Vous êtes sur la page 1sur 13

Matériels et méthodes

B.Matériel et méthode 

I. Echantillonnage 

C’est une étape primordiale qui conditionne la qualité des résultats. Les
échantillons doivent être toujours prélevés aves toutes les conditions d’asepsie
nécessaires dans des contenants stériles de verre qui sont les tubes a essais de
large ouverture , de capacité d’environ 250 ml , en laissant un espace d’air d’au
moins 2,5 cm .On a cinq échantillons ( P1, P2, P 3, P4 et P5 ) ont été prélevés
séparément de trois poissons d’élevage de type DAURADE de région de
Monastir , et menés au laboratoire de microbiologie.

Les prélèvements effectués à partir des viscères des poissons sont mis dans des
bouillons MRS. Après l’incubation de 24 h dans une température de 37ºC est
faite (dans l’étuve).

Les bouillons MRS deviennent très troubles c'est-à-dire les bactéries


commencent de croitre dans les bouillons.

Les prélèvements effectués à partir des viscères des poissons ont permis
d’obtenir, après les étalements sur les boites de pétri, plusieurs centaines des
colonies sur le milieu de culture utilisé (MRS).
Matériels et méthodes

Figure 2 : les colonies des bactéries lactiques dans leurs bouillons
MRS.

II. Isolement des souches :

L’isolement a été effectué sur un milieu de culture spéciale et sélectif pour les
bactéries lactiques qui est le Man Rogosa et sharpe (MRS), l’isolement
commence par le pré-enrichissement dans le bouillon MRS qui est un milieu
liquide permettant la croissance des bactéries sans exigences particulières. En
milieu aseptisé, on prélève tout les viscères des poissons et on les met dans le
bouillon MRS, ensuite, on l’incube à l’étuve à 37°C pendant 24 heures. Cette
étape permet aux bactéries stressées de récupérer leur stabilité.

La deuxième étape est l’enrichissement sur des milieux liquides (MRS) simple
avec le tween 80 pour favoriser la croissance des bactéries lactiques.
Matériels et méthodes

Les colonies prédominantes ont été collectées au hasard et les cultures pures ont
été obtenues par repiquage par stries d’épuisement sur le même milieu gélosé.

Figure.3. Culture des souches sur la gélose MRS.

1. Milieu MRS :

Le milieu MRS ( milieu de de Man Rogosa et sharpe , de Man et al , 1960) est


composé de 10 g/l de peptone de protéase n°3 , de 10g/ l d’extrait de baeuf , de
5g/ l d’extrait de levure , de 20 g/ l de glucose , de 1g / l de polysorbate 80 , de 2
g/l de citrate d’ammonium , de 5g/l d’acétate de sodium , de 0,1 g/ l de sulfate
de magnésium , de 0,05 g/ l de sulfate de maganése et de 2 g/ l de phosphate
dipotassique . Le pH final de ce milieu est de 6,5. Le milieu est ensuite stérilisé
par autoclavage durant 15 min à 1 bar.

C’est un milieu sélectif, milieu d’isolement spécifique pour les bactéries


lactiques.
Matériels et méthodes

III. Identification phénotypique 

Les souches ont été caractérisées par quelques tests classiques tels que :

1. Test de la catalase 

C’est un test fondamental pour orienter l’identification des coques et bacilles


à Gram+.

Le test catalase permet une première orientation dans la classification d’une


souche bactérienne pure. Les BL isolées à partir des deux lots
d’échantillonnage et ayant une activité inhibitrice sont testées pour la
production ou non de la catalase. Ce test est réalisé comme suit : une goutte
de peroxyde d’hydrogène (H2O2) à 3% (v/v) est ajoutée sur une colonie
placée sur une lame de microscope. La réaction est dite positive lorsqu’une
effervescence est observée.

1. Test de l’oxydase :

Ce test est à la base de l’identification des bactéries Gram - ; il est l’un des
critères les plus discriminatifs et les plus employés pour l’identification des
bactéries, surtout des bacilles. Le test est effectué comme suit : la colonie pure
prise du milieu gélosé qui est le MRS est mise sur papier watman imprégné de
réactif de l’oxydase (N-tétramétyl-1,4 phénylènediamine). Les bactéries
produisent l’enzyme oxydent ce réactif pour former un composé violet,
l’indophénol, la suspension devient alors violette après 20 à 60 secondes.

