Vous êtes sur la page 1sur 15

Arch Microbiol (2008) 189:27–41

DOI 10.1007/s00203-007-0290-1

ORIGINAL PAPER

Growth phase-associated changes in the transcriptome


and proteome of Streptococcus pyogenes
Michelle A. Chaussee Æ Alexander V. Dmitriev Æ
Eduardo A. Callegari Æ Michael S. Chaussee

Received: 3 May 2007 / Revised: 19 June 2007 / Accepted: 4 July 2007 / Published online: 31 July 2007
 Springer-Verlag 2007

Abstract Streptococcus pyogenes is responsible for Enzymes involved in glycolysis and pyruvate metabolism
approximately 500,000 deaths each year worldwide. Many and several stress-responsive proteins were more abundant
of the associated virulence factors are expressed in a in the stationary phase of growth. Overall, the results
growth phase-dependent manner. To identify growth identified growth phase-regulated genes in strain NZ131
phase-associated changes in expression on a genomescale, and revealed significant post-transcriptional complexity
the exponential and stationary phase transcriptomes and associated with pathogen adaptation to the stationary phase
proteomes of S. pyogenes strain NZ131 (serotype M49) of growth.
were compared by using Affymetrix NimbleExpress gene
chips and two-dimensional gel electrophoresis. At the Keywords 2-DE  Proteomics  Transcriptome 
transcript level, the expression of 689 genes, representing Growth phase  Group A streptococcus  Bacterial
approximately 40% of the chromosome, differed by two- pathogenesis
fold or more between the two growth phases. The majority
of transcripts that were more abundant in the early-sta- Abbreviations
tionary phase encoded proteins involved in energy con- THY Todd-Hewitt yeast extract broth
version, transport, and metabolism. At the protein level, an 2-DE Two-dimensional gel electrophoresis
average of 527 and 403 protein spots were detected in the
exponential and stationary phases of growth, respectively.
Tandem mass spectrometry was used to identify 172 pro-
tein spots, 128 of which were growth phase regulated. Introduction

Streptococcus pyogenes is the cause of significant morbidity


Communicated by Erko Stackebrandt.
and mortality worldwide. Colonization can result in
asymptomatic carriage or uncomplicated pharyngitis, as
Electronic supplementary material The online version of this well as life-threatening diseases such as streptococcal toxic
article (doi:10.1007/s00203-007-0290-1) contains supplementary shock and necrotizing fasciitis. Each year, approximately
material, which is available to authorized users.
1.8 million people in the United States are diagnosed with
M. A. Chaussee  A. V. Dmitriev  E. A. Callegari  streptococcal pharyngitis, with an associated cost of over
M. S. Chaussee (&) $100 million (Neuner et al. 2003). Worldwide, nearly
Division of Basic Biomedical Sciences, 700,000 people acquire an invasive infection, which has a
The Sanford School of Medicine of the University of South
Dakota, Lee Medical Building, 414 East Clark Street,
mortality rate as high as 50% (Davies et al. 1996; Carapetis
Vermillion, SD 57069-2390, USA et al. 2005). Prompt treatment of pharyngitis is effective in
e-mail: mchausse@usd.edu preventing post-infection autoimmune sequelae, such as
rheumatic fever and acute glomerulonephritis (Cunningham
A. V. Dmitriev
Department of Molecular Microbiology,
2000). The importance of adequate medical care is reflected
Institute of Experimental Medicine, Saint-Petersburg, Russia in the observation that the incidence of these sequelae is

123
28 Arch Microbiol (2008) 189:27–41

approximately 20 times higher in developing countries expression of genes associated with metabolism, stress
(Carapetis et al. 2005). Overall, S. pyogenes causes responses, and virulence.
approximately half a million deaths each year worldwide
(Carapetis et al. 2005). Thus, the impact of S. pyogenes on
human health is significant, despite the fact that all isolates Materials and methods
are currently sensitive to b-lactam antibiotics.
During the initial stages of pharyngeal infection, S. py- Culture conditions
ogenes competes with normal flora for host cell receptors
and nutrients. To maintain colonization, the pathogen Streptococcus pyogenes strain NZ131 (serotype M49) was
presumably must use a variety of carbon sources and adapt grown at 37C with 5% CO2 in 50 ml Todd-Hewitt broth
to the accumulation of metabolic endproducts. Such containing 0.2% (w/vol) yeast extract (THY; Difco Labo-
adaptation is thought to require extensive changes in gene ratories, Detroit, MI, USA) without agitation until either
expression. Many bacteria use secondary sigma factors to the mid-exponential (OD600 = 0.35; approximately 3.5 h of
alter gene expression in response to changes in the envi- incubation), early-stationary (OD600 = 0.7; approximately
ronment. For example, the Bacillus subtilis genome en- 6.5 h incubation), or stationary (OD600 = 0.7; approxi-
codes at least 17 sigma factors, including SigB, which is mately 18 h of incubation) phase of growth.
involved in stationary-phase expression of a variety of
stress responsive genes (Helmann and Moran 2002). In DNA microarray analysis
contrast, the genome of S. pyogenes encodes one alterna-
tive sigma factor known as SigX, which controls the RNA was isolated with an RNeasy Mini Kit (QIAGEN,
expression of competence-associated genes (Woodbury Valencia, CA, USA) from 40 ml cultures, as previously
et al. 2006). Thus in contrast to many bacterial pathogens, described (Dmitriev et al. 2006). The concentration and
S. pyogenes is thought to change growth phase-associated quality of RNA was assessed with an Agilent 2100 Bio-
patterns of gene expression by interactions among tran- analyzer (Agilent, Palo Alto, CA, USA) using an RNA
scriptional regulators (Kreikemeyer et al. 2003). 6000 Nano LabChip Kit (Agilent). cDNA synthesis and
Batch culture is a convenient method to investigate labeling was done as previously described (Dmitriev et al.
bacterial adaptation to the depletion of preferred carbon 2006). Affymetrix NimbleExpress Arrays were purchased
and energy sources and the accumulation of metabolic from Affymetrix (Santa Clara, CA, USA). The array design
endproducts. The relevance of the model to pathogenesis is was based on the S. pyogenes strain SF370 genome se-
supported by the finding that many virulence-associated quence (Ferretti et al. 2001) and consisted of 2,543 quali-
factors of S. pyogenes are expressed in a growth phase- fiers representing 1,694 predicted S. pyogenes ORFs and
dependent manner (Kreikemeyer et al. 2003). When grown 804 intergenic region probes. In addition, 45 control oligos
with Todd-Hewitt media, S. pyogenes preferentially fer- were used for spike-ins. The GeneChips were hybridized
ments glucose and produces lactic acid as the primary and washed with an automated Affymetrix GeneChip
metabolic endproduct (Chaussee et al. 1997; Neijssel et al. Fluidics Station 450 (Dmitriev et al. 2006). The arrays
1997). The transition to the early-stationary phase of were scanned at 570 nm at a resolution of 1.56 lm using a
growth is associated with the depletion of glucose and confocal GC3000 laser scanner (Affymetrix) and gene
acidification of the media to a pH of approximately 5.5 expression levels were determined with GeneSpring 7
(Chaussee et al. 2003). Therefore, examining the tran- software and normalized with the per chip algorithm (Sil-
scriptome of S. pyogenes at different growth phases may icon Genetics, Redwood City, CA, USA). For each growth
provide insight into the adaptive responses of S. pyogenes condition, two independently isolated RNA samples were
to nutrient limitation and the accumulation of metabolic analyzed. The average signal intensity value of each gene
endproducts. Moreover, because such adaptation is likely was transformed to a log2 (log base 2) value. The change
to involve both post-transcriptional and post-translational between two experimental conditions (n-fold) was calcu-
mechanisms of regulation, it is also of interest to compare lated by taking the ratio of the signal intensity (difference
the exponential and stationary phase proteomes. of the log2 value) between experimental conditions. Present
In this study, Affymetrix NimbleExpess DNA micro- and absent calls were assessed and genes with a twofold
arrays and two-dimensional gel electrophoresis (2-DE) difference in RNA levels were considered to be differen-
were used to compare the transcriptomes and proteomes of tially expressed (Table S1). Statistically significant (t test;
S. pyogenes during the exponential and stationary phases of P < 0.05) differences of fivefold or greater are summarized
growth. The results indicate that entry of strain NZ131 into in Table 2.
the stationary phase is associated with transcriptional, post- All of the microarray data are available through the
transcriptional, and post-translational changes in the Gene Expression Omnibus data repository at NCBI (http://

