689

Isolation and mapping of microsatellite markers specific for the D genome of bread wheat
E. Pestsova, M.W. Ganal, and M.S. Röder

Abstract: The potential of Aegilops tauschii, the diploid progenitor of the D genome of wheat, as a source of microsatellite markers for hexaploid bread wheat was investigated. By screening lambda phage and plasmid libraries of Ae. tauschii genomic DNA, dinucleotide microsatellites containing GA and GT motifs were isolated and a total of 65 functional microsatellite markers were developed. All primer pairs that were functional in Ae. tauschii amplified well in hexaploid wheat. Fifty-five loci amplified by 48 primer sets were placed onto a genetic framework map of the reference population of the International Triticeae Mapping Initiative (ITMI) ‘Opata 85’ × ‘W7984’. The majority of microsatellite markers could be assigned to the chromosomes of the D genome of wheat. The distribution of the markers along the chromosomes is random. Chromosomal location of 22 loci nonpolymorphic in the reference population was determined using nullitetrasomic lines of Triticum aestivum ‘Chinese Spring’. The results of this study demonstrate the value of microsatellite markers isolated from Ae. tauschii for the study of bread wheat. The microsatellite markers developed improve the existing wheat microsatellite map and can be used in a wide range of genetic studies and breeding programs. Key words: Aegilops tauschii, wheat, molecular markers, genetic map, simple sequence repeats. Résumé : Le potentiel de l’Aegilops tauschii, l’espèce donatrice du génome D du blé, en tant que source de marqueurs microsatellites pour le blé hexaploïde a été étudié. En criblant des banques génomiques (phages lambda et plasmides) de l’Ae. tauschii, des microsatellites dinucléotidiques GA et GT ont été isolés et 65 marqueurs microsatellites fonctionnels ont été développés. Toutes les paires d’amorces qui étaient fonctionnelles chez l’Ae. tauschii ont bien amplifié chez le blé hexaploïde. Cinquante-cinq locus amplifiés à l’aide de 48 paires d’amorces ont été placés sur une carte génétique issue de la population de référence de l’ITMI (« International Triticeae Mapping Initiative »), ‘Opata 85’ × ‘W7984’. La majorité des microsatellites pouvaient être assignés au chromosomes du génome D du blé. La distribution des marqueurs au long des chromosomes était aléatoire. L’emplacement chromosomique des 22 locus monomorphes au sein de la population de référence a été déterminé à l’aide de lignées nulli-tétrasomiques de Triticum aestivum ‘Chinese Spring’. Les résultats de cette étude montrent l’intérêt chez le blé des microsatellites isolés de l’Ae. tauschii. Les microsatellites développés contribuent à améliorer la carte existante du blé et peuvent être employés pour une vaste gamme d’études génétiques et en sélection. Mots clés : Aegilops tauschii, blé, marqueurs moléculaires, carte génétique, répétitions de séquences simples. [Traduit par la Rédaction] Pestsova et al. 697

Introduction
Microsatellites or simple sequence repeats (SSR) are tandem repeats of 2–4 nucleotides. They are frequent and almost randomly distributed in most eukaryotic genomes. This makes them desirable markers for genetic mapping. Molecular markers based on microsatellite sequences detect extra high levels of polymorphism and can be easily assayed by PCR (polymerase chain reaction). A highly saturated microsatellite map published for human consists of about 8000
Corresponding Editor: G.J. Scoles. Received January 4, 2000. Accepted May 23, 2000. Published on the NRC Research Press web site on July 20, 2000. E. Pestsova,1 M.W. Ganal, and M.S. Röder. Institut für Pflanzengenetik und Kulturpflanzenforschung (IPK), Corrensstraße 3, 06466 Gatersleben, Germany.
1

Author to whom all correspondence should be addressed (e-mail: pestsova@ipk-gatersleben.de).

such markers (Weissenbach 1998). In recent years, microsatellite markers were integrated into the existing molecular maps of Arabidopsis (Bell and Ecker 1994), tomato (Areshchenkova and Ganal 1999), rice (Cho et al. 1998), maize (Taramino and Tingey 1996), barley (Liu et al. 1996), wheat (Röder et al. 1998), and other plants. The high-density microsatellite map of bread wheat (Triticum aestivum L. em Thell.) constructed in our laboratory consists of more than 279 markers (Röder et al. 1998). These microsatellites have been successfully used for the study of genetic diversity (Plaschke et al. 1995; Fahima et al. 1998), testing of authenticity of genetic stocks (Korzun et al. 1997; Peil et al. 1998; Pestsova et al. 2000a), and gene mapping (Korzun et al. 1998; Peng et al. 1999; Salina et al. 2000). Bread wheat is allohexaploid (2n = 42, AABBDD) and consists of three different genomes A, B, and D. Common wheat is a product of hybridization between the tetraploid wheat T. turgidum L. (2n = 28, AABB) and diploid grass Aegilops tauschii Coss. (2n = 14, DD) (Kihara 1944;
© 2000 NRC Canada

Genome 43: 689–697 (2000)

