Vous êtes sur la page 1sur 10

Impaired NK Cytolytic Activity and Enhanced

Tumor Growth in NK Lytic-Associated


Molecule-Deficient Mice
This information is current as Richard G. Hoover, Gail Gullickson and Jacki Kornbluth
of January 26, 2011
J Immunol 2009;183;6913-6921; Prepublished online 13
November 2009;
doi:10.4049/jimmunol.0901679
http://www.jimmunol.org/content/183/11/6913

Downloaded from www.jimmunol.org on January 26, 2011


References This article cites 37 articles, 17 of which can be accessed free at:
http://www.jimmunol.org/content/183/11/6913.full.html#ref-list-1
Subscriptions Information about subscribing to The Journal of Immunology is online at
http://www.jimmunol.org/subscriptions
Permissions Submit copyright permission requests at
http://www.aai.org/ji/copyright.html
Email Alerts Receive free email-alerts when new articles cite this article. Sign up at
http://www.jimmunol.org/etoc/subscriptions.shtml/

The Journal of Immunology is published twice each month by


The American Association of Immunologists, Inc.,
9650 Rockville Pike, Bethesda, MD 20814-3994.
Copyright ©2009 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
The Journal of Immunology

Impaired NK Cytolytic Activity and Enhanced Tumor Growth


in NK Lytic-Associated Molecule-Deficient Mice1,2

Richard G. Hoover,† Gail Gullickson,† and Jacki Kornbluth3*†


NK lytic-associated molecule (NKLAM) is a protein involved in the cytolytic function of NK cells. It is weakly expressed in resting
NK cells but upon target cell stimulation or after incubation with cytokines that enhance NK killing, NKLAM mRNA levels
increase and protein is synthesized and is targeted to cytoplasmic granule membranes. We have previously shown that NKLAM
plays a role in perforin/granzyme-mediated cytolysis in vitro. To further investigate the function of NKLAM in NK cell-mediated
cytotoxicity, we generated, by gene targeting, NKLAM-deficient mice. These mice have normal numbers of NK cells and other
lymphoid populations in the spleen. They also have no alterations in NK maturation or NK receptor repertoire. NK cells from
NKLAM-deficient and WT mice have comparable amounts of perforin, granzyme B, and lysosomal membrane-associated protein
1 (CD107a) in their cytotoxic granules and comparable levels of granule exocytosis are induced by PMA and calcium ionophore
A23187. However, NKLAM-deficient NK cells display significantly less NK cytotoxic activity in vitro than WT NK cells. They also
secrete less IFN-␥ upon target cell stimulation, In addition, NKLAM-deficient mice exhibit greater numbers of pulmonary me-

Downloaded from www.jimmunol.org on January 26, 2011


tastases after i.v. injection with B16 melanoma cells. These studies indicate that NKLAM-deficient mice have diminished capacity
to control tumor metastases and support the role for NKLAM in NK function both in vitro and in vivo. The Journal of Immu-
nology, 2009, 183: 6913– 6921.

N atural killer cells are lymphocytes of the innate immune thesized and becomes targeted to cytoplasmic granule membranes.
system that play an important role in early host defense Studies have shown a role for NKLAM in perforin/granzyme-me-
against tumors and infectious agents (1). NK cells can diated cytolysis. Treatment of NK cells or CTL with NKLAM
induce target cell death by a variety of mechanisms. However, the antisense oligonucleotides inhibits their killing activity, indicating
primary mechanism of killing is the release of cytotoxic granules that NKLAM participates in the cytotoxic process (9, 10).
containing perforin and granzymes (2– 4). It has long been known To establish what function NKLAM plays in NK-mediated kill-
that NK-mediated killing can be augmented by cytokines, includ- ing, we focused our attention on the physical characteristics of
ing IL-2, IL-12, IL-15, and IFN (5– 8). In studies to characterize NKLAM protein. NKLAM contains three cysteine-rich domains
additional proteins associated with the cytolytic process, we iden- that form a really interesting new gene (RING)-in between RING
tified a novel protein whose expression was highly increased upon (IBR)-RING domain structure. This tripartite domain is also col-
cytokine stimulation of NK cells (9). This protein was named NK lectively known as a TRIAD or RBR (11, 12). There are currently
lytic-associated molecule (NKLAM).4 over 140 RING-IBR-RING containing proteins in a wide variety
NKLAM is found in the cytolytic granule membranes of NK of organisms, from yeast to human (13). Many of these proteins
cells and CTL. It is weakly expressed in resting NK cells and
are associated with diverse protein-protein interactions. A subset
unlike perforin and granzymes, there is little to no preformed
of these proteins has been found to possess E3 ubiquitin ligase
NKLAM mRNA or protein in NK cells. Upon target cell stimu-
activity (12, 13). E3 ubiquitin ligases regulate the ubiquitination of
lation or after incubation with cytokines that enhance NK killing,
proteins, catalyzing the transfer of activated ubiquitin from an E2
NKLAM mRNA levels in NK cells increase and protein is syn-
ubiquitin-conjugating enzyme to its substrate (14, 15). Multiple E3
ubiquitin ligases have been shown to have important roles in a
*Department of Veterans Affairs Medical Center, St. Louis, MO 63106; and †De- variety of immune functions (16). For example, GRAIL is asso-
partment of Pathology, Saint Louis University School of Medicine, St. Louis, MO
63104 ciated with the induction of anergy in CD4⫹ T cells (17). Triad3A
Received for publication May 27, 2009. Accepted for publication September targets TLRs for ubiquitination and subsequent degradation (18).
21, 2009. We have identified NKLAM as an E3 ubiquitin ligase but have not
The costs of publication of this article were defrayed in part by the payment of page yet determined how this enzymatic activity results in enhanced NK
charges. This article must therefore be hereby marked advertisement in accordance cytolytic function (19).
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
To further investigate the role of NKLAM in cell-mediated cy-
This material is based upon work supported by a merit review grant from the De-
partment of Veterans Affairs, Veterans Health Administration, Office of Research and totoxicity, NKLAM-deficient mice were generated. These mice
Development, Biomedical Laboratory Research and Development. appear normal and are fertile. They have normal numbers of NK
2
The views expressed in this article are those of the authors and do not necessarily cells in the spleen. NK cells from NKLAM knockout (KO) mice
reflect the position or policy of the Department of Veterans Affairs or the U.S.
government.
have comparable amounts of perforin, granzyme B, and lysosomal
3 membrane-associated protein 1 (LAMP-1; CD107a) in their cyto-
Address correspondence and reprint requests to Dr. Jacki Kornbluth, Department of
Pathology, St. Louis University School of Medicine, DRC 323, 1100 South Grand plasmic granules as NK cells from wild-type (WT) mice. How-
Boulevard, St. Louis, MO 63104. E-mail address: kornblut@slu.edu ever, these NKLAM-deficient NK cells display significantly less
4
Abbreviations used in this paper: NKLAM, NK lytic-associated molecule; IBR, in NK activity in vitro than WT cells and produce less IFN-␥ upon
between RING; KO, knockout; LAMP-1, lysosomal membrane-associated protein 1;
neo, neomycin resistance; poly(I:C), polyinosinic:polycytidylic acid; RING, really target cell stimulation. In addition, NKLAM-deficient mice exhibit
interesting new gene; WT, wild type; TK, thymidine kinase. enhanced numbers of pulmonary metastases after injection with

www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901679
6914 ENHANCED TUMOR METASTASIS IN NKLAM-DEFICIENT MICE

