Vous êtes sur la page 1sur 40

Université Aix-Marseille Atelier Initiation à la recherche 1 MBVB

Interactions protéine-protéine et cellulosomes


Sandrine Pagès-Bruno - Stéphanie Perret

Les polymères végétaux représentent une part majeure de la biomasse terrestre, et parmi
ces polymères la cellulose est le plus abondant et le plus récalcitrant à la dégradation
biologique du fait de sa structuration cristalline et de son intrication avec d’autres polymères
dans les parois. La dégradation de ces polymères constitue donc un phénomène clé du cycle
du carbone. De plus l’utilisation de la biomasse végétale comme ressource renouvelable pour
la production d’énergie présente un intérêt croissant face à la réduction des ressources
énergétiques fossiles et à l’augmentation des gaz à effet de serre.
L’étude des mécanismes de dégradation des polymères végétaux mis en place par les
microorganismes cellulolytiques constitue donc un enjeu de recherche fondamentale doublé
d’un potentiel d’application très important en développement durable.
La cellulose est un polymère linéaire de glucoses liés par des liaisons de type β-1,4
(Figure 1). Ce substrat est très récalcitrant à la dégradation du fait de sa structure compacte.
Les molécules sont associées entre elles par l’intermédiaire de liaisons hydrogène pour
constituer de véritables réseaux cristallins aux seins de microfibrilles de cellulose.

Figure 1 : molécule de cellulose

Dans les parois végétales les fibres de celluloses sont en étroite association avec
d'autres polymères et notamment des molécules d'hémicellulose. Les hémicelluloses
constituent une classe hétérogène de polysaccharides, souvent ramifiés et constituant une
matrice liée étroitement, de manière non covalente à la surface de chaque microfibrille de
cellulose.

Deux exemples de constituants de l’hémicellulose :


- Le xylane ou arabinoxylane : son squelette est composé de sous-unités D-
xylopyranose liées par des liaisons béta-1,4. Les molécules de xylose peuvent être
acetylées et/ou substituées par des groupements saccharidiques de type acide
méthylglucuronique ou arabinose. Les molécules d’arabinose peuvent être elle-même
substituées par des molécules d’acide phénolique (acides férulique ou coumarique).

1
- Le mannane : constitué de sous-unités D-mannopyranose reliées par des liaisons béta-
1,4 . Le mannane peut être ramifié par des résidus D-galactose en alpha-1,6 avec des
ratios mannose/galactose variables, on parle alors de galactomannane.

Les enzymes de dégradation des principaux polysaccharides pariétaux


Cette biodégradation est essentiellement accomplie par des microorganismes. Ceux-ci ont
développé des systèmes de dégradation très performants formés d’un grand nombre d’enzymes
de spécificités différentes. Ces systèmes comportent à la fois des cellulases, mannanases,
xylanases, pectinases… Ils peuvent être constitués soit de protéines indépendantes et sont
désignés comme systèmes non complexés soit de protéines liées autour d’une protéine
d’assemblage pour former des complexes extrêmement stables appelés cellulosomes.
Les enzymes impliquées dans la dégradation des polysaccharides des parois végétales
sont répertoriées dans la classification internationalement reconnue, établie par P. Couthino et
B. Henrissat à l’AFMB à Luminy (classification établie sur la base d’homologie de séquence)
qui regroupe 125 familles de glycosyl-hydrolases (GH), 22 familles de polysaccharide-lyases
(PL) et 16 familles de carbohydrate-estérases (CE). (http://www.cazy.org/).

Les modules catalytiques

Les modules catalytiques des cellulases appartiennent aux familles GH 5, 6, 7, 8, 9, 12,


44, 45, 48, 51, 61 et 74. On distingue deux types de cellulases : les endocellulases et les
cellulases processives. Les endocellulases hydrolysent des liaisons glycosidiques à l’intérieur
des chaînes de cellulose de façon aléatoire. Les cellulases processives, après hydrolyse de la
première liaison glycosidique, vont glisser le long de la chaîne et cliver le substrat à intervalle
régulier, libérant ainsi principalement du cellobiose. L’attaque initiale peut se faire sur
l’extrémité d’une chaîne, on parle alors d’exocellulase ou à l’intérieur d’une chaîne, on parle
d’endocellulase processive. Les modules catalytiques des xylanases sont principalement classés
dans les familles 10 et 11.
Il a été démontré que le repliement général de l’enzyme et le mécanisme catalytique
(rétention ou inversion de la configuration de carbone anomérique) sont conservés pour tous les
membres d’une même famille. Cependant, au sein d’une même famille, l’architecture
structurale du site actif n’est pas forcément la même et des spécificités de substrat différentes
peuvent être rencontrées. La famille GH5 regroupe par exemple des cellulases, mannanases,
lichenases, galactanases …
Les CE catalysent la dé-acétylation des chaînes principales de certaines hémicelluloses et
pectines. On trouve par exemple des acétyl-xylane-estérases, féruloyl-estérase, chitine-
déacétylase, pectine-méthyl-estérase … .
Les PL constituent un groupe d’enzymes qui catalyse le clivage des polysaccharides,
principalement la pectine, via un mécanisme de béta-élimination. Le sucre de l’extrémité non
réductrice nouvellement généré est alors insaturé. On trouve par exemple des pectate ou
pectine-lyases et rhamnogalacturonane-lyases.

Les modules d’interaction au substrat

64 familles de CBM (« Carbohydrate Binding Module ») ont été décrites


(http://afmb.cnrs-mrs.fr/CAZY/). Ces CBM sont affins pour un ou plusieurs sucres, solubles ou
insolubles. Ceux ayant une forte affinité pour la cellulose cristalline sont rangés dans un
nombre limité de familles. Certains CBM (CBM6 et 22 par exemple) affins pour le xylane ou
certains composés spécifiques des hémicelluloses (comme des béta-glucanes) se retrouvent
systématiquement associés à des modules catalytiques de type xylanase ou mannanase.

2
L’interaction d’une enzyme avec son substrat est une des premières étapes du processus
d’hydrolyse. Les enzymes des systèmes cellulolytiques non complexés possèdent toutes au
moins un CBM. Beaucoup d’enzymes cellulosomales (systèmes cellulolytiques complexés)
n’en n’ont pas. Leur adressage au substrat est assuré par le CBM3 du facteur d’assemblage
qui possède une très forte affinité pour la cellulose cristalline. Certaines possèdent toute fois
leur propre CBM.

Les modules dockérine

Les enzymes incorporées dans les cellulosomes contiennent un module dockérine qui est
impliqué dans l’édification de ces complexes. Ce module interagit avec un module de la
protéine d’assemblage qui est appelé module cohésine. Tous les modules dockérine mis en
évidence à ce jour sont constitués de deux segments (1 et 2) de 22 résidus chacun, conservés et
séparés par une séquence de jonction de 5 à 11 résidus non conservés.

Les micro-organismes cellulolytiques


Les micro-organismes cellulolytiques ont développés des systèmes enzymatiques
sophistiqués pour dégrader la cellulose et les polymères associés. Parmi, ces organismes,
certains champignons et bactéries anaérobies stricts produisent des complexes multi-
enzymatiques appelés « cellulosomes ».

C. cellulolyticum est une bactérie mésophile, anaérobie stricte, à Gram positif et mobile
grâce à des flagelles péritriches. Elle a été isolée à partir d’herbe en décomposition
(Petitdemange et coll., 1984). Cette bactérie est capable d’utiliser différents sucres simples tels
que l’arabinose, le cellobiose et le glucose, et des sucres complexes tels que la cellulose et le
xylane comme source unique de carbone et d’énergie.

C. cellulolyticum synthétise des complexes multi-enzymatiques de 600 kDa appelés


cellulosome. Des complexes similaires sont produits par d’autres clostridies comme par
exemple C. thermocellum, C. cellulovorans et C. josui. Les sous-unités catalytiques du
cellulosome sont attachées à une protéine d’assemblage de 160 kDa, dépourvue d’activité
enzymatique, appelée CipC (Figure 2). L’attachement de chaque enzyme au facteur
d’assemblage se fait par l’interaction des modules dockérines des enzymes, aux modules
cohésines de CipC (Pagès et al, 1996). Le séquençage du génome a montré l’existence d’une
soixantaine de gènes codant pour des enzymes à dockérines. (Blouzard et al 2010a).

CBM X2

Domaine catalytique
d’une cellulase Cohésine de CipC
dockérine
Figure 2 : représentation schématique d’un cellulosome
3
III But de l’atelier :
 Produire ET purifier une enzyme du système cellulolytique de C. cellulolyticum : la
mannanase Man5K et une miniprotéine d’assemblage : mini CipC1 chez E. coli.
 Démontrer le mode d’édification des complexes enzymatiques par l’interaction
spécifique entre les modules « dockérines » de l’unité enzymatique Man5K et les modules
« cohésines » de la protéine d’assemblage du complexe (protéine CipC).

Programme de l'atelier:

1. Le clonage de gènes codant pour la mannanase 5K et MinicipC1 dans un vecteur


d’expression.
2. La production par E. coli de ces protéines (surproduction de protéines hétérologues par le
colibacille).
3. La purification des ces protéines recombinantes
4. Mettre en évidence les interactions protéines-protéines a l’origine de l’édification des
cellulosomes.

Références
Blouzard JC, Coutinho PM, Fierobe HP, Henrissat B, Lignon S, Tardif C, Pagès S, de Philip P. Modulation of
cellulosome composition in Clostridium cellulolyticum: adaptation to the polysaccharide environment revealed
by proteomic and carbohydrate-active enzyme analyses. (2010a) Proteomics. 10(3):541-54.

Blouzard JC, Valette O, Tardif C, de Philip P. Random mutagenesis of Clostridium cellulolyticum using a
Tn1545 derivative. (2010b) Appl Environ Microbiol. Apr 30. [Epub ahead of print]

Pagès S, Bélaich A, Tardif C, Reverbel-Leroy C, Gaudin C, Bélaich JP (1996). Interaction between the
endoglucanase CelA and the scaffolding protein CipC of the Clostridium cellulolyticum cellulosome.. J
Bacteriol.178 : 2279-86.

Perret S, Bélaïch A, Fierobe H-P, Bélaïch J-P et C Tardif. Towards designer cellulosomes in clostridia :
mannanase enrichment of the cellulosomes produced by Clostridium cellulolyticum. (2004a) J Bacteriol
186:6544-6552.

Perret S, Maamar H, Bélaïch J-P et C Tardif. (2004b) Use of antisense RNA to modify the composition of
cellulosomes produced by Clostridium cellulolyticum. Mol Microbiol 51: 599-607.

4
TP M1-MBVB Atelier interaction protéine-protéine
Octobre 2012

Matin Après midi 14h


L 15/10 - Présentation atelier.
S. Pagès - Amplification des gènes man5K et miniCipC1.
- Contrôle sur gel d'agarose des amplicons.
- Ensemencement culture pour préparation d’ADN plasmidiques (pET22b+ et 28b+).
M 16/10 9h15 - Minipréparation d’ADN plasmidique et estimation des concentrations.
S. Pagès - Purification des amplicons Et contrôle sur gel.
- Digestion du fragment de PCR et de l’ADN plasmidique.