Fig.5 are marked by an asterisk. Efficiency of phage and plasmid libraries for the isolation of D-genome microsatellites.690 Table 1. Short arms of chromosomes are at the top. The microsatellite loci are indicated in bold and designated Xgdm (Gatersleben D-genome Microsatellite). tauschii plasmid library 51% 18% 24% 7% 100% Röder et al. Type of library Lambda–phage library Plasmid library Total No. (1998). tested primer pairs 51 98 149 No. The centromeres are indicated in black. Molecular linkage map of the D genome of wheat. Type of library Clones containing (GA)n and (GT)n based on hybridization useful in the primer pair design microsatellite too short or no microsatellite microsatellite too close to the cloning site repetitive DNA close to microsatellite Total a T. © 2000 NRC Canada . aestivum phage librarya 54% 36% 4% 6% 100% Ae. Efficiency of primer design with different libraries. 2000 Percent of functional primer pairs 31 50 44 Table 2. functional primer pairs 16 49 65 Genome Vol. 43. Microsatellite markers placed with LOD < 2. 1.

tauschii and the D genome of bread wheat are highly related and the chromosomes of Ae. Fig. This reflects the amount of polymorphism found in the different genomes of the mapping population. Gatersleben) were used as the source for microsatellite isolation. tauschii. aestivum genetic maps were in colinear order. Sorrells. The genome of Ae. a high-density genetic linkage map composed of RFLP (restriction fragment length polymorphism) and AFLP (amplified fragment length polymorphism) markers was published for Ae. tauschii and T. Recently. 691 McFadden and Sears 1946). The highest number of microsatellite loci in the existing microsatellite map of wheat is on the B genome and the lowest is on the D genome. for microsatellite isolation. AE 692) from the collection of the gene bank (IPK. N. strangulata (Acc. To enrich the D genome of bread wheat with microsatellite markers and improve the existing map we used the D-genome progenitor. and seeds were kindly provided by M. AE 473) and Ae. tauschii and T. Ae. durum ‘Altar 84’. Mapping was performed on 70 recombinant inbred lines from the International Triticeae Mapping Initiative (ITMI) population. No. obtained from a cross of Ae. tauschii (Boyko et al. tauschii show complete pairing with the D-genome chromosomes of bread wheat (Gill and Raupp 1987). DNA of Ae.). and it was shown that 123 of the 157 markers shared between the Ae. Materials and methods Plant material and DNA isolation Aegilops tauschii subsp. turgidum subsp. This population was derived from the cross of the Mexican wheat ‘Opata 85’ and the synthetic wheat ‘W7984’. The plant material was described in Van Deynze et al. tauschii was isolated from seedlings according to Anderson et al. 1 (concluded). Cornell University (Ithaca. tauschii subsp.Pestsova et al. tauschii (Acc. DNA of © 2000 NRC Canada . 1999).Y. (1995). (1992). No.