B16 melanoma cells. These studies indicate a significant role for 2 ⫻ 105–2 ⫻ 106 cells in 0.05 ml of flow buffer (ice-cold PBS plus 1% FBS
NKLAM in NK cytotoxic function in vitro and in vivo. plus 0.1% sodium azide) were incubated with 1 ␮l of Fc block (BD Pharm-
ingen) for 10 min at 4oC. Fluorescent-conjugated cell surface-specific pri-
mary Abs were then added and incubated for an additional 30 min at 4oC.
Materials and Methods Cells were washed twice with flow buffer and then either fixed with 0.2 ml
Constructs of PBS plus 1% formaldehyde or prepared for intracellular staining using
the BD Cytofix/Cytoperm Plus Fixation/Permeabilization Kit with Golgi-
NKLAM genomic clones were isolated from a 129 SvJ mouse liver
Stop according to the manufacturer’s directions. Cells were analyzed on a
genomic library (␭ Fix II; Stratagene) by hybridization using mouse
BD Biosciences FACSCalibur flow cytometer. Abs purchased from BD
NKLAM cDNA clones as previously described (10). Five overlapping
Biosciences were FITC-CD3 (no. 553061), Alexa Fluor 700-CD3 (no.
phage clones were obtained and the exon/intron boundaries were charac-
557984), allophycocyanin-NK1.1 (no. 550627), PE-Cy7-NK1.1 (no.
terized by PCR and sequencing. The targeting construct was generated
552878), PE-streptavidin (no. 13025D), PE-CD27 (no. 558754), PerCP-
using the pKO scrambler NTKV-1905 vector (Stratagene). This vector
CD45 (no. 557235), PE-CD49b (DX5; no. 553858), allophycocyanin-
contains a neomycin resistance (neo) cassette for positive selection and a
CD62L (L-selectin; no. 553152), PE-CD8a (no. 553032), allophycocyanin-
HSV thymidine kinase (TK) cassette outside the region of homology to
CD4 (no. 553051), allophycocyanin-CD19 (no. 550992), FITC-Gr-1
allow for negative selection. The 5⬘ arm of the targeting construct was a
(Ly-6G and Ly-6C; no. 553126), PE-CD11b (no. 557397), PE-Cy7-CD11b
3.5-kb EcoRI/KpnI fragment located within intron 1 of NKLAM. The 3⬘
(no. 553311), PE-CD25 (no. 553866), biotin-KLRG1 (no. 5500863), PE-
arm was a 6- kb EcoRI/EcoRI fragment extending from intron 5 to intron
NKG2D (no. 558403), FITC-Ly49C/I (no. 553278), PE-Ly49A (no.
8. This produced a targeting vector of 15 kb, which upon homologous
557424), and control Abs were FITC-IgG1 (no. 553971), PE-IgG2b (no.
recombination would replace exons 2–5 of NKLAM with the neo cassette.
553987), and allophycocyanin-IgG2a (no. 553932). Abs purchased from
This construct was linearized with NotI and electroporated into 129Sv/Ev
eBioscience were FITC-NKp46 (no. 11-3351-80), PE-Ly49I (no.
embryonic stem cells (inGenious Targeting Lab). The neo-expressing em-
12-5895), PE-granzyme B (no. 12-8899-41), and FITC-perforin (no. 11-
bryonic stem cells were selected in medium containing G418; DNA from
9392-82). Ly49H, Ly49A, and Ly49I Abs were generously provided by Dr.
G418-resistant clones was isolated and evaluated for homologous recom-
M. Buller (St. Louis University). Samples were analyzed using FlowJo
bination by a combination of Southern blotting and PCR. PCR with
software (Tree Star).
forward primer SMINTR1D (inside intron 1 within the 5⬘ arm) and

Downloaded from www.jimmunol.org on January 26, 2011


reverse primer A1570 (inside exon 6 within the 3⬘ arm) generated a WT
product of 7.4 kb and a KO product of 3 kb (PCR 1). Primers were Purification of NK cells and stimulation
SMINTR1D: GCTATTGTTTCAAGCTGTGAG and AM1570: CACCTC
CACGGCAAAGAGAAATGG. Clones showing the 3-kb KO band were NK cells were isolated from spleen cells using magnetic CD49b (DX5)
confirmed as recombinant by two additional PCR using neo primers com- microbeads, a MiniMACS Separator, and MS columns according to the
bined with NKLAM-specific primers on either side of the targeting arms manufacturer’s recommendations (Miltenyi Biotec) (21). These cells were
(data not shown). routinely ⬎92% DX5 by FACS analysis. For cytokine stimulation, NK
cells were cultured at 5 ⫻ 106 cells/ml in RPMI 1640 containing 10% FBS,
Production of NKLAM-deficient mice 1% glutamine, 5 ⫻ 10⫺5 M 2-ME, and 500 U/ml rIL-2. IL-2 was a gift
from Chiron. For some experiments, unseparated spleen cells were simi-
Two recombinant embryonic stem cell clones were microinjected into
larly cultured in IL-2 in parallel.
C57BL/6 blastocysts by inGenious. Coat color chimeric males (90 –100%
NK cells were activated in vivo by i.p. injection of mice with 200 ␮g of
agouti) were then mated with C57BL/6 female mice and the progeny were
polyinosinic:polycytidylic acid (poly(I:C), sodium salt; Sigma-Aldrich).
screened for germline transmission of the KO allele. Crossing of heterozy-
Control mice were injected with PBS. After 24 h, spleen cells or purified
gous mice produced viable homozygous KO offspring. Pups were geno-
NK cells were assayed for NK activity in vitro.
typed using DNA extracted from tail tissue by PCR 1. Heterozygous mice
have subsequently been backcrossed for 11 generations onto a C57BL/6
background. C57BL/6 mice were obtained from the National Cancer In- Killing assays and granule exocytosis
stitute. Early in the backcross process, progeny were selected for the
C57BL/6 NK gene complex alleles by PCR so that the NK cells from these Unstimulated and IL-2-stimulated purified NK cells were used as effectors
mice were genotypically C57BL/6 (20). Primers for NKRP1a were: for- in cytotoxicity assays against the 51Cr-labeled NK-sensitive mouse lym-
ward, TGCTTGACTCAAATTCATGAGG; reverse, ATTTTACTCGA phoma cell line YAC-1, as previously described (10). Assay conditions
CACCAGGTTGA, B6 allele 110 nt, 129 allele 133 nt. Primers for Ly49a were set up in triplicate wells at various E:T ratios in 96-well round-bottom
were: forward, GCCTCTGAGGTTCATGTTTGATT; reverse, TTCCTTC microtiter plates. After incubation for 4 h at 37oC, supernatants (0.1 ml)
CCTGTTGAGACTG, B6 allele 340 nt, 129 allele 321 nt. We observed no were harvested and the amount of 51Cr release from YAC-1 target cells was
significant differences in the results obtained from non-backcrossed and detected using a Packard Cobra II gamma counter. The percent specific
fully backcrossed NKLAM homozygous KO mice. All mice were main- lysis of targets was calculated as previously described. The SD of triplicate
tained in specific pathogen-free barrier housing and all experiments were values never exceeded 10% in all experiments.
conducted in accordance with institutional animal care and use guidelines. Granule exocytosis was monitored by the release of ␤-glucuronidase
using the fluorogenic substrate 4-methylumbelliferyl-␤-D-glucuronide (22).
Cell lines Reagents used in this assay were purchased from Sigma-Aldrich. Four ⫻
105 spleen cells or 2.5 ⫻ 105 purified NK cells were incubated with 0.025
YAC-1 and B16-F10 melanoma cells were purchased from the American ml of RPMI 1640 containing 4% FBS in 96-well plates. PMA (40 ng/ml)
Type Culture Collection. The NK- sensitive mouse lymphoma YAC-1 cell plus calcium ionophore A23187 (2 ␮g/ml) was used to induce granule
line was maintained in medium containing RPMI 1640 supplemented with exocytosis. Total release was obtained by incubation of cells with 1%
7.5% FBS and 1% glutamine. They were split twice a week and maintained Triton X-100. After 4 h at 37oC, cells were pelleted and supernatants were
at a density of 2 ⫻ 105 cells/ml. B16 melanoma cells were propagated in harvested. In brief, 0.005 ml of supernatant was added to triplicate wells of
DMEM containing 7.5% FBS and 1% glutamine. Subconfluent adherent 96-well black microtiter plates and mixed with 0.05 ml of ␤-glucuronidase
cells were trypsinized and split twice a week. substrate (1.5 mM 4-methylumbelliferyl-␤-D-glucuronide in 0.05 M so-
Isolation of spleen cells dium acetate, 0.01% BSA, and 0.1% Triton X-100, pH 4). Plates were
incubated for 10 min at 37oC. The reaction was stopped by the addition of
Spleens were harvested, rinsed in RPMI 1640, and gently homogenized 0.175 ml of 0.25 M sodium tetraborate. The fluorescence intensity was
using the blunt end of a 3-ml syringe. Released spleen cells were pelleted measured with excitation at 355 nm and emission of 460 nm in a Wallac
and then layered over a Lympholyte-M density gradient (Cedarlane Lab- Victor 1420 multilabel counter.
oratories/ Accurate Chemical Corporation) according to the manufacturers’
instructions to remove RBC, dead cells, and debris. Lymphocytes at the
interface were collected, washed twice with RPMI 1640, and counted. IFN-␥ production
These cells were analyzed by flow cytometry and/or used for the purifica- Unstimulated and IL-2-stimulated purified NK cells were cocultured with
tion of NK cells. YAC-1 target cells in triplicate wells at E:T ratios of 25:1 and 10:1, re-
Flow cytometry spectively, in 96-well round-bottom microtiter plates. After incubation for
4 h at 37oC, supernatants (0.1 ml) were harvested and the amount of IFN-␥
Flow cytometry was performed to analyze spleen cell subpopulations and was quantitated by ELISA (Endogen and Pierce Biotechnology) according
NK cells from WT and NKLAM-deficient mice. Briefly, tubes containing to the manufacturers’ protocol.
The Journal of Immunology 6915

