INTERNSHIP

Industrial Biotechnology Division

National Institute for Biotechnology and Genetic
Engineering

Topic Isolation of antibiotic producing Streptomyces isolate from a

soil sample collected from NIBGE premises

Name Muhammad Umer Farooq

Institute Muhammad Ali Jinnah University, Islamabad

Dr. Zafar M. Khalid Dr. M. Afzal Ghauri

Director, NIBGE Head of Division

Introduction

The actinomycetes are Gram positive bacteria having high G+C (>55%) content in their DNA.
The name ‘Actinomycetes’ was derived from Greek ‘aktis’ (a ray) and ‘mykes’ (fungus) and
given to these organisms form initial observation of their morphology. Actinomycetes were
originally considered to be an intermediate group between bacteria and fungi but now are
recognized as prokaryotic organisms. The majority of actinomycetes are free living, saprophytic
bacteria found widely distributed in soil, water and colonizing plants. Actinomycetes population
has been identified as one of the major group of soil population (Williams et al. 1989, Korn-
Wendisch and Kutzner 1992).

Indeed, different Streptomyces species, which may vary with the soil type. The actinomycetes
are noteworthy as antibiotic producers, making three quarters of all known products; the
Streptomyces are especially prolific and can produce a great many antibiotics and other class of
biologically active secondary metabolites. They cover around 80% of total antibiotic product,
with other genera trailing numerically; Micromospora is the runner up with less than one-tenth as
many as Streptomyces. If we include secondary metabolites with biological activities other than
antimicrobial, actinomycetes are still out in front, over 60%; Streptomyces spp. accounting for
80% of these (Miyadoh, 1993).

Serious infections caused by bacteria that have become resistant to commonly used antibiotics
have become a major global healthcare problem in the 21st century (Alanis 2005, Ceylan, 2008).
So search for new antibiotics effective against multi-drug resistant pathogenic bacteria is
presently an important area of antibiotic research. Natural products having novel structures have
been observed to possess useful biological activities. Soil is a natural reservoir for
microorganisms and their antimicrobial products (Dancer 2004). This study was carried out to
screen the antibiotic producing Strepomyces from different type of soil. Moreover, for strain
identification, 16S rRNA gene was PCR amplified from one of the local antimicrobial compound
producing Streptomyces isolate.
Materials and Methods

Isolation and enrichment isolate

Soil samples were collected from various locations from NIBGE. Several diverse habitats in
different areas were selected for the isolation of Streptomyces strains. These habitats included the
rhizosphere of plants, agricultural soil etc. The samples were taken up to a depth of 20 cm after
removing approximately 3 cm of the soil surface. The samples were placed in polyethylene bags,
closed tightly and stored in a refrigerator. The following screening procedure was adopted for the
isolation of Streptomyces

The soil was pretreated with CaCO3 (10:1 w/w) and incubated at 37°C for 4 days. It was then
suspended in sterile water. Test tubes containing a 10-2 dilution of the samples were placed in a
water bath at 45°C for 16 h so that the spores would separate from the vegetative cells and the
dilutions were inoculated on the surface of the starch-casein agar plates. The plates were
incubated at 28°C until the sporulation of Streptomyces colonies occurred. Streptomyces colonies
(where the mycelium remained intact and the aerial mycelium and long spore chains were
abundant) were then removed and transferred to the yeast extract- malt extract agar plates. Pure
cultures were obtained from selected colonies for repeated sub culturing.

Characterization of the isolate

Streptomyces colonies were characterized morphologically and physiologically. General
morphology was determined by direct light microscopy examination of the surface of the
cultures. Two isolates showed antibacterial activity against Bacillus subtlis.

Preparation of Genomic DNA from Streptomyces islolate

Materials

1) T.E Buffer,
2) 10% (w/v) SDS
3) 20 mg / ml proteinase K (stored in small single use aliquots at –20 C)
4) 5M NaCl
5) Ctab /NaCl soln
 6) 24:1 chloroform / isoamyl alcohol
7) 25: 24: 1 phenol / chloroform / isoamyl alcohol
8) Ethanol