2000 169 143 162 190 137 . 43. (CA)24(TA)7 (CA)24(TA)7 (AT)8(GT)28 imp. (AT)8(GT)28 imp. (GT)28 imp. (GT)27 (CT)19 (GA)21 imp. (GA)16 (GA)16 (GA)16 (GT)21 (GA)15 (CA)9 (CA)11 (GC)5(TC)8(GC)8 (CA)13 (GA)9GG(GA)6 Fragment size in Ae. tauschii (bp) 158 160 160 152 137 134 199 199 136 136 146 146 189 148 134 142 120 117 115 114 150 106 136 115 166 142 149 149 125 125 125 146 148 178 148 174 193 136 Fragment size in Opata (bp) 102 144 154 244 162 138 183 197 112 133 166 182 — 133 137 142 138 — 105 106 152 138 137 128 169 142 — — — — 217 151 164 — 141 179 199 — Fragment size in synthetic (bp) 104 — — 138 164 — 181 163 — 135 — — 214 — 130 — 136 111 124 111 157 109 139 146 171 — 110 140 109 134 215 153 — Genome Vol. 692 Locus Xgdm3-5D Xgdm5-2A Xgdm5-2D Xgdm6-2D Xgdm8-3D Xgdm14-6D Xgdm19-1D Xgdm19-2D Xgdm28-6A Xgdm28-1B Xgdm33-1D Xgdm33-1A Xgdm35-2D Xgdm36-6D Xgdm38-3D Xgdm43-5D Xgdm46-7D Xgdm60-1D Xgdm61-4D Xgdm62-3D Xgdm63-5D Xgdm67-7D Xgdm68-5D Xgdm72-3D Xgdm84-7D Xgdm86-7D Xgdm87-2B Xgdm87-2D Xgdm93-2D Xgdm93-2A Xgdm93-4B Xgdm98-6D Xgdm99-5D Xgdm107-2D Xgdm108-6D Xgdm109-5A Xgdm111-1D Xgdm113-6B © 2000 NRC Canada Left primer GTATCTCGGTGATGCAGCAA CTAGCCAGAAGGTTACTTTG CTAGCCAGAAGGTTACTTTG GATCAATCAAGCATGTGTGTGT TTCTCCAACGCACGTTAGC CAACGAGGTTGTCATGGATG GCGTTCGAGTGACTTCCAAT GCGTTCGAGTGACTTCCAAT ATCTGACTTCATGGTTTATAT ATCTGACTTCATGGTTTATAT GGCTCAATTCAACCGTTCTT GGCTCAATTCAACCGTTCTT CCTGCTCTGCCCTAGATACG ATGCAAAGGAATGGATTCAA CAAAATGAA GCATGAAGAGG GGTTGTCCTCTACTCCTCCT TGTGTTGGCCTTGTGGTG AGAAGGACCGTCGCGTC TTCTTTGCGTGTGTGCGT GAAAGCCGTCCACTGCC GCCCCCTATTCCATAGGAAT AAGCAAGGCACGTAAAGAGC GCCTGACCACTCCCATAAAA TGGTTTTCTCGAGCATTCAA GGGATGAATTGTGTGCTCG GGTCACCCTCTCCCATCC AATAATGTGGCAGACAGTCTTGG AATAATGTGGCAGACAGTCTTGG AAAAGCTGCTGGAGCATACA AAAAGCTGCTGGAGCATACA AAAAGCTGCTGGAGCATACA CCATCCATGAAATGGCG AGGTTGTCCACTGCCTGTTC AGCAACAAACGCGAGAGC AGGAGGTAAGAAGGACCATG GGTCCGCCTGACAGACC CACTCACCCCAAACCAAAGT ACCCATCTGATATTTTGGGG Right primer GTGTGATGTTTGAATACGCA CAACATTAACATTAACGCAC CAACATTAACATTAACGCAC GGATGCCATGCCAAAGTATT CCCAAATGATGGCAGCTACT GGTACACTAGCTGCCCTTGC ATTGACAGCAGATGGCAGTG ATTGACAGCAGATGGCAGTG TCAAGAATGAAGACATAGTT TCAAGAATGAAGACATAGTT TACGTTCTGGTGGCTGCTC TACGTTCTGGTGGCTGCTC ATGTGAATGTGATGCATGCA CAAATCCGCATCCAGAAAAT CAGCACATAGCTTTGGTCTT CTTAGCATGTGGTAAGCACA CTACCCAATGCATCCCCTTA ATGTTGGCCCTGAAGAAGAA CGCACTTTTTACTAGGGGTC GATCTTGAAGCACTCTTGGT CCTTTTGATGGTGCATAGGA CTCGAAGCGAACACAAAACA TCGGAAGGGGGACTATACAA TGCAACGATGAAGACCAGAA CGCACAATCTCTTCGTGAAA GGCGCTCCATTCAATCTG CCAAGCCCCAATCTCTCTCT CCAAGCCCCAATCTCTCTCT GGAGCATGGCTACATCCTTC GGAGCATGGCTACATCCTTC GGAGCATGGCTACATCCTTC GCCCTTCACTAGCCTTCATG ATGTCGTCCTCGTCTCATCC TGACACCCGGTTGTTGG CAGGAAGATGCCTGTCTTCC AAAGCTGCTCATCGTGGTG GATGCAATCGGGTCGTTAGT AAAATGCCCTTCCCAACC Tm (°C) 55 50 50 55 60 60 55 55 47 47 60 60 55 55 55 55 60 60 60 55 60 60 60 60 60 60 60 60 55 55 55 60 60 55 60 55 60 55 Repeat (GT)15 (GT)28 imp.Table 3. (CA)20 (CA)21 (CA)26 (GT)21 (CA)22 (GA)24 (CA)11 (CT)11 (GT)12 (CT)13 (CT)20 (GT)20 (TC)4TT(TC)14 (CT)25 imp. (GT)14(CG)7 imp. Microsatellite primer sets and loci mapped in the ITMI population. (GT)4GCG(GT)15 (CT)17 (GT)14(CG)7 imp.

