689

Isolation and mapping of microsatellite markers specific for the D genome of bread wheat
E. Pestsova, M.W. Ganal, and M.S. Röder

Abstract: The potential of Aegilops tauschii, the diploid progenitor of the D genome of wheat, as a source of microsatellite markers for hexaploid bread wheat was investigated. By screening lambda phage and plasmid libraries of Ae. tauschii genomic DNA, dinucleotide microsatellites containing GA and GT motifs were isolated and a total of 65 functional microsatellite markers were developed. All primer pairs that were functional in Ae. tauschii amplified well in hexaploid wheat. Fifty-five loci amplified by 48 primer sets were placed onto a genetic framework map of the reference population of the International Triticeae Mapping Initiative (ITMI) ‘Opata 85’ × ‘W7984’. The majority of microsatellite markers could be assigned to the chromosomes of the D genome of wheat. The distribution of the markers along the chromosomes is random. Chromosomal location of 22 loci nonpolymorphic in the reference population was determined using nullitetrasomic lines of Triticum aestivum ‘Chinese Spring’. The results of this study demonstrate the value of microsatellite markers isolated from Ae. tauschii for the study of bread wheat. The microsatellite markers developed improve the existing wheat microsatellite map and can be used in a wide range of genetic studies and breeding programs. Key words: Aegilops tauschii, wheat, molecular markers, genetic map, simple sequence repeats. Résumé : Le potentiel de l’Aegilops tauschii, l’espèce donatrice du génome D du blé, en tant que source de marqueurs microsatellites pour le blé hexaploïde a été étudié. En criblant des banques génomiques (phages lambda et plasmides) de l’Ae. tauschii, des microsatellites dinucléotidiques GA et GT ont été isolés et 65 marqueurs microsatellites fonctionnels ont été développés. Toutes les paires d’amorces qui étaient fonctionnelles chez l’Ae. tauschii ont bien amplifié chez le blé hexaploïde. Cinquante-cinq locus amplifiés à l’aide de 48 paires d’amorces ont été placés sur une carte génétique issue de la population de référence de l’ITMI (« International Triticeae Mapping Initiative »), ‘Opata 85’ × ‘W7984’. La majorité des microsatellites pouvaient être assignés au chromosomes du génome D du blé. La distribution des marqueurs au long des chromosomes était aléatoire. L’emplacement chromosomique des 22 locus monomorphes au sein de la population de référence a été déterminé à l’aide de lignées nulli-tétrasomiques de Triticum aestivum ‘Chinese Spring’. Les résultats de cette étude montrent l’intérêt chez le blé des microsatellites isolés de l’Ae. tauschii. Les microsatellites développés contribuent à améliorer la carte existante du blé et peuvent être employés pour une vaste gamme d’études génétiques et en sélection. Mots clés : Aegilops tauschii, blé, marqueurs moléculaires, carte génétique, répétitions de séquences simples. [Traduit par la Rédaction] Pestsova et al. 697

Introduction
Microsatellites or simple sequence repeats (SSR) are tandem repeats of 2–4 nucleotides. They are frequent and almost randomly distributed in most eukaryotic genomes. This makes them desirable markers for genetic mapping. Molecular markers based on microsatellite sequences detect extra high levels of polymorphism and can be easily assayed by PCR (polymerase chain reaction). A highly saturated microsatellite map published for human consists of about 8000
Corresponding Editor: G.J. Scoles. Received January 4, 2000. Accepted May 23, 2000. Published on the NRC Research Press web site on July 20, 2000. E. Pestsova,1 M.W. Ganal, and M.S. Röder. Institut für Pflanzengenetik und Kulturpflanzenforschung (IPK), Corrensstraße 3, 06466 Gatersleben, Germany.
1

Author to whom all correspondence should be addressed (e-mail: pestsova@ipk-gatersleben.de).

such markers (Weissenbach 1998). In recent years, microsatellite markers were integrated into the existing molecular maps of Arabidopsis (Bell and Ecker 1994), tomato (Areshchenkova and Ganal 1999), rice (Cho et al. 1998), maize (Taramino and Tingey 1996), barley (Liu et al. 1996), wheat (Röder et al. 1998), and other plants. The high-density microsatellite map of bread wheat (Triticum aestivum L. em Thell.) constructed in our laboratory consists of more than 279 markers (Röder et al. 1998). These microsatellites have been successfully used for the study of genetic diversity (Plaschke et al. 1995; Fahima et al. 1998), testing of authenticity of genetic stocks (Korzun et al. 1997; Peil et al. 1998; Pestsova et al. 2000a), and gene mapping (Korzun et al. 1998; Peng et al. 1999; Salina et al. 2000). Bread wheat is allohexaploid (2n = 42, AABBDD) and consists of three different genomes A, B, and D. Common wheat is a product of hybridization between the tetraploid wheat T. turgidum L. (2n = 28, AABB) and diploid grass Aegilops tauschii Coss. (2n = 14, DD) (Kihara 1944;
© 2000 NRC Canada

Genome 43: 689–697 (2000)

Type of library Clones containing (GA)n and (GT)n based on hybridization useful in the primer pair design microsatellite too short or no microsatellite microsatellite too close to the cloning site repetitive DNA close to microsatellite Total a T. 1.690 Table 1. (1998). Molecular linkage map of the D genome of wheat.5 are marked by an asterisk. The microsatellite loci are indicated in bold and designated Xgdm (Gatersleben D-genome Microsatellite). Fig. Efficiency of primer design with different libraries. 43. aestivum phage librarya 54% 36% 4% 6% 100% Ae. © 2000 NRC Canada . Efficiency of phage and plasmid libraries for the isolation of D-genome microsatellites. Microsatellite markers placed with LOD < 2. functional primer pairs 16 49 65 Genome Vol. Short arms of chromosomes are at the top. 2000 Percent of functional primer pairs 31 50 44 Table 2. tauschii plasmid library 51% 18% 24% 7% 100% Röder et al. The centromeres are indicated in black. Type of library Lambda–phage library Plasmid library Total No. tested primer pairs 51 98 149 No.