123
Arch Microbiol (2008) 189:27–41 29

www.ncbi.nlm.nih.gov/geo/) via accession number GSE

CACTGATAATCGTGTCACCCTTTCTTATCCTAAGACTC

TTGGTCAAGGTGTTATTAGCAACTCTTACTGAGGAA
3989.

TTCATGAATATCTTTGCTCCAATGGTTGATAAAGC
CAAAAGTGACCTCTGACAAGGCTAA TAACAGAGGTCCATCAGGGACAAAACAAGGAT

TCTTGATTTAGGTTTAGGTGCTGGGCCTTACC

CCAAAAGAGACTGACGAAGACAAGGCTGCT
Quantitative reverse transcription (RT)-PCR

ATGATGGCGCAAGCAAGTACCTAAACGA
ACTGTATCCAACAGCAGCGCGAAGATTT

TATGACCGTAATGAAACCACTCGCA
Oligonucleotide primers and TaqMan probes (Table 1)

TGAAATTGGCTGACCGCCTGCATA
were designed with Primer Express 2.0 software (ABI
Prism, PE Biosystems, Framingham, MA, USA) and pur-

Fluorescent probe (5¢–3¢)d

TACTGGTGGCGGCGCACC
chased from Sigma-Genosys (The Woodlands, TX, USA).
Amplification and detection were done with the ABI Prism
7700 Sequence Detection System (PE Applied Biosystems)
using TaqMan One-Step RT-PCR Master Mix reagents
(Roche, Indianapolis, IN, USA), as recommended by the
manufacturer. Each assay was done in triplicate with at
least two independently isolated RNA samples. The

AAATAAGTCCGCTCTGTCAGACAGT
quantity of cDNA for each gene was normalized to the

CTGTCATTGAATGTCCAAGCTAATG

Fold changes in gene transcripts in the early-stationary phase in comparison with mid-exponential phase as determined by RT-PCR
AAAGGAAGCCACACCACTACCA
quantity of gyrA cDNA in each sample, and the standard

GGTGCAAGGCTAAGATGGTTTT

ACAGCACTTTGGTAACCGTTGA
CTTCTGGGAAATGAGCCTTGAT

CCAAGTGCCATAGTGGAGCAT

CGAAATGCGCTCTTGTTTGTC

TTCGACCATGAGGGTCATCA
CAAGTTCGTCCCCACCTTCA
error was determined as previously published (Chaussee
et al. 2003).

Covalently linked at the 5¢ end to 5-carboxyfluorescein and at the 3¢ end to N, N, N-tetramethyl-6-carboxyrhodamine


Two-dimensional gel electrophoresis
Reverse (5¢–3¢)
Cytoplasmic proteins were isolated from S. pyogenes, as

Spy numbers are based on annotation of SF370 S. pyogenes strain complete genome (Ferretti et al. 2001)
previously described (Chaussee et al. 2006). Briefly, 40 ml
cultures centrifuged and the pellets were suspended in lysis
buffer. Proteins were isolated and clarified using FastPrep

AAGTCAACAAAGGAAAAGAACCTTTT

Gene designations are in italics, and the corresponding protein designations are in parentheses
CACAGGTCTCAAATGATGTTGTTCT
CACCTACACTAAAAAACCGCATCA

protein isolation and PlusOne 2-D Clean-up kits (GE

GGTGGTGGTAAAGTGCCTATGGT

CGCACTAAACCCTTCAGCTCTT
Healthcare, Piscataway, NJ, USA) to remove non-protein
Table 1 Primers and TaqMan probes used for quantitative reverse transcription (RT)-PCR

CCGAAAACCATCGCAAAATG

ACCTGGTTTCTGCCGTTTTTG
GAGTGGATGAGCACCGCTTT
TTGGAATGTTGGCAGCCTTT
CCCTTTTACGTGGGCATCTG
ACCCGCTTGTTTGGTTTGAG

contaminants. Protein determinations were done with a


PlusOne 2-D Quant kit (GE Healthcare), as described by
the manufacturer. Isoelectric focusing (IEF) was done
Fold changes in Forward (5¢–3¢)

using 24 cm immobiline dry strips with a linear pH range


of 4 to 7 (GE Healthcare). Following IEF, SDS-poly-
acrylamide gel electrophoresis (SDS-PAGE) separation
was done with a DALT II six electrophoresis apparatus
(GE Healthcare) and 10% acrylamide resolving gels. The
proteins were stained with Sypro Ruby (Molecular Probes),
transcriptsc

and digital images were acquired with a Typhoon 9410


imager (GE Healthcare). Analysis of the gels, including
gene

protein spot detection and quantitation, was done with


0.6
4

5
3
11

79

16

PDQuest software (Bio-Rad, Hercules, CA, USA). Gels


norA (putative antibiotic resistance protein

were normalized based on the sum of all protein spots


None (putative phosphotransferase system
None (putative regulatory protein - RofA

detected in each sample. For each phase of growth, proteins


None (putative serine cycle enzyme)
(PTS), enzyme II, component C)
nga (nicotine adenine dinucleotide

were isolated on three independent occasions and statisti-


relA ((p)ppGpp synthetase, GTP
phosphoribosyltransferase)

cally significant differences were determined using


speB (pyrogenic exotoxin B)
glycohydrolase precursor)

rgg (transcription regulator)


arcA (arginine deiminase)

PDQuest software (t test; P < 0.05).


pyrophosphokinase)
pyrE (putative orotate

mf (mitogenic factor)

Protein identification
Designationb

related)

NorA)