Procedure
1) Grow 5 ml bacterial culture to saturation. Micro centrifuges 1.5 ml of the culture for 2
min.
2) Resuspend pellet in 567 µL T.E buffer by repeated pipetting.
3) Add 100µL lysozyme (15mg/ml) put for 1 hour.
4) Add 30 µL of 10% SDS & 5µL of 20mg / ml proteinase K, mix & incubate 1hr at 37C &
3µL RNAase.
5) Add 100µL of 5M NaCl &mix thoroughly. Add 80µl Ctab 1NaCl soln., mix and
incubate10min at 65ºC.
6) Add equal volume (100μl) of chloroform/isoamyl alcohol (24:1), mix & micro centrifuge
at 4ºC to 5min at 13,000rpm.
7) Transfer the supernatant to a fresh tube (it is difficult to remove supernatant, remove the
interface with a tooth pick).
8) Add equal volume (100μl) phenol, chloroform/isoamyl alcohol mix & micro centrifuge to
5min. at 13000 rpm.
9) Transfer supernatant to a fresh tube.
10) Add 0.6 vol. (500/400μl) isopropanol & mix gently until DNA precipitates. Centrifuge at
14,000rpm to get DNA pellet. Wash DNA pellet with 1ml of 70% ethanol.
11) Micro centrifuge for 5min. at 14,000rpm ,discard supernatant & dry DNA pellet.
12) Resuspend in 100μl T.E buffer use 10 to 15μl per restriction digest.

Protocol for PCR Amplification of 16S rDNA

Polymerase chain reaction (PCR) amplification of 16S ribosomal DNA of isolates was carried
out using the following primers (Ghauri et al. 2003)
Forward primer (FD1) AGAGTTTGATCCTGGCTCAG
Reverse primer (rP1) ACGG(ACT)TACCTTGTTACGACTT
50µl of reaction mixture was prepared for each amplification. 1X PCR buffer, MgCl2, dNTPs
and taq DNA polymerase were of Fermentas Company, while FD1 and rP1 primers were of
TAGN.

For 50μl reaction mixture:

Nanopure water 34.75 µl
1X PCR buffer 5 µl
MgCl2 (25mM) 6 μl
dNTPs (20mM) 1 μl
FD1 1 μl
rP1 1 μl
taq DNA polymerase (1u/ μl) 0.25-1 μl
Template 1 μl

PCR Profile for 16S rDNA

Initial denaturation was carried out at 95 oC for 5 minutes. Amplification was carried out in thirty
cycles. Each cycle was comprised of 30 seconds at 95oC, 40 seconds at 55 oC and 2 minutes at 72
o
C. The final extension was for 10 minutes at 72 oC. Amplified PCR product was run on 1.5%
agarose gel.

Results

Out of 100 isolates subjected for primary screening process, only 2 isolates showed the activity
against test organisms (E. Coli, Bacillus subtilis and Salmonella typhi) (Fig 1). They were active
against both Gram’s positive as well as gram negative organism.

Fig. 1 Zone of inhibitions produced by

The antimicrobial compounds of local
Isolates against both Gram’s positive
and negative bacteria

Bacillu subtilis E-Coli Salmonella typhi

Genomic DNA extraction and PCR Amplification of the 16S rDNA and Sequencing
Genomic DNA samples were extracted from both Streptomyces isolates (Fig.2) and subjected to
amplification of 16S RDNA genes after optimizing the conditions. Using FD1 and RP1 primers a
PCR product of 1,500 bp was obtained (Fig2) for one of the isolate (Fig.3)

Fig. 2 Genomic DNA extraction from Streptomyces isolates

1 2

2000bp
1500bp
1000bp
750bp
500bp
250bp

Fig.3 PCR amplification of 16S rDNA of local Streptomyces isolate Lane1: 1Kb DNA
Ladder.
Lane 2: Local Streptomyces isolate
References

Alanis AJ (2005) Resistance to antibiotics: are we in the post-antibiotic era? Archives of Medical
Research 36, 697-705.

Ceylan O, Gulten O, Aysel U (2008). Isolation of soil Streptomyces as source antibiotics active
against antibiotic-resistant bacteria EurAsia J BioSci 2, 73-82.

Dancer SJ (2004) How antibiotics can make us sick: the less obvious adverse effects of
antimicrobial chemotherapy. The Lancet Infectious Diseases 4, 611-619.

Ghauri, M A, Khalid, A M, Grant S, Heaphy S, Grant W D (2003). Phylogenetic analysis of

different isolates of Sulfobacillus spp. isolated from uranium rich environments and recovery of
genes using integron specific primers. Extremophiles 5, 341-345

Korn-Wendisch F, Kutzner HJ (1992) The family Streptomycetaceae. In: Balows A, Truper HG,
Dworkin M, Harder W, Schleifer KH (eds), The prokaryotes, Springer-Verlag, New York, 921-
995.

Miyadoh S (1993) Research on antibiotic screening in Japan over the last decade: A producing
microorganisms approach. Actinomycetologica 9, 100-106.

Williams ST, Goodfellow M, Alderson G (1989) Genus Streptomyces Waksman and Henrici
1943, 339AL. In: Williams ST, Sharpe ME, Holt JG (eds.) Bergey's Manual of Systematic
Bacteriology, Vol. 4, Williams and Wilkins, Baltimore, 2452-2492.