Theor Appl Genet (2007) 115:277–287
DOI 10.1007/s00122-007-0568-3
ORIGINAL PAPER
High-density Brassica oleracea linkage map: identiWcation
of useful new linkages
Muqiang Gao · Genyi Li · Bo Yang · Dan Qiu ·
Mark Farnham · Carlos Quiros
Received: 5 January 2007 / Accepted: 23 April 2007 / Published online: 22 May 2007
© Springer-Verlag 2007
Abstract We constructed a 1,257-marker, high-density
genetic map of Brassica oleracea spanning 703 cM in nine
linkage groups, designated LG1–LG9. It was developed in
an F2 segregating population of 143 individuals obtained by
crossing double haploid plants of broccoli “Early-Big” and
cauliXower “An-Nan Early”. These markers are randomly
distributed throughout the map, which includes a total of
1,062 genomic SRAP markers, 155 cDNA SRAP markers,
26 SSR markers, 3 broccoli BAC end sequences and 11
known Brassica genes: BoGSL-ALK, BoGSL-ELONG,
BoGSL-PROa, BoGSL-PROb, BoCS-lyase, BoGS-OH,
BoCYP79F1, BoS-GT (glucosinolate pathway), BoDM1
(resistance to downy mildew), BoCALa, BoAP1a (inXores-
cence architecture). BoDM1 and BoGSL-ELONG are linked
on LG 2 at 0.8 cM, making it possible to use the glucosinolate
Communicated by F. Ordon.
Electronic supplementary material The online version of this
article (doi:10.1007/s00122-007-0568-3) contains supplementary
material, which is available to authorized users.
M. Gao
Department of Plant and Soil Sciences,
University of Kentucky, Lexington, KY 40546 , USA
G. Li
Department of Plant Science, University of Manitoba,
Winnipeg, MB, Canada R3T 2N2
M. Farnham
USDA-ARS-U.S., Vegetable Laboratory,
2700 Savannah Hwy, Charleston, SC 29414, USA
B. Yang · D. Qiu · C. Quiros (&)
Department of Plant Sciences, University of California,
Davis, CA 95616, USA
e-mail: cfquiros@ucdavis.edu
gene as a marker for the disease resistance gene. By QTL
analysis, we found three segments involved in curd formation
in cauliXower. The map was aligned to the C genome linkage
groups and chromosomes of B. oleracea and B. napus, and
anchored to the physical map of A. thaliana. This map adds
over 1,000 new markers to Brassica molecular tools.
Introduction
After the construction of the Wrst substantial linkage map of
B. oleracea, with isozyme loci, pioneered by Arus and
Orton (1983), several others have followed using a variety
of molecular markers (for review see Quiros 2000 and Qui-
ros and Paterson 2004). Little eVort was spent at that time
to align these maps across laboratories and to perpetuate the
mapping populations used for their construction. However,
it was possible to assign some of the linkage groups to their
respective chromosomes with alien addition lines (Hu and
Quiros 1991; Heneen and Jorgensen 2001). Sebastian et al.
(2000) established a consensus map for this species based
on perpetuated individuals from two double haploid popu-
lations, (cauliXower £ Brussels sprouts and broccoli £
kale) constructed with 547 RFLP, AFLP and SSR markers .
Its nine linkage groups have been now physically assigned
to their respective chromosomes by Howell et al. (2002)
using FISH. Furthermore, these chromosomes have now
been aligned with the linkage groups for both the A and C
genomes in B. napus by Bohuon et al. (1996), Lowe et al.
(2004) and Piquemal et al. (2005). With the availability of
EST sequences from Arabidopsis, these were used to
construct several maps allowing partial comparison of the
A. thaliana genome with the B. oleracea genome (Kowalski
et al. 1994; Lan et al. 2000; Babula et al. 2003). This task
was also accomplished by Li et al. (2003) using cDNA
123
278 Theor Appl Genet (2007) 115:277–287

polymorphisms to construct a linkage map in B. oleracea, Table 1 Primer pairs for the SRAP markers used in this study. Primer
followed by comparative physical mapping to A. thaliana. sequences reported in Sun et al. (2007) (in press)
Parkin et al. (2005) has now aligned all linkage groups of Markera Primer
B. napus to A. thaliana with RFLP markers.
We report the construction of a high-density genetic map m1–9 me2 + od4
based on the broccoli £ cauliXower F2 population used by m10–15 dc1 + od4
Li et al. (2003), adding various types of PCR-based markers m16–22 me2 + odd2
and sequences of known genes. Each linkage group has been m23–27 dc1 + od4
assigned to their respective chromosomes based on common m28–34 em2 + od1
markers with the Sebastian et al. (2000) and Piquemal et al. m35–39 em2 + od3
(2005) maps and to the chromosomes of A. thaliana. Fur- m40–44 em1 + od3
ther, the map was used to determine QTLs for curd forma- m45–51 em1 + od2
tion, which segregates in this population. Assignment of the m52–55 dc1 + od2
linkage groups of this map to their respective C genome m56–m59 em1 + od4
chromosomes adds over 1,000 new markers as mapping m60–64 dc1 + ga30
tools for B. oleracea and B. napus. The contribution of a m65–75 me2 + od11
substantial amount of new markers from our map will m76–85 em1 + ga30
increase the eYciency of marker-assisted selection and map- m86–94 dc1 + od19
based gene cloning in B. oleracea and B. napus. m95–102 em1 + od19
m103–109 em1 + od10
m110–115 dc1 + od15
Materials and methods m116–123 em1 + ga29
m124–125 me2 + od12
F2 mapping population m126–129 em2 + od5
m130–134 em2 + od4
To construct this map, we used the same F2 segregating m135–138 dc1 + od20
population as that used by Li et al. (2003) to construct a m139–146 em1 + od20
transcriptome map based on cDNA-SRAPs in B. oleracea. m147–150 dc1 + od21
It was developed by crossing two double haploid lines m151–155 em1 + od21
(broccoli “Early-Big” and cauliXower “An-Nan Early”), m156–162 em1 + od22
then selWng the F1 to make 143 F2 plants, which were used m163–165 me2 + od8
as parents to generate inbreds by single seed descent. In m166–173 me2 + od5
addition to the existing cDNA markers (Li et al. 2003), we m174–185 em2 + od26
added genomic SRAP markers, SSR markers, B. oleracea m186–195 me2 + od26
BAC clone sequences (B40L6, B59A4, B59C4) and m196–199 em1 + od30
sequences corresponding to 11 known B. oleracea genes. m200–201 em2 + od32
m202–207 dc1 + od33
Genetic markers m208–210 em1 + od33
m211–215 dc1 + od36
A total of 170 primer pairs, including 87 SRAP primers m216–221 dc1 + od35
labeled with IRDye 800 or IRDye 700 Xuorescent dyes m222–233 em1 + od35
combined with various unlabeled primers (Table 1), were m234–235 em2 + od20
used to amplify genomic DNA in the F2 population follow- m236–239 me2 + od15
ing the protocol of Li and Quiros (2001). The sequences of m240–245 dc1 + od34
these primers have been published by Sun et al. (2007) m246–256 em2 + od30
(in press). The PCR products were run in 5% polyacryl- m257–264 dc1 + od30
amide with the Li-Cor Global IR2 4200 sequencing system.
m265–270 me2 + od30
Public SSR primer sequences were obtained from http://
m271–274 em2 + od14
brassica.bbsrc.ac.uk/cgi-bin/ace/searches/browser/Brassica
m275–278 me2 + od32
DB and some from published papers (Sebastian et al. 2000;
m279–283 me2 + od23
Smith and King 2000). A total of 50 SSR primer pairs were
m284–292 em2 + od23
screened between two parents. Of these, 24 SSR primer

