Vous êtes sur la page 1sur 1201

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.

com |

Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :


| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
100%

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


re année
1Santé
TOUTE LA PACES
EN QCM
TRONC COMMUN:
UE1, UE2, UE3, UE4, UE5, UE6, UE7

coordonné par Daniel Fredon


Maître de conférences à l’université de
Limoges et enseignant à FormaPlus à Limoges

Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :


| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
© Dunod, 2015
5 rue Laromiguière, 75005 Paris
www.dunod.com

ISBN 978-2-10-073014- 8

Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :


| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
Toute la PACES en QCM
coordination : Daniel FREDON

maı̂tre de conf érences de mathématiques appliquées

avec les contributions de :

François BIREMBAUX
enseignant ; co-fondateur de Nice Ecurie et Prépas Nice.

Magali DÉCOMBE VASSET


agrég ée de chimie, professeur de physique-chimie dans l’académie de Lyon.

Alexandre FRADAGRADA
agrég é de biochimie, professeur de Biologie cellulaire en centre de préparation aux concours
PACES à Paris (Médisup).

Gilles FURELAUD
agrég é de Sciences de la Vie et de la Terre, professeur en classe préparatoire BCPST1 au
lycée Jacques-Pr évert (Boulogne-Billancourt).

Arnaud GÉA
enseignant ; co-fondateur de Nice Ecurie et Prépas Nice.

Maxime LACROIX
interne de spécialité.

Michel METROT
agrég é de sciences physiques, inspecteur pédagogique régional.

Nabil OTMANI
docteur en pharmacie, formateur à Prépa Paces Poitiers.

Laurence S ÉBELLIN
docteur en médecine, formatrice à Nice Écurie.

Jean Charles TASSAN


Dipl ômé de l’Ecole Supérieure de Commerce de Pau (GROUPE ESC PAU)
Master en Sciences Humaines et Sociales appliqué aux Sciences (Université de Lyon).

Collaboration technique : Thomas FREDON, ing énieur recherche Université de Limoges

Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :


| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
IV

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Contributions par UE :
Méthodologie : Arnaud Géa

UE1 : Magali D écombe Vasset, Alexandre Fradagrada, Michel Métrot

UE2 : Alexandre Fradagrada, Gilles Furelaud

UE3 : Arnaud Géa, Jean Charles Tassan

UE4 : Daniel Fredon

UE5 : Maxime Lacroix, Laurence Sébellin

UE6 : Nabil Otmani

UE7 : François Birembaux, Daniel Fredon

Merci pour leur aimable participation à :


Elric Ardant, Slim Bodin, Michel Bridier, Françoise Couty-Fredon, Kevin Rouard, Marion
Theillaud.

Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :


| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
V

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Avant-propos

Le livre

Voici la deuxième édition, fortement enrichie, du premier livre global d’entraı̂nement pour la
PACES (Première Année Commune aux Ètudes de Santé).
Le nombre de QCM est beaucoup plus important pour un entraı̂nement plus pouss é. Il s’agit
toujours de sujets extraits d’annales r écentes, ce qui vous permet de mieux savoir ce qui vous
attend le jour du concours.
L’origine des QCM est toujours citée, ainsi que l’auteur du sujet quand son nom est connu.
Le choix a été fait en privilégiant le caractère national du QCM.
Dans chaque partie correspondant à une Unité d’Enseignement, vous allez trouver :
➣ Une table détaill ée qui vous permet d’adapter l’usage de ce livre à votre cas personnel :
retenez les QCM qui correspondent à votre enseignement.
➣ Des QCM organisés et choisis pour couvrir l’essentiel de votre programme. Sur certains
sujets (rares heureusement) il peut exister plusieurs points de vue. Pour votre concours, c’est
l’opinion de vos professeurs que vous devez retenir. Nos corrigés n’ont rien d’officiel.
➣ Des Concours Blancs pour vous tester à l’approche de vos épreuves.
➣ Des corrig és détaillés, avec parfois des compléments indiqu és en dehors du temps du
concours  ou  pour en savoir plus . Il s’agit d’indications pour votre formation, mais le
jour du concours, vous devez être obséd é(e) par la vitesse !
Mais vous trouverez aussi :
➣ des conseils m éthodologiques,
➣ des annexes.
Les auteurs

Notre équipe s’est enrichie de quatre nouveaux auteurs qui assurent la préparation du concours
PACES dans le cadre de Nice-écurie.
Mais nous nous permettons de vous redire cette évidence : votre réussite dépend d’abord de
votre travail personnel.
Bon courage !