High-density filters for hybridization were prepared from the microtiter plates using the robotic gridding system BioGrid (BioRobotics Ltd.. (CA)22 151 122 127 149 185 186 110 120 112 144 216 188 140 116 242 234 141 121 143 142 189 184 116 120 90 143 101 211 — 117 — 250 — AGATAGCACGGGTGCGG CACAAACGACCCCTCTGG 60 (GA)10 155 154 PCR. Clones that gave a positive signal were selected and used for plasmid DNA isolation according to the plasmid mini protocol (Qiagen). The selected fraction of DNA. Each of the 384-well plates was replicated twice onto sterile LB-Amp-agar plates covered with 22-cm square nylon filter (Hybond N+. U. The obtained libraries were stored at –70°C. plasmid libraries constructed from PstI–Sau3A and PstI–MboI fractions of the Ae. Using the BioPick system (BioRobotics Ltd.). 1% (w/w) bacto yeast extract.4 mM MgSO4. Microsatellite marker development A lambda-phage library was constructed from DNA of Ae. Genetic mapping at the ITMI population was carried out according to Röder et al. 1987). One filter contained the immobilized DNA from 18 432 clones spotted out of 48 microtiter plates. PCR fragments in the range 70–300 bp were detected and analyzed. 13. 2. The location of nonpolymorphic loci was determined using the nullisomic–tetrasomic lines of T. The filters were hybridized with the dinucleotide repeats poly(GA) and poly(GT) (Pharmacia.). DNA of Ae. Further screening of the phage library was carried out as described by Röder et al. Sweden). Mapped microsatellite loci were designated Xgdm for Gatersleben D-genome Microsatellite.9% (w/w) H2O) and 10× freezing medium HMFM (1× concentration: 36 mM K2HPO4. One primer was labelled with fluorescein for fragment analysis on an ALF sequencer.4% (v/v) glycerol). 0. 147 124 — — 181 182 106 116 — 164 103 222 140 111 171 248 GCTGCAATGCAAGGTCTCTT CCAACACTTTGTTGGCCAG GCAAGTAGCTTTCCGTCACA GCAGGCGTGTTACTCCAAGT TCCATCATATCCGTAGCACA ACGGGGAAATTAAAACGACC TCACAGCAAACTCTGCGTG GAGCAGGCAGCAGCTAGC CCATCCAAGTACACCCGC ACCGCTCGGAGAAAATCC GGGATGAATTGTGTGCTCG CATGAGCCGATTCAGCG ATGGAGACCATGGACCAGAG ACTAGCCTGGCAGTTGATGC CAAACAAGGTGGGTTCACTG TATAGGCAAATTAATTAAGACG GATGTGGCTTTCTAAGGCAA CAGGATGCTCTGACAAGCAA GATGAATTGTGTGCTCGGG CCGAGGTGGATAGGAGGAAA CGTGGTTGATTTCAGGAGGT TGAGATGGAATCGACAGAAA ACAATTTGGCATGCTTCTCC TGCATCATCATCGGTCAAGT CGGAGGAGGAATGACGG AGGGGGGCAGAGGTAGG GTCGCATGCGACACATG CGCTTAAATTGAAGTACCGC GGCGGTGTTCCTATGCC CCGACCGGTTCACTTCC TTTTTGAGTTCAACGGAGAC ATCTTTATGTGAGTACACTGC 55 55 60 60 60 55 60 60 60 60 60 50 60 60 55 50 (AT)8(GT)26 (GA)13 (CA)17 imp. strangulata. Lander). tauschii subsp. was further digested with a second restriction enzyme MboI or Sau3A. (CA)29 (CA)13 (GT)17 imp.5 (provided by E. (1998) using MAPMAKER v. single colonies were transferred into 384-well microtiter plates containing 40 µL of the mixture 9:1 of growth medium 2YT (1. Fragments in the size of 1–3 kb were eluted from the gel using the Geneclean kit (Dianova). 6.8 mM (NH4)2SO4. © 2000 NRC Canada Xgdm114-2B Xgdm116-5D Xgdm118-5D Xgdm120-3B Xgdm125-4D Xgdm126-1D Xgdm127-6D Xgdm128-3D Xgdm129-4D Xgdm130-7D Xgdm132-6D Xgdm134-3A Xgdm138-5D Xgdm141-6D Xgdm150-7D Xgdm147-6B Xgdm153-5D Note: imp.0 (Lander et al.. aestivum ‘Chinese Spring’ as previously described (Röder et al. imperfect. Plasmid clones were sequenced with M13 primers on automated laser fluorescence (ALF) sequencers (Pharmacia Biotech. (1998). which is enriched for undermethylated low. (GT)13 (CA)15 (CT)27 (CT)24 (GT)25 imp. N. and genetic mapping PCRs and gel electrophoresis were performed as described by Röder et al.5% (w/w) NaCl. tauschii was digested with the methylation-sensitive restriction enzyme PstI and electrophoretically fractionated in 1% agarose. 0.2 (Pharmacia) by comparison with the internal size standards. Amersham). (1995).7 mM Na3-citrate. 1. 4. 693 the lines was extracted from whole seeds as described in Plaschke et al. 0. (1998). tauschii genome contained many clones with small size inserts (less than 200 bp).Pestsova et al.6% (w/w) bacto tryptone. a second size selection was performed and fragments in the size 250–1500 bp were chosen for the subsequent libraries construction. Sequences flanking the microsatellite motifs were tested for homology to known wheat repetitive sequences and oligonucleotide primer pairs were designed using the computer program PRIMER v. 1. tauschii while a plasmid library was prepared from DNA of Ae. fragment analysis.).and single-copy DNA. The fragment sizes were calculated using the computer program FRAGMENT MANAGER v. (CT)22 (GT)11 (GT)16 imp.J. 96. The high-efficiency Escherichia coli XL2-Blue ultracompetent cells (Stratagene) were used for transformation according to the manufacturer’s instructions. and the fragments were cloned either in the vector Lambda Zap Express (Stratagene) or the plasmid vector pUC18 BamH1 (Pharmacia Biotech). 1995). Piscataway.2 mM KH2PO4. tauschii subsp. (CT)44 imp.K. Initially. To increase the insert size. . Transformation mixture was plated onto 22 × 22 cm plates with LB (Luria broth) agar medium and incubated overnight at 37°C.