FIGURE 1. Generation and characterization of NKLAM-deficient mice. A, The mouse NKLAM targeting construct replaced exons 2–5 of the NKLAM
gene, encoding the second and third cysteine-rich domains and two of the three predicted transmembrane domains, with the neomycin resistance (neo) gene.
The targeting vector also contained a TK cassette outside the region of homology. This targeting construct was transfected into 129Sv/Ev embryonic stem
cells and neo-expressing clones were selected in medium containing G418. Homologous recombinant clones were identified by a combination of Southern

Downloaded from www.jimmunol.org on January 26, 2011


blotting and PCR. B, Progeny were genotyped from tail DNA using multiple PCR. In the representative PCR shown on the left, the primers are on either
side of knocked out exons 2–5 of the NKLAM gene. The WT band is 7.4 kb while the KO band is 3 kb. On the right, RT-PCR confirmed the absence of
NKLAM mRNA in IL-2-stimulated spleen cells in NKLAM⫺/⫺ mice. These PCR primers were located within the KO region of NKLAM. ␤-Actin served
as a positive PCR control.

Immunoblot analysis second and third cysteine-rich domains of NKLAM, which to-
Rat monoclonal anti-LAMP-1 (CD107a) mAb 1D4B, provided by Dr. J. T.
gether form a RING-IBR-RING structure, important in the E3
August, was obtained from the Developmental Studies Hybridoma Bank ubiquitin ligase activity of NKLAM. It also removed two of the
developed under the auspices of the National Institute of Child Health and three predicted transmembrane domains. This construct was trans-
Human Development and maintained by the University of Iowa (Depart- fected into 129Sv/Ev embryonic stem cells. The neo clones were
ment of Biological Sciences, Iowa City, IA) (23). It was used at 1/100. selected in medium containing G418; homologous recombinant
Anti-perforin Ab (no. 3693, 1/1,000) and anti-granzyme B Ab (no. 4275,
1/1000) were purchased from Cell Signaling. Anti-␤-actin mAb clone clones were identified by a combination of Southern blotting and
AC-15 (1/10,000) was purchased from Sigma-Aldrich. NKLAM mAb 35 PCR. Two recombinant clones were subsequently microinjected
was produced in our laboratory and used at 35 ␮g. Immunoblots were into C57BL/6 blastocysts. Chimeric heterozygotes that displayed
performed as previously described (19). Briefly, cell extracts were prepared germline transmission were intercrossed to produce NKLAM⫺/⫺
from purified NK cells from NKLAM-deficient and WT mice by lysing
cells in buffer containing 20 ␮M PIPES, 4% sucrose, 100 mM NaCl, and progeny (Fig. 1B). Heterozygotes were simultaneously back-
0.5% Nonidet P-40 plus protease inhibitors (25 ␮g/ml aprotinin, leupeptin, crossed to C57BL/6 mice for 11 generations to generate NKLAM-
pepstatin, 2 mM benzamidine, 1 mM PMSF). Lysates were sonicated twice deficient mice on a C57BL/6 background. Early in the backcross
for 10 s each, then mixed with 2⫻ SDS loading buffer. Samples were process, heterozygous progeny were selected for the C57BL/6 NK
boiled for 20 min and loaded onto 7.5% SDS-PAGE at 100 –150 V. Pro- gene complex alleles by PCR so that the NK cells from these mice
teins were transferred to polyvinylidene difluoride membranes, incubated
with blocking buffer for various times (10 mM Tris, 150 mM NaCl, 0.2% were genotypically C57BL/6. Progeny were evaluated by a com-
Tween 20, and 5% blotto) and then incubated with primary Ab. Secondary bination of both Southern blotting and PCR. RT-PCR confirmed
Abs were HRP-conjugated goat anti-mouse IgG (1/10,000; Bio-Rad), goat the absence of NKLAM mRNA in IL-2-stimulated spleen cells
anti-rabbit (1/2,000; Cell Signaling), or donkey anti-rat IgG (1/5,000; Mil- from NKLAM⫺/⫺ mice compared with heterozygous (⫹/⫺) and
lipore). Membranes were then placed in Supersignal Chemiluminescence
solution (Pierce) and exposed to film. WT (⫹/⫹) mice (Fig. 1B).
Homozygous NKLAM-deficient (⫺/⫺) mice were born at the
Lung metastasis studies expected Mendelian ratio. Overall, the mice appeared normal and
B16 melanoma cells were injected i.v. through the tail vein into NKLAM- were fertile. Histological examination of the major organs of 8-wk-
deficient KO and WT mice. Cells were washed with PBS and each mouse old NKLAM⫺/⫺ and heterozygous (⫹/⫺) mice revealed no overt
was injected with 300,000 cells in 0.2 ml of PBS. Fifteen days later, ani- abnormalities by light microscopy. NKLAM⫺/⫺ mice were ob-
mals were sacrificed and lungs were harvested and fixed in Fekete’s solu- served for over 18 mo. They developed normally and there was no
tion. Individual lobes were dissected and black B16 melanoma metastatic
nodules were enumerated on each lobe surface in a blinded fashion. Data
obvious difference in gross morphology, size, or body weight be-
were analyzed using a two-tailed Student’s t test. tween WT and NKLAM-deficient mice during the 18-mo period
(data not shown).
Results
Generation of NKLAM-deficient mice Normal distribution of lymphoid cells in the spleens of
Genomic clones containing mouse NKLAM were isolated from a NKLAM-deficient mice
129SvJ library. The NKLAM gene contains nine exons, spanning The distribution of lymphoid cells in the spleens of NKLAM⫺/⫺
over 29 kb. It was not possible to knock out exon 1, containing the and NKLAM⫹/⫹ mice was analyzed by flow cytometry. There was
start codon, because intron 1 is extremely large, over 14 kb. There- no significant difference in the absolute numbers of lymphoid cells
fore, a targeting vector was constructed in which exons 2–5 (⬃6 in NKLAM-deficient and WT mice; the total number of spleen
kb) were replaced with a neo cassette (Fig. 1A). This removed the cells was 87.5 ⫾ 9.2 ⫻ 106 in NKLAM-deficient mice and
6916 ENHANCED TUMOR METASTASIS IN NKLAM-DEFICIENT MICE