Le coordinateur Daniel Fredon


daniel.fredon@laposte.net

Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :


| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
VI

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Table des matières

UE 1 : Atomes ; biomolécules ; génome ; bioénergétique ;


métabolisme. 21
1. Chimie générale 23
2. Chimie organique 45
3. Biochimie 60
4. Biologie moléculaire 92

Énoncés des concours blancs 129


Corrigés des QCM classés 180
Corrigés des concours blancs 269

UE 2 : La cellule et les tissus. 305


1. Biologie cellulaire 308
2. Histologie 356
3. Reproduction 384
4. Embryologie 396

Énoncés des concours blancs 408


Corrigés des QCM classés 456
Corrigés des concours blancs 531

UE 3 : Organisation des appareils et systèmes :


aspects fonctionnels et méthodes d’étude. 559
1. Généralités 561
2. Liquide, gaz et solution 562
3. Le domaine de l’optique 567
4. Rayons X et gamma 575
5. Rayonnements particulaires 581
6. Les très basses fréquences du spectre électromagn étique 589
7. Biophysique cardiaque 590
8. Mécanique des fluides 594
9. Électrophysiologie 601
10. Régulation du milieu int érieur 605
11. Solutions 614
Énoncés des concours blancs 617
Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
VII

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Corrigés des QCM classés 645
Corrigés des concours blancs 683

UE 4 : Évaluation des méthodes d’analyse appliquées


aux sciences de la vie et de la santé. 703
1. Outils mathématiques 705
2. Statistique descriptive 710
3. Probabilités 713
4. Statistique inférentielle 719
5. Applications aux sciences de la vie 733
6. Informatique médicale 744
Énoncés des concours blancs 746
Corrigés des QCM classés 761
Corrigés des concours blancs 800

UE 5 : Organisation des appareils et systèmes :


aspects morphologiques et fonctionnels. 811
1. Généralités 813
2. Tête et cou 817
3. Rachis et cage thoracique 833
4. Neuroanatomie et peau 837
5. Système appendiculaire 851
6. Appareil respiratoire 875
7. Appareil cardio-vasculaire 877
8. Parois du tronc 881
9. Appareil digestif et endocrinien 883
10. Appareil uro-génital et sein 887

Énoncés des concours blancs 891


Corrigés des QCM classés 925
Corrigés des concours blancs 961

UE 6 : Initiation à la connaissance du médicament. 979

1. Cadre juridique 981


2. Cycle du médicament 1078
3. Pharmacologie générale 1007
Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
VIII

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Énoncés des concours blancs 1039
Corrigés des QCM classés 1066
Corrigés des concours blancs 1111

UE 7 : Santé ; société ; humanité. 1133


1. Histoire de la médecine et de la pharmacie 1135
2. Droit et éthique 1137
3. Facteurs de risque et sociéte´ 1140
4. Organisation des systèmes de soins 1149
5. Psychologie 1154

Énoncés des concours blancs 1156


Corrigés des QCM classés 1162
Corrigés des concours blancs 1180

Annexes 1185
1. Le code génétique 1185
2. Classification p ériodique des éléments 1186
3. Constantes physiques 1187
4. Formulaire de biostatistiques 1188
5. Formulaire de mathématiques 1189
6. Tables statistiques 1190

Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :


| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Techniques de résolution des QCM

Méthodologie
et d’entraı̂nement

|
m
o
c
t.
o
p
s
g
lo
Introduction

.b
s
in
c
e
d
1. L’entraı̂nement en fonction des phases de l’année

e
m
s
e
rd
o
s
1.1 Pendant la phase d’apprentissage des cours

e
tr
e
/l
:/
(première moitié du semestre)

p
tt
h
|
m
Apprendre puis s’entraı̂ner

o
.c
s
Apprendre en s’entraı̂nant

s
re
p
rd
o
.w
1.2 Pendant la phase de révision (deuxième moitié du semestre)

s
in
c
e
Un entrainement progressif
d
e
m
s
Une réflexion sur les erreurs
e
rd
o
s

Pour finir
e
tr
e
/l
:/
p
tt

2. Le QCM
h
|
s
in
c

2.1 Les différentes formes de QCM


e
d
e
M
s

Le QCM de cause à effets


e
rD
o

Le QCM classique
s
re
T
e
/L
s

2.2 Techniques de réponses aux QCM


p
u
ro
/g

Lecture lente et attentive


m
o
.c
k

Travail de la phrase de contexte


o
o
b
e

D étermination des items à sélectionner


c
a
.f
w
w
w

2.3 Les écueils à éviter


|
s
in
c
e

Voir des pièges partout


d
e
M
s

Vous focaliser sur les mots que vous ne connaissez pas


e
rD
o

Effectuer directement des QCM en temps limit é.


s
re
T
e

Pour finir
/L
m
o
.c
k
o
o
b
e
c
a
.f
w
w
w
|

document rédigé par : Arnaud G éa Nice écurie

Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :


| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
2

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Introduction
S’entrainer en PACES est fondamental. Que vous vous serviez de l’entraı̂nement pour ap-
prendre votre cours, ou pour v érifier son apprentissage, il est toujours indispensable de s’exer-
cer à répondre aux types de questions que vous aurez au concours.