The genome of Ae. No.Y. Ae. AE 473) and Ae.Pestsova et al. This reflects the amount of polymorphism found in the different genomes of the mapping population. tauschii and T. 1 (concluded). This population was derived from the cross of the Mexican wheat ‘Opata 85’ and the synthetic wheat ‘W7984’. (1992). tauschii. a high-density genetic linkage map composed of RFLP (restriction fragment length polymorphism) and AFLP (amplified fragment length polymorphism) markers was published for Ae. Sorrells. and seeds were kindly provided by M. 691 McFadden and Sears 1946). tauschii show complete pairing with the D-genome chromosomes of bread wheat (Gill and Raupp 1987). tauschii and T. Mapping was performed on 70 recombinant inbred lines from the International Triticeae Mapping Initiative (ITMI) population. Recently. DNA of Ae. (1995). obtained from a cross of Ae. 1999). tauschii (Boyko et al. and it was shown that 123 of the 157 markers shared between the Ae. The plant material was described in Van Deynze et al. tauschii was isolated from seedlings according to Anderson et al. N.). The highest number of microsatellite loci in the existing microsatellite map of wheat is on the B genome and the lowest is on the D genome. Cornell University (Ithaca. for microsatellite isolation. aestivum genetic maps were in colinear order. No. turgidum subsp. DNA of © 2000 NRC Canada . tauschii subsp. To enrich the D genome of bread wheat with microsatellite markers and improve the existing map we used the D-genome progenitor. Materials and methods Plant material and DNA isolation Aegilops tauschii subsp. AE 692) from the collection of the gene bank (IPK. durum ‘Altar 84’. tauschii (Acc. tauschii and the D genome of bread wheat are highly related and the chromosomes of Ae. strangulata (Acc. Fig. Gatersleben) were used as the source for microsatellite isolation.

