Vous êtes sur la page 1sur 14

1

DNA COMPUTING

By,
Ch.Lakshmi Kalyani & K.Haritha
¾, B.TECH. CSE, College of Engineering,
Andhra University

Email: kalyanichalla85@gmail.com,
harithakiraj1@gmail.com

For,
ANITS,
VISAKHAPATNAM

000 times that of a typical high performance hard drive! This feature of computers based on molecular biology gives rise to a seriously debated question whether they would be an alternative to the microprocessor made of silicon which would soon reach its limit of speed and miniaturization. manipulation of DNA.000. even supercomputers. The concepts like successor to silicon. C (cytosin). the data density is over 1. 2 Abstract DNA computing is a fledgling technology that uses the synthetic make-up of DNA for computing purposes in contrast to binary 0s and 1s used in silicon chips of electrical computers.000 gbits per square inch. yet it can solve very common problems(which today’s computers. its operations in parallel are elucidated herein. This paper zeroes in on the hypothetical model of a DNA computer and an illustration of how such a computer can solve a logistics problem called Hamiltonian problem. Although this technology cannot compete with most of the pros of silicon technology. take an incredibly long time to find an answer) in a remarkably very little time owing to its parallel processing and high data density capabilities. T (thymin). Just like a string of binary data is encoded with ones and zeros a strand of DNA is encoded with four bases namely A (adnine). which is about 100. . G(guanine). It is noteworthy that DNA computing is gaining serious attention by the National Governments for speedy decryption of protected data.The data density of DNA is strikingly high in 2d.if we assume one base per square nanometer.

DNA molecules have already been Biology is in the offing. which Definition of DNA promises to have a tremendous influence on the The scientific name for DNA is theoretical and practical progress of computer deoxyribonucleic acid. Almost every two years. Millions of 50's. One of the recently introduced unconventional paradigms. complexes can be viewed as potential machines components dates back to the late 1950s. it potential to perform calculations many times has also been realized that integrated circuit- faster than the world's most powerful technology is running against its limits and it has human-built computers. DNA has the have assumed only half the space and however. including our body. science is DNA computing. molecular biology A brief history and computer science is to produce some The idea that living cells and molecular remarkable offspring. It is sure that the union of two of cell to reproduce and perform their functions. DNA might one day been a hotly debated question whether computers be integrated into a computer chip to create a of an entirely new kind. DNA carries the genetic the classical Turing/Von Neumann notion of information that encodes proteins and enables computing. computers have natural supercomputers exist inside living become twice as fast whereas their components organisms. science's most fertile fields. Moore's Law leaves off. which under some helical molecular chain found within the nucleus circumstances might be an elegant alternative to of each cell. when Microprocessors made of silicon will Richard Feynman delivered his famous paper eventually reach their limits of speed and . The double-stranded. We won't believe where scientists have found Today's computers are millions of times more the new material they need to build the next powerful than their crude ancestors in the 40's and generation of microprocessors. Chip makers need a new material to produce faster computing speeds. DNA computers have the potential to be capable of storing billions of times more data take computing to new levels. 3 Introduction miniaturization. the number of electronic devices problems. picking up where than our personal computer. put on a microprocessor has doubled every 18 While still in their infancy. quantum-mechanical so-called biochip that will push computers even computers or computers based on Molecular faster. DNA computers will months. In accordance with harnessed to perform complex mathematical Moore's Law.

hence Why DNA? the name 'semiconductor'. engineering and so DNA offers a solution to many of the hurdles on. . the well-known function of DNA is microprocessor. thus increasing speed interesting candidate for other roles that nature did and efficiency. By representing information as is the transistor. Its immediate goal is to improve that causes the circuit to shorten. Beyond a the limitations that classical silicon-based certain limit. when Len Adleman of USC announced that electronic devices. Alien showed how to use existing DNA-manipulation atoms. the number of silicon atoms in the electronics is facing in the coming years. It is the best producing a new range of electronic devices that nanowire in existence. chip that is only slightly larger than a thumbnail. genetic information. the more can can conduct an electrical current has made it an be squeezed onto a chip. conducting and a non-conducting state. techniques to implement a simple. added during the production process. and it self-assembles. In fact. DNA electronics does not aim to make sufficient to prevent the leakage of electrons something new. vial of DNA. he had solved a small instance of a The basic unit of an integrated circuit. us into the domain of DNA electronics. and these limits of electric circuits. such as the Pentium IV® chip. could be useful in nanotechnology for the design technical and economic limits. This field is highly smaller electronic devices may eventually lead interdisciplinary. a simple electronic switch that sequences of bases in DNA molecules. But in the past few years. to use individual DNA molecules for that need to be overcome. biology. Adleman is etched into various layers of silicon. chemistry. A modern Biologically. DNA transistors is heading towards physical. In addition. although in the cost of production increases drastically with any process it may create entirely new ideas in reduction in size. massively allow a transistor to switch between a parallel random search. So the need to develop even nanoelectronics. But further miniaturization of not intend for this molecule. computationally intractable problem using a small such as a computer processor or a memory chip. insulating layers of a transistor is no longer In general. merging physics. which could help to overcome will be reached within a few years. faster and more energy computing was grounded in reality at the end of efficient than the present semiconductor-based 1994. In particular. the discovery that DNA The smaller these transistors are. the old concepts in a new manner. 4 describing "sub-microscopic" computers DNA are much smaller. computer science. to code for functional proteins that are the has more than 40 million transistors on a silicon expressed form of hereditary.