2. Coloration du Gram :

La coloration du Gram est la coloration la plus utilisé en bactériologie,


permettant de mettre en évidence les propriétés de la paroi bactérienne et
d’utiliser ces propriétés pour distinguer et classifier les bactéries.
Matériels et méthodes

La coloration a été faite comme suit : après avoir déposé une goutte d’eau sur
une lame de verre, on prélève une colonie à l’aide d’une pipette pasteur ; ensuite
on fait dissocier soigneusement l’inoculum dans la goutte d’eau et la laisser
sécher puis on procède à la fixation du frottis soit avec l’éthanol à 90°C (5 min)
puis on enflamme la lame ou on passe directement 3 fois la lame dans la flamme
du bec bunsen. La coloration au violet de Gentiane (coloration basique) : la
lame est plongée pendant 2 à 3 min dans la coloration au violet de gentiane,
toutes les bactéries sont colorées en violet puis rincer à l’eau déminéralisée. En
suite, la décoloration à l’alcool : verser goutte à goutte l’alcool sur la lame
inclinée obliquement, surveiller la décoloration (5 à 10 secondes) l’alcool
pénètre dans la bactérie. La coloration au violet de Gentiane disparait. Les
bactéries décolorées sont des bactéries Gram négatifs. Si l'alcool ne traverse pas
la paroi, on est en présence de bactéries Gram positifs. Une contre coloration
avec la Fushine ou de la Safranine : laisser agir de 30 secondes à 1 minute puis
laver doucement à l’eau déminéralisée. Les bactéries Gram négatif sont colorées
en rose.
Matériels et méthodes

Figure 4 : les étapes de la coloration de Gram


Matériels et méthodes

Figure 5 : la lame après la coloration du Gram.

2. Confirmation moléculaire des souches obtenues :

*Extraction de l’ADN :

Deux méthodes d’extraction de l’ADN génomique bactérien ont été utilisées et


testées au cours du stage qui sont l’extraction par choc thermique et l’extraction
par kit.

1. L’extraction par choc thermique :

On va prendre quelques colonies bactériennes de chaque souches pure cultivée


sur gélose MRS ont été prélevées à l’aide d’une anse et suspendues dans 1 ml
d’eau distillée stérile. Les tubes sont ensuite centrifugés à 8000 rpm pendants 5
minutes à 20°C. Le surnageant de chaque culture a été soigneusement éliminé et
le culot cellulaire a été lavé du nouveau par 1 ml d’eau distillée stérile. Les
échantillons ont été ensuite portés à l’ébullition dans un bain marie à 100 °C
pendant 3 minutes et puis rapidement transférés et incuber sur la glace pendant 3
minutes. Après centrifugation à 1200 rpm pendant 5 minute, 100µl du
surnageant ont été récupérés à l’aide d’une micropipette et mise dans un
nouveau eppendorf stérile.

 L’extraction par choc thermique  (par détaillée)

L’extraction de l’ADN par choc thermique soit à partir de bouillon de MRS ou


par les boites qui contiennent les colonies, elle est comme suit :

*à partir des boites de pétri : on va prendre 1ml d’eau distillé + des colonies
qui se trouve dans les boites de pétri.

*on va faire la centrifugation en 13000 rpm pendant 7 minutes.

*rejeter le surnageant de volume 800 µl.


Matériels et méthodes

*récupérer le culot de volume 200 µl.

* chauffage par ébullition 100 °C pendant 5 min pour le but de fragiliser la


membrane bactérienne.

*mettre directe dans le glace puis mettre directe dans – 20 °C dans le


congélateur (cette étape reste 5 min).

*Centrifuger une autre fois 13000 rpm pendant 5 min.

* récupérer le surnageant de 100 ul.

*récupérer dans le congélateur.

2. Extractions par kit :

C’est une autre méthode dans le but d’extraire l’ADN :

A partir du bouillon d’enrichissement les bactéries ont été récoltées par


centrifugation à 8000 rpm pendant 5min. Ensuite, le culot bactérien a été mis
en suspension dans 200 µl de tampon TE (50 mM Tris, EDTA, PH 8,0) plus
de 400 µl de la solution digestion et 3µl de la protéinase K (20 mg / ml ) et
incubé 5 min à 55°C . Le culot d’ADN a été ensuite lavé avec 260µl de
l’éthanol à 100 % puis la mixture préparée à été placée dans des tubes de
collection. Une centrifugation répétée deux fois à 1000 rpm pendant 2 min a
été réalisée. Les tubes de collection ont été par la suite placés dans des tubes
eppendorf et 50 µl du tampon d’élution ont été ajoutés au centre de la
membrane de chaque tube de collection, et les tubes ont été incubés à 37°C
pendant 2 min. Une dernière centrifugation à 1000 rpm durant 2 min à été
faite pour la récupération de l’ADN extrait.

3. Identification des souches bactériennes par l’amplification du gène


par réaction de polymérisation en chaine :
Matériels et méthodes

La technique d’amplification génique in vitro ou PCR (polymerease chain


reaction) consiste en une multiplication exponentielle d’un fragment d’acide
nucléique dont la taille est généralement comprise entre 200 et 300 paires de
base.

Cette technique utilise une ADN polymérase particulière .dénommée


polymérase taq, issue d’une bactérie (Thermophilus aquaticus) vivant dans des
sources d’eau chaude, cette enzyme est stable à haute température et reste active
pendant le déroulement de la PCR.