2000 © 2000 NRC Canada . (CT)15(CA)7 (GT)12 imp. Genome Vol. Description of microsatellite primer sets and chromosomal locations assigned with the nullitetrasomic stocks of ‘Chinese Spring’ (CS). (GT)17 Fragment size in Ae. imperfect.. tauschii (bp) 87 221 124 146 136 136 135 142 125 223 120 120 185 150 150 139 193 127 153 103 186 250 Fragment size in CS (bp) 122 175 116 132 142 116 138 127 121 197 84 125 110 82 150 138 186 120 135 106 113 270 Note: imp.694 Table 4. Locus Xgdm29-2D Xgdm34-4D Xgdm40-4D Xgdm64-3B Xgdm68-5A Xgdm68-5B Xgdm77-2D Xgdm86-2B Xgdm88-4A Xgdm101-5B Xgdm115-5B Xgdm115-5D Xgdm124-2B Xgdm133-4D Xgdm133-5B Xgdm136-5D Xgdm142-7D Xgdm145-4A Xgdm146-5B Xgdm148-2D Xgdm149-5B Xgdm152-7A Left primer CTAGTTGTGCTAGGCGCTCC GATCGGACTTTGTGGATGCT GACCTAAGGCTCGGTCACC CCCGCTAGTGTTTGTGTTTG GCCTGACCACTCCCATAAAA GCCTGACCACTCCCATAAAA GACACACAATAGCCAAAGCA GGTCACCCTCTCCCATCC TCCCACCTTTTTGCTGTAGA GTCTCCATGACAAGGAGGGA TTTCCATGTCCTATGCCCC TTTCCATGTCCTATGCCCC ACCCAATTACGGAGCCTTTT ACGATTCATAACACAGCGCA ACGATTCATAACACAGCGCA CTCATCCGGTGAGTGCATC TGTGCCATGGAACAGGG TGAAGGACAAATCCCTGCAT ATCCTGACGGCCACCAC GATTTGACCGTCTGAGGTCG TCTTTGGGTCGTATGCAGTG ATAACATGCACACAAATTTT Right primer CTGGCTGCTCCCTCCTC ATGGCTGTAGGTGGACCAAC GCAGGCATGGTACCCTTG GTCTCTTGCGTACACAGGCC TCGGAAGGGGGACTATACAA TCGGAAGGGGGACTATACAA TGATGTCGGCACTATTTTGG GGCGCTCCATTCAATCTG AAGGACAAATCCCTGCATGA TGAAACCTCAAAGGGAAAGA AAGGTAGTGACGAGGGCATG AAGGTAGTGACGAGGGCATG CATATCACGCGTTCACCG TGAGAACAATTTCACGGCTG TGAGAACAATTTCACGGCTG CCCGCATGTCTACATGAGAA TGAAGCGCCGATTAGGAG TCCCACCTTTTTGCTGTAGA CAAAGCCTGCGATACATCAA AACTAGTTCTGTGGCAAGCT TGCACGCCAACGTAAAATTA GCCAGTGCCAAGCTTGC Tm (°C) 60 55 60 60 60 60 55 60 60 55 60 60 60 60 60 55 60 55 60 60 60 55 Repeat (CA)14(TA)4 (GA)24 imp. (TC)4TT(TC)14 (TC)4TT(TC)14 (GA)11 (CT)17 (TG)13 (CT)17 (CA)15 (CA)15 (GT)10(GA)32 (CA)21GAAA(GA)9 (CA)21GAAA(GA)9 (TC)32 (CA)11 (CA)13 (TC)17 (GT)16 (CA)31(CGCA)12 imp. 43.