Mc 17/10 9h00 -Purification des vecteurs et inserts après


S. Perret digestion enzymatique. TD Bioinformatique
-Contrôle sur gel d’agarose.

J 18/10 9h15 -Ligature.


S. Pagès -Transformation de cellules E. coli compétentes.
V 19/10 9h15 - PCR sur colonies.
S. Pagès - Discussion et analyse des résultats.

L 22/10 9h15 - Pré culture des souches d'expression BL21DE3 recombinantes, suivi de cultures.
S. Pagès - TD production/purification.
- Préparation des Fioles à toxines pour la production de protéines recombinantes.

M 23/10 9h00 - Suivi de culture et induction.


S. Perret - Préparation des solutions et du matériel pour la purification.
- Préparation des gels d’acrylamide.

Mc 24/10 9h00 - Centrifugation des cultures.


S Perret - Casse et purification des protéines recombinantes.
- Préparation des échantillons pour SDS-PAGE.
- Chargement des gels SDS-PAGE et coloration.

J 25/10 9h00 - Décoloration et analyse des gels.


S. Perret - Dialyse et concentration des protéines.
- Evaluation des concentrations des protéines recombinantes purifiées (DO 280 et dosage de
Lowry).

V 26/10 9h00 - Gel bilan dénaturant des protéines pures.


S. Perret - Etude des interactions protéines/ protéines.
- Far western blot (du gel au transfert.)

L 29/10 9h00 - Gel natif


S. Perret - Far western blot (fin)

M 30/10 9h00 - TD Bilan - Travail personnel


S. Perret
M 31/10 ORAUX
S. Pagès / S. Perret

5
Recommandations générales

Attribuez vous un numéro de groupe, notez bien ce numéro sur tous vos tubes et boites, il vous
servira à identifier vos échantillons…

Lorsque vous avez à réaliser un mélange réactionnel, il est souhaitable de commencer par
déposer dans le tube le volume le plus important. Cette règle devra s’appliquer pour tous les
mélanges réactionnels que vous aurez à réaliser au cours de ces TP.

Si ce n’est pas précisé dans le polycopié, par défaut, n’utilisez que des tubes Eppendorf de
1,5ml. Les tubes de 0,5 sont utilisés pour les réactions de PCR.

Laverie : enlevez les traces de marqueur sur la vaisselle sale, rincez et déposez la vaisselle
dans les bassines de la laverie.

Lire la veille le travail a faire pour le jour J. La numérotation 1) 2) etc… du travail a réaliser
quotidiennement ne reflète pas forcement l’ordre dans lequel il est judicieux de proceder.
Anticipez vos expériences, prévoyez à l’avance les bains-marie, étuves …

Les déchets biologiques liquides sont à traiter à l’eau de javel


Les déchets biologiques solides (microbiologie) sont à évacuer dans la poubelle autoclave
Les déchets BET solides sont évacués dans la poubelle jaune, paillasse BET
Les déchets BET liquides sont récoltés dans un bidon prévu à cet effet.

Utilisation du BET : Ce composé très toxique doit être manipulé avec des gants. Protégez
vous, et protégez vos collègues : si vos gants sont souillés, ne souillez pas les pipetmans,
poignées de porte…

Centrifugeuses : équilibrez les rotors avant utilisation

De manière générale, pensez à économiser les consommables à votre disposition

6
SOUCHES ET PLASMIDES UTILISES

SOUCHES DE COLIBACILLE
DH5α α
F-, ø80dlacZ∆M15, ∆(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rk-, mk+), phoA,
supE44, λ-, thi-1, gyrA96, relA1
BL21(DE3)
F– ompT gal dcm lon hsdSB(rB- mB-) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])
(an E. coli B strain with DE3, a λ prophage carrying the T7 RNA polymerase gene and lacIq.
Transformed plasmids containing T7 promoter driven expression are repressed until IPTG
induction of T7 RNA polymerase from a lac promoter).

PLASMIDE
- pET22 b(+)
- pET28 a(+)
Voir fiche technique Novagen à la fin du poly.

Semaine 1 :
(BIOLOGIE MOLECULAIRE)_ Préparation des vecteurs

recombinants.
J1
1/ Amplification du gène codant pour Man5K et miniCipC1 par PCR.
Attention, travaillez près de la flamme pour utiliser ce matériel stérile. Les tubes et les
embouts non utilisés doivent rester stériles pour l’étape de transformation.

L'ADN chromosomique de Clostridium cellulolyticum a été purifié au préalable par les


enseignantes. Cet ADN servira de matrice pour la PRC.

séquences des amorces:

ManKNcoIdir 5’gattaCCATGGCGACTACATACAAACTTGG 3’
K5rev 5’ gggCTCGAGTCTGACTACGTCAGGATG 3’

CipCmat : CCCTATAcatatgGCAGGTACTGGCGTCGTA
Minic1rev : AACCAGctcgagTACTGCTACTTTAAGTTCCTTTG

Au cours du TD de bioinformatique vous apprendrez à analyser une séquence d’ADN,


dessiner des oligonucléotides, calculer leurs Tm respectifs etc…. d’ores et déjà vous pouvez
vous plonger dans la séquence des vecteurs pET et essayer de positionner les oligos sur les
séquences respectives.

Vous disposez de :

7
ADN génomique d’E. coli 1046 à 50 ng/µl.
oligo dir à 10 pmol/µl
oligo rev à 10 pmol/µl
dNTP 1 mM
tampon (X5)
solution de MgCl2 (50mM)
enzyme (The GoTaq® Flexi DNA Polymerase 5 U/µl).

Note : Toutes les ADN polymérases synthétisent l’ADN dans le sens 5'-3' et aucune n’est capable de commencer
la synthèse d'un brin de novo. Elles ne peuvent que rajouter des nucléotides à une extrémité hydroxyle libre (le
3'-OH du brin en cours de synthèse). Pour cette raison l'ADN polymérase a besoin d’une amorce (ou primer), sur
laquelle elle pourra ajouter de nouveaux désoxyribonucléotides.

The GoTaq® Flexi DNA Polymerase :


GoTaq® Flexi DNA Polymerase offers robust amplification equal to and in some cases superior to conventional
Taq DNA polymerase, allows optimization of MgCl2 concentration, and facilitates direct-to-gel analysis of PCR
products. The enzyme is supplied with a tube of 25mM MgCl2, allowing you to optimize the magnesium
concentration in your reactions. Two reaction buffers, Green and Colorless GoTaq® Flexi Buffers, are also
supplied. Both buffers contain a compound that increases sample density, allowing samples to sink easily into
the wells of agarose gels and making it possible to load your reaction directly onto a gel after amplification. The
5X Green GoTaq® Flexi Buffer contains two dyes (blue and yellow) that separate during electrophoresis to
monitor migration progress. The colorless buffer is used when direct fluorescence or absorbance readings are
required without prior purification of the amplified DNA.

Réalisez le mélange dans un volume de 50µl final, dans un tube de 0,2 ml:
ADN génomique 50 ng
Chaque oligo à 0,5µM chacun
dNTP, 0,1 mM
Tampon 1X
MgCl2 1,5mM
DNA polymérase, 2 U

Calculez les volumes nécessaires

Programme PCR :
94°C 30 sec 1 cycle
94 °C 30 sec
30 cycles ? °C 30 sec cette température varie en fonction du couple d’oligo utilisé.
72 °C ? min le temps d’élongation varie en fonction du couple d’oligo utilisé
72 °C 10 min 1 cycle

2/ Préparation d’une solution d’agarose en surfusion


Trois groupes vont préparer 400 ml d’une solution d’agarose à 0.8 % qui sera conservée à 60
°C. Ces solutions serviront tout au long de la première semaine de TP en fonction des besoins
collectifs. VOIR FICHE1

3/ Couler un gel
Un gel d’agarose doit être coulé. Ceci afin de vérifier après la PCR les amplifications
obtenues. VOIR FICHE1

4/ Vérification des produits PCR sur gel d’agarose.


Lorsque la PCR est terminée chaque groupe récupère son tube et se réfère à la FICHE 1 pour
préparer son échantillon.

8
Attention de ne pas jeter le produit PCR après vérification. Conservez le à -20 °C
A chaque migration d'ADN un ladder devra être déposé sur le gel.
Bench Top 1 Kb DNA ladder "Promega".

5/ Culture de souches recombinantes d’E. coli contenant les vecteurs pET22 et pET28.
Pour vos clonages vous aurez besoin de deux vecteurs: soit le pET22 soit le pET28. Ces
vecteurs seront extraits et purifiés à partir de souches d’E. coli recombinantes. Des cultures de
ces bactéries recombinantes doivent donc être réalisées la veille.
Chaque groupe va ensemencer 30 ml de LB stériles, a partir de la boite de pétri qui vous sera
fournie sur laquelle a été ensemencer les deux souches d‘E. coli recombinantes, auxquels il va
ajouter l’antibiotique adéquat. Déposer l’erlen dans une étuve a 37 °C sous agitation.

Les vecteurs que nous avons fournis sont des vecteurs recombinants. C'est-à-dire qu’ils
contiennent déjà, entre les sites NdeI/XhoI pour le pET22 et NcoI/XhoI pour le pET28, un
insert. Cet insert, devra être retiré, par digestion enzymatique, pour ne conserver que la partie
« vecteur » qui nous intéresse pour le clonage.

J2
1/ Purification du fragment PCR (gène man5K ou miniCipC1). Extraction à partir d’un
gel d’agarose.
Avant de soumettre votre fragment à la digestion enzymatique nécessaire pour le clonage dans
votre vecteur d’expression vous devez le « nettoyer » en enlevant toute trace de sels, de dNTP
etc …..Il peut également y avoir, minoritairement bien sur, des fragments d’ADN qui ont été
amplifiés de façon non spécifiques. Pour s’en débarrasser nous allons procéder a une
extraction d’ADN sur gel d’agarose.

9
Vous devez couler un gel d’agarose en utilisant un peigne à grandes dents. Faite migrer la
totalité de votre mélange PCR, en ajoutant bien sur du tampon de charge. Faites migrer puis
découper à l’aide d’un scalpel, sous table a UV, le petit morceau de gel contenant l’amplicon.
Cette étape sera réalisée sous le contrôle de l’enseignante. Déposer le fragment de gel dans un
tube eppendorf de 2 ml.

Le fragment d’ADN sera purifié suivant les instructions du kit "Wizard® SV Gel and PCR
Clean-Up System" qui vous sera fourni. Protéger une partie de votre paillasse avec du papier
de protection de paillasse « benchguard ». Manipuler avec des gants, et déposer tout le
matériel contaminé (tubes, pointes) dans un tube falcon de 50 ml. Ce dernier sera jeté a la fin
de la purif dans la poubelle à BET qui se trouve sous la hotte.
Après purification conservez bien votre tube contenant le vecteur.
Wizard® SV Gel and PCR Clean-Up System :
The Wizard® SV Gel and PCR Clean-Up System extracts DNA fragments of 100bp to 10kb from standard or
low-melt agarose gels in either Tris acetate (TAE) or Tris borate (TBE) and purifies PCR products directly from
an amplification reaction. Up to 95% recovery is achieved, depending on DNA fragment size. PCR products are
commonly purified to remove excess nucleotides and primers. This membrane-based system, which can bind up
to 40µ g of DNA, allows recovery of isolated DNA fragments or PCR products in as little as 20 minutes,
depending on the number of samples processed and protocol used. Purified DNA can be used for automated
fluorescent DNA sequencing, cloning, labeling, restriction enzyme digestion or in vitro transcription/translation
without further manipulation.