Table I. Analysis of spleen cell subpopulations in NKLAM-deficient with NKLAM antisense oligonucleotides reduces both NKLAM
micea levels and NK-mediated cytotoxicity, indicating a role for
NKLAM in NK killing. Therefore, NK cells from NKLAM-defi-
Cell Type Designation NKLAM⫹/⫹ NKLAM⫺/⫺ cient mice were predicted to have lower NK activity. To test this
T cell CD3⫹ 36.9 ⫾ 3.1 33.6 ⫾ 2.6 hypothesis, DX5⫹ NK cells from the spleens of NKLAM⫺/⫺,
CD4⫹ 19.6 ⫾ 1.7 19.9 ⫾ 1.5 ⫹/⫺, and ⫹/⫹ WT mice were isolated by magnetic bead column
CD8⫹ 14.8 ⫾ 2.0 11.8 ⫾ 2.5 purification. Total numbers of NK cells were comparable among
Activated T CD3⫹CD25⫹ 3.2 ⫾ 0.9 3.1 ⫾ 0.8 the three groups. Freshly isolated NK cells were tested for killing
B cell CD19⫹ 44.0 ⫾ 5.2 48.3 ⫾ 7.3
of NK-sensitive YAC-1 tumor target cells in 4-h 51Cr release as-
NK cell CD3⫺DX5⫹ 3.5 ⫾ 1.0 3.3 ⫾ 0.8
DX5⫹CD62L⫹ 2.3 ⫾ 0.9 2.1 ⫾ 0.4 says. As shown in Fig. 3, NK cells from NKLAM⫺/⫺ mice had
CD3⫺NK1.1⫹ 1.6 ⫾ 0.3 1.5 ⫾ 0.4 significantly lower spontaneous NK activity in vitro compared
NKp46 90.9 ⫾ 1.5 92.4 ⫾ 2.5 with NKLAM⫹/⫺ heterozygous mice or WT mice. This represents
NKG2D 87.7 ⫾ 5.0 90.2 ⫾ 3.8 a 60% reduction in NK killing of YAC-1 targets by NKLAM-
NKG2A/C/E 48.3 ⫾ 1.3 47.0 ⫾ 1.8
Ly49A 4.5 ⫾ 1.3 4.0 ⫾ 0.9 deficient NK cells.
Ly49C/I 34.8 ⫾ 1.9 35.9 ⫾ 2.4 NKLAM expression is greatly increased in NK cells after treat-
Ly49D 49.8 ⫾ 2.1 52.4 ⫾ 3.0 ment with cytokines that enhance NK killing, such as IL-2 and
Ly49H 67.8 ⫾ 2.0 71.0 ⫾ 0.5 IFN. We therefore compared the cytotoxic activity of resting and
Ly49I 60.0 ⫾ 4.3 60.3 ⫾ 2.3
in vitro IL-2-stimulated NK cells from NKLAM⫺/⫺ and WT mice.
KLRG1 33.5 ⫾ 3.7 33.1 ⫾ 0.5
Total spleen cells (⫻106) 84.0 ⫾ 7.8 87.5 ⫾ 9.2 As seen previously, resting NK cells from NKLAM-deficient mice
a
had lower NK activity than cells from WT littermates. Interest-
Results represent the percentage of spleen cells positive for the indicated mark-
ers by flow cytometry. The mean ⫾ SD of eight individual mice per genotype is ingly, IL-2 enhanced the killing activity of both NKLAM-deficient