Primer pairs were designed for 98 clones. obtained after two size selections. 1995a. Van Deynze et al. tauschii compared to a phage library of wheat described by Röder et al. which means they amplified fragments of the expected size in Ae. tauschii is presented in Fig. 1995b. tauschii based on sequence data. Forty-eight primer sets detected 55 loci. but the majority of microsatellites were in the range of 10– 20 repeated units. The first constructed plasmid libraries were ineffective because of the high proportion of clones with small insert sizes. With an average insert size of 350 bp. the size of amplifying fragments in wheat differed greatly from amplifying fragments in Ae. The use of the methylation-sensitive restriction endonuclease PstI for library construction was preferable to other restriction enzymes (Röder et al. The number of positive clones after hybridization with poly(GA) and poly(GT) varied in different plasmid libraries. Almost half of the sequenced clones were discarded for the following reasons: 18% of the clones did not contain any microsatellite or the microsatellite was too small (less than 10 repeated units). Therefore.Pestsova et al. tauschii was pre-digested with PstI and a low-molecular-weight fraction was used for library construction. 1995c. In the presented map. The microsatellite markers cover all seven of the D-genome chromosomes. 149 primer pairs were tested (Table 1). and 7% of the clones contained a repeated DNA close to the microsatellite. There was no significant difference in the efficiency of microsatellite isolation from a phage library of Ae. tauschii mapped on the D genome of wheat. The microsatellites are randomly distributed along the chromosomes. Ten markers were ordered at LOD scores higher than 2. tauschii. Of these. many microsatellites were too close to one of the cloning sites and it was not possible to design the primers. Forty-nine percent of the clones containing microsatellites with more than ten repeats harboured GA repeats. the parents of the ITMI population. In spite of the fact that many clones from the plasmid library contain microsatellites close to the cloning site. Seven percent of the clones contained GA and GT repeats in combination. This library was chosen for further microsatellite isolation. Marino et al. GA and GT motifs were adjacent or interrupted with AT and GC repeats. The wheat D-genome microsatellite map Polymorphic microsatellites were placed into a genetic framework RFLP map previously created for the ITMI population (Nelson et al. In this case.21% of total number of tested clones) was observed in the PstI–MboI library. All primer pairs that were functional in Ae. A comparison of primer design efficiency between the phage library of wheat and the plasmid library of Ae. To achieve a higher efficiency for the subsequent libraries. Thus. This was suggested by new results during ditelosomic analysis of wheat microsatellites. since it requires up to three rounds of hybridization to purify positive phage plaques and for the conversion of phages into plasmid clones. (1998). The highest number of positive clones (0. in 24% of the clones the microsatellite was too close to one of the cloning sites. Forty-eight primer pairs (74% of functional primer pairs) detected polymorphisms between ‘Opata 85’ and synthetic wheat ‘W7984’. This step allowed an increase in the size of inserts. The length of the isolated microsatellites varied from 4–69 repeated units. the proportion of markers useful for primer design was approximately equal in these two libraries. 1. tauschii amplified well in hexaploid wheat. 42 loci amplified with 40 primer pairs mapped on the D genome of wheat. The number of markers varies from three on chromosome 4D to nine on chromosome 5D. and consequently the number of clones useful for primer design. The number of designed and functional primer pairs and number of mapped microsatellite markers isolated from this library are presented in Table 1. The availability of robotic systems makes it feasible to analyze large numbers of plasmid clones faster and more efficiently than previously. tauschii genome contains GA or GT dinucleotide repeats every 220 kb. 1996). 50% of primer pairs amplified one or several additional monomorphic fragments. They mapped either to homoeologous or nonhomoeologous loci (Table 3). and 44% of the clones harboured GT repeats. Microsatellite marker development In total. or nothing. tauschii. and the other markers were assigned to the most likely interval. All mapable fragments in the range 75–300 bp were scored and integrated into the map. that is.5. with the exception of a slight clustering in the pericentromeric region of chromosome 3D. Linkage group Xabc172a–Xcdo482 was moved from the end of the 3DS linkage group to the 3DL linkage group. Initially. 1995. Five primer sets were mapped on two sites and one primer set on three sites. monomorphic fragments of the wrong size. DNA of Ae. 695 Results Efficiency of different libraries It was shown earlier that the isolation of microsatellites from hypomethylated regions of the wheat genome increased the proportion of useful markers almost two-fold. Sixty-five primer pairs (44%) were functional. 51% of all sequenced clones obtained from plasmid libraries. Development of microsatellites from phage libraries is a time-consuming technique. tauschii is presented in Table 2. Only 30% of the polymorphic primer pairs amplified exclusively the expected fragment. In some cases. a second size selection after digestion with Sau3A or MboI was performed. 1998). and 20% of primer pairs amplified one or several additional polymorphic fragments. the low-copy fraction of the Ae. A molecular linkage map of the wheat D genome containing 42 microsatellite loci isolated from Ae. In total. 1998). In several cases. approximately 150 000 recombinant clones from different plasmid libraries were analyzed and 240 positive clones were selected. one change was made in the framework from the previously published wheat microsatellite map constructed for the same mapping population (Röder et al. Chromosomal location of nonpolymorphic markers The chromosomal location of nonpolymorphic markers was © 2000 NRC Canada . The remaining primer pairs amplified either a smear. Primer pairs were constructed for microsatellites containing more than 10 repeats. the majority of microsatellite markers isolated from Ae. and the other loci mapped on the A and B genomes of wheat (Table 3). microsatellite markers were isolated from lambda phage libraries of Ae.