(GT)14(CG)7 imp. 43. (AT)8(GT)28 imp. (GT)27 (CT)19 (GA)21 imp. (CA)24(TA)7 (CA)24(TA)7 (AT)8(GT)28 imp. tauschii (bp) 158 160 160 152 137 134 199 199 136 136 146 146 189 148 134 142 120 117 115 114 150 106 136 115 166 142 149 149 125 125 125 146 148 178 148 174 193 136 Fragment size in Opata (bp) 102 144 154 244 162 138 183 197 112 133 166 182 — 133 137 142 138 — 105 106 152 138 137 128 169 142 — — — — 217 151 164 — 141 179 199 — Fragment size in synthetic (bp) 104 — — 138 164 — 181 163 — 135 — — 214 — 130 — 136 111 124 111 157 109 139 146 171 — 110 140 109 134 215 153 — Genome Vol. (GT)28 imp. (CA)20 (CA)21 (CA)26 (GT)21 (CA)22 (GA)24 (CA)11 (CT)11 (GT)12 (CT)13 (CT)20 (GT)20 (TC)4TT(TC)14 (CT)25 imp. 2000 169 143 162 190 137 .Table 3. 692 Locus Xgdm3-5D Xgdm5-2A Xgdm5-2D Xgdm6-2D Xgdm8-3D Xgdm14-6D Xgdm19-1D Xgdm19-2D Xgdm28-6A Xgdm28-1B Xgdm33-1D Xgdm33-1A Xgdm35-2D Xgdm36-6D Xgdm38-3D Xgdm43-5D Xgdm46-7D Xgdm60-1D Xgdm61-4D Xgdm62-3D Xgdm63-5D Xgdm67-7D Xgdm68-5D Xgdm72-3D Xgdm84-7D Xgdm86-7D Xgdm87-2B Xgdm87-2D Xgdm93-2D Xgdm93-2A Xgdm93-4B Xgdm98-6D Xgdm99-5D Xgdm107-2D Xgdm108-6D Xgdm109-5A Xgdm111-1D Xgdm113-6B © 2000 NRC Canada Left primer GTATCTCGGTGATGCAGCAA CTAGCCAGAAGGTTACTTTG CTAGCCAGAAGGTTACTTTG GATCAATCAAGCATGTGTGTGT TTCTCCAACGCACGTTAGC CAACGAGGTTGTCATGGATG GCGTTCGAGTGACTTCCAAT GCGTTCGAGTGACTTCCAAT ATCTGACTTCATGGTTTATAT ATCTGACTTCATGGTTTATAT GGCTCAATTCAACCGTTCTT GGCTCAATTCAACCGTTCTT CCTGCTCTGCCCTAGATACG ATGCAAAGGAATGGATTCAA CAAAATGAA GCATGAAGAGG GGTTGTCCTCTACTCCTCCT TGTGTTGGCCTTGTGGTG AGAAGGACCGTCGCGTC TTCTTTGCGTGTGTGCGT GAAAGCCGTCCACTGCC GCCCCCTATTCCATAGGAAT AAGCAAGGCACGTAAAGAGC GCCTGACCACTCCCATAAAA TGGTTTTCTCGAGCATTCAA GGGATGAATTGTGTGCTCG GGTCACCCTCTCCCATCC AATAATGTGGCAGACAGTCTTGG AATAATGTGGCAGACAGTCTTGG AAAAGCTGCTGGAGCATACA AAAAGCTGCTGGAGCATACA AAAAGCTGCTGGAGCATACA CCATCCATGAAATGGCG AGGTTGTCCACTGCCTGTTC AGCAACAAACGCGAGAGC AGGAGGTAAGAAGGACCATG GGTCCGCCTGACAGACC CACTCACCCCAAACCAAAGT ACCCATCTGATATTTTGGGG Right primer GTGTGATGTTTGAATACGCA CAACATTAACATTAACGCAC CAACATTAACATTAACGCAC GGATGCCATGCCAAAGTATT CCCAAATGATGGCAGCTACT GGTACACTAGCTGCCCTTGC ATTGACAGCAGATGGCAGTG ATTGACAGCAGATGGCAGTG TCAAGAATGAAGACATAGTT TCAAGAATGAAGACATAGTT TACGTTCTGGTGGCTGCTC TACGTTCTGGTGGCTGCTC ATGTGAATGTGATGCATGCA CAAATCCGCATCCAGAAAAT CAGCACATAGCTTTGGTCTT CTTAGCATGTGGTAAGCACA CTACCCAATGCATCCCCTTA ATGTTGGCCCTGAAGAAGAA CGCACTTTTTACTAGGGGTC GATCTTGAAGCACTCTTGGT CCTTTTGATGGTGCATAGGA CTCGAAGCGAACACAAAACA TCGGAAGGGGGACTATACAA TGCAACGATGAAGACCAGAA CGCACAATCTCTTCGTGAAA GGCGCTCCATTCAATCTG CCAAGCCCCAATCTCTCTCT CCAAGCCCCAATCTCTCTCT GGAGCATGGCTACATCCTTC GGAGCATGGCTACATCCTTC GGAGCATGGCTACATCCTTC GCCCTTCACTAGCCTTCATG ATGTCGTCCTCGTCTCATCC TGACACCCGGTTGTTGG CAGGAAGATGCCTGTCTTCC AAAGCTGCTCATCGTGGTG GATGCAATCGGGTCGTTAGT AAAATGCCCTTCCCAACC Tm (°C) 55 50 50 55 60 60 55 55 47 47 60 60 55 55 55 55 60 60 60 55 60 60 60 60 60 60 60 60 55 55 55 60 60 55 60 55 60 55 Repeat (GT)15 (GT)28 imp. Microsatellite primer sets and loci mapped in the ITMI population. (GT)4GCG(GT)15 (CT)17 (GT)14(CG)7 imp. (GA)16 (GA)16 (GA)16 (GT)21 (GA)15 (CA)9 (CA)11 (GC)5(TC)8(GC)8 (CA)13 (GA)9GG(GA)6 Fragment size in Ae.