2/ Purification des plasmides pET= nimiprep d’ADN plasmidique


Référez vous au protocole du kit qui vous sera fourni. Etablissez votre propre protocole.
Faites le vérifier par l’enseignante avant de démarrer.

Note : En biologie moléculaire, une minipréparation ou miniprep est une technique permettant d'extraire une
petite quantité (100 ng à 5 µg) d'ADN sous forme de plasmide provenant de bactéries ayant subi une
transformation, le plus souvent effectué sur Escherichia coli.
Le principe de l'extraction est connu sous le nom de lyse alcaline. Cette méthode permet de préparer
sélectivement l'ADN du plasmide contenu dans les bactéries, tout en éliminant l'ADN du chromosome bactérien.
Le principe de cette méthode consiste effectuer la lyse des cellules au moyen d'un détergent (dodécyl sulfate de
sodium) en présence de soude, à pH 13. A ce pH très alcalin, l'ADN est dénaturé, c’est-à-dire que les deux brins
de la double-hélice sont séparés. On neutralise ensuite rapidement la solution, ce qui provoque la renaturation
brutale (réappariement des brins du duplex d'ADN). L'ADN chromosomique, très long (~10⁶ paires de base), ne
parvient pas à se réapparier complètement et forme des enchevêtrements insolubles. L'ADN plasmidique, court
(~10³ paires de base), parvient à se reformer et reste en solution. On sépare alors les espèces par centrifugation.
L'ADN plasmidique est alors concentré par précipitation à l'alcool. Différentes variantes ou améliorations de
cette méthode existent notamment dans un grand nombre de kits commerciaux. Ces derniers contiennent souvent
des petites colonnes de résine chromatographique échangeuse d'ion, permettant d'améliorer la pureté de l'ADN
obtenu. Pour éliminer les ARN, on ajoute fréquemment des ribonucléases qui vont hydrolyser sélectivement ces
acides nucléiques, en laissant l'ADN intact.

3/ Estimation de la concentration de l’ADN plasmidique


Dosage des acides nucléiques : Il est rarement nécessaire d'effectuer un dosage très précis et
dans la pratique une simple estimation de la concentration suffit.

10
Elle est effectuée par spectrophotométrie. Les bases puriques et pyrimidiques absorbant
fortement dans l'ultraviolet à 260 nm.
Une unité de densité optique à 260 nm (DO lue sur le spectrophotomètre) correspond à :
une solution d'ADN double brin à 50 µg/ml une solution d'ARN ou d'ADN simple brin à 25
µg/ml (attention ces valeurs s'appliquent à des acides nucléiques parfaitement purs et en
solution homogène)
Aussi il convient de rechercher une éventuelle contamination protéique car les protéines
absorbent non seulement à 280 nm mais aussi à 260 nm. Pour cette raison on effectue une
seconde mesure de DO à 280 nm. Un ADN pur doit avoir un rapport DO 260 / DO 280
compris entre 1,8 et 2.

Vous appliquerez cette procédure et méthode de calcul pour estimer la concentration de votre
ADN plasmidique.
Utiliser des cuves en quartz pour effectuer votre mesure.

4/ Gel d’agarose
Chaque groupe dispose de deux échantillons à vérifier sur gel d’électrophorèse :
-le vecteur pur surenroulé
-un fragment PCR purifié
Il sera donc nécessaire soit de couler un grand gel soit deux petits.
Référez vous à la FICHE 1 pour préparer vos échantillons

Note : l’ADN plasmidique peut apparaître sous plusieurs conformations notamment surenroulé et relâché. Mais
attention l’estimation de la taille du plasmide sur gel d’electrophorèse ne peut se faire que sur la forme linéarisée
du plasmide.

5/ Digestion des vecteurs et inserts


Note : Une enzyme de restriction peut couper un fragment d'ADN au niveau d'une séquence de nucléotides
caractéristique appelée site de restriction.
Chaque enzyme de restriction reconnait ainsi un site spécifique. Plusieurs centaines d'enzymes de restriction sont
actuellement connues, on en retrouve naturellement dans un grand nombre d'espèces de bactéries.

Vous devez savoir quelles enzymes de restriction vous devez utiliser. Discutez-en avec
l’enseignante avant de démarrer.
Les digestions enzymatiques seront réalisées dans des volumes finaux de 20 µl contenant:
- 5 µl de solution de plasmide ou 10 µl de fragment PCR purifié
- 2 µl de tampon réactionnel X 10
- 1 µl de chaque enzyme enzyme (5 unités)
11
- eau stérile QSP 20 µl.
Vous utiliserez des enzymes « FastDigest» à action rapide.

Attention, l'eau et les consommables (tubes, pointes) que vous utiliserez pour la préparation
de mélanges contenant de l'ADN doivent avoir été autoclavés afin de détruire toute trace de
DNAse.
Déposer vos échantillons a -20 °C.

J3
1/ Purification des vecteurs pET digérés par extraction sur gel d’agarose.
Vous devez couler un gel d’agarose avec un peigne à grande dents afin de purifier les vecteurs
d’expression. En effet, suite à la double digestion enzymatique des vecteurs recombinants
pET22 ou pET28 vous obtenez un mélange contenant le vecteur et l’insert. Il s’agit
maintenant de séparer ces deux fragments d’ADN. Pour cela vous devez séparer les deux
portions d’ADN sur gel d’électrophorèse. Vous procèderez comme la veille.
Après purification conservez bien votre tube contenant le vecteur.

2/ Purification du fragment PCR (gène man5K ou miniCipC1) après digestion


Avant de cloner votre fragment d’ADN dans votre vecteur d’expression vous devez le
« nettoyer » en enlevant toute trace de sels et d’enzymes de restriction.
Référez vous au protocole du kit qui vous sera fourni.

3/ Gel d’agarose
Chaque groupe dispose de deux échantillons à vérifier sur gel d’électrophorèse :
-le vecteur coupé pur.
-le fragment d’ADN coupé, pur.
Il sera donc nécessaire soit de couler un grand gel soit deux petits.
Référez vous à la FICHE 1 pour préparer vos échantillons

4/ TD Bioinformatique
Voir fiche 4
J4

1/ Préparation du mélange de ligature


Chaque groupe va préparer deux mélanges de ligature :
* mélange expérimental contenant le vecteur approprié et l'insert
* témoin négatif : contenant le vecteur seul

LigaFast™ Rapid DNA Ligation System :


The LigaFast™ Rapid DNA Ligation System is designed for the efficient ligation of sticky-ended DNA inserts
into plasmid vectors in just 5 minutes (blunt-ended inserts in as little as 15 minutes). Rapid ligation is based on
the combination of T4 DNA Ligase with a unique 2X Rapid Ligation Buffer. The LigaFast™ System is designed
to eliminate any further purification prior to transformation of ligated DNA. The specially formulated 2X Rapid
Ligation Buffer requires no additional ATP or Mg2+ addition prior to use.
Le protocole du fournisseur vous sera remis le jour du TP.
Homogénéisez vos mélanges avant l’incubation.
Si suite à cette homogénéisation si votre mélange s’est un peu dispersé sur les parois de votre
tube centrifugez quelques secondes votre échantillon.
12
Les mélanges sont incubés 30 min à température ambiante

2/ Transformation des cellules compétentes


Deux mélanges de transformation sont à préparer:
1 - Mélange "expérimental"
2 - Mélange "témoin négatif "
Ces mélanges sont réalisés en procédant comme suit:
Placer 3 tubes Eppendorf (2ml) au froid. Mettre 50 µl de cellules compétentes par tube.
Attention les cellules compétentes ont tendance à sédimenter. Agiter doucement le tube stock
avant de prélever.

Ajouter les 10µl de mélange de ligature dans le cas du mélange « expérimental ».


Ajouter les 10µl de mélange de ligature correspondant au « témoin négatif ».
Réalisez le choc thermique :
Laisser chacun des mélanges au froid pendant 30 min puis incubez les pendant 90 secondes à
42°C. Les tubes sont ensuite replacés dans la glace 3 à 5 min.

Note : In the standard procedure for artificial transformation of E. coli by plasmid DNA, cellular competence for
DNA uptake is developed by suspending the cells in ice-cold CaCl2 (50−100 mM). It is believed that CaCl2 helps
DNA adsorption to the lipopolysaccharide (LPS) molecules on E. coli cell surface; however, the binding
mechanism is mostly obscure.

Ajouter dans les 3 tubes 0,5 ml de milieu riche SOC préchauffé à 37°C.
Les 3 tubes sont placés à 37°C pendant 30 min.
Cette incubation est nécessaire pour permettre aux cellules ayant reçu un plasmide
d'exprimer le gène codant pour la β-lactamase (responsable de la résistance à l'ampicilline
(Ap).

Vous étalerez sur boite LB Amp ou LB Kana des fractions aliquotes des mélanges de
transformation en suivant les indications ci-dessous:
Témoin négatif : 1 boite 200 µl
Mélange expérimental: 2 boites avec 200 µl, une boite avec 100 µl.
Pour étaler : déposer quelques billes stériles dans votre boite de pétri, ajouter le volume à
étaler au centre de la boite puis disperser liquide à étaler de façon homogène en effectuant des
rotations. Tourner la boite de façon à faire tomber les billes dans le couvercle de la boite de
pétri et enlever les billes.

13
Incuber les boites à 37°C couvercle en bas dans la chambre chaude.
Placer les boites sur l’étagère du haut de la chambre chaude.

J5
1/ observation des boites
Observez vos boites et discutez des résultats avec l’enseignante.
Sortez une boite LB+ ATB de la chambre froide et faite la sécher.

2/ PCR sur colonies


La PCR sur colonie permet d'amplifier de façon simple de l'ADN de micro-organisme
(bactéries, archées ou levures) en inoculant directement la colonie dans le milieu réactionnel
de la PCR. Durant les premières étapes de dénaturation, les cellules sont lysées et leur ADN
est libéré dans le milieu réactionnel. L'ADN ainsi libéré peut alors servir de matrice.
La PCR sur colonie est utilisée notamment pour vérifier la présence de clones recombinants
après une transformation.
Confectionner les suspensions cellulaires:
A l'aide d'1oese stérile, et en conditions stériles, suspendre l'équivalent d'une colonie
bactérienne dans 30 µl d’eau distillée stérile ou moins selon la taille de la colonie. Discutez-
en avec l’enseignante. Choisissez 8 colonies sur la boite mélange expérimental et repiquez les
sur une nouvelle boite de pétri. Vortexer pour assurer une suspension homogène. Notez sur
cette boîte les colonies prélevées de 1 à 10.

Préparer le mélange enzymatique suivant :


44µl d’eau stérile
20 µl de tampon Green GoTaq® Flexi Buffers
4 µl de solution de MgCl2
10 µl de solution de dNTP 1mM
10 µl de solution d'oligo Dir 10 pmoles/µl
10 µl de solution d'oligo Rev10 pmoles/µl
2 µl de Taq polymérase (5U/µL)
Conserver cette solution dans la glace jusqu'à son utilisation.