Proteins of interest were excised from the SDS-PAGE gels


with a robotic spot cutter (Bio-Rad) and identified with
tandem mass spectrometry, as previously described
1059

1547
1856

1981

2039
2042
2043
2084
no.a
Spy

165

216

901

(Chaussee et al. 2004). Spectra were obtained in positive


b

d
a

123
30 Arch Microbiol (2008) 189:27–41

Table 2 Growth phase-associated differences in the transcriptome greater than fivefold (P < 0.05)
SPya Gene Description Fold change
(stat/exp)

More abundant in early stationary phase


Translation
552 – Hypothetical protein 5
Transcription
2172 – Hypothetical protein 15
1763 hrcA Putative heat shock transcription repressor protein 11
1259 – Transcriptional regulator 8
1602 – Transcriptional regulator 8
1285 – Transcriptional regulator 7
1817 scrR Putative sucrose operon repressor 5
2177 – Putative transcriptional regulator (TetR AcrR 5
family)
Replication, recombination and repair
1846 dinP DNA-damage-inducible protein P 14
1510 mutT Mutator protein 8
185 polA DNA polymerase1 6
550 – Hypothetical protein 6
1314 uvrB Excinuclease (subunit B) 5
1369 deaD2 Putative RNA helicase 5
Defense mechanisms
837-838b –/yknZ ABC transporter-hypothetical protein 8–9
1286 – ABC transporter 7
Signal transduction mechanisms
1780 – Hypothetical protein 7
584 ptsK Hpr kinase phosphatase 5
Cell wall/membrane biogenesis
836 – Hypothetical protein 10
585 lgt Prolipoprotein diacylglycerol transferase 5
716 agaS Tagatose-6-phosphate aldose ketose isomerase 5
2059 pbp2A Penicillin-binding protein 2a 5
Posttranslational modification, protein turnover, chaperones
888 clpL ATP-dependent protease 22
1509 clpE ATP-dependent protease 14
1759-1760-1761 dnaJ/dnaK/grpE Heat shock proteins/Hsp-70 cofactor 10-9-12
2105 nrdG Putative anaerobic ribonucleotide reductase 8
activator
2037 – Peptidylprolyl isomerase 7
2072 groES Heat shock protein 6
395 clpP ATP-dependent protease subunit 6
2079 ahpC Putative alkyl hydroperoxidase 5
Energy production and conversion
1191 oadA Oxaloacetate decarboxylase alpha chain 21
1189 citF Citrate lyase, alpha subunit 19
1184-1186 –/citD Decarboxylase, beta subunit- citrate lyase, gamma 14-18
subunit
1683-1684 glpO/glpK Alpha-glycerophosphate oxidase-glycerol kinase 9-9
352 – Acylphosphatase 8
512 – NADH-flavin oxidoreductase 8

123
Arch Microbiol (2008) 189:27–41 31

Table 2 continued
SPya Gene Description Fold change
(stat/exp)

839 – Glycerophosphodiester phospohodiesterase 8


2049 pflD Pyruvate formate lyase-2 6
801 – Ferredoxin 5
1029 acoC Putative dihydrolipoamide S-acetyltransferase 5
1192 citC Putative citrate lyase synthetase (citrate (pro-3S)- 5
lyase ligase)
2047 gldA Glycerol dehydrogenase 5
Carbohydrate transport and metabolism
1188 citE Citrate lyase, beta subunit 15
1816 scrB Sucrose-6-phosphate hydrolase 9
1287 – Hypothetical protein 8
1599 – Beta glucosidase 8
1604 – Alpha-mannosidase 8
1707-1708-1709-1710-1711 lacB.1A.1/–/–/– Galactose-6-phosphate isomerase-PTS 7-11-6-8-6
1976 msmK Multiple sugar metabolism transporter 7
1592 – Hypothetical protein 6
1682 glpF Glycerol uptake facilitator 6
1918-1919-1921-1922 lacFD.2C.2B.2 PTS-tagatose-PTS-system-1,6-diphosphate aldolase- 5-6-5-5
tagatose 6-phosphate kinase- galactose-6-
phosphate isomerase
Amino acid transport and metabolism
1544 arcB Putative ornithine transcarbamylase 107
1542 – Putative Xaa-His dipeptidase 95
1547 arcA Arginine deiminase 41
511 gloA Lactoylgutathione lyase 9
513 pepQ Putative XAA-PRO dipeptidase 7
183-184 opuAAABC Glycine betaine proline ABC transporter-glycine- 7-7
betaine binding permease protein
1111 Alcohol dehydrogenase 6
1991 trpG Anthranilate synthase component II 5
Nucleotide transport and metabolism
2110 nrdD Anaerobic ribonucleoside-triphospate reductase 8
Coenzyme transport and metabolism
1096 folC.1 Folyl-polyglutamate synthetase 6
Lipid transport and metabolism
1190 citX Hypothetical protein 20
1183 – Decarboxylase, gamma chain 17
Inorganic ion transport and metabolism
1715 copA Putative cation-transporting ATP-ase 9
158 – Toxic anion resistance protein 7
408 – Hypothetical protein 6
2115 Hypothetical protein 5
General function prediction only
1546 – Hypothetical protein 63
2170 – Hypothetical protein 11
775, 1339 – Hypothetical proteins 8
2106-2107 – Hypothetical protein-putative oxidoreductase 7-7
357, 500, 588 – Hypothetical proteins 5

123
32 Arch Microbiol (2008) 189:27–41

Table 2 continued
SPya Gene Description Fold change
(stat/exp)

Function unknown
1543 – Hypothetical protein 85
1260-1261-1262-1263-1264-1265 – Hypothetical proteins 19-15-12-19-11-12
2173 yoxJ Hypothetical protein 16
238 – Hypothetical protein 15
470 – Myosin-crossreactive antigen 12
1603, 1686 – Hypothetical proteins 7
1440 – Putative holin - phage associated 5
Not in COGs
2040 – Hypothetical protein 44
2043 mf Mitogenic factor 18
1156-1157 – Hypothetical proteins 9-15
1436 mf3 Putative deoxyribonuclease 11
2039 speB Pyrogenic exotoxin B 11
577, 802 – Hypothetical proteins 6
1600 – Hyaluronidase 6
997 hylP2 Hyaluronidase phase associated 5
159, 492, 553, 578, 914, 1405, 1437 – Hypothetical proteins 5
Less abundant in early stationary phase
Translation, transcription, replication, recombination and repair
870 fms Polypeptide deformylase –7
307 – Hypothetical protein –5
847 – 16S rRNA processing protein –5
Defense mechanisms
1205 – Putative antimicrobial resistance factor –15
Posttranslational modification, protein turnover, chaperons
850 – Thioredoxin reductase –6
Transport and metabolism
323 braB Putative branched-chain amino acid transport –16
protein
1506-1507 – Putative amino acid ABC transporter –11–11
1270 – Amino acid symporter –8
386 – Ferrichrome ABC transporter –7
1136-1137 xpt/- Santhine phosphoribosyltransferase-purine –7–5
permease
1114 – Hypothetical protein –7
2193 – Hypothetical protein –5
General function prediction only, function unknown, not in COGs
1139 – 4-oxalocrotonate tautomerase –8
314 – Hypothetical protein –7
312, 1735 – Hypothetical proteins –6
1206-1208 – ABC transporter-hypothetical protein –6–5
305-306 – Hypothetical proteins –5–5
421 yoaK Hypothetical protein –5
1203 – hypothetical protein –5
a
SPy numbers are based on the SF370 S. pyogenes genome annotation (Ferretti et al. 2001)
b
Contiguous genes likely to be co-transcribed are grouped together