Downloaded from www.jimmunol.org on January 26, 2011


shown. The percentage of NK cells bearing individual NK receptors is derived from and WT NK cells. However, the level of killing by IL-2-stimulated
the gated CD3⫺NK1.1⫹ population. There were no significant differences in the ab- NK cells from NKLAM⫺/⫺ mice was still much less than the
solute number or distribution of lymphocyte or NK subsets between WT (⫹/⫹) and
NKLAM-deficient (⫺/⫺) mice. killing mediated by IL-2-stimulated WT NK cells (Fig. 4). Cumu-
latively, these results indicate that NKLAM plays a role in NK
cytotoxicity in vitro. However, it is not absolute in that there is
84 ⫾ 7.8 ⫻ 106 in WT mice. The percentages of CD3⫹, CD4⫹, residual killing displayed by NKLAM-deficient NK cells, which
and CD8⫹ T cells, CD3⫹CD25⫹ activated T cells, CD19⫹ B cells, can be enhanced by exposure to IL-2. This suggests that NKLAM
and CD3⫺DX5⫹ NK cells were evaluated. We also looked at the is one of multiple factors contributing to the total amount of cy-
proportion of DX5⫹ NK cells coexpressing CD62L (L-selectin). In totoxicity mediated by DX5⫹ NK cells.
humans, L-selectin expression is associated with an immature NK
cell phenotype (24). In mice, L-selectin expression on NK cells
may influence the migration of NK cells to various lymphoid or- NKLAM-deficient NK cells display normal granule exocytosis
gans (25). As shown in Table I, there were no differences in any of and granule contents
the cell populations between NKLAM-deficient and WT mice. Since NKLAM is found in the membrane of cytolytic granules, it
Analysis of the number of CD3⫺NK1.1⫹ NK cells and the NK is possible that it plays a role in the migration and/or fusion of
receptor repertoire was also performed. NKLAM-deficient and granules to the cell membrane during the process of granule exo-
WT mice had equivalent levels of CD3⫺NK1.1⫹ cells (Table I). cytosis when NK cells are activated to kill. NKLAM levels are low
Examination of gated CD3⫺NK1.1⫹ splenic NK cells for NK in- in resting NK cells and unlike other granule membrane proteins
hibitory and activating receptors showed no differences in the ex- like CD107a (LAMP-1), there is little to no preformed NKLAM in
pression of NKp46, NKG2D, NKG2DA/C/E, Ly49A, Ly49C/I, cytolytic granules (9, 30). Upon target cell stimulation, NKLAM
Ly49D, Ly49H, Ly49I, and KLRG1 between KO and WT NK levels increase. To determine whether NKLAM plays a role in
cells (Table I and Fig. 2). Therefore, the lack of NKLAM expres- granule exocytosis, spleen cells and purified NK cells from
sion does not significantly alter the numbers or distribution of NK NKLAM⫺/⫺ and WT mice were treated with PMA and calcium
populations or other lymphocyte subsets in the spleen. ionophore A23187 to trigger granule exocytosis. Four hours later,
Maturation of NK cells was first shown to be accompanied by an the supernatants were monitored for ␤-glucuronidase, a soluble
up-regulation of CD11b (Mac-1) expression (26). It was subse- component of the granules and a measure of granule release. Total
quently demonstrated that mouse NK cells could be dissected into levels of ␤-glucuronidase in the cells were determined by deter-
four subsets based on cell surface density of CD27 and CD11b gent (Triton X-100) lysis. As shown in Fig. 5, the total and re-
(27–29). This developmental program begins with CD11blow leased amounts of ␤-glucuronidase in NKLAM-deficient and WT
CD27low NK cells and progresses through CD11blowCD27high, cells were comparable. This indicates that NKLAM is likely not
CD11bhighCD27high, and CD11bhighCD27low. The distribution of required for granule exocytosis and/or release of soluble granule
these subsets in CD3⫺NK1.1⫹ NK cells from the spleens of components.
NKLAM-deficient and WT mice was evaluated. As shown in Fig. Granule exocytosis-mediated killing of tumor targets requires
2, NKLAM KO and WT mice have similar levels of these subsets. functional granules containing perforin and granzymes. If
In addition, as described, the percentage of NK cells expressing NKLAM alters the expression and/or function of these proteins, it
Ly49C/I in the CD11blow subsets of both KO and WT mice was could alter the killing activity of NK cells. Therefore, the levels of
much lower (8%) than in the CD11bhigh subsets (30%) (data not perforin, granzyme B and the granule membrane protein CD107a
shown). Overall, these results suggest no NK maturational alter- in NKLAM⫺/⫺ and WT NK cells were evaluated. A representative
ations in NKLAM-deficient mice. immunoblot is shown in Fig. 6. The amount of perforin, granzyme
B, and CD107a was quantitated by densitometry and normalized to
NKLAM-deficient mice display lower splenic NK activity in vitro the levels of ␤-actin. We found no significant differences in per-
Previous studies have shown that NKLAM is located in NK cy- forin, granzyme B, or CD107a expression between NKLAM⫺/⫺
tolytic granule membranes (9). In addition, treatment of NK cells and WT NK cells, suggesting that NKLAM does not alter the
The Journal of Immunology 6917

Downloaded from www.jimmunol.org on January 26, 2011

FIGURE 2. Normal NK cell subsets and receptor repertoire in NKLAM-deficient mice. Representative flow cytometry results from eight independent
experiments are shown. Cells isolated from the spleens of NKLAM-deficient (KO) and WT mice were stained for the markers indicated. A, Electronically
gated NK cells (CD3⫺NK1.1⫹, left panel) were evaluated for expression of the NK maturation markers CD27 and CD11b (middle panel). The dot plots
indicate the percentage of each NK subset. The right panel depicts the intracellular staining levels of granzyme B and perforin in electronically gated
CD3⫺NK1.1⫹ cells from purified NK cells stimulated with IL-2 for 3 days in vitro from KO and WT mice. B and C, The histogram plots represent the
expression levels of the indicated NK activating and inhibitory receptors electronically gated on CD3⫺NK1.1⫹ spleen cells from KO and WT mice.
Numbers indicate the percentage of positive cells for each subset.
6918 ENHANCED TUMOR METASTASIS IN NKLAM-DEFICIENT MICE

FIGURE 3. In vitro splenic NK activity is lower in NKLAM-deficient


mice. DX5⫹ NK cells from the spleens of NKLAM KO (⫺/⫺), heterozy-
gous (⫹/⫺), and WT (⫹/⫹) mice were isolated by magnetic bead column
purification. These cells were assessed for cytolytic activity against 51Cr-
labeled YAC-1 target cells in 4-h killing assays at the E:T ratios shown.
Results are expressed as the percent specific lysis of YAC-1 cells. This
represents one of six experiments with similar results. SDs of triplicate
values in each experiment did not exceed 10%.

FIGURE 5. NK cells and spleen cells from NKLAM KO and WT mice


expression of these proteins. However, we cannot rule out the pos-
display comparable levels of granule exocytosis. Granule exocytosis was
sibility that there may be functional differences in the proteins monitored by the release of ␤-glucuronidase using the fluorogenic substrate
between these mice. NKLAM was undetectable in KO cells. 4-methylumbelliferyl-␤-D-glucuronide. Four ⫻ 105 spleen cells or 2.5 ⫻

Downloaded from www.jimmunol.org on January 26, 2011


Intracellular levels of perforin and granzyme B were also ana- 105 purified NK cells from NKLAM KO or WT mice were incubated with
lyzed by flow cytometry. Fig. 2A (third panel) depicts the intra- 0.025 ml of RPMI 1640 containing 4% FBS in 96-well plates. PMA (40
cellular expression of these proteins in NKLAM KO- and WT- ng/ml) plus calcium ionophore A23187 (2 ␮g/ml) (P ⫹ I) was used to
purified NK cells stimulated for 3 days with IL-2. Cells from induce granule exocytosis. Total release was obtained by incubation of
NKLAM KO and WT mice have comparable levels of granzyme cells with 1% Triton X-100. After 4 h at 37oC, 0.005 ml of supernatant was
B and perforin; ⬎97% of the CD3⫺NK1.1⫹ NK cells express added to triplicate wells of 96-well black microtiter plates and mixed with
0.05 ml of ␤-glucuronidase substrate. Plates were incubated for 10 min at
granzyme B and ⬎70% express perforin. Similar results were seen
37oC. The reaction was stopped by the addition of 0.175 ml of 0.25 M
in three independent experiments. Total splenocytes from
sodium tetraborate. The fluorescence intensity was measured in a Wallac
NKLAM-deficient and WT mice were also cultured for 3 days in Victor 1420 multilabel counter. Error bars represent the SEM from five
IL-2. Granzyme B and perforin levels in the KO and WT independent experiments. unstim, Unstimulated.
CD3⫺NK1.1⫹ cells in these cultures were also comparable, with
⬎97% of the cells expressing granzyme B and ⬃45% expressing
perforin (data not shown). The flow cytometry results correlate NK cells after target cell stimulation. Freshly isolated, purified,
with the protein levels seen in immunoblot analysis. Consistent unstimulated NK cells or NK cells stimulated with IL-2 for 3 days
with studies by Fehninger et al. (8), granzyme B and perforin were in vitro were cocultured with YAC-1 target cells at E:T ratios of
undetectable in purified, unstimulated NK cells.