123
Theor Appl Genet (2007) 115:277–287 279

Table 1 continued Table 1 continued

Markera Primer Markera Primer

m293–303 em2 + od15 m767–786 s12 + ce12

m304–307 me2 + ga2 m787–797 em1 + ga3
m308–315 me2 + ga5 m798–820 em1 + ga5
m316–322 me2 + ga6 m821–830 em1 + ga6
m323–335 me2 + ga15 m831–832 em1 + od24
m336–341 me2 + ga19 m833–839 em1 + od38
m342–348 me2 + ga22 m840–847 em1 + od39
m349–356 me2 + ga27 m848–853 em1 + od40
m357–363 me2 + ga31 m854–858 dc1 + ga3
m364–367 me2 + ga32 m859–863 dc1 + od54
m368–372 me2 + ga39 m864–868 dc1 + od37
m373–381 me2 + ga41 m869–876 dc1 + od38
m382–387 me2 + ga42 m877–883 dc1 + od39
m388–396 me2 + ga45 m884–886 dc1 + od43
m397–398 me2 + sa4 m887–894 dc1 + od48
m399–406 me8 + sa7 m895–898 dc1 + od49
m407–416 me8 + ga3 m899–901 dc1 + ga2
m417–425 s12 + pm5 m902–906 dc1 + od40
m426–436 ga5 + pm1 m907–910 em1 + ga10
m437–446 s12 + pm4 m911–918 od8 + pm1
m447–456 od3 + pm5 m919–922 ga3 + ce12
m457–466 od3 + pm3 m923–927 od8 + ce7
m467–481 s12 + pm3 m928–934 od8 + pm4
m482–501 s12 + pm1 m935–944 od8 + ce8
m502–513 od3 + pm1 m945–949 od8 + ce9
m514–519 em1 + od50 m950–962 o15 + pm1
m520–523 dc1 + od54 m963–972 od15 + ce9
m524–528 dc1 + ga6 m973–979 od26 + sa1
m529–532 em1 + od51 m980–987 od26 + o3
m533–540 dc1 + ga22 m988–995 s14 + pm3
m541–542 dc1 + od55 M996–1005 s14 + c8
m543–544 em1 + od46 M1006–1014 s17 + ga1
m545–551 em1 + od45 M1015–1018 s17 + ga2
m552–555 em1 + od43 M1019–1026 me2 + s9
m556–570 ga3 + pm1 M1027–1038 me2 + s16
m571–587 ga3 + pm3 M1039–1045 me8 + s14
m588–600 ga3 + pm6 M1046–1049 me8 + s15
m601–611 ga5 + ce12 M1050–1061 em1 + od52
m612–626 od3 + ce7 S1–11 dc1 + odd15
m627–635 od3 + ce12 S12–20 dc1 + Me2
m636–652 o15 + ce12 S21–26 dc1 + Mc4
m653–667 o26 + ce12 S27–33 dc1 + odd10
m668–681 od26 + pm1 S34–40 dc1 + Mc5
m682–698 od26 + pm5 S41–42 Me2 + eM8
m699–709 od26 + pm6 S43–53 eM2 + odd15
m710–729 s12 + pm1 S54–58 Me8 + odd15
m730–751 s12 + ce7 S59–73 dc1 + Mc7
m752–766 s12 + ce10 S74–90 eM2 + fc3

123
280 Theor Appl Genet (2007) 115:277–287

Table 1 continued

Gao et al. sequence 2005

From cDNA sequence

Smith and King 2000
Markera Primer

Gao et al. 2005

S91–96 eM2 + Mc5

Li et al. 2001
Li et al. 2003

This paper
S97–106 dc1 + Me10

This paper
This paper
This paper
This paper

This paper
This paper
This paper
Resource
S107–110 dc1 + Me1
S111–117 dc1 + fc8
S118–120 dc1 + odd4
S121–127 dc1 + Me8

5⬘-TTG AAT ATC CAG TGT AAG GTT-3⬘

5⬘-GTA GTA TTC TCA AAA TCT TGT-3⬘
S128–137 dc1 + Me9

5⬘-CGGAGTTGAAGAGGAAAACT-3⬘
S138–142 dc1 + ga30

5⬘-GTCATAACAATGTGCCGAGT-3⬘

5⬘-TTCAGTTTCGACCAGAGAAA-3⬘
5⬘-AAAAACCACTGACTTGCTCA-3⬘

5⬘-AACGTACATTTGCCGAACTA-3⬘
5⬘-ACGCATTGTCAGAATGATCT-3⬘

5⬘-CCTTGGTACATGCCACTGAA-3⬘
5⬘-CCACTATCCCGACACTATCA-3⬘

5⬘-CCAGAAGCAGGGACAAGT-3⬘
5⬘-GATGCTCTCCTTCTTGTGA-3⬘
S143–154 dc1 + odd30

5⬘-AAGCGATCAAAGCGGG-3⬘
S155–165 eM1 + ga23
S166–170 eM1 + dc1
S171–172 eM2 + Me9
S173 eM1 + fc3
S174–176 eM2 + Me8
S177–192 dc1 + ga23
S193–202 eM2 + ga23

Sequence
S203–212 eM2 + ga30
S213–217 eM2 + eM8
S218–221 eM2 + Mc7
S222–228 eM2 + Me2
Right primer