Confectionner les mélanges d'analyse PCR:


14
Par tube de 0,2 ml: 9 µl de mélange enzymatique + 1 µl de suspension bactérienne.
Conserver dans la glace.

Programmer l'appareil PCR:


94°C, 5 min , 1cycle
94°C, 30 sec )
55°C, 30 sec ) 30 cycles
72°C, 1 min )
72°C, 5min, 1 cycle

Placer les tubes dans l’appareil PCR


Lancer le programme rapidement.
Lorsque le programme est terminé, retirer les tubes de l'appareil.
Ajoutez à chaque échantillon 1µl de solution de charge, et chargez les échantillons dans les
puits d'un gel d'agarose à 0,8% préalablement confectionné.

Semaine 2 :
(BIOCHIMIE)_ Production et purification des protéines

recombinantes.
J6
1/Ensemencement des précultures :
Ensemencez 20ml de LB avec une colonie d’une boîte donnée par les enseignantes,
BL21(DE3)[pET28mank] ou BL21(DE3)[pET22minicip]. La culture doit contenir
l’antibiotique approprié, kanamycine à 50µg/ml (pET28) ou ampicilline à 200µg/ml (pET22).
Pour cela vous disposez de solutions concentrées d’ampicilline et de kanamycine à 25mg/ml.
Calculez le volume d’antibiotique nécessaire à la culture.
Incubez la culture en présence d’antibiotique à 37°C sous agitation, suivez la croissance en
mesurant la densité optique à 600nm. Vous vous servirez de LB stérile pour effectuer le blanc
au spectrophotomètre. N’utilisez que deux cuves tout au long des mesures, une pour le blanc,
remplie de LB, que vous conserverez sur votre paillasse recouverte de parafilm, l’autre pour
les mesures de la culture. Cette dernière sera vidée dans la poubelle de javel et retournée sur
un papier absorbant. Quand la DO sera égale à 1, stockez votre culture à 4°C pour la nuit.
Attention, le spectrophotomètre est fiable pour des valeurs de DO comprises entre 0,05 et 0,6,
au-delà, pensez à diluer l’échantillon de culture à doser avec du LB pour mesurer
l’absorbance, et calculez l’absorbance véritable de votre culture en tenant compte de la
dilution.

2/TD :
Le TD portera sur la production de protéines recombinantes chez E. coli par le système pET et
sur la purification des protéines recombinantes par chromatographie d’affinité.

3/Préparation des fioles à toxine


Chaque groupe prépare 500 ml de LB selon la composition suivante :
15
Déposez un bouchon sur les fioles à toxines, et déposez dans l’autoclave.
Vérifiez que la table rotative est équipée du nombre de tulipes nécessaires pour fixer les fioles
à toxines de l’atelier dans la chambre chaude.
Vérifiez que la solution de glycérol à 60% est stockée à température ambiante
Calculez les volumes d’antibiotiques et de glycérol à ajouter le lendemain dans les fioles à
toxines. Lisez la suite du protocole, entrainez vous à calculer les volumes de culture à
prélever.

J7
1/Culture des souches BL21(DE3) [pET28manK] et [pET22miniCipC1], et induction.
En conditions stériles, supplémentez 1 fiole à toxines de 500 ml de milieu LB avec 10 ml de
solution de glycérol 60% et 200µg/ml d’ampiciline (solution mère à 25 mg/ml) pour la souche
BL21(DE3)[pET22MiniCipC1] ou de 50µg/ml de kanamycine (solution mère à 25mg/ml)
pour la souche BL21(DE3)[pET28Man5K] puis ensemencez la avec 5 ml de la préculture
ensemencée la veille.
Placer les fioles sur une table d’agitation rotative à 37°C. Après 2 heures de culture, mesurez
l’absorbance à 600 nm. Suivez la croissance jusqu’à atteindre la DO de 1,5. Après chaque
prélèvement, n’oubliez pas de vite réincuber votre culture à 37°C pour maintenir une
croissance optimale. Prélever l'équivalent de 0,5 ml de culture à DO 1 (voir avec un
enseignant). Placez-le dans un tube Eppendorf de 1,5 ml, centrifugez 5 min à 14000 rpm.
Retirer soigneusement tout le surnageant et conservez le culot à -20°C. Ce tube vous servira
de témoin de « culture non induite » (NI) lors des analyses ultérieures par SDS-PAGE.
Stocker la fiole de culture à 4°C jusqu’à 16h00.
A 16h00, ajoutez à la culture le volume de solution mère d’inducteur (IPTG 50 mM)
nécessaire pour obtenir une concentration finale de 250µM. Placez les fioles sur une table
d’agitation rotative à température ambiante jusqu’au lendemain matin.

2/ Préparation de la solution d’IPTG


Pour la classe, préparez une solution de 40ml d’IPTG à 50mM. Peser l’IPTG nécessaire à la
confection de 40 ml de solution (PM = 238,3g/mol). Dissoudre la poudre sous agitation dans
20 ml d’eau. Ajuster le volume de la solution à 40 ml dans une éprouvette de 50 ml. Filtrer la
solution à travers un filtre bactériologique (0,22 µm) à l’aide d’une seringue et en condition
aseptique. Récolter le filtrat stérile pour moitié environ dans 2 tubes Falcon stériles de 50ml.

3/ Préparation des solutions pour la purification des protéines recombinantes.


Préparez une solution de phosphate de potassium 1M pH 7 (200ml). Puis préparez chacun 500
ml de tampon à 50mM et à 12,5 M, ainsi que 100ml d’eau pour la purification de la protéine
miniCipC. Placez les solutions à 4°C
Les groupes qui produisent Man5K doivent préparer une solution de Tris HCl 30mM pH8,
200ml chacun, et 50ml de Tris HCl 30mM pH8 additionné d’imidazole 50mM.
Au cours de la journée, lisez attentivement le protocole de purification des protéines
recombinantes, et préparez les solutions nécessaires, placez les à 4°C. Préparez les montages
16
pour tenir les colonnes de chromatographie (seringue, tuyau, pince, coton, ou cafetière à
filtration avec une membrane en fibre verre et trompe à eau), familiarisez vous avec le
matériel. Préparez vous un plan d’expérience.

4/ Préparation du gel d’acrylamide dénaturant


Vous devez préparer un gel par groupe. Pour la confection du gel, référez vous à la fiche 2.
Coulez les deux parties, gel de séparation puis gel de concentration. Sans enlever le peigne,
emballez les gels dans du parafilm sans laisser d’air, et conservez les gels à 4°C.

J8
1/Purification des protéines recombinantes
Le lendemain matin, mesurez la DO finale des cultures. Prélever l'équivalent de 0,5 ml de
culture à DO 1 (voir avec un enseignant). Placez-les dans un tube Eppendorf de 1,5 ml,
centrifuger 5 min a 14000 rpm. Retirer le surnageant et conserver le culot à -20°C. Ce tube
vous servira de témoin de « culture induite ».
Centrifugez les cultures dans des pots de centrifugation de 250 ml et à 8 000 rpm pendant 15
min à 4°C (centrifugeuse Sorvall équipée du rotor GSA ou centrifugeuse Sigma). Pensez à
équilibrez les pots de centrifugation diamétralement opposés.
Videz le surnageant et resuspendez la totalité des cellules dans 20 ml de tampon froid
- Tris-HCl 30 mM, pH 8 pour la purification de la mannase5K,
- Phosphate 50mM pH7 pour la purification du miniCip.
Ces tampons auront été préparés la veille et conservés à 4°C. Placer la suspension homogène
dans un bécher propre de 50 ml. Les cellules seront cassées par sonication.
Centrifugez à 14000 rpm pendant 30 min à 4°C dans un rotor SS34 et dans la centrifugeuse
Sorvall. Transvasez le surnageant (extrait soluble) à la pipette et propipette dans un bécher
propre de 50 ml, et placez-le à 4°C. Le culot sera repris dans le même volume de tampon Tris
30mM ou phosphate 50mM, mélangez vigoureusement et conservez le mélange dans la glace.

2/ Purification de Man5K :
Cette protéine étiquetée par une queue de 6 histidines sera purifiée à l’aide d’une résine
Nickel-NTA. Vous disposez d’une seringue de 5ml à fixer à l’aide de la pince et de la
potence, adaptez à la sortie de colonne un petit morceau de tuyau et une pince pour fermer la
sortie. Au fond, déposez un peu de coton cardé tassé, puis ajoutez 1 ml de résine NI-NTA.
Placez un bécher sous la colonne pour recueillir les liquides passant à travers par gravité.
Toutes les solutions doivent être conservées dans la glace, ainsi que les fractions récoltées.
- Equilibrez la colonne avec 15 ml de tampon Tris HCl 30mM pH 8. Le montage peut
être conservé fermé à 4°C la nuit.
Attention, ne laissez pas sécher la résine
- Chargez la résine avec le surnageant de centrifugation obtenu après case des cellules.,
Récoltez dans un bécher propre la fraction « non retenue » qui passe à travers la
colonne.
- Lavez avec 20ml de tampon Tris HCl 30mM pH8, puis 5ml, mesurez la DO à 280nm
des 5ml passés à travers la colonne. Elle doit être proche de zéro pour pouvoir
17
commencer l’étape d’élution. Si nécessaire, lavez encore avec 20ml de tampon, et
remesurer la DO.
- Pour l’élution, fermez la sortie de la colonne et ajoutez 2ml de tampon Tris HCl
30mM additionné de 50mM d’imidazole, mélangez la résine avec cette solution à
l’aide d’une pipette Pasteur, rouvrez la sortie et récoltez cette fraction d’élution 1 dans
un tube propre, puis procédez de même encore deux fois. A la fin de l’opération, vous
aurez une fraction avant passage sur la colonne, une fraction « non retenu », et trois
fractions d’élution notés E1, E2, E3. Placez tous les tubes dans la glace.

4/ Purification de MiniCipC1 :
Cette protéine sera purifiée grâce à la présence du CBM qui interagit avec la cellulose
cristalline. Incubez l’extrait soluble avec 3g d’Avicel (cellulose cristalline en poudre) pendant
30 minutes à 4°C avec une légère agitation.
- Montez une cafetière à filtration avec une membrane en fibre verre qui permettra de
retenir la cellulose (seuil de coupure de 2,7µm). Branchez-la à une trompe à eau.
- Filtrez le mélange extrait soluble/cellulose, et conservez la fraction non retenue dans la
glace.
- Lavez le gâteau de cellulose avec 300 ml de tampon phosphate 50mM glacé, mettez de
coté la solution de lavage.
- Lavez ensuite avec 300 ml de tampon phosphate 12,5 mM glacé, conservez la solution de
lavage à 4°C (recouvrez le bécher avec du parafilm). Prenez la DO à 280nm en utilisant le
tampon phosphate 12,5 mM comme référence. La DO doit être proche de zéro. Si
nécessaire, poursuivez le lavage.
- Avant de procéder à l’élution, lavez soigneusement le réservoir inférieur de la cafetière à
filtration. Ajoutez 20ml d’eau déionisée glacée sur le gâteau de cellulose sans aspirer.
Reprenez le gâteau de cellulose dans l’eau à l’aide d’une pipette en verre, sans déchirer le
filtre. Dans ces conditions non salines, l’affinité du CBM de la protéine d’échafaudage du
cellulosome pour la cellulose est réduite et le complexe est élué. Puis commencez
l’aspiration.
- Centrifugez la fraction d’élution à 14000 rpm pendant 15 minutes pour éliminer la
cellulose résiduelle.
- Prélevez le surnageant et placez- le dans la glace dans un tube Falcon.