C. really. and G. which is what all modern DNA: A unique data structure CPUs are. von Neumann architecture computer. such processors per volume would be potentially The Structure and manipulation of DNA . but in general. ligation. PCR- DNA. represented by the letters A. Just like execute cycle" over and over again. T.000 times faster than the fastest computers. however. stochastic machines that approach molecule. parallel. is non-von spaced every 0. with its unique data structure and ability to amplifications) would be slow compared to perform many parallel operations. It does bases. nanometer. In an in vitro assay we could handle conformations. and modern CPUs incorporate some supercomputers existing today. if you assume one base per square different class of problems. allows you to electronic computers. This is about a billion times more energy instructions are handled sequentially. Compare this to the data bit/nm3. Neumann machine. A von efficient than today's electronic devices. •Speed: Although the elementary operations Successor to silicon (electrophoretic separation.35 nanometers along the DNA Neumann. in the basic • Energy efficiency: 1019 operations per Joule. a strand of DNA is encoded with four memory. really The bases (also known as nucleotides) are fast. which is about 7 Gbits per square inch -- small processor on nano-scale and the number of a factor of over 100. so that in certain models the point of view. And it is cheap. these many. it fetches an a string of binary data is encoded with ones and instruction and the appropriate data from main zeros.000 smaller. parallel processing. their parallelism would look at a computational problem from a different strongly prevail. as the cost of easily with about 1018 processors working in individual bases is hardly a rupee. basically repeats the same "fetch and The data density of DNA is impressive. density of a typical high performance hard • High parallelism: every molecule could act as a drive. Of course there are multi-processor least 100. Transistor-based computers number of operations per second could be of typically handle operations in a sequential order 1018 operations per second. which is at manner. many times in a row. 5 self-replicates and can adopt various states and enormous. In two computers for the purpose of solving a dimensions. DNA computers. giving DNA a remarkable data computation in a different way from ordinary density of nearly 18 Mbits per inch. the data density is over one million • Size: the information density could go up to 1 Gbits per square inch. and it executes the instruction.

A bonds with T and G In the cell. thus any single Detection: Confirm presence/absence of DNA strand has a natural orientation. Merging: pour two test tubes into one to perform union. The four DNA nucleotides are computer: adenine. T) and (G. It CAATGTTGCGCATGCATGTTCACAGGCT consists of polymer chains. The following operations can be done on DNA An n-letter sequence of consecutive bases is sequences in a test tube to program the DNA known as an n-mer or an oligonucleotide of length n. Synthesis: synthesis of a desired strand commonly abbreviated to A. guanine. Cutting: cut DNA with restriction enzymes Ligation: Legate DNA strands with Each strand has. or bases. G. There is a wide variety and sequence is number of these "operational" proteins. Thus a hypothetical DNA molecule to nature's design. double helix of DNA is formed when two separate Operations in parallel strands bond together. commonly TACCGGTTAC referred to as DNA strands. cytosine and thymine. which are tiny protein therefore known as Watson-Crick complementary machines that read and process DNA according base pairs. 6 DNA (deoxyribonucleic acid) encodes the AACGCGTACGTACAAGTGTCCGAATGGC genetic information of cellular organisms. Extraction: extract those strands containing a given pattern. The classical in a given test tube. C and T Separation: separation of strands by length respectively. a 5' and a 3' end. according to chemical complementary sticky ends using legate. The pairs (A. which . Bonding occurs by the pair wise attraction of bases. Each strand may Operations on DNA sequences be viewed as a chain of nucleotides. convention. Melting/Annealing: break/bond two single strand DNA molecules with complementary sequences. C) are variety of enzymes. Amplification: use PCR(polymerase chain reaction) to make copies of DNA strands. DNA is modified biochemical by a bonds with C.