BAC59C4R
S229–233 Me8 + ga23

CALSSRR
OH1274R

GT1028R
LS2230R

CY2000r
ODD12

DM1-R
S234–238 Me8 + odd30
PM132
PL581

AP1R
IPM9

LA4
S239–246 Me2 + odd30
S250 dc1 + ga29
S251–252 eM2 + odd30

5⬘- TCAACGTGTTAGACCAAAGT TCT-3

S253–254 Me2 + eM7
5⬘-TTC CAT CAT TTA CTT TCT CAG-3⬘
5⬘-AGA AGG GTG GTG ATT GTT G-3⬘
5⬘-GTG ACG GTG AAC AAT CTC C-3⬘

5⬘-AAAGGAGAAAGCCATACAGG-3⬘
S255–260 Me2 + ga23 5⬘-TAGGACAAGCGGAGAAAGAT-3⬘

5⬘-GTTAAGTGTGGCGTTAGAGG-3⬘
5⬘-GGTACGAACAAGGCTTCTCT-3⬘
5⬘-ACGCATTGTCAGAATGATCT-3⬘

5⬘-AATACAAGACGAGACGGCG-3⬘
5⬘-CACCGTTTGCTCTGTTCTAC-3⬘
5⬘-CGGCAAAAGCAATTCTTAC-3⬘

5⬘-TATATGGCTTGGGCAACGA-3⬘
a
Marker gel migration and primer sequences provided as supplemen-

5⬘-CTGGTGAATGCCGCTCT -3⬘
tary information

pairs showing polymorphism between two parents were run

in the F2 population.
Table 2 Primer sequences for 11 genes included in the map

Map construction
Sequence

The map was constructed with the program Joinmap 3.0

(LOD score from 4.0 to 8.0). SRAP markers from genomic
DNA were developed for this map (starting with M or S on
the actual map). These were combined with 155 cDNA
BAC59A4F
BAC59C4F

SRAP markers (Li et al. 2003), 26 SSR markers (starting

Left primer

CALSSRF
OH621F
CY713F
GT435F
LS360F

with OL on the map, or named NGA248, LS107, sORA21b,

DM1-F
PL132
odd48
PM87

AP1F
IPM2

LA3

MB4), three BAC end sequences: B40L6 (corresponding to

A. thaliana At5g23400), B59A4 (At2g03240), and B59C4
(At4g29905) and 11 B. oleracea genes as follows: glucosino-
late pathway: BoGSL-ALK, BoGSL-ELONG, BoGSL-PROa ,
BoGSL-ELONG

BoGSL-PRO-b
BoGSL-PROa

BoGSL-PROb, BoCS-lyase, BoGS-OH, BoCYP79F1, BoS-

BoCYP79F1
BoGSL-ALK

BAC59C4F
BoCS-lyase
BoGS-OH

GT; resistance to cotyledon stage downy mildew: BoDM1;

BAC59A
BoS-GT

BoDM1
BoCAL
BoAP1

B40L6

and inXorescence development: BoCAL ,and BoAP1. Primer

Gene

sequences used to map these genes are shown in Table 2.

123
Theor Appl Genet (2007) 115:277–287
Alignment of our map to existing maps and assignment
of linkage groups to speciWc chromosomes
A total of 26 SSR markers and 77 SRAP markers were
compared with the current B. napus and B. oleracea maps
(Sebastian et al. 2000; Howell et al. 2002; Lowe et al.
2004; Piquemal et al. 2005; Qiu et al. 2006). Following the
rationale of Li et al. (2003), 155 cDNA markers, 11 known
gene sequences and three BAC-end sequences were use for
alignment with Arabidopsis chromosomes.
QTL mapping of curd phenotype
We visually scored each of the F2 plants in the greenhouse
and F3 families in the Weld and greenhouse for inXores-
cence type in three major classes: 1 = broccoli-like,
2 = intermediate and 3 = cauliXower-like based on the scor-
ing system of Labate et al. (2006). QTL determination was
carried out by composite interval mapping with the soft-
ware WinQTLCart 2.0 (Zeng. 1994). The threshold LOD of
2.50 was selected based on a 5% signiWcance level deter-
mined by 300 permutations.
Results
Construction of the map
A 1,257-marker high-density genetic map of Brassica oler-
acea was constructed and spanned 703 cM in nine linkage
groups designated LG1–LG9. Most of these markers were
randomly distributed throughout the map (Fig. 1). It
included a total of 1,062 genomic SRAP dominant markers
generated with the 170 primer pairs. On an average, 6.2
SRAP polymorphic markers were produced per primer pair.
All 155 cDNA SRAP markers produced by Li et al. (2003)
in the same population were integrated into the nine linkage
groups of this map. Of the 50 SSR primer pairs screened
between two parents, only 24 showed polymorphism. The
24 SSR primer pairs found to be polymorphic between the
two parents generated 26 SSR markers. Of these, 26 mark-
ers were mapped into the nine linkage groups.
The eight glucosinolate genes, BoDM1, BoCAL and
BoAP1 and three BAC clone end sequences were scored as
co-dominant markers. BoGSL-ELONG and BoDM1 were
mapped on BoLG2, 0.84 cM apart. Giovanelli et al. (2002)
reported RAPD marker OMP-750 linked at 3 cM to
BoDM1 in B. oleracea. After sequencing of this marker, we
found conservation of the chromosome segment containing
BoGSL-ELONG and OMP-750 in A. thaliana. The OMP-
750 Arabidopsis homolog is in BAC MOP9 and is 53 Kb
apart from At5 g23020, which corresponds to the BoGSL-
ELONG gene (Gao et al. 2005) (Fig. 2). Downstream from
281
the BoGSL-ELONG ortholog, there is a putative disease
resistance gene, At5 g23400. Screening of the B. oleracea
“Early Big” BAC library produced clone B57M17 harbor-
ing the gene corresponding to At5 g23400. Sequencing of
this gene in B. oleracea revealed that it has 1,764 bases, it
is intronless and has 86% identity with At5 g23400 (data
not shown). A marker developed from sequencing the Bras-
sica homolog to this gene on this BAC clone, co-segregated
with BoGSL-ELONG, revealed further conservation of the
chromosomal segment in both species. The mapping prog-
eny did not segregate for downy mildew resistance, there-
fore it was not possible to conWrm whether the At5 g23400
homolog is the true gene for BoDM1. Genes BoCAL and
BoS-GT mapped on BoLG3, BoGSLPROa, BoGSL-PROb
(previously named BoGSL-PRO and BoGSL-PROL, respec-
tively; (Gao et al. 2006) and BoCYP79F1 mapped on
BoLG5. The Wrst two genes were only 0.027 cM apart.
They are duplicated gene members of the MAM (meth-
ylthioalkylmalate synthase) gene family (Gao et al. 2006).
BoAP1-a and BoCS-lyase mapped on BoLG 6. BoGSL-ALK
and BoGS-OH mapped on BoLG9 5.4 cM apart. These two
genes are members of the AOP (2- oxoacid-dependent
dioxygenases) family. The latter corresponds to the A. tha-
liana ortholog (at2 g25450) and has not been previously
mapped on Brassica.
Alignments to C genome linkage groups
from other B. oleracea and B. napus maps
Using 22 common SSR markers, we were able to align the
linkage groups of our map to the genome speciWc groups of
B. oleracea and B. napus. The nine linkage groups BoLG1–
BoLG9 on our map are equivalent to the B. oleracea linkage
groups O1–O9 (Sebastian et al. 2000; Howell et al. 2002)
and B. napus linkage group N11–N19, respectively (Bohuon
et al. 1996; Lowe et al. 2004; Piquemal et al. 2005)
(Table 3). Of the genomic SRAP markers in our map, 77 had
also been included in an ultradense B. napus map constructed
by Sun et al. (2007) (in press). Thus, it was possible to align
both maps, conWrming our previous assignment of our link-
age groups to the N11 through N19 standardized groups.
Based on the physical assignment of the linkage groups
in the map developed by Sebastian et al. (2000) and Howell
et al. (2002), our linkage groups BoLG1–BoLG9 are analo-
gous to their linkage groups, which corresponds to the C
genome chromosomes 8, 5, 1, 2, 6, 9, 4, 7 and 3, respec-
tively (Fig. 1).
Alignment of B. oleracea linkage groups
and the Arabidopsis thaliana physical map
Our map was compared to the Arabidopsis physical map
with 11 gene sequences, three BAC-end sequences, and
123
282 Theor Appl Genet (2007) 115:277–287