18
- Procédez à l’étape de concentration en utilisant un centricon (voir J9). Concentrez jusqu’à
un volume de 200 à 500µl. Homogénéisez votre échantillon à l’aide d’un pipetman par
une série d’aspirations et refoulements, puis aliquotez en 4 tubes.

5/ Préparation des échantillons pour l’électrophorèse dénaturante.


Vous disposez de deux culots cellulaires prélevés avant et après induction (NI et I), des
extraits protéiques solubles (ES) et insolubles (EI) obtenus après casse des cellules, de la
fraction non retenue (NR), et des fractions d’élution (E). Pour préparer les échantillons,
utilisez des tubes Eppendorf de 1,5ml.
- Les culots cellulaires I et NI sont à reprendre dans 30µl d’eau déionisée et 10µl de
solution de charge SDS concentrée
- Prélevez un volume de ES, EI et NR 25 fois plus petit que le volume prélevé pour
l’échantillon de culture induite, complétez à 30µl d’eau et 10 µl de solution de charge
concentrée.
- 10µl de chaque fraction d’élution seront prélevés, ajoutez 3 µl de solution de charge
concentrée.

Faîtes bouillir pendant 5 minutes les échantillons dans une bouilloire, sur un flotteur
(n’oubliez pas d’ajouter le capuchon bloquant l’ouverture des tubes).
Les échantillons I et NI et EI seront ensuite centrifugés 2 minutes à la vitesse maximale.
Transférez le surnageant dans un tube Eppendorf propre étiqueté. Les autres échantillons
seront également centrifugés de manière à faire descendre l’eau de condensation.

6/ Contrôle de la purification :
Vous disposez d’un gel pré-coulé et des échantillons. Installez le montage de l’électrophorèse,
chargez le gel en n’oubliant pas d’inclure 5µl de marqueur de taille moléculaire.
Après migration colorez au Bleu de Coomassie, décolorez et analysez vos gels.

La protéine a-t-elle été produite ? quelle est sa taille ? Est elle trouvée dans la fraction NR ?
Est elle présente dans les fractions d’élution ? Est elle pure ? abondante ?
19
J9

2/ Concentration des fractions à l’aide de centricons:


Principe :
La centrifugation est utilisée comme force de filtration à travers une membrane. Les
molécules plus grosses que les pores de la membrane seront retenues dans le réservoir
d’échantillon (réservoir supérieur), les solvants et les molécules de faible Mr passeront à
travers la membrane vers le réservoir de filtrat (réservoir inférieur). Afin d’obtenir un
rendement de récupération optimum, il convient de choisir une taille d’exclusion 3 à 5 fois
inférieure à la taille de la molécule à concentrer ; la taille d’exclusion d’une membrane
d’ultrafiltration étant définie par sa capacité à retenir 90% d’une molécule globulaire idéale
dont la Mr est la taille d’exclusion. Le système que vous utiliserez a une taille d’exclusion de
10 000 Da.

Décongelez les fractions d’élution. Commencez l’étape de concentration de la fraction la plus


concentrée pour la Mannanase5K ou de la fraction d’élution totale pour le MiniCip. Chargez
la partie supérieure, centrifugez à 14000 g pour les petits centricons ou 8000 g pour les grands
centricons. Le but de cette expérience est de réduire le volume de la solution protéique dans la
chambre supérieure (concentrer), puis de reprendre ce faible volume par le tampon sans
imidazole (Tris 30mM pH8 ou phosphate 12,5 mM pH 7) puis de concentrer, de manière à
éliminer progressivement l’imidazole contenu dans la solution protéique (dialyser). Utilisez
de préférence la centrifugeuse réfrigérée, ou placez une centrifugeuse en chambre froide.
A la fin, de la concentration, reprenez soigneusement le liquide de la chambre supérieure,
mélangez bien à l’aide d’un pipetman, et aliquotez dans des tubes Eppendorfs propres.

3/ Détermination de la concentration protéique par spectrophotométrie:


La concentration en protéine est calculée à partir de la mesure de A280nm en utilisant la
formule A280nm = ε d [C] avec d = chemin optique =1 cm et [C] en Moles/l, ε: le coefficient
d’extinction molaire est en M-1cm-1
Et donc : [C] = A280nm X facteur de dilution
ε

20
ε est déduit de la séquence primaire des protéines et calculé pour des mesures de A280
effectuées dans l’eau déionisée.
Caler le spectrophotomètre à zéro avec de l’eau dans une cuve en quartz. Effectuer la mesure
de la concentration de la solution protéique en ajoutant 5 µl de celle-ci au mélange de la cuve.
Bien homogénéiser en renversant la cuve plusieurs fois après l’avoir bouchée avec un carré de
Parafilm, puis lire A280nm. Il est possible d’ajouter encore 5µl pour effectuer une deuxième
mesure, faites la moyenne des concentrations obtenues pour les deux mesures.
Exprimer les concentrations en µM et en mg/ml

2/ Dosage par la méthode de Lowry :


La courbe d'étalonnage sera réalisée à partir d'une solution mère d'albumine sérique de bœuf
(BSA). Vous disposez de BSA à 10mg/ml, à partir de cette solution, réalisez une gamme
étalon de 0 à 100 µg/ml pour un volume de 0,5 ml à doser.
D’après la mesure de l’absorbance à 280nm de la protéine recombinante, estimez le volume à
prélever pour obtenir 20 et 60 µg/ml de protéine à doser.
Dans des tubes en verre déposez 0,5 ml d'échantillon à doser, puis 2,5 ml de réactif C.
Après dix minutes, ajoutez rapidement 0,25 ml de réactif de Folin-Ciocalteu, dilué de moitié
dans l'eau (ajouter le réactif au centre du tube, ne pas le faire couler sur les parois). Ce réactif
est préparé pendant les 10 minutes d'attente, et en quantité juste suffisante pour le dosage
en cours (exemple: un témoin + 5 dosages, soit 6 tubes. Il vous faudra donc 1,5 ml de réactif
dilué de moitié, c.a.d. 0,75 ml de réactif de Folin-Ciocalteu. Pour tenir compte d'un éventuel
volume mort de la pipette, diluez 1 ml de réactif pur pour 2 ml final).
Mélanger. Après 30 minutes à l'obscurité, l'absorbance à 750 nm est lue et la concentration en
protéines estimée par rapport à la courbe étalon établie avec l'albumine sérique de bœuf.
Tracez votre courbe étalon, elle doit être rectiligne et doit passer par le zéro.

N.B.: Réactif C = 50 parties de réactif A pour 1 partie de réactif B

A = Na2CO3 20 g/l dans NaOH 0,1N


B = CuSO4 5 g/l; tartrate de sodium et de potassium 10 g/l.

A partir de l’ensemble de ces résultats, déterminez quelle est la concentration en g/L et en


mol/L de votre échantillon protéique.

J10
1/ Estimation de la pureté de la protéine :
Un gel bilan sera réalisé de manière à analyser toutes les protéines purifiées au cours du TP.
Vous ferez migrer vos échantillons sur un gel pré-coulé dans le système Phast (voir fiche 3). Il
faut au préalable préparer les échantillons de manière à charger 2µg de protéine. En fonction
de la concentration déterminée par spectrophotométrie, pipetez le volume de solution de
protéine nécessaire, procédez à une dilution si nécessaire, ajoutez 1/4 de solution de charge
concentrée, le volume total ne doit pas dépasser 4µl. Après la migration colorez votre gel au
21
bleu de Coomassie puis décolorez-le. Faites également migrer les échantillons de
cellulosomes obtenus à raison de 10 à 15 µg par piste.
Les protéines sont elles pures ? Que pensez-vous des concentrations estimées ?

2/ TD interactions protéines /protéines

3/ Analyse des interactions par Far Western Blot


Principe : Il s’agit d’un western blot au cours duquel une étape supplémentaire d’incubation
avec l’une des protéines à étudier est ajoutée. C’est cette protéine qui sera détectée par les
anticorps : si une bande est détectée sur la membrane, c’est qu’il y interaction de cette
protéine avec l’une des protéines transférée sur la membrane.

Pour l’ensemble de la classe, coulez 4 SDS-PAGE à 12%. Chargez le gel selon le tableau
suivant.

WB anti Man5K WB anti CBM


1 2 3 4 5 6 7 8 9 10
L MC1 ManK ManK Cell L MC1 Man5K Man5K Cell
(G1) (G3) (G4) (G1) (G3) (G4)

FWB 1/ MC1 2/ anti CBM FWB 1/ ManK 2/ anti ManK


1 2 3 4 5 6 7 8 9 10
L MC1 Man5K Man5K Cell L MC1 Man5K Man5K Cell
(G1) (G3) (G4) (G1) (G3) (G4)

WB anti Man5K WB anti CBM


1 2 3 4 5 6 7 8 9 10
L MC1 Man5K Cell L MC1 Man5K Cell
(G2) (G5) (G2) (G5)

FWB 1/ MC1 2/ anti CBM FWB 1/ ManK 2/ anti ManK


1 2 3 4 5 6 7 8 9 10
L MC1 Man5K Cell L MC1 Man5K Cell
(G2) (G5) (G2) (G2)
1µg de protéine Minicip ou Man5K seront chargées à par piste. Préparez une solution de 40µl
contenant
- la protéine à une concentration finale de 0,1µg/µl (soit 4µg dans les 40 µl finaux)
- 10 µl (soit ¼ du volume final) de solution de charge dénaturante concentrée,
- Faîtes bouillir 5 minutes. Chargez 10µl d’échantillon par piste (1µg).
- Chargez 15 µg de cellulosomes (10µl d’une solution à 0.15µg/µl).
- A la fin de la migration, procédez au transfert. Préparez une membrane de nitrocellulose aux
dimensions du gel et incubez la dans la solution de transfert (attention, si c’est une membrane
de PVDF, il faudra l’incuber au préalable dans de l’éthanol 96%). Faîtes tremper également
deux éponges et quatre papiers Whatman découpés à la bonne dimension dans la solution de
22
transfert. Préparez le sandwich en déposant successivement une éponge dans le montage coté
blanc et deux papiers Whatman.
- Enlevez une des plaques du gel et posez la membrane de nitrocellulose en une fois sur le gel,
prenez soin de bien la disposer sur le gel, sans bulles d’air. Décollez l’ensemble gel et
membrane et déposez le sur le sandwich puis recouvrez de deux papiers Whatman et enfin
d’une éponge, puis refermez avec la partie noire. Coulissez le sandwich dans le montage à
éléctrode, coté noir contre coté noir (-), lui-même placé dans la cuve contenant la solution de
transfert. Recouvrez de solution de transfert, et Transférez 1 heure à 100V.
Dans quel sens migrent les protéines dans le sandwich ?
- Les protéines transférées sur le filtre seront fixées pendant 10 min dans du tampon de
fixation. Le filtre sera ensuite lavé à l’eau distillée puis les protéines colorées au rouge
Ponceau 10 minutes. Rincez le filtre à l’eau distillée et repérez les bandes du marqueur de
taille et des protéines les plus abondantes avec un stylo bille directement sur la membrane
(avec des points de marquage aux extrémités des bandes.
- Placez les membranes à -20°C.