was further digested with a second restriction enzyme MboI or Sau3A. 96.). tauschii while a plasmid library was prepared from DNA of Ae. Clones that gave a positive signal were selected and used for plasmid DNA isolation according to the plasmid mini protocol (Qiagen).. 0. DNA of Ae. (CA)29 (CA)13 (GT)17 imp. strangulata. © 2000 NRC Canada Xgdm114-2B Xgdm116-5D Xgdm118-5D Xgdm120-3B Xgdm125-4D Xgdm126-1D Xgdm127-6D Xgdm128-3D Xgdm129-4D Xgdm130-7D Xgdm132-6D Xgdm134-3A Xgdm138-5D Xgdm141-6D Xgdm150-7D Xgdm147-6B Xgdm153-5D Note: imp. 13.2 mM KH2PO4. The obtained libraries were stored at –70°C. 1% (w/w) bacto yeast extract. 0. (1998) using MAPMAKER v.2 (Pharmacia) by comparison with the internal size standards. (CT)44 imp.8 mM (NH4)2SO4. tauschii subsp.7 mM Na3-citrate.and single-copy DNA. Transformation mixture was plated onto 22 × 22 cm plates with LB (Luria broth) agar medium and incubated overnight at 37°C. Using the BioPick system (BioRobotics Ltd. Piscataway.4% (v/v) glycerol). (1995).J. 2. Genetic mapping at the ITMI population was carried out according to Röder et al. 6. and genetic mapping PCRs and gel electrophoresis were performed as described by Röder et al. Amersham). and the fragments were cloned either in the vector Lambda Zap Express (Stratagene) or the plasmid vector pUC18 BamH1 (Pharmacia Biotech). 1987). 693 the lines was extracted from whole seeds as described in Plaschke et al. (1998). The high-efficiency Escherichia coli XL2-Blue ultracompetent cells (Stratagene) were used for transformation according to the manufacturer’s instructions. 0. N. (GT)13 (CA)15 (CT)27 (CT)24 (GT)25 imp. PCR fragments in the range 70–300 bp were detected and analyzed. Plasmid clones were sequenced with M13 primers on automated laser fluorescence (ALF) sequencers (Pharmacia Biotech.5% (w/w) NaCl. U. tauschii was digested with the methylation-sensitive restriction enzyme PstI and electrophoretically fractionated in 1% agarose.). Fragments in the size of 1–3 kb were eluted from the gel using the Geneclean kit (Dianova). (1998). Lander). 1. Mapped microsatellite loci were designated Xgdm for Gatersleben D-genome Microsatellite.).9% (w/w) H2O) and 10× freezing medium HMFM (1× concentration: 36 mM K2HPO4.5 (provided by E.6% (w/w) bacto tryptone. (CA)22 151 122 127 149 185 186 110 120 112 144 216 188 140 116 242 234 141 121 143 142 189 184 116 120 90 143 101 211 — 117 — 250 — AGATAGCACGGGTGCGG CACAAACGACCCCTCTGG 60 (GA)10 155 154 PCR. . Further screening of the phage library was carried out as described by Röder et al. tauschii genome contained many clones with small size inserts (less than 200 bp). 4. which is enriched for undermethylated low. 147 124 — — 181 182 106 116 — 164 103 222 140 111 171 248 GCTGCAATGCAAGGTCTCTT CCAACACTTTGTTGGCCAG GCAAGTAGCTTTCCGTCACA GCAGGCGTGTTACTCCAAGT TCCATCATATCCGTAGCACA ACGGGGAAATTAAAACGACC TCACAGCAAACTCTGCGTG GAGCAGGCAGCAGCTAGC CCATCCAAGTACACCCGC ACCGCTCGGAGAAAATCC GGGATGAATTGTGTGCTCG CATGAGCCGATTCAGCG ATGGAGACCATGGACCAGAG ACTAGCCTGGCAGTTGATGC CAAACAAGGTGGGTTCACTG TATAGGCAAATTAATTAAGACG GATGTGGCTTTCTAAGGCAA CAGGATGCTCTGACAAGCAA GATGAATTGTGTGCTCGGG CCGAGGTGGATAGGAGGAAA CGTGGTTGATTTCAGGAGGT TGAGATGGAATCGACAGAAA ACAATTTGGCATGCTTCTCC TGCATCATCATCGGTCAAGT CGGAGGAGGAATGACGG AGGGGGGCAGAGGTAGG GTCGCATGCGACACATG CGCTTAAATTGAAGTACCGC GGCGGTGTTCCTATGCC CCGACCGGTTCACTTCC TTTTTGAGTTCAACGGAGAC ATCTTTATGTGAGTACACTGC 55 55 60 60 60 55 60 60 60 60 60 50 60 60 55 50 (AT)8(GT)26 (GA)13 (CA)17 imp. aestivum ‘Chinese Spring’ as previously described (Röder et al. The selected fraction of DNA. Sweden). imperfect. The fragment sizes were calculated using the computer program FRAGMENT MANAGER v. tauschii subsp. To increase the insert size.0 (Lander et al. Sequences flanking the microsatellite motifs were tested for homology to known wheat repetitive sequences and oligonucleotide primer pairs were designed using the computer program PRIMER v. a second size selection was performed and fragments in the size 250–1500 bp were chosen for the subsequent libraries construction. Microsatellite marker development A lambda-phage library was constructed from DNA of Ae. single colonies were transferred into 384-well microtiter plates containing 40 µL of the mixture 9:1 of growth medium 2YT (1. The filters were hybridized with the dinucleotide repeats poly(GA) and poly(GT) (Pharmacia. High-density filters for hybridization were prepared from the microtiter plates using the robotic gridding system BioGrid (BioRobotics Ltd.K. One filter contained the immobilized DNA from 18 432 clones spotted out of 48 microtiter plates. Initially.Pestsova et al. The location of nonpolymorphic loci was determined using the nullisomic–tetrasomic lines of T. plasmid libraries constructed from PstI–Sau3A and PstI–MboI fractions of the Ae. Each of the 384-well plates was replicated twice onto sterile LB-Amp-agar plates covered with 22-cm square nylon filter (Hybond N+..4 mM MgSO4. 1995). 1. fragment analysis. One primer was labelled with fluorescein for fragment analysis on an ALF sequencer. (CT)22 (GT)11 (GT)16 imp.