Fig. 1 Linkage groups LG1– BoLG1(C8) BoLG2(C5) BoLG3(C1)

LG9 for the B. oleracea map and
0 M489
their correspondence to the C ge- 9 M68 0 B40L6
14 M427 2 OL11G11a
nome chromosomes (C1–C9). 15 M670 3 M940
21 S248 5 M167
cM are shown on the left side. -12 T30
22 M114 6 S112BoCAL
-8 M483 M711 7 M863 M523
Bars on the right indicate -6 T143 23 M305 M569 M962 M338
-1 T121 M538 10 M462
homologous segments to chro- 0 T222 24 M313 13 T80 M1078
25 T6 BoELONG 14 M666 M996
mosomes 1–5 of A. thaliana 2 T229 3 26 T230 M467 DM1 5 15 M612 T79
3 S245 M1000
4 M1053 28 M290 M964 16 M987 M440
29 T218 17 M439 M575
5 S137 30 M1067 M596 S147 1
7 T233 M527 18 M582
31 S67 S169
8 T228 M309 M96 19 M1019
9 T95 M89 32 M393 M416 M749
12 S29 20 M721 M493
33 M864 M44 OL11B5b
14 M604 M968 M561
16 M203 21 M461 M748
34 S175 M346 M472
17 M283 S260 T187 S37 22 M259
18 S51 S46 S116 23 M689 M543
35
19 M1065 M678 T42 M933 24 M896 M875
M51 S66 T212 25 M747 S61
20 S158 36 M264 M549 M746
M186 M256 M1070 26 M946 T82
21 M208 S259 M183 27 M188 M377
M336 M329 28 M1034 M90
22 M823 M165 30 M1021 T53
M180 37 M4 M159 34 M328 M12
M149 M674 M761 M904 M11 M466
23 M927 M880 S162 M514 35 M1071
24 M299 S77 M901 M248 36 T177 OL10A5a
25 M844 S178 M955 M448 37 M395
26 OL12F11 M162 M1023 38 M185 M726
38 M824 M811 1 M498
27 M1074 M913 M1032 M998 39 M77
M275 M6 M509 M160 40 M184
28 M502 M688 M122 M548 41 M854
29 M229 T217 M984 42 M414
S26 M91 M760 M559 43 M648 M526
30 M943 M445
39 T216 M520 44 S14 BoS-GT
31 M986 M692 M406 M859 46 M1076 M109 2
M588 M978 47 OL11G11b
32 M403 M784 M387 M768 T44 T45
T14 M547 40 M454 50 T46
M119 M693 M481 M27 53 M908 M70
M617 M1029 41 M351 Ol9A6 54 OL11B5a
33 M1045 M153 M253 M792 55 M534 4
42 S179 M98 56 T54
M741
M340 M802 57 M232
M321 M644 58 M345 M865
M563 M147 43 M932 M1066 M72 M233
34 M935 M517 M312
59 M533 M389
M911 44 S181 M907 M659 M170
M374 M379 M787 M219 S106
M463 M347 45 M960 M7 T196 M129
35 M869 M950 M902 M433 60 M148 M515
46
M608 M1068 1 M230 M173 5
47 T107 61 M166 M128
M404 M93 M990 S200 M920
36 M293 M794 48 S194 S173 S96 M664
M645 62 S108
49 M484 S99
37 T238 M813 50 M460 63 T2 M108
M589 64 S98
51 M625 S97 M342 T175
38 S114 S113 52 T169 T74
M738 65 M945 M47
S237 T195 M320
S13 S73 53 T158 M642
39 66 M178 M675
T104 T76 54 T180 M117 M386
40 M470 M511 55 M912 M601 S221 M318
S70 S227 67
56 T179 M231 M397
41 S149 M31 57 M53 M268 M597
M635 59 T114 M202 68 M1061 M853
M1020 LS107
42 S203 60
61
T13
M494 69 M546 M118 1
43 S55 M1011 4 M61
M641 M930 62 M497 S130 M464 S228
M729 M501 65 T139 70 M327 M94
45 NGA248 67 T51 71 M676 ORA21
46 M29 68 S182 72 S140 S242
47 S229 70 M552 73 T92 M103
48 T184 73 M850 T71 74 T134 M86
76 M456 75 T100 M315
50 S103 77 M143
57 S21 77 T219
78 T213 78 M131 M742
60 T4 80 T126 OL13C12 M882
79 M101
81 T55
82 S15 80 T209
81 M658
83 T149 T77 82 T226
T59 83 M211 M570
84 M709 84 M107
86 M270 85 M1075
88 M903 88 M116
89 M898
93 S132