Other the computer’s task is to check each of them and enzymes function as copiers and others as repair winnow out the incorrect ones. . The Hamiltonian Path Problem enzymes do not function sequentially. OR. and two-way roads. that makes up the palette of operations available 3. that allow the shortest strand and decoding it what answer it to perform even the most complex calculations. This is the power of DNA (HPP) may be phrased as follows: computing. logical answer. and computer does that subjecting all of the strands Biotechnology have developed techniques that simultaneously to a series of chemical reactions allow us to perform many of these cellular that mimic the mathematical computations and functions in the test tube. 7 manipulate DNA on the molecular level. and many others. Output: When the chemical reactions are for computation. Nondeterministic Polynomial (NP) time. along with some synthetic chemistry. that it can work in a massively parallel “given a set of n cities connected by one-way fashion. For 2. Molecular biology. many copies of the A well known mathematical enzyme can work on many DNA molecules problem called The Hamiltonian Path Problem simultaneously. DNA has cutting. it represents. For instance. Just like a CPU has a basic suite complete. etc. which signifies the nucleotides. with one another. by locating the longest or operators (AND. copying. NOT NOR). using the class of problems solvable in techniques developed for bio-technology. Biochemistry. repairing. pasting. but trying to solve. The strands have been synthesized in fact belongs to the notoriously intractable by combining the building blocks of DNA. and enzymes that paste it back together. Input: Each DNA strand represents one possible answer to the problem that computer is The problem is deceptively easy to describe. humans analyze the strands to find the of operations like addition. Rather. called class of NP-complete problems. And note that in the test tube. does there exist a path through this network starting at the first city and Hypothetical model of DNA computing ending at the last city such that each city is visited once and only once?” 1. there are enzymes that cut DNA and incorrect. but one or a few may be correct. It's this cellular electronic computer would perform on each machinery. possible answer. bit-shifting. The DNA units. Processing: Most of the possible answers are example. working on one DNA at a time.

then each city and each route between two cities in those containing the DNA sequence for city 2. put into a test tube. respectively. The third stage is to extract all those strands way roads. second". If there is a solution to this route For example. Consider a stored in a separate test tube. increase in the number of possibilities to be If each city is represented by 8 DNA bases. when manual or first half of the strand for city 2. it will be found in the strands extracted could be AATGCCGG.. and so on. all searched through. conventional computing techniques become GGCCAAAT. That is. The second stage was to extract those strands .. "The DNA computer provides complementary version of the last four bases of enormous parallelism.e. but where each possibility can strands of 40 bases would be extracted and be searched through polynomial time. and manipulation techniques is that they will work the second part is the complementary strand to the on a much larger scale. and AAAT is the complementary version teaspoon of solution approximately 10 to the of the first four bases of city 2. map with five cities linked by one-way and two. i. these problems involve a search where which corresponded to a certain length which at each point in the search there is an exponential signified exactly 5 cities being passed through. Adleman's approach was to encode containing the DNA sequence for city 1. GGCCAAAT Example of DNA structure illustrating AATGCCGGTTTAAGCC Hamilton problem Similarly the DNA molecules strands can be formed for all the nodes and edges representing all possible routes in the directed graph in the test tube. Thus the edge power 14 DNA 'flight numbers' were joining the cities 1 and 2 is being encoded as simultaneously concatenated in about one follows. DNA strands. The first stage of Adleman's computation was to extract those long strands which start with city 1 and store these in a separate test tube. GGCC is the overwhelmed. 8 Typically. in one fiftieth of a city 1. A road from city 1 to 2 is encoded in This particular problem can be manually solved such a way that the first part is the complementary in a few minutes but the key point about DNA strand to the second half of strand for city 1. the strand coding for cities 1 and 2 problem. TTTAAGCC for the last city 5.