694 Table 4.. (GT)17 Fragment size in Ae. Locus Xgdm29-2D Xgdm34-4D Xgdm40-4D Xgdm64-3B Xgdm68-5A Xgdm68-5B Xgdm77-2D Xgdm86-2B Xgdm88-4A Xgdm101-5B Xgdm115-5B Xgdm115-5D Xgdm124-2B Xgdm133-4D Xgdm133-5B Xgdm136-5D Xgdm142-7D Xgdm145-4A Xgdm146-5B Xgdm148-2D Xgdm149-5B Xgdm152-7A Left primer CTAGTTGTGCTAGGCGCTCC GATCGGACTTTGTGGATGCT GACCTAAGGCTCGGTCACC CCCGCTAGTGTTTGTGTTTG GCCTGACCACTCCCATAAAA GCCTGACCACTCCCATAAAA GACACACAATAGCCAAAGCA GGTCACCCTCTCCCATCC TCCCACCTTTTTGCTGTAGA GTCTCCATGACAAGGAGGGA TTTCCATGTCCTATGCCCC TTTCCATGTCCTATGCCCC ACCCAATTACGGAGCCTTTT ACGATTCATAACACAGCGCA ACGATTCATAACACAGCGCA CTCATCCGGTGAGTGCATC TGTGCCATGGAACAGGG TGAAGGACAAATCCCTGCAT ATCCTGACGGCCACCAC GATTTGACCGTCTGAGGTCG TCTTTGGGTCGTATGCAGTG ATAACATGCACACAAATTTT Right primer CTGGCTGCTCCCTCCTC ATGGCTGTAGGTGGACCAAC GCAGGCATGGTACCCTTG GTCTCTTGCGTACACAGGCC TCGGAAGGGGGACTATACAA TCGGAAGGGGGACTATACAA TGATGTCGGCACTATTTTGG GGCGCTCCATTCAATCTG AAGGACAAATCCCTGCATGA TGAAACCTCAAAGGGAAAGA AAGGTAGTGACGAGGGCATG AAGGTAGTGACGAGGGCATG CATATCACGCGTTCACCG TGAGAACAATTTCACGGCTG TGAGAACAATTTCACGGCTG CCCGCATGTCTACATGAGAA TGAAGCGCCGATTAGGAG TCCCACCTTTTTGCTGTAGA CAAAGCCTGCGATACATCAA AACTAGTTCTGTGGCAAGCT TGCACGCCAACGTAAAATTA GCCAGTGCCAAGCTTGC Tm (°C) 60 55 60 60 60 60 55 60 60 55 60 60 60 60 60 55 60 55 60 60 60 55 Repeat (CA)14(TA)4 (GA)24 imp. 2000 © 2000 NRC Canada . Description of microsatellite primer sets and chromosomal locations assigned with the nullitetrasomic stocks of ‘Chinese Spring’ (CS). (TC)4TT(TC)14 (TC)4TT(TC)14 (GA)11 (CT)17 (TG)13 (CT)17 (CA)15 (CA)15 (GT)10(GA)32 (CA)21GAAA(GA)9 (CA)21GAAA(GA)9 (TC)32 (CA)11 (CA)13 (TC)17 (GT)16 (CA)31(CGCA)12 imp. (CT)15(CA)7 (GT)12 imp. 43. tauschii (bp) 87 221 124 146 136 136 135 142 125 223 120 120 185 150 150 139 193 127 153 103 186 250 Fragment size in CS (bp) 122 175 116 132 142 116 138 127 121 197 84 125 110 82 150 138 186 120 135 106 113 270 Note: imp. Genome Vol. imperfect.