J. the observed differences were up to 20 bp but in some cases. The application of microsatellites from one species for the study of the other species raises the question of whether amplification products from the second species contain microsatellites. and for the verification of the authenticity of intervarietal chromosome substitution lines of wheat (Pestsova et al. In total.. Xgdm115-5B. A. urartu (V.. the flanking regions of the microsatellites in these two genomes may be divergent. these amplified fragments may contain no microsatellite sequence. tauschii germplasm (Pestsova et al. S. tauschii has a high potential as a source of microsatellite markers for the D genome of wheat. This work was supported by the Deutsche Forschungsgemeinschaft (grant Ro 1033/1-3). Nasuda.. T.. 9 functional markers out of 65 (14%) detected multiple loci. 2000 determined on nullitetrasomic lines of ‘Chinese ‘Spring’. microsatellites isolated from Ae..A. Sorrells.R.. Xgdm1343A. Xgdm 34-4D.and B-genome chromosomes. 1994. Long tomato microsatellites are predominantly associated with centromeric regions.K. 2000a). Development of a chromosomal arm map for wheat based on RFLP markers. (1998) reported that 80% of functional microsatellites isolated from wheat were polymorphic in the ITMI population. 1999. 1999). Discussion We have isolated 65 functional microsatellite markers from Ae. It was previously shown that the PCR products from barley and rye corresponding to most wheat microsatellites contain either no microsatellite sequence or a very short microsatellite that is too small to be detected by the dot-blot hybridization (Röder et al.. 19: 137–144. tauschii (Pestsova et al. S. Fritz. intimate association of microsatellite repeats with retrotransposons and other dispersed repetitive elements was reported for barley (Ramsay et al. boeoticum. Xgdm34-4D. Appl. Xgdm87-2B. Gill. 2000b).S. M. Considering the high polymorphism of microsatellites. References Anderson. 1999). Korzun personal communication). some microsatellite markers undetectable on the D genome would then amplify from the homoeologous loci on the A or B genome. for the mapping of the induced sphaerococcoid mutation gene in T. 1992. 1995). At the same time. Röder et al. (2) Alternatively. Assignment of 30 microsatellite loci to the linkage map of Arabidopsis. tauschii. L.N.. Taking into consideration the homology of all three wheat genomes. and Tanksley. 43. Theor. W. T.. 2000b). tauschii are different. it should be expected that the sizes of amplifying fragments from wheat and Ae. The lower figure for the D-genome markers reflects the lower amount of polymorphism in the D genome of the ITMI population. Boyko. Several of them marked loci on the A and B genomes in addition to the main homoeologous locus on the D genome. microsatellite marker Xgdm68 revealed one polymorphic fragment on chromosome 5D. In the present study. Bell. 1996). Ziegle. The microsatellites from the D genome could probably spread throughout the other wheat genomes as a part of retrotransposons. the size decrease of the mapped fragments in wheat was greater than the whole length of the microsatellites. J. C. It is interesting that 24% of the polymorphic loci and 59% of the nonpolymorphic loci were mapped on the A and B genomes of wheat. and Ganal. wheat microsatellites were highly effective in detecting polymorphism among T. Mickelson-Young. tauschii accessions (Pestsova et al. The obtained data confirm the idea that Ae. J.. © 2000 NRC Canada . M. 2000). It was possible to assign 22 loci amplified with 19 primer sets (Table 4).696 Genome Vol. The second possible reason for the decrease of the amplified fragment size is the presence of deletions in the flanking regions of the microsatellite. Acknowledgements We thank Dr. In the case of seven markers. T. Genomics. 2000b). aestivum (Salina et al. 42: 536–544. Raupp.S. In conclusion. and Xgdm147-6B. whereas homoeologous chromosomes 5A and 5B carry nonpolymorphic fragments. E. Three primer sets amplified two nonpolymorphic fragments from either homoeologous or nonhomoeologous chromosomes. For example. There are two probable explanations for this finding: (1) The microsatellites present in the D genome of Ae. tauschii sequences are as useful for wheat genome analysis as markers from hexaploid wheat. Ten nonpolymorphic markers were located on D-genome chromosomes. Genome. Generally. Forty-two (76%) of polymorphic Xgdm loci were integrated into the framework map of the D genome. Victor Korzun for preparing a phage library and Angelika Flieger for excellent technical assistance. Y. 1998). All primer pairs that were functional in Ae. Ogihara.J. Areshchenkova. Xgdm3-5D. Singh. tauschii were mapped on wheat. K. Extra high mutation frequency within the flanking regions of microsatellites due to insertions and deletions was reported for sweet potato (Buteler et al.D. It was shown that microsatellite markers mapped to homoeologous as well as nonhomoeologous loci of the wheat genome.W. A large increase in the length of the PCR product could be explained by the expansion of the microsatellite. D. tauschii fragments. and 74% of the functional primer sets were polymorphic between the parents of the ITMI mapping population.V. Recently.. It is possible that nonhomoeologous loci are due to a large portion of ancestral transposable elements in the Gramineae genomes (Röder et al. Xgdm133-4D. J. which was also observed with RFLP markers (Marino et al.. tauschii may be absent or deleted in the D genome of wheat. and Xgdm40-4D assigned by nullitetrasomic analysis detected a high level of polymorphism between different accessions of Ae. 83: 1035–1043.E. Microsatellite markers that are nonpolymorphic in the ITMI mapping population can reveal polymorphism in other genetic stocks. tauschii amplified well in hexaploid wheat.. Therefore.. and Ae. A decrease of the PCR product length is not always accounted for by variation in the repeat numbers. monococcum. S. microsatellite markers developed from Ae. Genet. Hassawi. It has been shown that microsatellite markers Xgdm29-2D. This is demonstrated by the fact that they were already successfully used for the analysis of Ae. the size of amplifying fragments from wheat differed greatly from the Ae. The remaining markers were mapped exclusively on the A. and Ecker.