123
Arch Microbiol (2008) 189:27–41 33

ion mode, deconvoluted, and analyzed with MassLynx 4.0 interest. In addition, metabolic genes likely to be growth
software (Waters Corp., Milford, MA, USA). Protein Lynx phase-regulated were selected. The majority of growth
Global Server v. 2.1 (Waters) was used to search databases phase-responsive genes encoded proteins involved in
consisting of S. pyogenes genome sequences and the NCBI metabolism and transport, stress responses, protein trans-
v20060512 non-redundant genomic databases. The lation, cell-wall metabolism, and protein synthesis (Fig. 1).
parameters for the search were as follows: the modification Transcript changes fivefold or greater are reported in Ta-
on cysteine residue by carboxyamidomethylation was set ble 2. In addition to the transcriptome analysis, changes in
as fixed; asparagine and glutamine deamidation, and the proteome were identified by using 2-DE and repre-
methionine oxidation were considered as variable modifi- sentative gels are shown in Fig. 2. An average of 527 and
cations. The maximum number of missed cleavages was 403 protein spots were detected in gels containing samples
one. Monoisotopic masses were considered, and the pep- from the exponential and stationary phases of growth,
tide and fragment tolerances were 100 ppm and 0.25 Da, respectively. Several hundred protein spots were excised
respectively. Proteins were identified by matching MS/MS from gels containing both exponential and stationary-phase
spectra from at least two tryptic peptides or by de novo proteins and analyzed with tandem mass spectrometry. The
peptide sequence determination, when only one MS/MS results were used to confirm protein spot matching among
match was identified. the gel set. Among the spots analyzed, 172 unique proteins
were identified, which represented 96 loci (Table S2). 128
protein spots, representing 80 loci, were altered in a growth
Results phase-specific manner. Statistically significant changes
(P < 0.05) are summarized in Table 3.
Growth phase-associated changes in the transcriptome
and proteome Growth phase-associated changes in regulatory genes

Growth phase-associated changes in the S. pyogenes In the absence of a stationary phase-specific secondary
NZ131 transcriptome were identified with Affymetrix sigma factor, genomewide changes in expression are
NimbleExpress whole-genome chips. RNA was isolated thought to result from interactions among regulons. In the
during the mid-exponential and early-stationary phases of early-stationary phase of growth, changes in the transcrip-
growth. The transcript levels of 689 genes, representing tome correlated with increases in transcripts encoding glo-
approximately 40% of the chromosome, changed by two- bal regulatory proteins (Table S1). These included: (a) codY
fold or more upon entry into the early-stationary phase of (threefold), which controls the cellular response to nitrogen
growth; 522 and 167 gene transcripts were more and less starvation (Fisher 1999). (b) relA (twofold), which mediates
abundant, respectively (Table S1). Quantitative RT-PCR the stringent response to amino acid starvation (Steiner and
was used to measure transcripts of 11 genes (Table 1) in Malke 2000). and (c) luxS (twofold), which synthesizes an
both the mid-exponential and early-stationary phases of autoinducing quorum sensing molecule (Lyon et al. 2001).
growth and the results correlated with the microarray data, The increase in codY expression was associated with
which supports the validity of the array data (Fig. S1). The changes in the CodY regulon (Malke et al. 2006). For
genes selected included several known or putative viru- example, genes involved in peptide and amino acid trans-
lence-associated genes and regulators, which are of general port (oppBCD and dppBCDE, and braB) were less abundant

Transport and metabolism (513)


Energy production and conversion (62)
Posttranslational modification, protein turnover, chaperones (56)
Cell wall and membrane biogenesis (76)
Signal transduction mechanisms (70)
Replication, recombination and repair (128)
Transcription (133)
Translation (152)

0 10 20 30 40 50 60

Fig. 1 Growth phase-associated changes in functionally categorized compared to those during the mid-exponential phase of growth are
gene transcripts in NZ131. The percentages of more-abundant (open shown. The number of genes within each category is indicated in
bars) and less-abundant (closed bars) gene transcripts in each parentheses
functional category during the early-stationary phase of growth

123
34 Arch Microbiol (2008) 189:27–41

except glucose kinase, were identified in 2-DE gels and


were more abundant in the stationary phase of growth
(Fig. 3). The increase correlated with transcriptome results
(Table S1). Proteins involved in pyruvate metabolism were
also elevated in the stationary phase of growth including
pyruvate dehydrogenase (AcoB, SPy 1028; AcoL, SPy
1031), which converts pyruvate to acetyl CoA and CO2,
and L-lactate dehydrogenase (LDH) (Fig. 3, Table 3).
Presumably, the increase in central metabolic enzymes
enhances the ability of the pathogen to scavenge carbo-
hydrates present at very low concentrations (Harder and
Dijkhuizen 1983). In this regard, Escherichia coli adapts to
glucose-limiting conditions by increasing the expression of
genes involved in central metabolism (Hua et al. 2004) and
the abundance of proteins involved in glucose uptake
(Wick et al. 2001). Such adaptation may be particularly
important during infection of tissues in which the con-
centration of carbohydrates is very low.
Transcripts associated with the transport and metabo-
lism of lactose, sucrose, mannose, and amylase were also
more abundant during the stationary phase of growth
(Table S1). Similarly, transcripts encoding arginine dei-
minase (arcA) and serine dehydratase (sdh), which are
involved in the catabolism of arginine and serine,
respectively, were elevated in the stationary phase of
growth (Table S1). The changes in the expression of
amino acid catabolic enzymes were associated with in-
creased expression of several genes encoding putative
peptidases, such as pepA, pepC, pepD, pepP, pepQ,
pepXP. Several of the changes were cognate with those
obtained with 2-DE (Table 2). Finally, transcripts encod-
Fig. 2 Representative 2-DE gels of S. pyogenes proteins isolated ing the citrate lyase complex (citDEFX) and oxaloacetate
during the a exponential and b stationary phases of growth. The SPy decarboxylase (oadA) were more abundant in the early-
numbers (based on the SF370 genome annotation) of proteins
identified with tandem mass spectrometry are indicated
stationary phase of growth (Table S1). Together, the
changes in genome expression are consistent with the
de-repression of genes involved in the metabolism of non-
in the early-stationary phase of growth compared to the glucose carbon sources.
exponential phase. Similarly, the increase in relA transcripts
was associated with increased expression of murE, rplL, and Growth phase-associated changes in stress responsive
fus, which are part of the stringent response. The expression genes
of several other regulatory gene transcripts was also altered
coincident with entry into the early-stationary phase of Nutrient limitation and decreasing pH trigger a variety of
growth (Table S1). The only change in regulatory proteins bacterial stress responses (Len et al. 2004). Not surpris-
detected with 2-DE gels was PyrR (SPy 830), which was ingly, the abundance of several stress responsive proteins
detected only in protein samples from stationary phase was elevated in the stationary phase of growth (Table 3)
cultures (Table 3). The absence of other regulatory proteins including DnaK (SPy 1760), ClpE (SPy 1509), and Nox1
in the 2-DE gels is not surprisingly given that they are (SPy 2080); the cognate transcripts were elevated by 9, 14,
typically expressed at relatively low levels. and 6-fold, respectively (Table 2).
In some instances, growth phase-associated changes in
Growth phase-associated changes in metabolic genes stress responsive proteins were detected at either the tran-
script or the protein level. For example, transcript levels of
In THY broth, S. pyogenes obtains energy primarily from clpL, groEL, groES were more abundant upon entry into
the fermentation of glucose. All of the glycolytic enzymes, the stationary phase of growth (Table 2); however, no