J11

1/ Analyse de complexes par électrophorèse en conditions natives.


Principe : les protéines à étudier seront mélangées puis chargées sur gel natif. La piste du
mélange de protéines sera comparée aux pistes ne contenant qu’un partenaire. Sur gel, une
bande supplémentaire apparaîtra dans la piste « mélange » si un complexe s’est formé.
Préparer une solution à 20µM de Minicip et 20µM de Man5K dans du tampon Tris 30mM
supplémenté de 1mM de CaCl2 (à préparer à partir de Tris 30mM pH8 et de CaCl2 1M). A
partir de ces solutions protéiques concentrées préparer 20 µl de Minicip à 10µM, 20µl de
Man5K à 10µM, et 20µl du mélange contenant 10µM Minicip et 10µM de Man5K. Après 10
minutes, prélevez 10µl de chaque solutions (Minicip, Man5K et du mélange), ajoutez 3µl de
solution de charge concentrée (sans SDS), puis chargez 4µl de chaque échantillons sur un gel
pré-coulé du système Phast (gradient d’acrylamide 4-15%) en condition natives. Après
migration procédez à une coloration au Bleu de Coomassie.

2/ Révélation du transfert de Western :


Découpez les membranes selon le plan de gel en prenant soin de découper un repère pour
orienter votre membrane (coupez la membrane en haut à droite).
Répartissez les s dans des boîtes de Pétri. Lavez à l’eau encore quelques minutes puis incubez
dans du TBS-Lait 5% sous agitation pendant 1heure.
Si nécessaire (voir tableau ci-desous), incubez la membrane pendant 1H dans du TBS-Lait 5%
+/- Man5K ou +/- MiniCipC à raison de 20µg dans 15ml. Laver 3x10min dans du Tween-
TBS 1%
Puis suivez le protocole suivant :
- Incuber dans TBS-Lait 5% + anti-Man5K 1/10000ème ou anti-CBM 1/10000ème
- Laver 3x10min dans du Tween-TBS 1%
- Incuber dans du TBS-Lait 5% + anticorps secondaire 1/5000 (anti lapin couplé à la
phosphatase alcaline)
23
- Laver 3x10min dans du Tween-TBS 1%
- Révéler avec la solution Western Blue R
- Arrêter la réaction en lavant à l’eau. Analysez les résultats.

WB anti Man5K WB anti CBM FWB


------ ------ MinicipC(2Gpes) Man5K (2 Gpes)
Anti-Man5K Anti-CBM Anti-CBM Anti-Man5K
Anti-IgG-PA Anti-IgG-PA Anti-IgG-PA Anti-IgG-PA

J12
TD Bilan

24
Fiche 1 : gel d’agarose
Préparation d’un gel d’agarose.
Dans une bouteille de 500 ml, peser 3,2 g d'agarose. Ajouter 400 ml de tampon TBE X
1. Porter le mélange à ébullition. Utiliser le micro-onde qui se trouve dans la salle de
préparation. Attention rester à côté du micro-onde en permanence jusqu'à dissolution
complète de l’agarose. Le gel, ainsi préparé, est à 0,8%. Laisser refroidir jusqu'à 60°C environ
et déposer le gel dans une étuve a 60°C.

Pour couler un gel.


Prélever dans un tube falcon de 50 ml 25 ml d’agarose en surfusion a 60°C.
SOUS LA HOTTE :
Ajouter 2 gouttes de solution de bromure d'éthidium.

Attention: Vous devez mettre des gants pour manipuler le bromure d'éthidium.
Couler le gel sur le support après avoir placé la plaque et le peigne.
Attention, les puits doivent être placés du coté de la borne - (noire) de l'appareil
d'électrophorèse, et sur une bande rouge du support de gel. L'ADN est chargé - , il va migrer
dans le gel vers la borne + (rouge).
Attendre au moins une 1/2h avant de charger les puits.

Préparation des échantillons :


• 3 µl d’échantillon d’ADN à analyser auxquels vous ajouterez 6 µl d'eau et 1 µl
de solution de charge.
Par gel vous devrez déposer une fraction aliquote de la solution de marqueurs de taille "1-kb
ladder": une solution prête à l'emploi est à votre disposition. Vous en prélèverez 10 µl que
vous placerez dans un tube Eppendorf.

Attention, l'eau que vous utiliserez pour la préparation de mélanges contenant de l'ADN doit
avoir été autoclavée afin de détruire toute trace de DNAse.

Mise en route de l'électrophorèse :


Enlever délicatement le peigne et sortir l’ensemble gel + plaque du support en plastique.
Déposer l’ensemble gel + plaque dans la cuve d’électrophorèse.
Avant de charger les échantillons, remplir la cuve d'électrophorèse avec du tampon TBE X
0,5 de façon à recouvrir le gel sur une hauteur de 2 à 3 mm environ.
Charger les puits à l'aide d'une pipette automatique.

25
Raccorder l'appareil d'électrophorèse au générateur. L'électrophorèse est controlée grace à la
migration d'un colorant le bleu de bromophénol présent dans la solution de charge. Ce
colorant signale approximativement la position des fragments d'ADN linéaire de 500 paires de
bases.
Lorsque le bleu a atteint les 2/3 de la longueur du gel, éteignez l'alimentation.
Débrancher l'appareil d'électrophorèse. Le gel peut être observé sur la table transilluminatrice
(Cette observation sera faite en présence d'un enseignant).

Attention, vous devez mettre des gants pour manipuler le gel, il contient du bromure
d'éthidium. Une fois l'observation réalisée, le gel et les gants seront jetés dans une poubelle
rouge prévue à cet effet sur la paillasse latérale.

26
Fiche 2

Electrophorèse dénaturante (SDS)


- Laver les plaques en verres avec de l’alcool
- Préparer le montage des plaques en verre sur le support
- Tester l’étanchéité du montage en versant de l’eau entre les deux plaques, vider l’eau

-Préparation du gel de séparation à 12% : mélanger dans un erlen de 100 ml:


Acrylamide/Bis-acrylamide 4 ml
SDS 10% 0,1 ml
Tris-HCl 1.5 M pH 8.8 2,5 ml
H2O déminéralisée 3,3 ml
-Juste avant de couler les gels, ajouter les deux catalyseurs de polymérisation :
TEMED 4 µl
Persulfate d’ammonium 100 µl
-Mélanger et couler la solution, à la pipette Pasteur, entre les 2 plaques de verre. Après
l’ajout des catalyseurs, la polymérisation débute rapidement et prend environ 20 min.
-Couvrir avec de l’eau.
-Attendre 3/4 heure pour que la polymérisation soit complète.
-Retirer l’eau du dessus du gel (verser dans l'évier) et assécher avec précaution, sans
toucher le gel, à l'aide de papier filtre.

-Préparation du gel de concentration à 5% : mélanger dans un erlen de 25 ml


acrylamide/bis-acrylamide 0,83 ml
SDS 20% 0,05 ml
Tris-HCl 1 M pH 6.8 0,63 ml
H2O déminéralisée 3,4 ml
-Puis ajouter:
TEMED 5 µl
Persulfate d’ammonium 50 µl

-Couler rapidement (la polymérisation est complète en 15 min) au dessus du gel de


séparation.
-Placer le "peigne" servant à mouler les "puits" de dépôt. Lorsque la polymérisation est
complète, retirer le peigne, monter les plaques sur la cuve à électrophorèse, remplir les 2
compartiments avec le tampon d'électrophorèse. S'assurer que le contact du gel avec le
tampon de la cuve inférieure est correct. Régler le voltage à 100V pendant le migration dans
le gel de concentration puis augmenter le voltage à 150 V. Arrêter la migration quand le front
de migration atteint le bas du gel.
- Démouler le gel, repérez le premier dépôt avec une encoche sur le gel, puis colorer le gel au
bleu de Coomassie pendant 30 minutes
- Décolorer le gel avec une solution de décoloration

27
Fiche 3

Electrophorèse dénaturante (SDS) avec le Phast system


A/ Préparation des échantillons :
• Pour les échantillons de culture resuspendre les cellules dans 20 l d’eau. Ajouter 7,5
µl de tampon de charge SDS.
• Pour les échantillons solubles : dans un tube Eppendorf de 1,5 ml, placer l’échantillon
contenu dans un volume total de 15 µl (si le volume d’échantillon protéique à traiter
est inférieur à 15 µl, compléter à 15 µl avec de l’eau). Ajouter 10 µl de tampon de
charge
• Dans le cas des électrophorèses dénaturantes, faire bouillir pendant 5 min.
Pour cela mettre en route une bouilloire et fermer les tubes à l’aide de capuchons colorés.
Après incubation, centrifuger quelques secondes pour rassembler l’échantillon dans le
fond du tube.

B/ Mise en route de l’électrophorèse :


Le Phast system Pharmacia permet d’effectuer des séparations de protéines sur gel
d’électrophorèse dans des conditions standardisées.
Il sera posé dans l’appareil au niveau d’un des cadres rouges :
- un gel de polyacrylamide précoulé sur un film plastique. Différent gel sont a votre
disposition (gradient 4-15% dans votre cas).
- le support de mèches (natives ou SDS) sera calé sur les plots prévus à cet effet. 2
mèches adéquates auront été préalablement placées dans le support de façon à
venir en contact, pour l’une avec le haut du gel, pour l’autre avec le bas.
- rabattre la cale noire sur le dispositif. Celle ci appuie légèrement sur les mèches et
permet d’assurer le contact avec le gel. Elle contient également les encoches
permettant de placer le peigne chargé avec les échantillons.
4 l d’échantillon protéique sont introduits dans chaque dent d’un peigne à 6 dents OU
BIEN 1 l dans chaque dent d’un peigne à 8 dents.
Le peigne est placé dans les encoches, le capot de l’appareil refermé et l’électrophorèse
programmée.
Contrôler l’avancement de l’électrophorèse en suivant la migration du bleu. Arrêter avant que
le bleu n’ait atteint le niveau de la deuxième mèche.
Ouvrir le capot. Retirer délicatement le peigne. Puis soulever les différents éléments posés sur
le gel afin de pouvoir récupérer celui-ci. Le gel est placé dans une boite plastique.

C/ Fixation et coloration du gel après migration :


Recouvrir le gel d’un peu de solution de bleu de Coomassie, et laisser incuber 20 minutes.
Verser dans l’évier.
Ajouter du décolorant. Laisser incuber jusqu’à décoloration du fond du gel et apparition des
bandes de protéines sur fond clair. Changer de temps en temps la solution de décoloration.
Ajouter un petit tampon de mousse dans le bain afin de fixer le colorant et donc d’accélérer la
décoloration.

28
Fiche 4 - TD bioinformatique
But du TD : Comprendre les constructions réalisées en TP, le dessin des amorces, le choix des
vecteurs, analyser les protéines produites :
Man5K, MiniCipC1
Veiller à enregistrer régulièrement les données.

1- Aller chercher la séquence nucléotidique et protéique du gène étudié dans le site


CAZY

“The CAZy database describes the families of structurally-related catalytic and carbohydrate-
binding modules (or functional domains) of enzymes that degrade, modify, or create
glycosidic bonds.”