155 cDNA markers. As expected , the alignment between
the B. oleracea linkage groups and chromosomes of A. tha-
liana (Fig. 1) fully agrees with that reported by Li et al.
(2003). However, there was only partial agreement with the
alignment reported for the C genome chromosomes of B.
napus and A. thaliana chromosomes by Parkin et al.
(2005). Lack of total agreement between the two reports is
not unexpected considering that none of the two maps are
complete.
QTL mapping of curd phenotype
The frequency distribution for inXorescence type, charac-
terized as broccoli-like versus exhibiting curd formation in

123
Theor Appl Genet (2007) 115:277–287 283

Fig. 1 continued BoLG4(C2) BoLG5(C6) BoLG6(C9)

0 BoCYP79F1 -7 S85 M65
0 M192 5 S133 0 T214
3 M81
5 M79 6 M42 1 M102
7 M152 7 M705 3 S148 S100
9 M593 10 M135 4 T105
11 M961 11 M765 M278 5 M703 S250
14 M594 13 M174 6 M937 M317
19 M458 14 S215 7 M124 M394
21 M391 M733 15 S62 8 M260 M95
26 T163
16 M519 9 S161 M449
27 M354 10 M238 S115
28 M352 17 M280 1 11 M874 S53
29 M753 18 S109 S218 12 M624 S230
30 M356 19 T144 M817 M513 M2
31 S252
T22e M702
5 20 M545 T81 13
M100
32 S249 M1059 M442
M572 21 M74 M785 14
33 T174 M485
34 M311 22 M897 M164 M651 M958
35 M80 M226 S247 M816 15 S255 M737
M385
5
36 M353 23 T16 M381
37 M1009 M8 M187 M156 T215
38 S45
24 M438 BoPRO-a 16 M302 M163
39 T108 T110 M227 BoPRO-Lb M957 M281
M409 M989 M616
S47 M697
40 M623 25 M18 M1030
41 M1057 M991 M632 17
26 M602 S231 M1072 M579
42 T70 M856 M917
43 T245 M752 M685 18 M818
44 T211 M137 27
S104 M780 M921
45 M482 M710 M441 M224
T145 S107 19 M436 M975
46 T161 M1037
28 M39 M113 M918 M421
M650 M121 20 M54 M830
M294 M566 M682 M17 S91 M324
47 T239 M707 M37 21 M175 M558
M138 M815 M382 M639 M665
48 M66 M1033 S86 M535 M274 M52
M64 S254 29 22
T50 M465
3 M771 M663 M819
M583 M899 M668 M841
49 M584 S68 23 M298 T136
M222 S207 M565 M942
M959 M977 10A5b
M243
M424 M450 M1003 M297 24 M524 M348
50 M1022 M963 M873 M587 S50
T24 30 S209 M212 25 M1031 T106
M557 M540 26 M92
M599 OL13D2 M308 M10 27 S92 T236
S168 M636 28 M151 M291 2
M171 M503 31
51 M893 M408 M954 M316 29 M375
M411 M398 M744 OL12F2 30 M622 M611
OL10F12 OL11H8 32
M885 M564 M1004 S150
M516 S156 T111 31 M800 BoCS-LYASE
M881 M910 M310 M679 M126
M598 M115 S102 M223
52 M83 M1005 M590 M537
M432 M866 M953 M479 32 M288 10H7
33 M262
M99 S20 M330 M19
M799 M16 M368 M637 33 M263 M662
M1054 M605 M731 M36 M919
53 M586 M279 M132 M457 34 M78
M20 M5 M429 M671
M104 M210 M234 M541
T90 34 M334 M35 35
M179 S75 T67 M161
T132 M105 M506 M577 M437
54 35
M1044 M401 T170 M580 M197
S17 S183 S258 5 36 M237 M603
M474 M423 36 S164 S157
M833 M528 37 M366
S111 T172 M745
55 M619 M402
37 M213 S226 38 M793
M190 M1016
M431 M900 38 M988 39 M475
M125 M895 39 M434 M981 40 T221
56 M687 M169 40 S110 41 M204
T176 M499 41 S87 T190 42 T8 MB4
57 M28 M727 42 M654 43 M621
M821 M287 43 M567 45 T22
58 M469 M938 47 M739
M782 45 M803
47 M916 M944 49 M196 Bo A P 1 1
M838 M872 50 M609 M661
59 M894 M704 49 M1043
52 T214b
M924 S72 50 M218 M46 54 T168
60 M372 M606 52 T155
M71 55 M1064
T232 M172
53 S166 4 57 T127
61 M613 54 M1041 59 T130
M790 S246 58 M45 61 M154 T151
62 M888 1 59 S167 62 T73
63 M795 M9 66 M581 64 M952 T78
64 M887 S211 72 M245 68 M84
65 M939 T153 78 M683
67 M34
68 T197
72
73
T31
M1015
2
74 T164
80 M428

the mapping populations is shown in Fig. 3. Although in Discussion

general it followed a bell-shaped curve, it was skewed
toward the broccoli phenotype. Three chromosomal regions
for curd formation were detected in this population by sta-
tistically signiWcant QTLs. Two QTLs in BoLG1 explained
21 and 6% of the variation, respectively. These two were
17 cM apart with non-overlapping conWdence intervals.
The third QTL was on BoLG6 associated with BoAP1-a
and explained 15% variation. No QTLs were detected in
the linkage group regions containing the BoCAL-a and
BoGSL-ELONG genes (Table 4).
The number of markers, linkage group coverage and den-
sity reported in our map and its alignment to the B. olera-
cea maps of Sebastian et al. (2000) and Howell et al.
(2002), and to the B. napus maps of Lowe et al. (2004),
Piquemal et al. (2005), Parkin et al. (2003, 2005), Qiu et al.
(2006) and Sun et al. (2007) (in press) add a signiWcant
number of markers to the C genome useful for marker
assisted selection and map-based cloning in both species. Basi-
cally, we have added 1,257 markers to the B. oleracea maps

123
284 Theor Appl Genet (2007) 115:277–287

Fig. 1 continued BoLG7(C4) BoLG8(C7) BoLG9(C3)