123
Arch Microbiol (2008) 189:27–41 35

Glucose
Glucose kinase
(SPy1529) (not
detected in 2-DE
Fold change (stat/exp)
gels)
Exponential Stationary mRNA Protein
Glucose-6-Phosphate

Glucose-6-P isomerase
(SPy0215) 2 6
Fructose-6-Phosphate

Phosphofructokinase
(SPy1283) 3 3

Fructose-1,3-Bisphosphate

Fructose bisphosphate aldol-


ase (SPy1889) 3 2

Glyceraldehyde-3-Phosphate
Glyceraldehyde 3-P
dehydrogenase 3 22
(SPy0274)

1,3-bisphosphoglycerate

Phosphoglycerate kinase
(SPy1881) nd 4

3-phosphoglycerate

Phosphoglycerate
mutase (SPy1429) 2 3
2-phosphoglycerate

Enolase
(SPy0731) 4 2
phosphoenolpyruvate

Pyruvate kinase
(SPy1282) 3 12

lactate pyruvate acetyl-CoA


L-lactate Pyruvate dehydrogenase (SPy1028)
dehydrogenase (SPy1151) Dihydrolipoamide dehydrogenase (SPy1031)

Exponential Stationary
Exponential Stationary

SPy1028 4 2
3 2

SPy1031 4 uc

Fig. 3 Growth phase-associated differences in the abundance of transcript levels were determined by DNA microarray analysis. ‘‘uc’’
proteins involved in glycolysis and pyruvate metabolism. Selected indicates that the ratio cannot be calculated and ‘‘ND’’ indicates the
enzymes are circled and proteins indicated in the pathway diagram. value was not determined
The fold change in protein and transcript levels is indicated. The

difference was detected at the protein level. In contrast, the stationary phase and a proton translocating ATPase AtpA
peptidyl-prolyl cis-trans isomerase RopA (SPy 1896), (SPy 0758) was only detected among stationary phase
which is required for the secretion of the cysteine protease proteins (Table 3); however, no changes in the corre-
SpeB (Neely et al. 2003), was more abundant during the sponding transcripts were observed (Table S1). Thus, post-
stationary phase; however, changes in ropA transcripts transcriptional mechanisms of regulation are involved in
were not detected. Similarly, the abundance of cysteine the adaptation of S. pyogenes to the culture conditions
synthase CysM (SPy 1618) increased sevenfold in the associated with the stationary phase of growth.

123
36 Arch Microbiol (2008) 189:27–41

Table 3 Growth phase-associated changes in the proteome (P < 0.05)


SPya Gene Description Exponential Stationary Fold
phaseb phaseb changec
(stat/exp)

Translation
0273 fus EF-G 630 112 –6
0273 fus EF-G NDd 476 uce
0273 fusf EF-G 102 1006 10
0611 tufA EF-Tu 6626 1222 -5
1688 glyS Glycyl-tRNA synthetase (beta subunit) ND 725 uc
2093 tsf EF-Ts 45 1,950 43
Cell wall/membrane biogenesis
0763 – UDP N acetylglucosamine 1 carboxyvinyltransferase ND 423 uc
0784 rmlD dTDP 4 keto L rhamnose reductase 467 2686 6
1280 glmS L glutamine D fructose 6 phosphate amidotransferase ND 777 uc
1525 murD UDP-N-acetylmuramoylalanine-D-glutamate ligase ND 114 uc
Posttranslational modification, protein turnover, chaperones
1509 clpE ATP dependent protease ND 197 uc
1509 clpE ATP dependent protease ND 103 uc
1760 dnaK Heat shock protein 70 2263 6355 3
1896 ropA Trigger factor (prolyl isomerase) 1305 7530 6
Energy production and conversion
0226 gpsA NAD(P)H-dependent glycerol-3-phosphate 70 552 8
dehyrodgenase
0758 atpA Proton translocating ATPase alpha subunit ND 1047 uc
0759 atpG Proton-translocating ATPase, gamma subunit ND 972 uc
1028 acoB Pyruvate dehydrogenase (beta chain) 2372 4562 2
1028 acoB Pyruvate dehydrogenase (beta chain) ND 166 uc
1031 acoL Pyruvate dehydrogenase, component E3 31 921 29
1069 – NADH dehydrogenase ND 657 uc
1128 pta Phosphotransacetylase 975 4011 4
1151 ldh L-lactate dehydrogenase 1109 238 -5
1151 ldh L-lactate dehydrogenase 4210 9286 2
1371 gapN NADP-dependent glyceraldehyde-3-phosphate 2232 5602 3
dehydrogenase
1371 gapN NADP-dependent glyceraldehyde-3-phosphate 41 367 9
dehydrogenase
Carbohydrate transport and metabolism
0215 pgi Glucose-6-phosphate isomerase 252 1427 6
0613 tpi Triosephosphate isomerase 4938 1360 -4
0731 eno Enolase 385 ND uc
0731 eno Enolase 21888 41572 2
1282 pyk Pyruvate kinase 605 6499 12
1283 pfk 6-Phosphofructokinase 2748 7889 3
1372 pstI Phosphoenolpyruvate:sugar phosphotransferase system 1930 5763 3
enzyme I
1429 gpmA Phosphoglycerate mutase 2728 7412 3
1676 tkt Transketolase 1255 4467 4
1881 pgk Phosphoglycerate kinase 1933 288 –7
1881 pgk Phosphoglycerate kinase 2152 405 –5
1881 pgk Phosphoglycerate kinase 1133 297 –3
1881 pgk Phosphoglycerate kinase 296 4463 15

123
Arch Microbiol (2008) 189:27–41 37

Table 3 continued
SPya Gene Description Exponential Stationary Fold
phaseb phaseb changec
(stat/exp)