- Rechercher dans le site de CAZY la séquence correspondant à la mannanse 5K de C.


cellulolyticum (GH, GH5, bacteria, Clostridium cellulolyticum, Man5K Ccel_0736) :
- Rechercher dans le site de CAZY la séquence correspondant à CipC (CBM, CBM3, C.
cellulolyticum CipC Ccel_0728)

Deux références sont possibles dans la colonne Genbank, l’une est la séquence obtenue par le
séquençage du génome (JGI (Joint Genome Institute), l’autre a été déposée lors de la
publication de la séquence du gène d’intérêt.
S’agit-il d’une séquence protéique ou nucléotidique ?
Choisissez la séquence déposée par le JGI (Joint Genome Institute), en format Fasta (fonction
display settings en haut à gauche).
Copiez cette séquence (avec son titre) en format Fasta (cliquez sur Fasta en haut à gauche)
dans un fichier word. Notez à quoi correspond cette séquence.
Retournez à la page précédente.

Y a-t’il un peptide signal ? Notez les numéro d’acides aminés concernés

Retrouvez la séquence nucléotidique codant la protéine d’intérêt dans la partie « More about
the gene … », et cliquez sur le nom du gène.
Que trouvez-vous sur cette page ?
Cliquez sur Fasta pour obtenir la séquence nucléotidique. Copiez collez sur votre fichier.
Notez de quoi il s’agit.

Copiez la séquence nucléotidique sur Word

NB / D’autres possibilités s’offrent à vous pour obtenir la séquence nucléotidique ou


protéique selon les informations dont vous disposez.
- Il est possible à partir d’une courte séquence (nucléotidique ou protéique) d’effectuer une
recherche avec le programme Blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
-Il est également possible, à partir du numéro de locus, de retrouver dans la banque NCBI la
séquence du gène ( http://www.ncbi.nlm.nih.gov/sites/entrez)

29
Vous disposez à présent d’une séquence protéique et d’une séquence nucléotidique de
votre gène d’intérêt.
Afin de cloner le gène d’intérêt il est important de délimiter le début et la fin de la protéine
que vous voulez produire, et par conséquent le début et la fin de la séquence nucléotidique à
cloner. Pour délimiter la séquence protéique, vous devez d’abord analyser son organisation en
domaines.

2- Analyse de la séquence protéique

Présence de domaines conservés : PFAM


- Copiez la séquence protéique
- Collez la dans http://pfam.sanger.ac.uk/ / Séquence search
- Notez le résultat (début et fin des différents domaines protéiques d’intérêt)
Pour Man5K, que remarquez-vous ? s’agit-il d’une GH5 ? Que remarquez-vous à propos de
la dockérine ?
Pour CipC, que remarquez-vous ?
- Pour CipC, notez la fin de la première cohésine.
Vous pouvez tester d’autres séquences protéiques traduites de gènes du cluster cip-cel.
La dockérine est habituellement placée à l’extrémité C-terminale, et deux segments
dockérines sont nécessaires pour former une dockérine fonctionnelle.

Séquence signal : Signal P


- Copier la séquence protéique
- Aller dans http://www.cbs.dtu.dk/services/SignalP/
- Coller la séquence
- Régler les paramètres (gram positive bacteria)
- Noter le résultat

NB : La protéine entière est obtenue lors de la synthèse peptidique par les ribosomes. Comme
la séquence est dotée d’une séquence signal à l’extrémité N-terminal, la protéine est adressée
vers le domaine extracellulaire à travers la machinerie de sécrétion Sec. Après export de la
protéine dans l’espace extracellulaire la séquence signal est coupée par une peptidase
spécifique du système Sec. La protéine mature, active dans l’espace extracellulaire débute
donc au premier acide aminé après le site de clivage de la séquence signal. C’est le gène
codant pour la protéine mature que vous devez cloner, même si E. coli, la protéine sera
produite dans l’espace cytoplasmique. Après purification c’est bien la forme mature que l’on
veut étudier.

A cette étape vous connaissez quel sera le premier acide aminé ainsi que le dernier. A
présent vous devez retrouver dans la séquence nucléotidique le premier et le dernier
nucléotide à cloner. Comme il faut 3 nucléotides (codon) pour coder un acide aminé, le
plus simple est d’obtenir la séquence nucléotidique entière, et sa traduction simultanée.

Traduction, correspondance séquence nucléotidique/séquence protéique :


- Aller dans le site d’analyse de séquences d’Expasy
http://au.expasy.org/tools/ puis cliquez sur Translate (assez bas sur la feuille).

30
- Copier votre séquence nucléique, essayer les différents modes de traduction.
Combien de traductions sont proposées, pourquoi ? Quelle est la bonne ?

- Choisissez la traduction « include nucleotide sequence » et coller votre séquence


Comment est donné le résultat ? A quoi cela vous sert il ?

- Avec l’ensemble de ces données délimitez la séquence de la protéine souhaitée (sans


séquence signal, et les domaines voulus) en fonction des codons de traduction.
- Vérifiez les zones d’hybridation des amorces que nous vous avons données (parties
spécifiques du gène), sur le gène à cloner. Est ce correct ?
- Dans votre fichier initial (contenant les séquences entières des gènes d’intérêts), copiez et
collez la séquence nucléotidique entière puis retirez les parties inutiles, notez la
« séquence nucléotidique à cloner ».

A cette étape vous possédez la séquence nucléotidique d’intérêt. A présent il faut définir
la stratégie de clonage : quel vecteur choisir ? Quels enzymes de restriction choisir pour
le clonage ? Ces choix vont dépendre de la séquence nucléotidique, ainsi que des
vecteurs à disposition.

3-Clonage dans un vecteur d’expression

Vous disposez de deux vecteurs d’expression de type pET, le pET28a et le pET22b+. La


protéine mature sera produite dans le cytoplasme d’E. coli, et sera fusionnée à une queue
polyhistidine.
A présent il s’agit de déterminer quels sites de clonages choisir en fonction du vecteur
d’expression et des sites présents ou absents de la séquence d’intérêt. La première étape
correspond donc à l’analyse des vecteurs. Les cartes et la liste des sites de restriction des
deux vecteurs disponibles sont présentés à la fin du document. Toutes les cartes de la série
pET sont disponibles sur le site :
http://www.emdmillipore.com/life-science-research/vector-table-novagen-pet-vector-
table/c_HdSb.s1O77QAAAEhPqsLdcab .

Pour qu’une séquence d’ADN soit transcrite puis traduite, il faut des signaux de transcription
(fonctionnement de l’ARN polymérase), puis des signaux de traduction (fonctionnement des
ribosomes).

31
Transcription :

Promoteur
Terminateur

Traduction :

RBS ou séquence Shine-Dalgarno


Codon d’initiation
Codon stop
1/Séquence du pET22b+ et 28a

- Où sont les signaux de transcription?


- Où sont les signaux de traduction ?
- Où est la séquence codant la queue histidine
- Quels sont les sites de clonage dans les vecteurs pET ?

2/ Analyse de restriction de la séquence à cloner :

A présent il s’agit d’identifier les sites de restriction présents et en particulier ceux absents de
la séquence nucléotidique à cloner. Seuls des sites absents pourront être choisis pour le
clonage. La plupart du temps il n’y a pas de sites de restriction naturels utlisables pour cloner
le fragment d’interêt. En revanche il est possible d’utiliser les amorces pour ajouter des sites
de restriction à l’amplicon final (=produit PCR) à cloner (=queues flottantes). Les séquences
des amorces sont trouvées à chacune des extrémités de l’amplicon obtenu en fin de PCR.

- Allez dans tools.neb.com/NEBcutter2/ ou www.restrictionmapper.org/ ou encore


molbiol-tools.ca/Restriction_endonuclease.htm

- Copier votre séquence nucléique finale, collez-la dans le serveur

- Copier le résultat, et coller le dans votre fichier. Repérez les sites absents, ils vous
serviront pour le clonage dans le pET.

Certains de ces sites sont-ils présents parmi les sites de clonages utilisables dans les vecteurs
mis à disposition ?
Quels sont les sites finalement choisis dans votre cas ?
Avec l’ajout du site de restriction en amont et en aval de la séquence à cloner, votre séquence
sera elle en phase avec l’ATG, la séquence codant la queue histidine et le codon stop ?
Des codons ont-ils été ajoutés à votre séquence initiale ?

- A partir de la séquence du vecteur, de votre séquence finale après PCR, reconstruire in


silico le clonage réalisé dans Word de l’ATG au codon stop.

- A l’aide du programme de traduction, traduisez votre séquence, vérifiez que votre


séquence code pour la bonne protéine, en fusion avec la queue histidine.

32
5-Analyse de la protéine produite

- A partir le la séquence protéique finale, analyser la protéine produite à l’aide du site


Expasy (http://www.expasy.org/) /proteomics/protparam: nombre d’aa, masse
moléculaire, PI, coefficient d’extinction et Absorbance.
- Copiez les résultats.

6- Pour aller plus loin …


Analyse des codons (expression hétérologue)

Dans http://gcua.schoedl.de/index.html « each triplet position vs. usage table »


Entrer la souche d’origine du gene, la séquence du gene et la souche productrice E coli.
Y a-t-il des codons rares dans votre séquence ?

Le code génétique

33
Annexe 1
Séquence codante du gène man5K
ATGAAAAAAATTGCTAGTTTGGTACTCACAACAGCAATGGTATTCCTTGCAGCATTGCCGCT
GCCAGCTTCGGCTGCGACTACATACAAACTTGGTGATGTTGACAATGATACTCTAATTTCTG
CCATTGATTTAGCAGCTGTACAGCAGCACATACTTGGAAAAAAAACCTTGACGGGTGAGGCC
TTTAAAGCAGCTGATGTAAATGCTAACGGAGAAATTGAAGCATTGGATTTAGCCGAACTAAA
ACAGTTTCTTCTCGGTAGGATTACTAAGTTCTCCGGAGAAGGACAACAACAACCATCTGGAG
TCGGAATAACTTGGATGGACGGTAATACACTGTACCCGGTTGGAGTTAACTATGCATGGTAC
AACTGGTCGTATGAGTTTTCAGATAACAACTGGAATTCCAACTTTACGAGAATCAAGAGTGA
TTTGGACACAATGTCCTCAAAGGGAATTAATTCTCTGAGATGGTGGGTATTCCCGGACCTTG
CCTATGGTCCGCTATGGTCAGGCCCAAATGAAGGAAGCCTTTGTACAGGACTTCCTGAAAAA
TGGGTTGACCATATGAAGGAAACTTGTGATTATGCGTATTCAAAGGGTATAAAAATCTACTG
GACTATAACAAGCTTTGACTGTGCAAGAGCAGATGATTCTGTTGACCATGATGATATCATTG
ATAATCCTATAGTACTTCAAAGCTTCCTTGACAATGCTATGAAGCCAATACTGCAAACATTG
GGCGAACATCCGGGAGTATTGGGATGGGATATTATTAATGAACCTGAATGGATCATAAAAAA
AGAAGACAACGGTGAACCAAACAATAAGGGAGAAATCTTCCCACTTGCTGCAATGAGAAACT
ACATAAAAACTACATGTGATTTTATACACCAATATGCAAAGCAGCCTGTAAGCTTCGGGAGT
GCAAATATGAAGTGGCTTGGTGCACAGTATGATTTATGGGACGGATTGGGACTTGATTTCTA
CGATTTCCACTGGTATGACTGGGCTACTCCGTATTTTAACCCTGTTACAACTCCAGCTTCAA
GTCTGAAGTTGGACAAACCTGTAATAATCGGTGAAATGATGCCTGATACCCAAAGTTCTTCA
CTAAAAATGACACACAAGCAGGTACTGGATGCCATATATAAAAACGGTTATGCCGGATATAT
GCTCTGGTCATGGAACGATGGAGCTTTTGACTGCAAACCTTACGTTGGAAACAACTTTATTG
ATTTTGCCGCAGAGCATCCTGACGTAGTCAGATAA
ManKNcoIdir 5’gattaCCATGGCGACTACATACAAACTTGG 3’ (67-58°C)
K5rev 5’ gggCTCGAGTCTGACTACGTCAGGATG 3’ (71-57°C)