need to check increases exponentially. the number of itineraries you simplified to make it easier to follow and present. and it becomes a problem NY being my final destination. It should take you only a moment to see that there 3.A. The hand. and need to visit four soon you will run out of pen and paper listing all cities: Houston. the problem quickly gets out of DNA methods demonstrated by Adleman. Chicago. there is a the shotgun approach mentioned previously. the selection process is massively parallel. Assuming a random distribution of concepts are the same but the example has been connecting routes. Select itineraries with the correct is only one route. and NY. visit a city twice. The airline I’m for a computer or perhaps DNA. What should my itinerary be then selected the correct itinerary. seven. using the cities increases. For something works than by going through an six. as the number of directed Hamiltonian Path problem. For this example you obviously don’t need There is no better way to understand how the help of a computer to find a solution. the problem is example step by step. or not make it to N.Y.e. Select itineraries that start with the proper city and end with the final city.Y. Miami. Since the enzymes work on many DNA molecules at once. This is the if I want to visit each city only once? advantage of DNA. Dallas. fly to Chicago. He flight from L. to Chicago. 9 The Adleman experiment destination. you need to number of cities. Generate all possible routes. 2. It’s small and there are combinatorial techniques that can quickly generate many different data strings. with the possible routes. Miami and then to N. Any other choice of cities will force you to miss a . However. Pretty Suppose that I live in LA. So let’s solve our own still manageable. The method taking has a specific set of connecting flights that Adleman used to solve this problem is basically restrict which routes I can take (i. or even eight cities. but no flight from first generated all the possible itineraries and Miami to Chicago). the method based on Adleman’s experiment would be as follows: 1.A. Starting from L. Specifically.

. you can encode the routes between For example. For example. which New ATGCCG not only uniquely represents the route from York Miami to NY. 10 4. To accomplish this you city sequences for which routes exist. For example: York would simply be GCTACGCTAGTATCGTACCTACGGATGCC G. So how do we generate this? Synthesizing short single stranded DNA is now a routine process.CGG) and the first half of the code from L. each city can be represented by a cities by encoding the compliment of the second "word" of six bases: half (last three letters) of the departure city and the first half (first three letters) of the arrival Los GCTACG city. city only once. or equivalently it could be represented in double stranded form with its complement . Select itineraries that contain each sequence. Encode itineraries by connecting the together in proper order. the route Miami (. GCCTAC. Itineraries can then be produced Strategy: Encode city names in short DNA from the city encodings by linking them sequences. can take advantage of the fact that DNA hybridizes with its complimentary sequence. standard molecular biology techniques.. For DNA can simply be treated as a string of data. By taking the complement of this you get.A -> Chicago -> Dallas -> Miami -> New representing NY (ATG. The molecules can be made by a machine called a DNA synthesizer or even custom ordered from Part I: Generate all possible routes a third party. example. For example the route between Miami Angeles (CTACGG) and NY (ATGCCG) can be made Chicago CTAGTA by taking the second half of the coding for Dallas TCGTAC Miami (CGG) and the first half of the coding for Miami CTACGG NY (ATG). but will connect the DNA The entire itinerary can be encoded by simply representing Miami and NY by hybridizing stringing together these DNA sequences that itself to the second half of the code representing represent specific cities. This gives CGGATG... All of the above steps can be accomplished with so encoding the city names is straightforward.).

11 Part II: Select itineraries that start and end with the correct cities Strategy: Selectively copy and amplify only the section of the DNA that starts with LA and ends with NY by using the Polymerase Chain Reaction. What we are left with are allows you to produce many copies of a specific strands of DNA representing itineraries with a sequence of DNA. amplified exponentially. By selecting primers that flank the section of DNA you want to amplify. amplify the itineraries that start and stop with so numbers are on our side. For example: those cycles through a series of copying events using an enzyme called polymerase. we now have a test tube full of various lengths of DNA that encode possible routes between cities. say 10^13 copies of of PCR. After many iterations an excess of DNA encodings. Polymerase will copy a section of single stranded DNA starting at the position of a primer. So to selectively Remember DNA is a highly compact data format. After Part I. What we want Random itineraries can be made by mixing city encodings with the route encodings. we use primers that are complimentary to LA and NY. the are routes that start with LA and end with NY. What we end up with after PCR is a test tube full of double . the polymerase preferentially amplifies the DNA between these We can be confident that we have all possible primers. a short piece of DNA complimentary to one end of a section of the DNA that you're interested in. PCR is an iterative process random number of cities and random set of routes. doubling the amount of DNA combinations including the correct one by using containing this sequence. which enzyme called ligase. our cities of interest. To accomplish this we can use a technique DNA strands can be connected together by an called Polymerase Chain Reaction (PCR). Finally. the DNA you're working on is each city and each route between cities.