Amino acid transport and metabolism


0911 bcaT Branched-chain-amino-acid transferase 2212 656 -3
1070 – Dipeptidase 1149 4053 4
1316 – ABC transporter 2179 4373 2
1541 arcC Carbamate kinase 1081 3585 3
1544 arcB Ornithine transcarbamylase ND 115 uc
1618 cysM O-acetylserine lyase 1380 10213 7
Nucleotide transport and metabolism
0160 purA Adenylosuccinate synthetase 84 404 5
0830 pyrR Pyrimidine regulatory protein ND 346 uc
0892 punA Purine nucleoside phosphorylase 2279 4621 2
2206 guaB Inosine monophosphate dehydrogenase ND 139 uc
2206 guaB Inosine monophosphate dehydrogenase 38 1160 31
Lipid transport and metabolism
1637 atoB Acetyl CoA acetyltransferase 18 233 13
1748 fabF Beta-ketoacyl-ACP synthase II 796 2,010 3
Secondary metabolites biosynthesis, transport, and catabolism
0647 – Acetoin reductase 990 4423 5
General function prediction only
0044 adhA Alcohol dehydrogenase I 3166 6250 2
1150 nox NADH oxidase 536 5180 10
a
SPy numbers are based on the SF370 S. pyogenes genome annotation (Ferretti et al. 2001). More than one isoform of each protein may have
been detected and the corresponding quantity is shown on a separate line
b
Mean quantity of protein was determined with PDQuest 7.3.0 2-D analysis software
c
The fold change in protein abundance in the exponential compared to the stationary phase. Negative values indicate the protein was more
abundant in the exponential phase
d
Protein spot not detected
e
Unable to calculate ratio because one spot was not detected
f
Protein spot quantities are reported for each isoform identified

Growth phase-associated regulation of virulence genes Protein isoforms

Several virulence factors of S. pyogenes are expressed in a Post-translational protein modifications such as phosphor-
growth phase-dependent manner (Kreikemeyer et al. ylation, glycosylation, acetylation, and proteolysis can alter
2003). Surprisingly, a difference in the expression of the the migration of proteins in 2-DE gels. In this study, 33 loci
Mga-regulated operon, which is known to be expressed were identified that encoded proteins with multiple iso-
primarily in the exponential phase of growth, was not forms. Together, the isoforms were among the most abun-
detected in strain NZ131. The RNA was isolated from dant proteins and accounted for 30% of the total amount of
cultures in the early-stationary phase of growth. Thus is protein detected. Among the isoforms, the migration of 25
seems likely that Mga-regulated transcripts decrease at proteins deviated from the predicted Mr by more than
later times in the stationary phase. Nonetheless, the 10,000 Da; the migration of five proteins deviated from the
expression of several genes encoding secreted proteins, predicted pI by more than 1.0 (Table S2). Proteins with the
such as mf-1, mf-3, hyluronidase, speB, cfa, and sagA most isoforms included enolase (Eno; SPy 0731), elonga-
increased in the stationary phase of growth (Table S1), as tion factor Tu (EF-Tu; SPy 0611), elongation factor G (EF-
expected. G; SPy 0273), phosphoglycerate kinase (Pgk; SPy 1881),

123
38 Arch Microbiol (2008) 189:27–41

triosephosphate isomerase (SPy 0613), cell division initia- Growth phase-associated transcriptional changes
tion protein (DivIVAS; SPy 1514), heat-shock protein 70 in vitro, in vivo and during growth with human saliva
(DnaK; SPy 1760), O-acetylserine lyase (CysM; SPy 1618),
and elongation factor Ts (EF-Ts; SPy 2093). DNA microarrays were recently used to characterize S.
The abundance of several isoforms changed in a growth pyogenes gene expression during soft-tissue infections of
phase-associated manner. For example, one LDH isoform mice (Graham et al. 2006). Over 80% of the transcripts that
was more abundant during the exponential phase of growth were most abundant during soft-tissue infections are also
while a different isoform was more abundant during the growth-phase regulated in strain NZ131. Moreover, genes
stationary phase of growth (Table 3); the corresponding ldh that are highly expressed in mice were typically expressed
transcripts were threefold more abundant upon entry in the in the early-stationary phase of growth in the present study.
stationary phase of growth (Table S1). Similarly, the These include genes involved in maltodextrin utilization
abundance of one DivIVAS isoform (Table S2) was greater (SPy 1299, 1302, and 1304), a variety of stress response
during the exponential phase of growth, while the abun- related genes including dnaK, grpE, hrcA (SPy 1760-
dance of three other isoforms increased in the stationary 1763), and a cluster of hypothetical protein genes (SPy
phase of growth. Growth phase-associated changes in 1260-1265). One of the genes annotated as a hypothetical
divIVAS transcripts were not detected, suggesting that protein (SPy 1260) is similar to Gls24 of Enterococcus
DivIVAS changes are mediated post-transcriptionally. faecalis, which is expressed in response to nutritional stress
Further analysis of tryptic peptides revealed that one and contributes to virulence (Giard et al. 2000; Hew et al.
DivIVAS isoform was phosphorylated, at the threonine 2006). Similarly, several genes expressed at a low level in
residue (position 205). This modification was similar to a soft tissue infections were also less abundant in the sta-
previous report of growth phase-associated phosphorylation tionary phase of growth in strain NZ131. Exceptions to this
of DivIVAS in Mycobacterium tuberculosis (Kang et al. trend included the hypothetical proteins SPy 308-314 and
2005). The nature of the other modifications and the func- 2191-2193. Both soft-tissue infection and the stationary
tional significance of the changes remain to be determined. phase of growth are associated with low concentrations of
glucose, which is consistent with the shared patterns of
gene expression.
Discussion The transcriptome of S. pyogenes MGAS5005 has also
been characterized during growth with human saliva
Growth phase-associated changes in gene expression have (Shelburne et al. 2005). Among the 20 most abundant gene
been used as a convenient, albeit imperfect, method to transcripts during the stationary phase of growth in saliva,
study pathogen adaptation to changing environmental 80% were more abundant during the early-stationary phase
conditions. Many of the established virulence factors of S. of growth of NZ131 with THY. Among the differences,
pyogenes are regulated in a growth phase dependent fash- SPy 0084 (annotated as a hypothetical protein) was the
ion, which suggests that the model is relevant to the study most highly expressed transcript in saliva but was less
of pathogenesis. In this study, differences in gene expres- abundant during batch culture of NZ131 (Table S1). Other
sion between the exponential and early-stationary phases of noteworthy differences were among the malAC and prtS
growth were identified at both the transcript and protein genes, which were more abundant in the stationary phase of
level in strain NZ131 (serotype M49). The results showed growth with saliva but not when grown with THY, prob-
de-repression of operons involved in non-glucose based ably because THY does not contain a significant amount of
catabolism, increased expression of stress responsive maltodextrins.
genes, and increased expression of a variety of virulence-
associated genes in the stationary phase of growth. Results Growth phase regulation in different strains
obtained with DNA microarrays provided much informa- of S. pyogenes
tion on the expression of genes likely to be present at low
concentrations in the cell, such as regulatory proteins. The Previously, growth phase-associated changes in the tran-
complementary proteomic approach revealed the formation scriptome of S. pyogenes strain 591, which is also a sero-
of growth phase-associated isoforms and identified changes type M49 strain, were analyzed using DNA microarrays
in protein abundance not evident at the transcript level. In (Beyer-Sehlmeyer et al. 2005). Among the growth phase-
addition, several open reading frames previously annotated regulated genes identified in strain 591, 145 genes were
as hypothetical proteins were identified in the 2-DE gels. also regulated in growth phase-specific manner in strain
Together, the results help to define growth phase specific NZ131. For 64 loci, a growth phase-associated change in
patterns of gene expression in a serotype M49 strain of expression was detected in strain 591 but not in strain
S. pyogenes. NZ131. For 16 genes, opposing results were noted. The