-5 T231
0 M773 0 T10 -1 M221 M1060
2 M1001 M871 3 T119 0 M1048 S56
8 T33 1 M254 M407
5
4 M686
19 M350 10 T9 T152 1 2 M825 M214
24 S143 12 T133 M459
30 S153 13 T87 T36 3 M201 M295
14 T61 T56 4 S142 S180
32 S205 M217 S256
35 T112 T116 15 T18 5
17 T91 S146
38 S144 3 S213 M858
39 M257 18 T47 6 M332
43 T225 23 M236 M518 T140
45 M419 M855 27 M478 7
T69 M860
46 S219 31 M539 M383 M521 M672
33 T237 8
47 M1035 M198
49 M444 35 M488 M490 M971 M177
9
51 M845 37 M965 M251 S54
52 M239 38 M764 2 M508 S32
53 M359 39 M1056 10 M620 T23
55 S136 M839 40 S225 M630
41 S186 11 M63 S172
56 S155 M314 M339
57 M150 42 M829 12
T160 M412
58 M556 M199 43 M157 M852 M914
61 M376 44 12D5 M840 13 M769
63 M133 45 M491 T204 M265 S74
64 S196 47 T193 14 M929 T173
65 M826 T38 S90 M861 S214 M878
48 M370 M26
M1014 S204 T188 T192
66 49 M50 M48 S52 M106
T49
67 M282 M296 M592 15 S134 M734
50 M191 M843 M892 M655
M905 S24
68 T5 M145 S48 M14
51 S44
OL10A5c M576
69 M341 M443 M306
M883 M969 52 M842 M554 S223
70 M244 M595 M144
53 M1042 M399
M1038 T154 M983 M805 16 M941 M477 1
71 55 M194
S216 S40 T182 T178
M49 M300 3 56 M1062 M32 M926 M578
72 M200 M447 M653 M1069
57 M343 M446
M714 T185 M426 M30 M786 M684
M289 M544 58 S224 T243
M322 M553
73 M732 M357 59 S58 S43 17 T103 M76
M365 M877 60 M195 M837 M396
M1018 T208 M1 M344 M1028 M822
61 M325 M261
M510 M607 M373 S64 M507
M970 M69 62 12G4 18 M879 M777
M453 M181 63 M176 M591 M972
M949 M1036 64 M285 M1063 19 M266 M615
M763 M415 65 S88 S222 OL12A4
M680 M708 S95 M555 20 M647
74 M241 M550 66 T44b T89
S212
M574 S232 67 T241 21 M801 M335
M361 S185 68 T96 T117 M141
S257 M430 M405 M246 22 M38 M706
M333 M512 70 M371 M890
M110
M857 M715 M487
71 M250 3 23 M331
M413 M867 72 S251 OL13C3 M1008
75 M638 M452 M225 S27 24
73 M851
M486 M155 M139 M349 M142
M33 M628 74 M410 S118 25
M1049
OL10H4 M417 S76 M568 26 M995 M97
76 M400 S189 75 T85 M25 27 M88 S131
M146 M646 M390 M130 28 T142
M388 M1050 M610 30 M267
M258 M435 M337 M762 31 T199 M979
M667 M730 76 S239
M277 M505 32 T210
M948 M849 M220 M831
77 T65 T68 34 OL11H6
M551 38 S170
M814 M634 M827 M480 41 S202
M1027 S145 77 M562 M985 42 S36
M304 S94 M696 44 M215
78 M471 M476 M756 S18 46 M757 5
M808 M720 78 S39 M759 48 M1052
M492 M252 M836 M1012 50 M758
79 M724 M496 S154 S129 51 M657 Bo G S - O H
M193 M60 79 S31 M751
S152 53
M828 M140 80 M228 S71 M627
80 1 54 M136
M915 81 S192 M909
81 M891 55 M292
82 S119 57 BoALK M656
S138 M1025 83 M85
82 M1007 M242 58 S163 M755
84 M276 61 M754
83 M3 M40 85 T26 64 M631
S19 86 M73 70 S199
84 S123 M560 87 T135
S12 88 S197
85 S42 89 T93
88 B59A4 90 S188
90 M182 91 S198
91 M43 93 M235
92 M1006

(Table 3). The level of polymorphism of genomic SRAP
markers between broccoli and cauliXower is high, so simi-
lar levels are expected between other more divergent Bras-
sica crops, such as broccoli and kale (Li and Quiros 2001).
Although most of these markers are dominant, they could
be quite eYcient for marker-assisted selection when associ-
ated in repulsion phase to genes targeted for selection
(Haley et al. 1994). Regarding the usefulness of a high-
marker density map for map-based-cloning, it can be esti-
mated based on genome size and map length, that 1 cM
corresponds to approximately 800 Kb in B. oleracea. How-
ever, this value must be taken conservatively considering
the variation in density along the chromosomes. An exam-
ple of this is the positional cloning of gene BoGSL-ALK

123
Theor Appl Genet (2007) 115:277–287 285

0.8 3 cM Broccoli
Cauliflower
GSL-ELONG Dm1 OPM-16
120
18kb 35kb

Number of lines
100

At5g23020 At5g23400 MOP9 (BAC) 80

GSL-ELONG Putative Dis.Resist. (OPM-16) 60

Fig. 2 Maps for BoGSL-ELONG and BoDM1. Top, genetic map; bot-
tom, physical map.OPM-750 is RAPD marker reported by Giovannelli
et al. (2002)
tagged with a marker at 1.4 cM, but at a physical distance
of less than 100 Kb (Li and Quiros 2003).
Further, anchoring this map to the A. thaliana physical
map is an important asset because the latter could serve as a
useful source of additional markers to saturate speciWc seg-
ments carrying a gene(s) of interest in B. oleracea. Discrep-
ancies of alignment between the C genome chromosomes
of B. oleracea and B. napus might reXect chromosomal
structural changes during alloploidization and stabilization
of B. napus (Song et al. 1995).
Several linkages described in this paper are of particular
interest. For the downy mildew resistance gene BoDM1, we
populated the BoLG 2 region with three markers including
the gene BoGSL-ELONG. Some of these markers should
prove more useful than others previously described (Gio-
vannelli et al. 2002) for marker-assisted selection to
develop cotyledon stage downy mildew resistance. Another
interesting linkage on BoLG9 was for the AOP gene family
members BoGSL-ALK and BoGSL-OH. These genes act
sequentially in the side chain modiWcation of aliphatic gluc-
osinolates, the Wrst directing desaturation to produce alke-
nyl glucosinolates and the second one their subsequent
40
20
0
1 2 3
phenotype
Fig. 3 Histogram showing phenotype distribution for inXorescence
type in F2 mapping population. (phenotype 1 = broccoli; phenotype
2 = intermediate; phenotype 3 = cauliXower)
hydroxylation (Li and Quiros 2003). In A. thaliana, there
are three AOP genes in triplicate, GS-OH (AOP3), GS-ALK
(AOP2) and AOP1 (unknown function) (Gao et al. 2004).
Similar to A. thaliana, in B. oleracea, BoGSL-ALK and
BoAOP1 are next to each other, but both are duplicated in
tandem and the sequence corresponding to the gene GS-OH
is absent (Gao et al. 2004). Evidently in B. oleracea,
although genes BoGSL-OH and BoGSL-ALK lay on the
same chromosome they are not contiguous as in A. thali-
ana. Another conserved linkage is between the MAM gene
family members BoGSL-PROa and its duplicate BoGSL-
PROb involved in the synthesis of 3 carbon side chain gluc-
osinolates (Gao et al. 2006). These are homologs of the
same Arabidopsis gene (At1 g18500) located at the top of
chromosome 1.
Among the glucosinolate pathway genes that we
mapped, BoGSL-ALK, BoGSL-ELONG and BoGSL-PRO