Annexe 2 :

Séquence codante du gène cipC


ATGCGTAAAAAGTCTTTAGCATTTTTGTTAGCACTAACAATGTTGGTGACATTATTAGGGGCTC
AGCTTACAGCTTTTGCAGCAGGTACTGGCGTCGTATCAGTGCAATTTAATAATGGCAGTTCACC
GGCATCATCAAATTCCATATACGCTAGATTCAAAGTTACAAACACAAGTGGTTCACCAATCAAC
TTGGCAGATTTGAAACTTAGATATTATTACACTCAGGATGCGGACAAGCCATTGACATTCTGGT
GTGACCATGCAGGTTATATGAGCGGTAGCAACTATATAGATGCCACCTCAAAGGTAACCGGATC
ATTTAAAGCAGTAAGTCCTGCTGTTACAAATGCAGATCACTATCTTGAAGTTGCATTAAATAGT
GATGCAGGAAGTCTTCCAGCTGGAGGATCCATAGAGATTCAAACCAGATTTGCAAGAAACGACT
GGAGTAATTTCGATCAATCAAATGACTGGTCATATACTGCAGCCGGCTCATACATGGATTGGCA
GAAGATTAGTGCTTTTGTAGGAGGAACTCTTGCTTACGGTTCAACTCCTGACGGTGGAAACCCA
CCTCCACAAGATCCTACAATCAATCCTACTTCTATTTCTGCAAAAGCAGGATCTTTCGCAGATA
CTAAAATAACTCTTACACCAAACGGTAATACTTTCAATGGAATTAGTGAATTACAGAGTAGCCA
ATATACAAAAGGAACAAATGAAGTAACATTATTGGCTAGCTATTTGAATACACTTCCGGAAAAT
ACTACTAAGACTCTTACTTTCGATTTCGGTGTAGGTACAAAAAATCCTAAATTGACAATTACTG
TTTTACCAAAAGATATCCCTGGCGATTCTCTTAAAGTTACAGTAGGAACAGCTAATGGTAAGCC
TGGCGATACAGTAACAGTTCCTGTTACATTTGCTGATGTAGCAAAGATGAAAAACGTAGGAACA
34
TGTAATTTCTATCTTGGATATGATGCAAGCCTGTTAGAGGTAGTATCAGTAGATGCAGGTCCAA
TAGTTAAGAATGCAGCAGTTAACTTCTCAAGCAGTGCAAGCAACGGAACAATCAGCTTCCTGTT
CTTGGATAACACAATTACAGACGAATTGATAACTGCAGACGGTGTGTTTGCAAATATTAAGTTC
AAATTAAAGAGTGTAACGGCTAAAACTACAACACCAGTAACATTTAAAGATGGTGGAGCTTTTG
GTGACGGAACTATGTCAAAGATAGCTTCAGTTACTAAGACAAACGGTAGTGTAACTATAGATCC
TGGTACTCAACCTACAAAGGAACTTAAAGTAGCAGTAGGAACAGCTAATGGTAAGCCTGGAGAT
ACAGTCACAGTTCCTGTTACATTTGCTGACGTAGTAAATGTAGGCAATGTAGGAACATGTAATT
TCTATCTTGGATATGATGCAAGCCTGTTAGAAGTAGTATCAGTAGATGCAGGTCCAATAGTTAA
GAATGCAGCAGTTAACTTCTCAAGCAGTGCAAGTAACGGAACAATAAGCTTCCTGTTCTTGGAT
AACACAATTACAGACGAATTGATAACTTCAGACGGTGTGTTTGCAAATATTAAATTCAAGTTAA
AGAGTGTAGCAACTAAAACTACAACACCAGTAACATTTAAAGATGGTGGAGCTTTCGGTGACGG
TACTATGGCAAAGATAGCTACAGTTACTAAGACAAACGGTAGTGTAACTATAGATCCTGGTACT
CAACCTACAAAGGAACTTAAAGTAGCAGTAGGAACAGCTAATGGTAAGCCTGGAGATACAGTCA
CAGTTCCTGTTACATTTGCTGACGTAGCAAGTGCAGGTAATGTAGGAACATGTAATTTCTATCT
TGCATATGATGCAAGCCTGTTAGAGGTAGTATCAGTAGATGCAGGTCCAATAGTTAAAATGCAG
CAGTTAATTTCTCAAGCAGTGCAAGCAATGGATCAATAAGCTTCCTGTTCTTGGATAACACAAT
TACAGACGAATTGATAACTGCAGACGGTGTGTTTGCAAATATTAAATTCAAATTAAAGAGTGTA
GCAGCTAAAACTACAACACCAGTAACATTTAAAGATGGTGGAGCTTTCGGTGACGGTACTATGA
CAAAGATAGCTACAGTTACTAAGACAAACGGTAGTGTAACTATAGATCCTGGTACTCAACCTAC
AAAGGAACTTAAAGTAGCAGTAGGAACAGCTGAAGGTAATGTTGGAGATACAGTTACAGTTCCT
GTTACATTTGCTGACGTAGCAAGTGCAGGTAATGTAGGAACATGTAATTTCTATCTTGCATATG
ATGCAAGCCTGTTGGATGTTGTATCAGTAGCTGCAGGTCCTATAGTTAAGAATGCAGCTGTTAA
TTTCTCAAGCAGTGCAAGCAATGGATCAATCAGCTTCCTGTTCTTGGATAACACAATTACTGAT
GAATTGATAACTGCAGATGGTGTATTTGCAAATATCACATTCAAATTAAAGAGCGTAACAGCTA
AAACAACAACACCAGTAACATTTAAAGATGGTGGAGCTTTTGGTGACGGTACTATGGCAAAGAT
AGCTACAGTTACTAAGACAAACGGTAGTGTAACTATAGTTCCCGGTATTCAACCTACAAAGGAA
CTTAAAGTAGCAGTAGGAACAGCTGAAGGAAACGTTGGAGATACAGTTACAGTTCCTGTTACAT
TTGCTGACGTAGCAAGTGCAGGTAATGTAGGAACATGTAATTTCTATCTTGCATATGATGCAAG
CCTGTTGGATGTTGTATCAGTAGCTGCAGGTCCGATAGTTAAGAATGCAGCTGTTAATTTCTCA
AGCAGTGCAAGCAATGGATCAATCAGCTTCCTGTTCTTGGATAACACAATTACTGATGAATTGA
TAACTGCAGATGGTGTATTTGCAAATATCACATTCAAATTAAAGAGTGTAGCGGCTAAAACAAC
AACACCAGTAACATTTAAAGATGGTGGAGCTTTCGGTGACGGTACTATGGCAAAGATAGCTACA
GTTACTAAGACAAACGGTAGTGTAACTATAGTTCCCGGTATTCAACCTACAAAGGAACTTAAAG
TAGCAGTAGGAACAGCTGAAGGAAACGTTGGAGATACAGTTACAGTTCCTGTTACATTTGCTGA
CGTAGCAAGTGCAGGTAATGTAGGAACATGTAATTTCTATCTTGCATATGATGCAAGCCTGTTG
GATGTTGTATCAGTAGCTGCAGGTCCGATAGTTAAAAATGCAGCTGTTAATTTCTCAAGCAGTG
CAAGCAATGGATCAATCAGCTTCCTGTTCTTGGATAACACAATTACTGATGAATTGATAACTGC
AGATGGTGTGTTTGCAAATATCACATTCAAATTAAAGAGTGTAGCGGCTAAAACAACAACACCA
GTAACATTTAAAGATGGTGGAGCTTTCGGTGACGGTACTATGGCAAAGATAGCTACAGTTACTA
AGACAAACGGTAGTGTAACTATAGTTCCTGGTATTCAACCTACAAAGGAACTTAAAGTAGCAGT
AGGAACAGCTTCAGGTAAAGCCGGAGACACTGTAACAGTACCTGTTACTTTTGCAGATGTAGCA
ACAGTAGGTAATGTAGGAACTTGTAACTTCTACGTTACTTATGACACAAATCTGTTGGAAGTAG
CATCAGTGACACCTGGTTCAATAGTAACAAATGCAGCAGTTAACTTCTCAAGTAGTACAAGCAA
TGGAACAATCAGCTTCTTGTTCTTGGACAATACAATTACTGATCAATTGATTAAGACTGATGGA
ACATTTGCTGAAATTAAATTCAAATTAAAGAGTGTAACAGCTAAAACAACAACACCAGTAGCAT
TTAAAGATGGTGGAGCTTTTGGTGACGGAACTATGGCTAAGATAGCTACAGTTACCAAGACAAA
CGGCAGTGTGACTATAGATGTTGGTGATGTTACTCCGGTAAACCCAACTATCACTCCTTCAACT
GCATCTTTTGATAAGTATGTTCCTGCAAATGTAAATGTAACTCTTACACCAAACGGAAATACTT
TCAAAGGTATCACAGGTTTGACATCAGGTACCGACTTTACAGTGTCAAATAATGTTGTAACAAT
CTCAAAGAGCTATTTGAGCACTTTAGCAGTTGGTTCAAAGACACTGACATTTGATTTTGGTGTT
ACAAATAATCCAGTTCTGACTTTAACAATCACTGACTCTACACCTGTTGTTACAGGACTTGGAG
TAAAGATTGCTTCAGTAACAGGTAAAACTGGTGATACTATAACAGTACCTGTAACTCTGAGCAA
TGTTGTTAAATCAGGTAATGTAGGAACATGTAATTTCTATATTACATACGATGCAAGCATGCTG
35
CAGGCAGTATCAGCAACAGCTGGTGACATAGTACTCAATGCACCAGTTAACTTCTCAAGCAGCA
TCAACGCAACAACTGGTACAATCAGTATCCTTTTCCTGGATAACACTATAGGTGATCAGCTCAT
TACCAGCGATGGAGTAGTTGCTAATCTTACATTTAAAGTAGTAGGAACTTCAAGCACAACAACT
CCTATCGCATTTAAAGCAGGCGGAGCTTTCGGTAATGGAAACATGTCTAAAATTTCTGATATTA
CATTCACAAACGGAAGTGCAAAACTTAATTAA

- CipCmat :
CCCTATAcatatgGCAGGTACTGGCGTCGTA

- Minic1rev :
AACCAGctcgagTACTGCTACTTTAAGTTCCTTTG

36
37
38
39
40