The gel is made accomplished by attaching the compliment of up of a polymer that forms a meshwork of linked the sequence in question to a substrate like a strands. The beads are then mixed with through the tiny spaces between these strands. Our test tube is now filled with DNA encoded itineraries that start with LA and end with NY. However be left with strands that encode each city once. where the number of cities in between LA and NY varies. . encoding with each band corresponding to a certain itineraries that start with LA and end with NY. We can then simply cut out the band of interest to isolate DNA of a specific length. DNA is a Strategy: Successively filter the DNA negatively charged molecule under most molecules by city. We now want to select those itineraries that are five cities long. base pairs of DNA. DNA. since the charge density of DNA is constant DNA containing a specific sequence can be (charge per length) long pieces of DNA move as purified from a sample of mixed DNA by a fast as short pieces when suspended in a fluid. the DNA. The basic principle behind Gel complete set of cities Electrophoresis is to force DNA through a gel matrix by using an electric field. In this Strategy: Sort the DNA by length and select the case we would isolate the DNA that was 30 base DNA whose length corresponds to 5 cities. technique called affinity purification. 12 stranded DNA of various lengths. one city at a time. These with after running a gel is a series of DNA bands. To accomplish this we can use a technique called Gel Electrophoresis. we will be attracted to the positive potential. Since the conditions. which contains the sequence which slows down the DNA at different rates you're after then hybridizes with the depending on its length. What we typically end up complement sequence on the beads. knowing the length of the itinerary gives us the number of cities. This is This is why you use a gel matrix. Part III: Select itineraries that contain the Since we known that each city is encoded with 6 correct number of cities. The DNA now is forced to thread its way magnetic bead. so if placed in an electric field it will DNA we start with contains five cities. length. pairs long (5 cities times 6 base pairs). which is a common procedure used to resolve the Part IV: Select itineraries that have a size of DNA.

Finally. Takes a pretty good time to obtain the answer visit each city once. Reading out the answer 2. then NY'-beads. with a different primer for each city in succession. For know Dallas is the fourth city in the itinerary example.. graduated PCR. itinerary is missing a city. using a Dallas primers was 24 base pairs long. 1. chips to make the entire process comfortable since we already have the sequence of the city and without any researcher for analysis. This field should advance to develop bio simply sequence the DNA strands. and LA & NY. Dallas. if we were careful in (where the ' indicates compliment strand) to fish our DNA manipulations the only DNA left in out DNA sequences which contain the encoding our test tube should be DNA itinerary encoding for L. Miami. However. and succession of primers used is LA & Chicago. For example. Chicago. for the first run we use L. Miami'-beads.'-beads (24 divided by 6). the next run we use Dallas'-beads. so if the PCR product for the LA and So we now affinity purifies fives times. conventional computer. What we are Limitations left with are the are itineraries that start in LA. By measuring the various lengths of DNA for each PCR product we can piece together the final sequence of cities in our itinerary. It requires human assistance for analyzing the One possible way to find the result would be to result. Here we do a series of PCR amplifications using the primer corresponding to L. The order isn’t important. 13 beads can then be retrieved and the DNA isolated.A. encodings we can use an alternate method called . you different city complement for each run. (which should be the entire DNA because LA.A. and 30 base pairs. then it will not be 24. we know that the DNA itinerary starts with LA and is 30 base pairs long. LA & Dallas.A. and end in NY. then Chicago'-beads. If the answer obtained in the blink of an eye by a exists we would retrieve it at this step. "fished out" during one of the runs and will be removed from the candidate pool. and finally LA & Miami. So if the of step 3). If an we would get PCR products with lengths 12. and NY. 18. This is for such a problem whose solution could be exactly what we are looking for.

. The DNA computer might be a cost effective way to decode the genetic material of humans •The DNA computer probably would be faster and other living things and it might be able to than a conventional computer.Unlike conventional computers. RYAN There is possibility of applications in other areas 3. “DNA computing: A Primer” by WILL systems. taking on tasks one at a time. researchers predict by VINCENT way that's analogous to the way we use electronic KIERNAN computers to control electrical and mechanical 2. 14 Advantages of DNA computer: 3. L.com Research papers • It is possible that we could use DNA computers 1. Molecular Computation of in the coming future. Solutions to Combinatorial Problems. DNA based computers could race past super to control chemical and biological systems in a computers. Conclusions 1. A DNA computer coupled with an input and output module is capable of diagnosing cancerous activity within a cell and then releasing an anti- cancer drug upon diagnosis. particularly if there create ‘web databases’ of DNA for research are further advances in processes for synthesizing purposes that would eliminate the time and decoding DNA quickly. DNA can be performed by a variety of bimolecular methods. 2. Conventional computers operate linearly. Hypography. consuming task of translating DNA into a form • Encrypting and decrypting data that is stored as that can be stored in an electronic computer. DNA computers perform calculations parallel to other calculations.Adleman. References Web sites: • DNA computers target in detecting deadly Wikipedia.com today's instruments.com viruses like West Nile or bird flu much faster than How stuff works.com.