or nothing. GA and GT motifs were adjacent or interrupted with AT and GC repeats. Forty-eight primer pairs (74% of functional primer pairs) detected polymorphisms between ‘Opata 85’ and synthetic wheat ‘W7984’. in 24% of the clones the microsatellite was too close to one of the cloning sites. 149 primer pairs were tested (Table 1). A molecular linkage map of the wheat D genome containing 42 microsatellite loci isolated from Ae. and the other loci mapped on the A and B genomes of wheat (Table 3). 1995c. The remaining primer pairs amplified either a smear. monomorphic fragments of the wrong size. and 44% of the clones harboured GT repeats. In spite of the fact that many clones from the plasmid library contain microsatellites close to the cloning site. Linkage group Xabc172a–Xcdo482 was moved from the end of the 3DS linkage group to the 3DL linkage group. but the majority of microsatellites were in the range of 10– 20 repeated units.5. A comparison of primer design efficiency between the phage library of wheat and the plasmid library of Ae. 42 loci amplified with 40 primer pairs mapped on the D genome of wheat. 695 Results Efficiency of different libraries It was shown earlier that the isolation of microsatellites from hypomethylated regions of the wheat genome increased the proportion of useful markers almost two-fold. which means they amplified fragments of the expected size in Ae. The wheat D-genome microsatellite map Polymorphic microsatellites were placed into a genetic framework RFLP map previously created for the ITMI population (Nelson et al. Five primer sets were mapped on two sites and one primer set on three sites. With an average insert size of 350 bp. the majority of microsatellite markers isolated from Ae. There was no significant difference in the efficiency of microsatellite isolation from a phage library of Ae. tauschii amplified well in hexaploid wheat. In total. Development of microsatellites from phage libraries is a time-consuming technique. 1995a. tauschii mapped on the D genome of wheat. In some cases. microsatellite markers were isolated from lambda phage libraries of Ae. Therefore. tauschii. Van Deynze et al. 1995b. tauschii based on sequence data. tauschii compared to a phage library of wheat described by Röder et al. 1998). a second size selection after digestion with Sau3A or MboI was performed.21% of total number of tested clones) was observed in the PstI–MboI library. 1. and 7% of the clones contained a repeated DNA close to the microsatellite. All mapable fragments in the range 75–300 bp were scored and integrated into the map. Seven percent of the clones contained GA and GT repeats in combination. the parents of the ITMI population. 1998). with the exception of a slight clustering in the pericentromeric region of chromosome 3D. approximately 150 000 recombinant clones from different plasmid libraries were analyzed and 240 positive clones were selected. The availability of robotic systems makes it feasible to analyze large numbers of plasmid clones faster and more efficiently than previously. 1995. The number of designed and functional primer pairs and number of mapped microsatellite markers isolated from this library are presented in Table 1. Chromosomal location of nonpolymorphic markers The chromosomal location of nonpolymorphic markers was © 2000 NRC Canada . tauschii genome contains GA or GT dinucleotide repeats every 220 kb. The use of the methylation-sensitive restriction endonuclease PstI for library construction was preferable to other restriction enzymes (Röder et al. and consequently the number of clones useful for primer design. The highest number of positive clones (0. All primer pairs that were functional in Ae. DNA of Ae. Only 30% of the polymorphic primer pairs amplified exclusively the expected fragment. the proportion of markers useful for primer design was approximately equal in these two libraries. Marino et al. 50% of primer pairs amplified one or several additional monomorphic fragments. Microsatellite marker development In total. In the presented map. one change was made in the framework from the previously published wheat microsatellite map constructed for the same mapping population (Röder et al. Ten markers were ordered at LOD scores higher than 2. Sixty-five primer pairs (44%) were functional. that is. obtained after two size selections. Almost half of the sequenced clones were discarded for the following reasons: 18% of the clones did not contain any microsatellite or the microsatellite was too small (less than 10 repeated units). In several cases. tauschii. Forty-eight primer sets detected 55 loci. since it requires up to three rounds of hybridization to purify positive phage plaques and for the conversion of phages into plasmid clones. They mapped either to homoeologous or nonhomoeologous loci (Table 3). This library was chosen for further microsatellite isolation. 1996). 51% of all sequenced clones obtained from plasmid libraries. Primer pairs were designed for 98 clones. tauschii was pre-digested with PstI and a low-molecular-weight fraction was used for library construction. This was suggested by new results during ditelosomic analysis of wheat microsatellites. This step allowed an increase in the size of inserts. (1998). Forty-nine percent of the clones containing microsatellites with more than ten repeats harboured GA repeats. In this case. Initially.Pestsova et al. Primer pairs were constructed for microsatellites containing more than 10 repeats. Of these. and 20% of primer pairs amplified one or several additional polymorphic fragments. The number of markers varies from three on chromosome 4D to nine on chromosome 5D. the size of amplifying fragments in wheat differed greatly from amplifying fragments in Ae. The length of the isolated microsatellites varied from 4–69 repeated units. The first constructed plasmid libraries were ineffective because of the high proportion of clones with small insert sizes. tauschii is presented in Fig. the low-copy fraction of the Ae. To achieve a higher efficiency for the subsequent libraries. Thus. and the other markers were assigned to the most likely interval. many microsatellites were too close to one of the cloning sites and it was not possible to design the primers. The microsatellite markers cover all seven of the D-genome chromosomes. The microsatellites are randomly distributed along the chromosomes. tauschii is presented in Table 2. The number of positive clones after hybridization with poly(GA) and poly(GT) varied in different plasmid libraries.