123
Arch Microbiol (2008) 189:27–41 39

discrepancies between the two studies typically involved et al. 2003) and thus the increase correlates with decreasing
relatively minor changes in transcript levels. For example, culture pH. CysM is essential for the survival of Pseudo-
in NZ131 deoB transcripts, encoding phosphopentomutase monas putida during cold shock (Reva et al. 2006), and
(SPy 0890), were threefold more abundant in the early- contributes to the resistance of Staphylococcus aureus to
stationary phase compared to the exponential phase. In tellurite, hydrogen peroxide, and acidic conditions (Lith-
contrast, the transcripts were twofold more abundant dur- gow et al. 2004). In addition, CysM was more abundant
ing the exponential phase in strain 591. Minor differences when S. pyogenes was grown in the presence of human
in experimental reagents (such as media composition) and plasma (Johansson et al. 2005). Nox1 may help S. pyogenes
techniques may account for some of the differences. In survive oxidative stress and its activity is decreased in the
contrast to results obtained with serotype M49 strains, only presence of glucose (Gibson et al. 2000). Therefore, it is
seven transcripts (sagA, sagI, arcT, arcA, sda and a not surprising to see an increase in Nox1 during the sta-
transposase gene designated SPyM3_0221), were elevated tionary phase of growth when glucose is depleted. Thus in
in strain MGAS315 (serotype M3) upon entry into the addition to well-characterized stress responsive proteins,
stationary phase of growth (Barnett et al. 2007). Interest- additional growth phase-regulated proteins were identified
ingly, in strain MGAS315, transcript levels of the arc op- which are likely to contribute to adaptation to the changing
eron varied among the genes in the operon and only arcT environmental conditions.
and arcA were elevated 2.3 and 4.8-fold, respectively, in
the stationary phase of growth. In contrast, in strain NZ131, Comparison of array and proteomic-derived results
transcript levels of all six genes in the presumptive poly-
cistronic operon were elevated over 40-fold in the early- The results obtained with DNA microarrays were signifi-
stationary phase of growth (Table 1). In strain MGAS315 cantly more comprehensive compared to those obtained
gene-specific degradation of mRNA is an important feature with 2-DE, due to the relatively low sensitivity of protein
of growth phase-associated gene regulation (Barnett et al. detection. The total number of unique proteins identified in
2007). In this regard, the extent to which the rate of mRNA this study corresponded to 9% of the predicted proteins
decay in strain NZ131 contributes to regulation remains to within the pI range of analysis (4–7), which is similar to
be determined. The differences in growth phase regulation results obtained in related studies (Jungblut et al. 2000;
among these strains, suggests that the clinical and pheno- Guillot et al. 2003; Folio et al. 2004). In general, changes in
typic diversity characteristic of S. pyogenes may result, at protein abundance correlated with changes in transcript
least in part, from differences in the regulation of gene levels. Nonetheless, the proteomic-derived dataset pro-
expression. vided the following information. First, several proteins are
post-translationally modified in a growth phase-dependent
Responses to changing culture conditions manner. The nature and functional significance of the
modifications remain to be determined. Second, several
The abundance of two LDH (SPy 1151) isoforms changed growth phase-associated changes in protein abundance
in a growth phase-associated manner. One isoform was were identified that were not associated with changes in the
more abundant during the exponential phase of growth corresponding transcript levels. Of particular note, proteins
while another was more abundant in the stationary phase of involved in cell wall and membrane biogenesis, including
growth (Table 3). Similar results were obtained with S. RmlD, GlmS, MurD were more abundant in the stationary
pneumoniae (Lee et al. 2006). In addition, LDH levels in- phase of growth, although a change in transcript level was
crease nearly twofold when S. mutans is exposed to acidic not detected. Third, several hypothetical open reading
conditions (Wilkins et al. 2002). Moreover, changes in the frames were found to encode expressed proteins, some of
migration of LDH in S. pyogenes were similar to those in S. which are also expressed in a growth phase dependent
mutans. For example, one LDH isoform from S. pyogenes manner.
migrated to a position 1.8 kDa and 0.2 pI units greater than In summary, genomewide differences in expression
the predicted values (Table S2), which is identical to the were identified between the exponential and early-station-
changes in the migration of an LDH isoform in S. mutans ary phase of growth in a serotype M49 S. pyogenes strain.
under acidic conditions (Wilkins et al. 2002). Thus, at least The changes are mediated by mechanisms that do not ap-
some of the growth phase-associated changes in the abun- pear to rely on secondary sigma factors, which may ac-
dance of protein isoforms identified in S. pyogenes, are count for the diversity in growth phase-associated gene
likely to result from acidification of the media. regulation among various strains of S. pyogenes. Clearly,
AtpA, CysM, and Nox1 were more abundant in the identifying the mechanisms of growth phase-mediated
stationary phase of growth (Table 3). In E. faecalis, AtpA control of gene expression is necessary to understanding
controls cytoplasmic pH under acidic conditions (Voyich the control of virulence factor expression in S. pyogenes.