Ganal.W. J. M. Theor. Bernard. R. 1995. 2000a. B. Macaulay. 1998. 39: 277– 287. Genet.. Powell. Molecular mapping of wheat: Major genes and rearrangements in homoeologous groups 4. A microsatellite map of wheat.S. E.. Jarret. J. A... 246: 327–333. P..R.C. Fahima.S. Lu. 5. Application of microsatellite markers to distinguish intervarietal chromosome substitution lines of wheat (Triticum aestivum L. K. V. Genet. E... and Appels. Tanksley.. and Röder.. Lu. E.S. The origin of Triticum spelta and its free-threshing hexaploid relatives. Y.T.S. Grama. W.J. 1996. Sorrells. 36: 511–514..J...E..S. M. Leroy. Molecular mapping of Rht8 on the short arm of chromosome 2D of bread wheat (Triticum aestivum L. Genome. Dubcovsky.E. A. and Leroy. J.. Tixier.. J. Worland. J. Korzun.. Sorrells. 141: 721–731. C. E. and Röder. and Nevo. 2000. Hammer. and Röder. Nelson. Kang. Genet..H. Lab. Appl. Gill. Sorrells. Theor. Abrahamson. A. Taramino. 107–116..R. and Saghai-Maroof. 19: 889–890. Appl. M.). M.. 96: 187–195. E. M. J. Börner. C. Genetics. Theor.S. DvoÍák.E.E.J. Korzun. Appl. Börner. Salina. and Ganal. W. Röder. Autrique.E. A.. A.. V. Part I. Euphytica.. 27: 445– 450.Pestsova et al. M. 1: 174–181.R. E. Sorrells. R.. A.W. R. Ramsay.. C.I. M. K. Röder. J. Theor. V. Leroy. Genetic analysis of the dwarfing gene (Rht8) in wheat. L. Cardle. Merlino.. Theor.S.S. Sorrells.. Maystrenko. Y.. V.. P. J. Genome. Hortic. M.. E. and suggestive negative crossover interference on chromosome 1B. E. Lagudah... em. Theor... M. Genomics.. Marino.S.S.S. P. M. and Raupp. 1999.. 2000b. N. Appl. B.. 96: 1104–1109. Thell. M.. Maestri. Peil. Comparative microsatellite mapping of the induced sphaerococcoid mutation genes in Triticum aestivum.C..N. König. 1987.. M. M. Liu. 1996.E. Molecular mapping of wheat: Homoeologous group 3.. and Leroy.E.. Microsatellite tagging of the stripe-rust resistance gene YrH52 derived from wild emmer wheat. I. variability and chromosomal location of microsatellites in wheat. and Röder. 1998. Nelson..D. Appl. Mol... Genet.. J.. G..W. J. 1996.. Integrated map of AFLP. Agric.. Appl. 38: 525– 533. Appl. 17: 415–425.S. E.. Biyashev. Pot. Z. Grama. J. Plaschke.E. Ganal. 100: 686–689. and Law.. D.. Goncharov.. A.. MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genet.H.V.. Lu. 99: 16–26. 1946. Genome. Y. J. Appl. Atkinson. Barlow.. L... 97: 370–380.L. M.W.. Simple sequence repeats for germplasm analysis and mapping in maize.R. Tuleen. and Newburg. Laikova. Ivanissevich.H. Gill. 1987. Sequence characterization of microsatellites in diploid and polyploid Ipomoea. 1995b.. and Tingey. and Anderson. Buteler. Genet. Genome. Theor. M. Faris. 1995a. 1999. Y.L.. Genet... J.. Detection of genetic diversity in closely related bread wheat using microsatellite markers.. Nelson.. McCouch.. E. and 7.C. S. M. Abundance. T. Theor.. Peng.L. J. M. S. Plant J. Microsatellite analysis of Aegilops tauschii germplasm. Appl. Genet. R. K. Schumann. Direct genetic transfers from Aegilops squarrosa L. Pestsova. Van Deynze. A. 93: 869–876. Röder. 1944. Atkinson. S.... the D-genome progenitor of bread wheat. Appl. Van Deynze.A. 1998. Med. Wendehake. A.W. Bernard.E.. McFadden.. Appl.G. Korzun... one of the ancestors of vulgare wheat. B. Leonova. M. Pestsova. Ronin. Genet. Leroy. A. S. The application of wheat microsatellites to identify disomic Triticum aestivum–Aegilops markgrafii addition lines.. M.I.. 1995.. Gill. Kihara. SSLP and RFLP markers using a recombinant inbred population of rice (Oryza sativa L.C.. M.M. V.S. Crop Sci. Genet. Lapitan. Theor. 98: 862–872. Cho.A. A highdensity genetic linkage map of Aegilops tauschii.C. E.. 101: In press. W... M.. and Sears.. 697 Nelson. Börner. M. J...). N. Hered.D. Molecular mapping of wheat: Homoeologous group 2. © 2000 NRC Canada .H. Genet. Korol. Autrique. Molecular genetic maps of the group 6 chromosomes of hexaploid wheat (Triticum aestivum L. Plaschke.U. A.Y. Microsatellites confirm the authenticity of inter-varietal chromosome substitution lines of wheat (Triticum aestivum L.. Maystrenko..N....S. Röder. A. and Eun..R. Y. Schubert. and Röder.W..).S. Lander. Van Deynze.. Korzun. Intimate association of microsatellite repeats with retrotransposons and other dispersed repetitive elements in barley. A.I. Lincoln. 149: 2007–2023... Negre. and Röder.S. Weissenbach.. M. Appl. 1998. to hexaploid wheat. H.E. Groenen. L..H. J. M. and Ganal. G.. C. Molecular-genetic maps for group 1 chromosomes of triticeae species and their relation to chromosomes in rice and oat.R. V.. M. 1999. 38: 516–524. Worland.J. Genetics. Chem... 95: 149–155. V.B. E. and LaBonte. P..E.. 39: 359–366.H... Discovery of the DD-analyser. P. M. Korzun. M. S. 38: 45–59.).. McCouch. A.E. Nelson. Börner.. Plaschke. Y. Gen. E. 1995c. Korzun. Microsatellite DNA polymorphism divergence in Triticum dicoccoides accessions highly resistant to yellow rust. A. Lopes. Theor. A. and Nevo. Li.. 91: 1001–1007. and Waugh..C. Genome. S. M. V. P. Genet. M. 99: 123–132. Triticum dicoccoides.. M. 1998. O. Sorrells.A. 101: In press. M. Lu. S. M. Salina. Röder. 37: 81–89. Genet. Kuiper. Morgante. 1998. Weber. Law. Van Deynze. 1997. Clin. Korzun. S. and Hart. Ganal. O.... Theor. M. Dahan. 1999. Fahima.. 1995.. Namuth.S. N. J. L. E. M. D. Green. 96: 138–146. J.M. M... Y. T.). Daly. Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Ph.S. and Gill... Theor. The Human Genome Project: From mapping to sequencing. M.E.

Sign up to vote on this title
UsefulNot useful