NKLAM-deficient mice produce less IFN-␥ upon target


stimulation in vitro
In addition to cytotoxic activity against YAC-1 tumor cells, we
compared the production of IFN-␥ by NKLAM-deficient and WT

FIGURE 4. IL-2 partially restores the killing activity of NKLAM-defi- FIGURE 6. Immunoblot analysis of granule proteins in NKLAM-defi-
cient NK cells in vitro. DX5⫹ NK cells from the spleens of NKLAM KO cient and WT mice. Purified NK cells from the spleens of NKLAM-defi-
(⫺/⫺) and WT (⫹/⫹) mice were isolated by magnetic bead column pu- cient KO and WT mice were stimulated with IL-2 (500 U/ml) in vitro for
rification. Cells were then cultured at 5 ⫻ 106 cells/ml in RPMI 1640 3 days. Cell lysates were then prepared as described and subjected to West-
containing 10% FBS, 1% glutamine, and 5 ⫻ 10⫺5 M 2-ME for 3 days ern blot analysis. The amount of perforin, granzyme B and CD107a from
with and without 500 U/ml rIL-2. These cells were assessed for cytolytic four independent experiments was quantitated by densitometry and nor-
activity against 51Cr-labeled YAC-1 target cells in 4-h killing assays at the malized to the levels of ␤-actin. Levels of expression between KO and WT
E:T ratios shown. Error bars represent the SDs from five independent cells varied by ⬍25% for each protein and were not significantly different.
experiments. NKLAM protein was undetectable in KO cells.
The Journal of Immunology 6919

FIGURE 7. NKLAM-deficient NK cells secrete less IFN-␥ than WT


NK cells upon target cell stimulation in vitro. Freshly isolated, purified,
unstimulated NK cells (unstimulated) or NK cells stimulated with IL-2 for
3 days in vitro (IL-2) from NKLAM-deficient (KO) and WT mice were
cocultured with YAC-1 target cells at E:T ratios of 25:1 and 10:1, respec-
tively. After 4 h of incubation, levels of IFN-␥ in the supernatants were
quantitated by ELISA and expressed as pg/ml. Results are the mean ⫾ SD
of four independent experiments.

Downloaded from www.jimmunol.org on January 26, 2011


25:1 and 10:1, respectively. After 4 h of incubation, levels of FIGURE 9. NKLAM-deficient mice exhibit greater pulmonary metas-
IFN-␥ in the supernatants were quantitated by ELISA. As shown tasis of B16 melanoma cells than WT mice. NKLAM-deficient KO (⫺/⫺)
in Fig. 7, freshly isolated NK cells from WT mice produced more and WT (⫹/⫹) mice were injected i.v. through the lateral tail vein with
IFN-␥ than NK cells from NKLAM KO mice after coculture with 300,000 B16 melanoma cells. Fifteen days later, lungs were harvested,
fixed, and the individual lobes dissected. Black metastatic melanoma col-
YAC-1 (93 pg/ml vs 64 pg/ml). The difference in IFN-␥ produc-
onies were counted on each lung lobe surface using a dissecting micro-
tion between WT and KO NK cells was even more dramatic when scope. Colonies were counted in a blinded fashion. A, Photograph shows
cells were first cultured in IL-2 for 3 days before the 4 h YAC-1 representative lungs from two WT (⫹/⫹) and two NKLAM-deficient KO
costimulation (1399 pg/ml vs 561 pg/ml). (⫺/⫺) mice. B, Lung tumors were quantitated in individual NKLAM KO
(⫺/⫺) and WT (⫹/⫹) male and female mice. Results indicate the mean
NK activity in NKLAM-deficient mice is stimulated in vivo by number of lung colonies. Error bars indicate the SEM (n ⱖ 8). The sta-
poly(I:C) tistical significance is p ⬍ 0.001 using the Student t test.
NK activity is enhanced by in vivo exposure to poly(I:C). Twenty-
four hours after i.p injection of mice with poly(I:C) or PBS, spleen
cells or purified NK cells from NKLAM-deficient and WT mice
were assayed for NK activity in vitro. Poly(I:C) increased the kill- mice had substantially higher numbers of lung metastases com-
ing activity of splenocytes and purified NK cells from both pared with WT controls (mean 92 nodules vs 32, p ⬍ 0.01; Fig. 9).
NKLAM KO and WT mice to the same extent (Fig. 8). Since a gender difference in response to B16 melanoma was re-
ported in NK receptor 2B4⫺/⫺ mice, tumor metastasis in both
Enhanced lung metastases in NKLAM-deficient mice NKLAM⫺/⫺ and ⫹/⫹ males and females was evaluated (34). We
The B16 melanoma model of experimental lung metastasis has observed no gender differences; both male and female
been widely used in studies of NK function (31–33). In these ex- NKLAM⫺/⫺ mice showed greater numbers of tumors than their
periments, NKLAM⫺/⫺ and WT mice were injected i.v. with WT gender-matched controls (Fig. 9B). In addition to having more
300,000 B16 melanoma cells. Fifteen days later, black metastatic metastases, both male and female NKLAM-deficient mice had
melanoma colonies in the lungs were counted. NKLAM-deficient larger tumor nodules than WT mice (Fig. 9A). These results indi-
cate that NKLAM-deficient mice have diminished capacity to con-
trol tumor metastases in vivo and support the role for NKLAM in
NK function in vivo.

Discussion
This report describes the generation and initial characterization of
mice with a targeted genetic deletion of NKLAM. NKLAM is a
RING-IBR-RING finger-containing transmembrane protein found
in NK cytolytic granules. It is weakly expressed in resting NK
cells; upon target cell stimulation or after incubation with cyto-
kines that enhance NK killing, NKLAM mRNA levels in NK cells
increase and protein is synthesized and becomes targeted to cyto-
FIGURE 8. NK activity in NKLAM-deficient mice is stimulated in vivo
plasmic granule membranes. Previous studies have shown a role
by poly(I:C) (p(I:C)). NKLAM-deficient (KO) and WT mice were injected
for NKLAM in perforin/granzyme-mediated cytolysis. Treatment
i.p. with poly(I:C) or PBS. After 24 h, spleen cells or purified NK cells
were assayed for NK activity in vitro using YAC-1 target cells in 4-h of NK cells with NKLAM antisense oligonucleotides inhibits their
killing assays at E:T ratios of 100:1 and 20:1, respectively. Results are killing activity, indicating that NKLAM participates in the cyto-
expressed as the percent specific lysis of YAC-1 cells. This represents one toxic process.
of four experiments with similar results. SDs of triplicate values in each To further evaluate the role of NKLAM in NK function in vivo,
experiment did not exceed 10%. NKLAM-deficient mice were generated. These mice were initially
6920 ENHANCED TUMOR METASTASIS IN NKLAM-DEFICIENT MICE