La technique de PCR est trouvée dans des nombreuses applications comme


dans le domaine de la recherche fondamentale (détection des microorganismes
pathogènes, détection des maladies génétiques).

a) Préparation de réaction PCR :

Tableau. 2. Contenu de chaque tube PCR :

Composants 1tube PCR 6tubes PCR


Tampon Buffer 2,5 17,5
dNTPs 0,25 1,75
IDLO3 R 1 7
IDLO4 F 1 7
Taq polymérase 0,2 1,4
Eau 18 126
ADN 2 -

b) Paramètres d’amplification :

La technique PCR est un enchainement de cycles généralement 20 à 40 qui


comprennent chacun les 3cycles suivants :
Matériels et méthodes

- Dénaturation thermique 5 min à 96ºC de l’ADN : les 2 brins constitués de


l’ADN sont séparés.
- Appariement de ces deux brins avec des oligonucléotides (appelé amorce)
choisis pour encadrer le fragment que l’on souhaite amplifier, un
oligonucléotide est complémentaire d’une séquence présente sur l’un des
brin, le second est complémentaire d’une séquence présente sur l’autre
brin.
- Elongation de chaque amorce par polymérase taq : elle ajouté des
nucléotides aux extrémités en respectant les règles d’appariement des
bases (A avec T et C avec G).

Chaque cycle aboutit théoriquement au doublement de la quantité du fragment


situé entre les deux amorces (Amorce sens :
5’CCACCTTCCTCCGGTTTGTCA’3 ; Amorce anti-
sens :5’AGGGTGAAGTCGTAACAAGTAGCC’3), de telle sorte que la
technique PCR permet en quelque heure une amplification spécifique de cent
milles à plusieurs millions de copies.

Nous avons utilisé un programme unique pour tous les gènes (les gènes de
dégradation et les gènes de l’ARNr16s) avec une température de réassociation
spécifique pour chaque gène, le programme est le suivant :

 1cycle de 5min à 96ºC (dénaturation initial)


 Dénaturation de 45s à 56ºC
 45s pendant 56ºC
 Extension pendant 3,5 min à 72ºC
 Extension pendant 10min à 72ºC
c) Visualisation des produits PCR :

Les produits de PCR ont été analysés par électrophorèse sur gel d'agarose à 1 %
contenant 0,5 μg/ml de bromure d'éthidium (BET) et préparé dans le tampon
Matériels et méthodes

TBE lX (45mM Tris- acide borique et 1mM EDTA [pH 8,0]). Un marqueur de
taille de 100 pb a été utilisé pour identifier les produits d’amplifications. La
migration a été réalisée à 110 Volts pendant 30-50 min.

Figure 6 :Le système d’électrophorèse sur gel d’agarose

3. Sélection des bactéries lactiques productrices de bactériocine 


1. Test d’activité antimicrobienne en gélose molle par la méthode des
puits (Agar Diffusion Test)

Les agents pathogènes ont été préparés sous forme des suspensions bactériennes
dans l’eau physiologie et puis nous les avons versées dans les boites de pétri
contenant la gélose Mueller Hinton (MH) après incubation 30 min à 37°C, des
puits ont été creusés dans la gélose et remplis de 80 µl du bouillon MRS
contenant les souches à tester.

La présence d’une activité antimicrobienne est révélée par la présence d’une


zone d’inhibition autour du puits. Le diamètre de la zone d’inhibition autour de
puits mesure le degré d’inhibition.

Pour le but de sélectionner les souches de BL présentant une activité


antimicrobienne, les surnageant de culture de 24 heures des souches ont été
Matériels et méthodes

testés selon la méthode de diffusion en puits.  Les différents tests réalisés dans le
cadre de la caractérisation de l’activité antimicrobienne des surnageant de
culture des souches de BL ont été faits. Les BL ont été cultivées pendant 24H
dans des bouillons MRS à 37°C ; les surnageant sont collectés après
centrifugation à 10000 rpm pendant 10 min à 4°C. 80 µl des surnageant à tester
« neutralisés et chauffés » ont été déposés dans chaque puits et on mettre les
boites dans le réfrigérateur pendant 2 heures. Les boites sont ensuite incubées
pendant 24 à 48 heures à Température adéquate selon la souche indicatrice
utilisée.

L’activité antibactérienne est mise en évidence par la présence d’un halot


d’inhibition dont le rayon est proportionnel à la concentration en produit actif
« bactériocine ».

Figure 7 : Test de l’activité antimicrobienne par la méthode des puits.


Matériels et méthodes

2. Détermination de l’activité antimicrobienne par la méthode des


disques :

On a l’eau physiologie ou il ya les bactéries pathogènes comme Bacillus cereus,

Staphylococcus, E. coli, Salmonella. On a les boites de pétri qui contiennent le


gélose MH, sur chaque boites on va déposer un volume de 1 ml du suspension
bactérienne après on faire l’étalement par une pipette pasteur stérile puis on met
les boites dans l’étuve pendant 30 minutes dont le but de les sécher.

Lorsque les boites sont séchées, on va déposer les disques (par exemple 3 ou 4
disques), on mettre un volume de 20 µl sur chaque disque, et on le laisser dans
le réfrigérateur durant une heure. Une incubation se fait dans l’étuve a 37°C
pendant 24 heures.

Vous aimerez peut-être aussi