References Anderson. A large increase in the length of the PCR product could be explained by the expansion of the microsatellite. and for the verification of the authenticity of intervarietal chromosome substitution lines of wheat (Pestsova et al. Mickelson-Young. Ziegle.K. Three primer sets amplified two nonpolymorphic fragments from either homoeologous or nonhomoeologous chromosomes. 2000b).R. In total. 2000b). Victor Korzun for preparing a phage library and Angelika Flieger for excellent technical assistance.E. Hassawi.. aestivum (Salina et al. The microsatellites from the D genome could probably spread throughout the other wheat genomes as a part of retrotransposons. the observed differences were up to 20 bp but in some cases. 1992. Ten nonpolymorphic markers were located on D-genome chromosomes. Forty-two (76%) of polymorphic Xgdm loci were integrated into the framework map of the D genome.. Xgdm115-5B. 2000). Raupp. T. Acknowledgements We thank Dr. This is demonstrated by the fact that they were already successfully used for the analysis of Ae.. S. urartu (V.. and Ae.. Genomics.V. 19: 137–144. Taking into consideration the homology of all three wheat genomes. S. A.. T. Several of them marked loci on the A and B genomes in addition to the main homoeologous locus on the D genome. 2000b). the size of amplifying fragments from wheat differed greatly from the Ae. which was also observed with RFLP markers (Marino et al.A. The obtained data confirm the idea that Ae. Development of a chromosomal arm map for wheat based on RFLP markers. tauschii has a high potential as a source of microsatellite markers for the D genome of wheat. C.. and Xgdm147-6B. In conclusion. tauschii. Extra high mutation frequency within the flanking regions of microsatellites due to insertions and deletions was reported for sweet potato (Buteler et al.. (2) Alternatively. 1999). M. S. Recently. Areshchenkova.D. 83: 1035–1043.W. tauschii sequences are as useful for wheat genome analysis as markers from hexaploid wheat. At the same time. Korzun personal communication). 43.S.S. This work was supported by the Deutsche Forschungsgemeinschaft (grant Ro 1033/1-3). and Ecker. Long tomato microsatellites are predominantly associated with centromeric regions. 42: 536–544. tauschii are different. Xgdm1343A. In the case of seven markers. It is interesting that 24% of the polymorphic loci and 59% of the nonpolymorphic loci were mapped on the A and B genomes of wheat. 1995). intimate association of microsatellite repeats with retrotransposons and other dispersed repetitive elements was reported for barley (Ramsay et al. and Ganal. tauschii fragments. microsatellite marker Xgdm68 revealed one polymorphic fragment on chromosome 5D. tauschii were mapped on wheat. 1999. Assignment of 30 microsatellite loci to the linkage map of Arabidopsis. Xgdm 34-4D. It has been shown that microsatellite markers Xgdm29-2D. For example. Y. microsatellites isolated from Ae..J. for the mapping of the induced sphaerococcoid mutation gene in T. Xgdm133-4D. J. It is possible that nonhomoeologous loci are due to a large portion of ancestral transposable elements in the Gramineae genomes (Röder et al. the flanking regions of the microsatellites in these two genomes may be divergent. 2000a). W.. 9 functional markers out of 65 (14%) detected multiple loci. Xgdm87-2B. 1994. 1999). K. T. It was shown that microsatellite markers mapped to homoeologous as well as nonhomoeologous loci of the wheat genome. Xgdm34-4D.. Genome. monococcum.696 Genome Vol. 1996). It was possible to assign 22 loci amplified with 19 primer sets (Table 4). J. Discussion We have isolated 65 functional microsatellite markers from Ae. Appl. Röder et al. M. Considering the high polymorphism of microsatellites. and Xgdm40-4D assigned by nullitetrasomic analysis detected a high level of polymorphism between different accessions of Ae. D. Microsatellite markers that are nonpolymorphic in the ITMI mapping population can reveal polymorphism in other genetic stocks. E. (1998) reported that 80% of functional microsatellites isolated from wheat were polymorphic in the ITMI population. The lower figure for the D-genome markers reflects the lower amount of polymorphism in the D genome of the ITMI population. The second possible reason for the decrease of the amplified fragment size is the presence of deletions in the flanking regions of the microsatellite. © 2000 NRC Canada . Fritz. Generally. J. boeoticum. and 74% of the functional primer sets were polymorphic between the parents of the ITMI mapping population. tauschii (Pestsova et al.J. There are two probable explanations for this finding: (1) The microsatellites present in the D genome of Ae.. All primer pairs that were functional in Ae.N. it should be expected that the sizes of amplifying fragments from wheat and Ae. Genet. tauschii germplasm (Pestsova et al. Therefore. In the present study. Nasuda. Bell. and Tanksley. Singh. some microsatellite markers undetectable on the D genome would then amplify from the homoeologous loci on the A or B genome.. the size decrease of the mapped fragments in wheat was greater than the whole length of the microsatellites. Xgdm3-5D. these amplified fragments may contain no microsatellite sequence. Boyko. Theor.and B-genome chromosomes. Sorrells. Gill. L. microsatellite markers developed from Ae. The application of microsatellites from one species for the study of the other species raises the question of whether amplification products from the second species contain microsatellites. tauschii accessions (Pestsova et al. tauschii amplified well in hexaploid wheat. Ogihara. 1998). whereas homoeologous chromosomes 5A and 5B carry nonpolymorphic fragments. tauschii may be absent or deleted in the D genome of wheat. 2000 determined on nullitetrasomic lines of ‘Chinese ‘Spring’. The remaining markers were mapped exclusively on the A. A decrease of the PCR product length is not always accounted for by variation in the repeat numbers. wheat microsatellites were highly effective in detecting polymorphism among T.. It was previously shown that the PCR products from barley and rye corresponding to most wheat microsatellites contain either no microsatellite sequence or a very short microsatellite that is too small to be detected by the dot-blot hybridization (Röder et al.