129Sv/Ev ⫻ C57BL/6 and have been backcrossed for 11 genera- involved in granule protein expression and the process of granule
tions onto a B6 background. During this process, we observed no exocytosis. However, we cannot rule out the possibility that
significant differences in the results obtained from non-back- NKLAM deficiency may lead to an alteration in other granule
crossed and fully backcrossed NKLAM homozygous KO mice. protein expression and/or function.
NKLAM-deficient mice were monitored for ⬎18 mo. Overall, the In addition to decreased cytotoxic activity against YAC-1 tumor
mice appeared normal and were fertile. Histological examination cells mediated by NK cells from NKLAM-deficient mice, these
of the major organs of NKLAM⫺/⫺ and ⫹/⫺ mice revealed no cells also secrete less IFN-␥ than WT NK cells after target cell
overt abnormalities by light microscopy. NKLAM⫺/⫺ mice devel- stimulation. It has been suggested that IFN-␥ is released both syn-
oped normally and there was no obvious difference in gross mor- aptically and multidirectionally by NK cells (36). Studies are in
phology, size, or body weight between WT and NKLAM-deficient progress to determine whether NKLAM is involved in IFN-␥ pro-
mice during the 18-mo period. duction and/or release by either of these two mechanisms.
We also observed no differences in the numbers or distribution We used the B16 melanoma model to evaluate the potential role
of lymphoid populations in the spleens of NKLAM⫺/⫺ mice com- of NKLAM in tumor metastasis in vivo. B16 melanoma cells ex-
pared with WT animals. The numbers of CD3⫹, CD4⫹, and CD8⫹ press low amounts of MHC class I and are readily killed by NK
T cells, CD3⫹CD25⫹ activated T cells, CD19⫹ B cells, cells. It has been well established that inhibition of NK activity by
CD3⫺DX5⫹, and CD3⫺NK1.1⫹ NK cells in both groups of mice various methods in vivo is associated with increased B16 pulmo-
were identical. We also looked at the proportion of DX5⫹ NK cells nary metastasis. More recently, Kim et al. (37) demonstrated that
coexpressing CD62L (L-selectin). In humans, L-selectin expres- NK cell-deficient transgenic mice have more than a 60-fold greater
sion is associated with an immature NK cell phenotype (24). In number of B16 lung metastases compared with WT mice, con-
mice, L-selectin expression on NK cells may influence the migra- firming a predominant role of NK cells in B16 lung metastasis
tion of NK cells to various lymphoid organs (25). Again, there was following i.v. injection. A gender difference in response to B16

Downloaded from www.jimmunol.org on January 26, 2011


no significant difference in the proportion of DX5⫹L-selectin⫹ melanoma was reported in mice deficient in the NK receptor 2B4
cells in NKLAM⫹/⫹ and ⫺/⫺ mice. We also saw no maturational (34). We found that NKLAM-deficient mice have significantly
differences between NKLAM KO and WT spleen NK cells based greater numbers of B16 lung nodules than WT mice (between 3-
on the levels of coexpression of CD27 and CD11b as described and 4-fold greater).We observed no gender differences; both male
previously (26 –29). Analysis of NK inhibitory and activating re- and female NKLAM⫺/⫺ mice showed greater numbers of tumors
ceptor expression by splenic NK cells in NKLAM-deficient and than their WT gender-matched controls. In addition to having more
WT mice also showed no differences. Evaluation of NK popula- metastases, both male and female NKLAM-deficient mice had
tions in other organs in NKLAM-deficient mice, including bone larger tumor nodules than WT mice. These results indicate that
marrow, lymph node, liver, and lungs, is currently in progress. NKLAM-deficient mice have diminished capacity to control tumor
Although NKLAM-deficient mice have normal numbers of metastases in vivo and support the role for NKLAM in NK func-
splenic NK cells and a normal NK receptor repertoire, these cells tion in vivo. Again, these results suggest a partial rather than ab-
display significantly less cytotoxic activity against YAC-1 target solute defect in NK activity in NKLAM-deficient NK cells.
cells in vitro compared with heterozygous or WT control cells. These studies point to an important role for NKLAM in NK cell
This demonstrates unequivocally that NKLAM plays a role in NK- function in vivo and in vitro. These NKLAM-deficient mice are a
mediated cytotoxicity. However, it also indicates that NKLAM is tool for characterizing the function of NKLAM and its role in
not absolutely required for all NK-mediated killing. Similarly, various disease processes. It also opens up new investigations into
when purified NK cells were stimulated with IL-2 in vitro, killing alternate, NKLAM-independent mechanisms used by NK cells to
of both NKLAM⫺/⫺ and ⫹/⫹ NK cells was increased. However, control tumors and viruses in vitro and in vivo.
the cytotoxic activity mediated by NKLAM-deficient NK cells
never reached the levels of WT NK cells. This indicates that IL-2 Disclosures
enhances the killing activity of NKLAM-deficient NK cells. It also The authors have no financial conflict of interest.
suggests that there is an NKLAM-dependent and NKLAM-inde-
pendent pathway used by NK cells. This is further supported by the
finding that poly(I:C) treatment in vivo enhances NK activity in
References
1. Herberman, R. B., and J. R. Ortaldo. 1981. Natural killer cells: their role in
both NKLAM-deficient and WT mice to the same extent. Because defenses against disease. Science 214: 24 –30.
the analysis of perforin-deficient mice led to the delineation of a 2. Peters, P. J., J. Borst, V. Oorschot, M. Fukuda, O. Krahenbuhl, J. Tschopp,
perforin-independent, Fas-dependent mechanism of cytotoxicity, J. W. Slot, and H. J. Geuze. 1991. Cytotoxic T lymphocyte granules are secretory
lysosomes, containing both perforin and granzymes. J. Exp. Med. 173:
studies of NKLAM-deficient mice may similarly unveil alternative 1099 –1109.
killing pathways (35). 3. Russell, J. H., and T. J. Ley. 2002. Lymphocyte-mediated cytotoxicity. Annu.
Rev. Immunol. 20: 323–370.
NKLAM is found in the membrane of cytolytic granules, sug-
4. Stinchcombe, J. C., and G. M. Griffiths. 2007. Secretory mechanisms in cell-
gesting that it might play a role in the migration and/or fusion of mediated cytotoxicity. Annu. Rev. Cell Dev. Biol. 23: 495–517.
granules to the cell membrane during the process of granule exo- 5. Trinchieri, G., D. Santoli, and H. Koprowski. 1978. Spontaneous cell-mediated
cytotoxicity in humans: role of interferon and immunoglobulins. J. Immunol. 120:
cytosis when NK cells are activated to kill. However, our results 1849 –1855.
indicate comparable release of the soluble granule protein ␤-glu- 6. Kuribayashi, K., S. Gillis, D. E. Kern, and C. S. Henney. 1981. Murine NK cell
curonidase by both NKLAM⫺/⫺ and WT spleen cells and purified cultures: effects of interleukin-2 and interferon on cell growth and cytotoxic re-
activity. J. Immunol. 126: 2321–2327.
NK cells after PMA and calcium ionophore treatment. Experi- 7. Kornbluth, J., and R. G. Hoover. 1988. Changes in gene expression associated
ments are planned to evaluate the potential role of NKLAM in with IFN-␤ and IL-2 induced augmentation of human natural killer cell function.
induction of granule exocytosis by other stimuli. J. Immunol. 141: 3234 –3240.
8. Fehninger, T. A., S. F. Cai, X. Cao, A. J. Bredemeyer, R. M. Presti, A. R. French,
We also found no differences in expression of the granule pro- and T. J. Ley. 2007. Acquisition of murine NK cell cytotoxicity requires trans-
teins perforin, granzyme B, or CD107a (LAMP-1) by flow cytom- lation of a pre-existing pool of granzyme B and perforin mRNAs. Immunity 26:
etry and/or immunoblot analysis between NKLAM⫺/⫺ and WT 798 – 811.
9. Kozlowski, M., J. Schorey, T. Portis, V. Grigoriev, and J. Kornbluth. 1999. NK
NK cells, indicating that NKLAM does not alter the expression of lytic-associated molecule: a novel gene selectively expressed in cells with cyto-
these proteins. Overall, these results suggest that NKLAM is not lytic function. J. Immunol. 163: 1775–1785.
The Journal of Immunology 6921