Table 3 Marker statistics for B. oleracea map and number of aligned markers with other genetic maps
General information Aligned markers

Linkage SRAP(M,S) CDNA SSR Markers for Total An integrated Total Aligned Aligned Total
group marker(T) genes and BACs mapa SSRb SRAPc

BoLG1 101 15 2 0 118 46 164 2 4 6

BoLG2 114 26 1 2 143 74 217 1 5 6
BoLG3 127 17 7 3 154 101 255 5 16 21
BoLG4 130 21 4 0 155 56 211 4 12 16
BoLG5 119 7 1 3 130 64 194 1 20 21
BoLG6 111 18 3 2 134 42 176 2 1 3
BoLG7 129 11 2 2 144 55 199 2 5 7
BoLG8 106 23 2 0 131 47 178 2 4 6
BoLG9 125 17 4 2 148 64 212 3 10 13
Total 1062 155 26 14 1257 549 1806 22 77 99
a
Markers in B. oleracea map http://www.brassica.bbsrc.ac.uk/, based on Sebastian et al. (2000)
b
To B. napus maps of Lowe et al. (2004); Piquemal et al. (2005) and Qiu et al. (2006)
c
To B. napus map of Sun et al. (2007) (in press)

123
286
Table 4 Chromosomal location of segments involved in curd devel-
opment detected by QTL analysis
Linkage Distance ConWdence Linked LOD Variation
group interval marker (%)
QTL-1 LG1 21.36 cM 15–26 cM M688 10.98 21
QTL-2 LG1 38.61 cM 35– 43 cM S203 4.32 6
QTL-3 LG6 57.19 cM 54–62 cM BoAP1 5.30 15
have been previously cloned and their function assessed
(Gao et al. 2003, 2004, 2006; Li and Quiros 2002, 2003).
For the rest of the genes, we only mapped their sequences.
Although there were enough diVerences in their sequences
in both parental plants for each of these genes to follow
their segregation in the progeny, we could not follow segre-
gation for their glucosinolate phenotype. This was due to
the fact that the phenotypes of these genes are based more
on glucosinolate amount and not quality, and the broccoli
and cauliXower parents of our population have similar
amounts for most of the glucosinolates controlled by these
genes. The only exception was for gene BoGSL-OH, whose
phenotype is presence/absence of the glucosinolate progoi-
trin. As expected, a major QTL for the presence of this
glucosinolate was found in the map location for gene
BoGSL-OH on LG 9 (data not shown). In any case, the
sequences and Xanking markers of the genes that could not
be associated with speciWc glucosinolate segregation in our
mapping population could be used in other populations,
segregating for glucosinolate amount and composition.
Application of marker-assisted selection in these popula-
tions will be helpful for the development of plants with spe-
ciWc glucosinolate proWles and content.
Although the intention of this paper was not to perform
an exhaustive QTL analysis for curd formation, as was
reported by Lan and Paterson (2000), we took advantage of
the fact that we used two double haploid plants as the par-
ents of the mapping population to do a general analysis to
compare with the results from previous studies. Our pheno-
typic analysis involved only visual scoring for inXores-
cence type and did not include detailed measurements as
done by Lan and Paterson (2000). The three chromosome
segments detected by QTL analysis in our population
explain 42% of the total phenotypic variation for inXores-
cence type. Two of these segments were on LG1, approxi-
mately 17 cM apart, but their conWdence intervals did not
overlap, thus indicating their independence. The other seg-
ment was on LG6. Only the latter fell on a major gene pre-
dicted to be involved in curd formation in cauliXower,
BoAP-a1 (Smith and King 2000; Purugganan et al. 2000).
The peak of this QTL is located at 57.19 cM and the BoAP1
sequence is located at 56.8 cM on LG6, which is in agree-
ment with previous reports indicating that this gene plays a
123
Theor Appl Genet (2007) 115:277–287
role in inXorescence architecture. We did not Wnd any asso-
ciation with the BoCAL-a sequence, which is another pre-
dicted gene of similar function (Smith and King 2000;
Purugganan et al. 2000). Thus, our results agree with those
of Labate et al. (2006), who found that the BoCAL-a gene
actually provides very little contribution to the cauliXower
phenotype. Additionally, Lan and Paterson (2000) detected
at least 67 loci, distinguishing broccoli from cauliXower in
a much more exhaustive analysis, including not only of
curd morphology, but also of size, shape and other related
traits. Thus, it is clear from Lan and Paterson (2000),
Labate et al. (2006) and from our study that additional
genes must be involved in curd development.
Acknowledgments We are indebted to Mr. Vincent D’Antonio and
to Mrs. Fengliang Huang for their technical assistance. The project was
supported by the National Research Initiative of the USDA Coopera-
tive State Research, Education and Extension Service, grant number
CFQ # 2005-35301-15886, “Cloning and characterization of the major
genes involved in the aliphatic glucosinolate pathway of Brassica
crops”.
References
Arus P, Orton T (1983) Inheritance and linkage relationships of iso-
zyme loci in Brassica oleracea. J Hered 74:405–412
Babula D, Kaczmarek M, Barakat A, Delseney M, Quiros CF, Sadow-
ski J (2003) Chromosomal mapping of Brassica oleracea based
on ESTs from Arabidopsis thaliana: complexity of the compara-
tive map. Mol Genet Genomics 268:656–665
Bohuon EJR, Keith DJ, Parkin IAP, Sharpe AG, Lagercrantz U, Lydi-
ate DJ (1996) Comparative genome of Brassica oleracea and
Brassica napus. Theor Appl Genet 93:833–839