123
40 Arch Microbiol (2008) 189:27–41

Acknowledgments We thank Emily McDowell for completing the Harder W, Dijkhuizen L (1983) Physiological responses to nutrient
quantitative RT-PCR assays. This work was supported by NIAID/ limitation. Annu Rev Microbiol 37:1–23
NIH grant RO1 AIO52147 to M.S.C and NIH Grant Number 2 P20 Helmann JD, Moran CP (2002) RNA polymerases and sigma factors.
RR016479 from the INBRE Program of the National Center for ASM Press, Washington DC
Research Resources. Hew CM, Korakli M, Vogel RF (2006) Expression of virulence-
related genes by Enterococcus faecalis in response to different
environments. Syst Appl Microbiol 30(4):257–267
Hua Q, Yang C, Oshima T, Mori H, Shimizu K (2004) Analysis of
References
gene expression in Escherichia coli in response to changes of
growth-limiting nutrient in chemostat cultures. Appl Environ
Barnett TC, Bugrysheva JV, Scott JR (2007) Role of mRNA stability Microbiol 70:2354–2366
in growth phase regulation of gene expression in the group A Johansson BP, Levander F, von Pawel-Rammingen U, Berggard T,
streptococcus. J Bacteriol 189:1866–1873 Bjorck L, James P (2005) The protein expression of Strepto-
Beyer-Sehlmeyer G, Kreikemeyer B, Horster A, Podbielski A (2005) coccus pyogenes is significantly influenced by human plasma. J
Analysis of the growth phase-associated transcriptome of Proteome Res 4:2302–2311
Streptococcus pyogenes. Int J Med Microbiol 295:161–177 Jungblut PR et al (2000) Comparative proteome analysis of Helicob-
Carapetis JR, Steer AC, Mulholland EK, Weber M (2005) The global acter pylori. Mol Microbiol 36:710–725
burden of group A streptococcal diseases. Lancet Infect Dis Kang CM, Abbott DW, Park ST, Dascher CC, Cantley LC, Husson
5:685–694 RN (2005) The Mycobacterium tuberculosis serine/threonine
Chaussee MS, Phillips ER, Ferretti JJ (1997) Temporal production of kinases PknA and PknB: substrate identification and regulation
streptococcal erythrogenic toxin B (streptococcal cysteine pro- of cell shape. Genes Dev 19:1692–1704
teinase) in response to nutrient depletion. Infect Immun Kreikemeyer B, McIver KS, Podbielski A (2003) Virulence factor
65:1956–1959 regulation and regulatory networks in Streptococcus pyogenes
Chaussee MS, Somerville GA, Reitzer L, Musser JM (2003) Rgg and their impact on pathogen-host interactions. Trends Microbiol
coordinates virulence factor synthesis and metabolism in Strep- 11:224–232
tococcus pyogenes. J Bacteriol 185:6016–6024 Lee KJ, Bae SM, Lee MR, Yeon SM, Lee YH, Kim KS (2006)
Chaussee MA, Callegari EA, Chaussee MS (2004) Rgg regulates Proteomic analysis of growth phase-dependent proteins of
growth phase-dependent expression of proteins associated with Streptococcus pneumoniae. Proteomics 6:1274–1282
secondary metabolism and stress in Streptococcus pyogenes. J Len AC, Harty DW, Jacques NA (2004) Stress-responsive proteins
Bacteriol 186:7091–7099 are upregulated in Streptococcus mutans during acid tolerance.
Chaussee MA, McDowell EJ, Rieck LD, Callegari EA, Chaussee MS Microbiology 150:1339–1351
(2006) Proteomic analysis of a penicillin-tolerant rgg mutant Lithgow JK, Hayhurst EJ, Cohen G, Aharonowitz Y, Foster SJ (2004)
strain of Streptococcus pyogenes. J Antimicrob Chemother Role of a cysteine synthase in Staphylococcus aureus. J Bacteriol
58(4):752–759 186:1579–1590
Cunningham MW (2000) Pathogenesis of group A streptococcal Lyon WR, Madden JC, Levin JC, Stein JL, Caparon MG (2001)
infections. Clin Microbiol Rev 13:470–511 Mutation of luxS affects growth and virulence factor expression
Davies HD et al (1996) Invasive group A streptococcal infections in in Streptococcus pyogenes. Mol Microbiol 42:145–157
Ontario, Canada. Ontario Group A Streptococcal Study Group. N Malke H, Steiner K, McShan WM, Ferretti JJ (2006) Linking the
Engl J Med 335:547–554 nutritional status of Streptococcus pyogenes to alteration of
Dmitriev AV, McDowell EJ, Kappeler KV, Chaussee MA, Rieck LD, transcriptional gene expression: the action of CodY and RelA.
Chaussee MS (2006) The Rgg regulator of Streptococcus Int J Med Microbiol 296:259–275
pyogenes influences utilization of nonglucose carbohydrates, Neely MN, Lyon WR, Runft DL, Caparon M (2003) Role of RopB in
prophage induction, and expression of the NAD-glycohydrolase growth phase expression of the SpeB cysteine protease of
virulence operon. J Bacteriol 188:7230–7241 Streptococcus pyogenes. J Bacteriol 185:5166–5174
Ferretti JJ et al (2001) Complete genome sequence of an M1 strain of Neijssel OM, Snoep JL, Teixeira de Mattos MJ (1997) Regulation of
Streptococcus pyogenes. Proc Natl Acad Sci USA 98:4658–4663 energy source metabolism in streptococci. Soc Appl Bacteriol
Fisher SH (1999) Regulation of nitrogen metabolism in Bacillus Symp Ser 26:12S-19S
subtilis: vive la difference! Mol Microbiol 32:223–232 Neuner JM, Hamel MB, Phillips RS, Bona K, Aronson MD (2003)
Folio P, Chavant P, Chafsey I, Belkorchia A, Chambon C, Hebraud M Diagnosis and management of adults with pharyngitis. A cost-
(2004) Two-dimensional electrophoresis database of Listeria effectiveness analysis. Ann Intern Med 139:113–122
monocytogenes EGDe proteome and proteomic analysis of mid- Reva ON et al (2006) Functional genomics of stress response in
log and stationary growth phase cells. Proteomics 4:3187–3201 Pseudomonas putida KT2440. J Bacteriol 188:4079–4092
Giard JC, Rince A, Capiaux H, Auffray Y, Hartke A (2000) Shelburne SA 3rd, Sumby P, Sitkiewicz I, Granville C, DeLeo FR,
Inactivation of the stress- and starvation-inducible gls24 operon Musser JM (2005) Central role of a bacterial two-component
has a pleiotrophic effect on cell morphology, stress sensitivity, gene regulatory system of previously unknown function in
and gene expression in Enterococcus faecalis. J Bacteriol pathogen persistence in human saliva. Proc Natl Acad Sci USA
182:4512–4520 102:16037–16042
Gibson CM, Mallett TC, Claiborne A, Caparon MG (2000) Contri- Steiner K, Malke H (2000) Life in protein-rich environments: the
bution of NADH oxidase to aerobic metabolism of Streptococcus relA-independent response of Streptococcus pyogenes to amino
pyogenes. J Bacteriol 182:448–455 acid starvation. Mol Microbiol 38:1004–1016
Graham MR et al (2006) Analysis of the transcriptome of group A Voyich JM et al (2003) Genome-wide protective response used by
Streptococcus in mouse soft tissue infection. Am J Pathol group A Streptococcus to evade destruction by human polymor-
169:927–942 phonuclear leukocytes. Proc Natl Acad Sci USA 100:1996–2001
Guillot A, Gitton C, Anglade P, Mistou MY (2003) Proteomic Wick LM, Quadroni M, Egli T (2001) Short- and long-term changes
analysis of Lactococcus lactis, a lactic acid bacterium. Proteo- in proteome composition and kinetic properties in a culture of
mics 3:337–354 Escherichia coli during transition from glucose-excess to

123
Arch Microbiol (2008) 189:27–41 41

glucose-limited growth conditions in continuous culture and vice Woodbury RL, Wang X, Moran CP Jr (2006) Sigma X induces
versa. Environ Microbiol 3:588–599 competence gene expression in Streptococcus pyogenes. Res
Wilkins JC, Homer KA, Beighton D (2002) Analysis of Streptococcus Microbiol 157:851–856
mutans proteins modulated by culture under acidic conditions.
Appl Environ Microbiol 68:2382–2390

123