10. Portis, T., J. Anderson, A. Esposito, and J. Kornbluth. 2000. Gene structure of function of L-selectin on CD56bright and CD56dim natural killer cell subsets.
human and mouse NKLAM, a gene associated with cellular cytotoxicity. Immu- J. Immunol. 161: 400 – 408.
nogenetics 51: 546 –555. 25. Chen, S., H. Kawashima, J. B. Lowe, L. L. Lanier, and M. Fukuda. 2005. Sup-
11. van der Reijden, B. A., C. A. Erpelinck-Verschueren, B. Lowenberg, and pression of tumor formation in lymph nodes by L-selectin-mediated natural killer
J. H. Jansen. 1999. TRIADs: a new class of proteins with a novel cysteine-rich cell recruitment. J. Exp. Med. 202: 1679 –1689.
signature. Protein Sci. 8: 1557–1561. 26. Kim, S., K. Iizuka, H. P. Kang, A. Dokun, A. R. French, S. Greco, and
12. Eisenhaber, B., N. Chumak, F. Eisenhaber, and M-T. Hauser. 2007. The ring W. M. Yokoyama. 2002. In vivo developmental stages of murine natural killer
between ring fingers (RBR) protein family. Genome Biol. 8: 209. cell maturation. Nat. Immunol. 3: 523–528.
13. Capili, A. D., E. L. Edghill, K. Wu, and K. L. B. Borden. 2004. Structure of the 27. Hayakawa, Y., and M. J. Smyth. 2006. CD27 dissects mature NK cells into two
C-terminal RING finger from a RING-IBR-RING/TRIAD motif reveals a novel subsets with distinct responsiveness and migratory capacity. J. Immunol. 176:
zinc-binding domain distinct from a RING. J. Mol. Biol. 340: 1117–1129. 1517–1524.
14. Fang, S., K. L. Lorick, J. P. Jensen, and A. M. Weissman. 2003. RING finger 28. Hayakawa, Y., S. V. Watt, K. Takeda, and M. J. Smyth. 2008. Distinct receptor
ubiquitin protein ligases: implications for tumorigenesis, metastasis and for mo- repertoire formation in mouse NK cell subsets regulated by MHC class I expres-
lecular targets in cancer. Semin. Cancer Biol. 13: 5–17. sion. J. Leukocyte Biol. 83: 106 –111.
15. Ardley, H. C., and P. A. Robinson. 2005. E3 ubiquitin ligases. Essays Biochem. 29. Chiossone, L., J. Chaix, C. Roth, E. Vivier, and T. Walzer. 2009. Maturation of
41: 15–30. mouse NK cells is a 4-stage developmental program. Blood 113: 5488 –5496.
16. Liu, Y. C. 2004. Ubiquitin ligases and the immune response. Annu. Rev. Immu-
30. Burkhardt, J. K., S. Hester, C. K. Lapham, and Y. Argon. 1990. The lytic granules
nol. 22: 81–127.
of natural killer cells are dual-function organelles combining secretory and pre-
17. Anandasabapathy, N., G. S. Ford, D. Bloom, C. Holness, V. Paragas, C. Seroogy,
lysosomal compartments. J. Cell Biol. 111: 2327–2340.
H. Skrenta, M. Hollenhorst, C. G. Fathman, and L. Soares. 2003. GRAIL: an E3
31. Hanna, N., and R. C. Burton. 1981. Definitive evidence that natural killer (NK)
ubiquitin ligase that inhibits cytokine gene transcription is expressed in anergic
cells inhibit experimental tumor metastasis in vivo. J. Immunol. 127: 1754.–1758.
CD4⫹ T cells. Immunity 18: 535–547.
18. Chuang T.-H., and R. J. Ulevitch. 2004. Triad3A, an E3 ubiquitin-protein ligase 32. Gorelik, E., R. H. Wiltrout, K. Okumura, S. Habu, and R. B. Herberman. 1982.
regulating Toll-like receptors. Nat. Immunol. 5: 495–502. Role of NK cells in the control of metastatic spread and growth of tumor cells in
19. Fortier, J. M., and J. Kornbluth. 2006. NK lytic-associated molecule, involved in mice. Int. J. Cancer 30: 107–112.
NK cytotoxic function, is an E3 ligase. J. Immunol. 176: 6454 – 6463. 33. Warner, J. F., and G. Dennert. 1982. Effect of a cloned cell line with NK activity
20. Brown, M. G., A. A. Scalzo, L. R. Stone, P. Y. Clark, Y. Du, B. Palanca, and on bone marrow transplants, tumour development and metastasis in vivo. Nature
W. M. Yokoyama. 2001. Natural killer gene complex (Nkc) allelic variability in 300: 31–34.
34. Vaidya, S. V., S. E. Stepp, M. E. McNerney, J. Lee, M. Bennett, K. Lee,

Downloaded from www.jimmunol.org on January 26, 2011


inbred mice: evidence for Nkc haplotypes. Immunogenetics 53: 584 –591.
21. Arase, H., T. Saito, J. H. Phillips, and L. L. Lanier. 2001. The mouse NK cell- C. L. Stewart, V. Kumar, and P. A. Mathew. 2005. Targeted disruption of the 2B4
associated antigen recognized by DX5 monoclonal antibody is CD49b (␣2 inte- gene in mice reveals an in vivo role of 2B4 (CD244) in the rejection of B16
grin, very late antigen-2). J. Immunol. 167: 1141–1144. melanoma cells. J. Immunol. 174: 800 – 807.
22. Taffs, R., M. Sitkovsky, and H. Takayama. 1998. Granule enzyme exocytosis 35. Kagi, D. B. Ledermann, K. Burki, P. Seiler, B. Odermatt, K. J. Olsen,
assay for cytotoxic T lymphocyte activation. In Current Protocols in Immunol- E. R. Podack, R. M. Zinkernagel, and H. Hengartner. 1994. Cytotoxicity medi-
ogy, Vol. 1. J. E. Coligan, A. M. Kruisbeek, D. M. Margulies, E. M. Shevach, and ated by T cells and natural killer cells is greatly impaired in perforin-deficient
W. Strober, eds. Wiley, New York, pp. 3.16.1–3.16.9. mice. Nature 369: 31–37.
23. Chen, J. W., T. L. Murphy, M. C. Willington, I. Pastan, and J. T. August. 1985. 36. Huse, M., E. J. Quann, and M. M. Davis. 2008. Shouts, whispers and the kiss of
Identification of two lysosomal membrane glycoproteins. J. Cell Biol. 101: death: directional secretion in T cells. Nat. Immunol. 9: 1105–1111.
85–95. 37. Kim, S., K. Iizuka, H. L. Aguila, I. L. Weissman, and W. M. Yokoyama. 2000.
24. Frey, M., N. B. Packianathan, T. A. Fehninger, M. E. Ross, W. C. Wang, In vivo natural killer cell activities revealed by natural killer cell-deficient mice.
C. C. Stewart, M. A. Caligiuri, and S. S. Evans. 1998. Differential expression and Proc. Natl. Acad. Sci. USA 97: 2731–2736.