Gao M, Li GY, Yang B, McCombie WR, Quiros CF (2004) Compara-
tive analysis of a Brassica BAC clone containing several major
aliphatic glucosinolate genes with its corresponding Arabidopsis
sequence. Genome 47:666–679
Gao M, Li G, McCombie W R, Quiros CF (2005) Comparative analy-
sis of a transposon-rich Brassica oleracea BAC clone with its cor-
responding sequence in A. thaliana. Theor Appl Genet 111:949–
955
Gao M, Li G, Potter D, McCombie W R, Quiros CF (2006) Compara-
tive analysis of methylthioalkylmalate synthase (MAM) gene
family and Xanking DNA sequences in Brassica oleracea and A.
thaliana. Plant Cell Rep 25:592–598
Giovannelli JL, Farnham MW, Wang M (2002) Development of se-
quence characterized ampliWed region markers linked to downy
mildew resistance in broccoli. J Am Soc Hortic Sci 127:597–601
Haley SD, Afanador L , Kelly JD (1994) Selection for monogenic pest
resistance traits with coupling- and repulsion-phase RAPD mark-
ers. Crop Sci 34:1061–1066
Heneen WK, Jorgensen RB (2001) Cytology, RAPD, and seed colour
of progeny plants from Brassica rapa-alboglabra aneuploids and
development of monosomic addition lines. Genome 44:1007–
1021
Howell EC, Barker GC, Jones GH, Kearsey MJ, King GJ (2002) Inte-
gration of the cytogenetic and genetic linkage maps of Brassica
oleracea. Genetics 161:1225–1234
Hu J, Quiros CF (1991) IdentiWcation of broccoli and cauliXower cul-
tivars with RAPD markers. Plant Cell Rep 10:505–511
Theor Appl Genet (2007) 115:277–287
Kowalski SP, Lan TH, Feldmann KA, Paterson AH (1994) Compara-
tive mapping of Arabidopsis thaliana and Brassica oleracea chro-
mosomes reveals islands of conserved organization. Genetics
138:499–510
Labate JA, Robertson LD, Baldo AM (2006) InXorescence identity
gene alleles are poor predictors of inXorescence type in broccoli
and cauliXower. J Am Soc Hortic Sci
Lan TH, Del Monte TA, Reischmann KP, Hyman J, Kowalski S,
McFerson J, Kresovich S, Paterson AH (2000) An EST-enriched
comparative map of Brassica oleracea and Arabidopsis thaliana.
Genome Res 10:776–788
Lan TH, Paterson AH (2000) Comparative mapping of quantitative
trait loci sculpting the curd of Brassica oleracea. Genetics
155:1927
Li G, Quiros CF (2001). Sequence-related ampliWed polymorphism
(SRAP), a new marker system based on a simple PCR reaction: its
application to mapping and gene tagging in Brassica. Theor Appl
Genet 103:455–461
Li G, Quiros CF (2002) Genetic analysis, expression and molecular
characterization of BoGSL-ELONG, a major gene involved in the
aliphatic glucosinolate pathway of Brassica species. Genetics
162:1937–1943
Li G, Gao M, Yang B Quiros CF (2003) Gene to gene alignment be-
tween the Brassica and Arabidopsis genomes by transcriptional
mapping. Theor Appl Genet 107:168–180
Li G, Quiros CF (2003) In planta side-chain glucosinolate modiWca-
tion in Arabidopsis by introduction of dioxygenase Brassica
homolog BoGSL-ALK. Theor Appl Genet 106:1116–1121
Lowe AJ, Moule C, Trick M, Edwards KJ (2004) EYcient large-scale
development of microsatellites for marker and mapping applica-
tions in Brassica crop species. Theor Appl Genet 108:1103–1112
Parkin IAP, Gulden SM, Sharpe AG, Lukens L, Trick M, Osborn T,
Lydiate DJ (2005) Segmental structure of the Brassica napus ge-
nome based on comparative analysis with Arabidopsis thaliana.
Genetics 171:765–781
Parkin IAP, Sharpe AG, Lydiate DJ (2003) Patterns of genome dupli-
cation within the Brassica napus genome. Genome 46:291–303
287
Piquemal J, Cinquin E, Couton F, et al. (2005) Construction of an oil-
seed rape (Brassica napus L.) genetic map with SSR markers.
Theor Appl Genet 111:1514–1523
Purugganan MD, Boyles AL, Suddith JI (2000) Variation and selection
at the cauliXower Xoral homeotic gene accompanying the evolu-
tion of domesticated Brassica oleracea. Genetics. 155:855–862
Qiu D, Morgan C, Shi J, Long Y, Liu J, Li R, Zhuang X, Wang Y, Tan
X, Dietrich E, Weihmann T, Everett C, Vanstraelen S, Beckett P,
Fraser F, Trick M, Barnes S, Wilmer J, Schmidt R, Li J, Li D,
Meng J, Bancroft I (2006) A comparative linkage map of oilseed
rape and its use for QTL analysis of seed oil and erucic acid con-
tent. Theor Appl Genet 114:67–80
Quiros CF (2000) DNA-based marker maps of Brassica. In: Phillips
RL, Vasil JK (eds) DNA-Based markers in Plants. Kluwer,
Dordrecht
Quiros CF, Paterson AH (2004) Genome mapping and analysis in
Brassica. In: Pua EC, Douglas CJ (eds) Biotechnology in Agricul-
ture and Forestry 54:31–42
Sebastian RL, Howell EC, King GK, Marshall DF, Kearsey MJ (2000)
An integrated AFLP and RFLP Brassica oleracea linkage map
from two morphologically distinct double haploid mapping pop-
ulations. Theor Appl Genet 100:75–81
Smith LB, King GJ (2000) The distribution of BoCAL-a alleles in
Brassica oleracea is consistent with a genetic model for curd
development and domestication of the cauliXower. Mol Plant
Breed 6:603–613
Song K, Lu P, Tang K, Osborn TC (1995). Rapid genome change in
synthetic polyploids of Brassica and its implications for polyploid
evolution. Proc Natl Acad Sci USA 92:7719–7723
Sun Z, Wang Z, Tu J, Rahman M, Zhang J, Yu F, McVetty PBE, Li G
(2007) An ultradense genetic recombination map for Brassica na-
pus, consisting of 13335 SRAP markers Theor Appl Genet (in
press)
Zeng ZB (1994) Precision mapping of quantitative trait loci. Genetics
136:1457–1468
123