester
Dans un acide nucléique(polymères des
nucléotides), les nucléotides sont associés
entre eux par des fonctions ester.
Quand l’acide phosphorique présente ses
deux fonctions acide bloquées par la
formation d’ester on parle de liaison
phosphodiester.

La liaison a est
une liaison en 3’
du sucre alors que
la liaison b est une
liaison en 5’ du
sucre suivant
Les acides nucléiques
La chaîne d’ADN
La chaîne d’ARN
La polarité d’une chaine d’acide
nucléique
Conformation du brin d’AN
Appariement des bases (règle de
complémentarité)
La double hélice
Structure
Sens de rotation
L’ADN
L’ARN
Tableau récapitulatif de la
structure des AN
Les acides nucléiques: l ’ADN

Une chaîne (ou brin) d’ADN est formée par


l ’enchaînement de désoxyribonucléotides
dGMP, dAMP, dCMP et TMP.
reliés par des liaisons phosphodiester
entre le carbone 3 ’ d ’un nucléotide
et le carbone 5 ’ du suivant.
Les acides nucléiques: l ’ARN

La
Lachaîne
chaîne(ou brin) d’ARN
(oubrin) d’ARNestestformée
forméepar
par
ll’enchaînement de ribonucléotides
’enchaînement de ribonucléotides
GMP,
GMP, AMP,AMP, CMP
CMP et et UMP
UMP..
reliés
reliéspar
par des
desliaisons
liaisonsphosphodiester
phosphodiester
entre
entrelelecarbone
carbone33’’dd’un’unnucléotide
nucléotide
et le carbone 5 ’ du suivant.
et le carbone 5 ’ du suivant.
Polarité de la chaîne d’AN
Extrémité
Extrémité5’5’

Liaison
Liaisonphosphodiester
phosphodiester

Représentation schématique
du fragment 5’- C-A-G-3’
5’Phosphate – C – A – G - 3’OH

Liaison
Liaisonphosphodiester
phosphodiester

Extrémité
Extrémité3’3’
Brin d ’ADN (sens)

OH-5 ’CGTGAATTCACG-3 ’OH


Les appariements de nucléotides

Vus
Vuspar
parun
un
modélisateur
modélisateur

Vus
Vuspar
parun
un
chimiste
chimiste
Brin d ’ADN (antisens)

OH-5’CGTGAATTCACG-3 ’OH
Règle de complémentarité
La double hélice d ’ADN
5’ 3’

3’ 5’
La double hélice d ’ADN
La forme B

Deux
Deuxchaînes
chaîneshélicoïdales
hélicoïdalesààrotation
rotationdroite
droite

Deux
Deuxchaînes
chaînespolynucleotidiques
polynucleotidiquesàà
polarité
polaritéinversée
inversée(antiparallèles).
(antiparallèles).

Pourquoi antiparallèles ?

5’ 3’

3’ 5’
5’ 5’

3’ 3’
Hélices droites et hélices gauches

La projection d'une hélice selon Hélice droite: rotation anti horaire


son axe est un cercle Hélice gauche: rotation horaire
Hélices droites


Hélice gauche


Hélices gauches
Double hélice gauche


La double hélice d ’ADN
La forme B

Deux
Deuxchaînes
chaîneshélicoïdales
hélicoïdalesààrotation
rotationdroite
droite

Deux
Deuxchaînes
chaînespolynucleotidiques
polynucleotidiquesàà
polarité
polaritéinversée
inversée(antiparallèles).
(antiparallèles).

Pourquoi antiparallèles ?

5’ 3’

3’ 5’
5’ 5’

3’ 3’
Les sillons de l ’ADN

L’
L’ ADN
ADN sous
sous forme
forme B
B

Observer la différence entre

le grand sillon

le petit sillon

Intéressant pour la reconnaissance


des protéines
La chaîne d ’ARN
LL’ARN
’ARNest
eststructuré
structuréen
ensimple
simplebrin...
brin...
5 ’- CAAGAGCCUAAUAACUCGGGCUAUAAACUAAGGAAU - 3 ’

...quipeut
...qui peutse
sereplier
replieren
ensuivant
suivantlalarègle
règle
decomplémentarité
de complémentaritédes desbases.
bases.

Boucle

Tige

5 ’- -3’

L’un des éléments de structure ainsi formé, qui joue un rôle important dans les fonctions
biologiques des ARN, est l ’épingle à cheveux ( hairpin ) ou tige boucle.
La double hélice d ’ARN
Deux
Deuxchaînes
chaîneshélicoïdales
hélicoïdales
ààrotation
rotationdroite
droite

Deux
Deuxchaînes
chaînespolynucleotidiques
polynucleotidiques
ààpolarité
polaritéinversée.
inversée.
(antiparallèles).
(antiparallèles).

Conformation
Conformation A
A
Les sillons de l ’ARN

L’
L’ ARN
ARN sous
sous forme
forme A
A

le
lepetit
petitsillon
sillon

le
legrand
grandsillon
sillon
Les différentes catégories d ’ARN
Les ARN participent à toutes les étapes de l ’expression des gènes
et de la biosynthèse des protéines
Dans les cellules on trouve essentiellement quatre types d ’ARN.

Les
LesARN
ARNribosomiques
ribosomiques(rARN)
(rARN)
Les
LesARN
ARNde
detransfert
transfert(tARN)
(tARN)
rRNA 16S Les
LesARN
ARNmessagers
messagers(mARN)
(mARN)
des
desARN
ARNnucléaires
nucléairesde
depetite
petitetaille(snARN)
taille(snARN)
tRNA

5’ 3’
5’
3’

snRNA
rRNA 5S
mRNA
Caractéristiques des formes canoniques A et B des AN

Forme B

Forme B A

Nombre de paires de bases par tour 10 (10,4) 11

Angle de torsion par paire de base 36° 32,7°


34Å

Pas de l'hélice 34 Å 29 Å

Distance axiale entre les paires de bases 3,4 Å 2,6 Å


3,4Å

Angle de basculement voisin de 0 à peu près 20

Largeur des sillons Grand 11,4 Å 2,4 Å

Petit 6,0 Å 11,0 Å

Distance du phosphore à l'axe de l'hélice 9,3 Å 9,5 Å