Theor. 1999. V. Molecular mapping of wheat: Homoeologous group 3. A.. and Gill. N. M. V.S. Gill.S.E. S.L. D. 95: 149–155. Van Deynze. 1998. 99: 16–26.). A. Microsatellite DNA polymorphism divergence in Triticum dicoccoides accessions highly resistant to yellow rust. Molecular mapping of wheat: Homoeologous group 2. 149: 2007–2023.. J. Genet. 17: 415–425. Abrahamson. König. M. K. Van Deynze. 96: 138–146. and Leroy. E. The Human Genome Project: From mapping to sequencing. Maystrenko.. 1996. Buteler. J. Nelson...M. M...G. Korzun. Korol. T. Röder. 1996. Appl.. E.. E.L.. 1: 174–181. Hered. The origin of Triticum spelta and its free-threshing hexaploid relatives.R.. Euphytica. N. Y. J.. 93: 869–876. Leonova. M.. E. Detection of genetic diversity in closely related bread wheat using microsatellite markers. A... Röder... 38: 516–524. Sorrells. J. Weissenbach. and Röder.. and suggestive negative crossover interference on chromosome 1B.. Ganal. E. em. R.J. and Ganal. 1987. variability and chromosomal location of microsatellites in wheat. Theor. 38: 45–59. C. M. M... M. B. P.S. Kihara. and Eun. M. Lu. S..D. C. Genet.S. Liu.. Börner. Theor. B. Appl. Marino. M. and Appels.S.. and Röder. Genetic analysis of the dwarfing gene (Rht8) in wheat. M. and Anderson.. 39: 277– 287.. Appl. Ph. Intimate association of microsatellite repeats with retrotransposons and other dispersed repetitive elements in barley. Cardle. Appl. P. M.. Genome. 1995.. Sorrells. Integrated map of AFLP. Ivanissevich. M.S. the D-genome progenitor of bread wheat.H.. Bernard. 1998. Theor. J. S... A. O. E. Appl. Kang.C. G. J.C. Lincoln.J.... R. M.. H. Salina. Röder. Clin. E. Y.R.. Genet. E. Y. Korzun.W. J.R. 246: 327–333. Sequence characterization of microsatellites in diploid and polyploid Ipomoea. J.). V. 2000b.. Sorrells. P.. Macaulay. N.S.H.. M. Genome.I. Korzun.W. and Newburg. Genome. Ganal.R. M.V. Discovery of the DD-analyser.S. Namuth.. J.Pestsova et al. A. 96: 187–195.. V. Fahima. M. M. Schubert. E. 96: 1104–1109. Ganal. Z. J. A. Röder. Biyashev. Y.H. MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Microsatellites confirm the authenticity of inter-varietal chromosome substitution lines of wheat (Triticum aestivum L. Theor. Triticum dicoccoides. Pestsova.. M. M. to hexaploid wheat. Gen. Grama. 1998. Van Deynze. and 7. Börner. Groenen.A.. 101: In press.. C. J. 1998. and Law. 1995. Genet. A. Genome. and Saghai-Maroof. Fahima. M. and Hart. Peil. S.E.. Korzun. Autrique. Green.C. A. A. Appl. A. Daly. W. and Waugh. Dahan.. Weber. G.. Taramino. 19: 889–890.. McCouch.H. Plaschke.W. A. 697 Nelson. S.. Lapitan. 39: 359–366. Lander. W. Cho. 1995c.. M.S. Maestri. Molecular mapping of wheat: Major genes and rearrangements in homoeologous groups 4.. Worland. Salina.. Appl..R. 27: 445– 450. Autrique. Theor.. Lab. M. L. V.S.. M. S... J. 1998. J.. 101: In press. V. Chem. M.. Maystrenko. and Tingey. Appl. Genet.. M. Goncharov.. Mol. Lu. Ramsay. Negre..S. 36: 511–514.. Worland. Tanksley... 98: 862–872. Part I..A.W. D..S.. V. one of the ancestors of vulgare wheat.E. Molecular genetic maps of the group 6 chromosomes of hexaploid wheat (Triticum aestivum L. 37: 81–89. Simple sequence repeats for germplasm analysis and mapping in maize. 1995a. Microsatellite analysis of Aegilops tauschii germplasm..J. M. K.R. A.. Crop Sci. and LaBonte.E. SSLP and RFLP markers using a recombinant inbred population of rice (Oryza sativa L. Lopes. Atkinson. M. Plant J. Börner.L.. 99: 123–132. Thell... W..C. Peng. Lu. Theor. Sorrells...Y.. Genet. Genome. M..A. M.U..C. Theor. M. 1946. 1999. 2000a... T..S.E. Microsatellite tagging of the stripe-rust resistance gene YrH52 derived from wild emmer wheat... 5.. Ronin.W. A. and Nevo.B.. Nelson.D.... Nelson.. Genet. J. L.W.. 1998. A highdensity genetic linkage map of Aegilops tauschii. Comparative microsatellite mapping of the induced sphaerococcoid mutation genes in Triticum aestivum. Med.. Abundance.S. Grama. Genet. J.. and Raupp. L..E. M. Sorrells. Theor. Morgante. Lagudah. I.H. Development of simple sequence repeat DNA markers and their integration into a barley linkage map..E. S. and Ganal.. S. E..E.. Direct genetic transfers from Aegilops squarrosa L.E. Gill. McCouch... A. Wendehake. Van Deynze. Nelson..).I. A. Genet. Y. Gill. Powell. Law. M.. Tixier. Theor. 97: 370–380. Molecular mapping of Rht8 on the short arm of chromosome 2D of bread wheat (Triticum aestivum L. Tuleen.S. © 2000 NRC Canada .. 38: 525– 533.M. Bernard. 1944.. Sorrells. Atkinson. Li.. P.S. J.C. 100: 686–689. Molecular-genetic maps for group 1 chromosomes of triticeae species and their relation to chromosomes in rice and oat. Genet. Leroy. E.E. Faris. Laikova. E. 1996.. 1995. M. Dubcovsky. M. Pestsova. Appl. J.S. Genomics. Y. 91: 1001–1007.).E. and Röder. M. and Röder. P.. Korzun. Plaschke. and Sears. O. Application of microsatellite markers to distinguish intervarietal chromosome substitution lines of wheat (Triticum aestivum L. The application of wheat microsatellites to identify disomic Triticum aestivum–Aegilops markgrafii addition lines. 1999. 107–116.N. Appl. V... DvoÍák. 141: 721–731. Korzun. R.T. Theor. Y. Merlino.. and Röder. M. Barlow. J. K. C. Appl. and Leroy. 1995b. Korzun. Kuiper.N. B. Leroy. Röder. Hortic.H..J.E. Hammer. L. A. P.). 2000.. 1997.I. Theor.. Genetics. E. and Nevo. Leroy. Agric. 1987. Jarret. Lu.. Appl. A microsatellite map of wheat.. Genet. 1999. Pot.. E.. Börner. R. Genetics.E..S. Genet.. McFadden. and Röder. Genet. Schumann. Plaschke..

Sign up to vote on this title
UsefulNot useful