Celui-ci se compose de deux sortes d’épreuves :


➣ Des Question à Choix Multiples (ou QCM), qui évaluent toutes les matières de cette
première année d’ étude de santé.
➣ Une question ouverte ou un résumé, qui ne concerne que l’UE7 (Sant é, Société, Huma-
nité), et qui fait l’objet d’une double correction. Notons que cette UE est donc évaluée à la
fois par cette épreuve rédactionnelle et par un QCM.
Ainsi, vous serez confronté aux QCM dans toutes les unités d’enseignement de la PACES.

Si vous voulez être prêt pour votre concours, il faudra avoir été performant dans l’apprentis-
sage de vos cours, et réussir à r éinvestir vos connaissances dans la réponse aux QCM.
Cette transition  apprentissage → r éponse  n’est pas évidente : ce n’est pas parce que vous
connaissez votre cours que vous savez forcement ´ répondre à un QCM. Cela nécessite un tra-
vail spécifique, que ce livre vous aidera à accomplir. En vous fournissant un grand nombre
de QCM issus de différentes universités, vous aurez un support suffisant vous permettant un
entraı̂nement régulier, et performant.

Voyons tout d’abord comment mener l’entraı̂nement tout au long de l’année, avant de vous
proposer une méthode de r ésolution du QCM qui maximise vos chances de bonne réponse.
3

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


1. L’entraı̂nement en fonction

Méthodologie
des phases de l’année
Selon le moment de l’année, vous n’utiliserez pas les supports d’entraı̂nement de la même
façon 1. Nous séparerons l’année en deux phases, en fonction de votre degré de connaissance
du cours. L’entrainement sur QCM permet de favoriser le stockage de l’information sur le
long terme d’une part, et de vous assurer de votre capacit é à mobiliser vos connaissances de
façon rapide d’autre part.

1.1 Pendant la phase d’apprentissage des cours


(première moitié du semestre)
L’apprentissage des cours nécessite de prendre du recul pour être capable de répondre à toutes
formes de questions.
Ce travail concerne le début d’ann ée, lorsque vous êtes en train d’apprendre les cours, c’est-
à-dire sur la p ériode allant de fin juillet (pour ceux qui commencent à travailler pendant l’ été)
à mi octobre. L’entraˆınement joue naturellement un rôle central dans cette phase.
Il existe deux moyens differents ´ de l’integrer,
´ qui d épendent à la fois de votre profil et des
matières.
☛ Apprendre puis s’entraı̂ner
Voici clairement la méthode que je conseille :
fig 1 : Chronologie pour apprendre puis s’entraı̂ner

Elle se déroule en 3 phases :


1. Vous apprenez vos cours (rep ´ étition, récitation, r´
ep étition, etc)
2. Vous introduisez une distraction, pour vider la mémoire à court terme. Cette distraction
peut être la lecture d’une page de magazine, d’un autre cours, ou toute autre activité sans
rapport avec le chapitre que vous venez de travailler.
3. Vous utilisez le présent ouvrage pour vérifier votre capacité à répondre aux QCM.

1. Vous trouverez une m éthode efficace de préparation à la PACES dans l’ouvrage :  Je réussis ma PACES  ,
aux éditions EDISCIENCE.
4

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Les exercices viennent alors valider un apprentissage rigoureux et efficace. Si vous proposez
de nombreuses réponses fausses, il faudra identifier les raisons de ces erreurs (qui se trouvent
dans vos méthodes de travail), et recommencer l’apprentissage des parties concernées.

Apprendre puis s’entrainer permet de v érifier l’ap-


À retenir : prentissage correct par votre capacit é à fournir les
bonnes réponses aux QCM.

En ajustant ainsi régulièrement votre travail par rapport à ces séances d’entrainement, vous
êtes sûrs de fournir un travail toujours pertinent.
• Pour qui ?
Cette méthode est particulièrement performante pour :
➣ Les étudiants qui n’ont pas de probl ème dans l’apprentissage par cœur.
➣ Les matières des UE2, 5, 6, 7 et certaines matières de l’UE1.
Les exercices viennent alors valider votre travail sur le cours.
• Comment s’y prendre ?
L’idéal est de consacrer quelques heures par semaine à ces séances de vérification de l’ap-
prentissage. Voici quelques propositions d’organisation :
➣ Vous apprenez un cours le jour J. Au matin du jour J+1, vous r écitez par écrit ou oralement
ce que vous avez retenu de l’apprentissage de la veille, puis vous effectuez quelques QCM
pour vérifier votre capacité à utiliser vos connaissances.
➣ Vous intégrez dans votre planning g énéral des séances de QCM séparées de la phase d’ap-
prentissage du cours, dans lesquelles vous pouvez regrouper plusieurs mati ères (de façon à
ne pas perdre de temps). En moyenne, dans cette période de l’année, si vous consacrez entre
3 et 5 heures par semaine toutes matières confondues, aux exercices, c’est déjà bien.
➣ Vous enchaı̂nez apprentissage du cours + Entrainement sur QCM en ayant soin d’intro-
duire entre les deux une distraction, pour vider la mémoire à court terme.
L’important est d’éviter de consulter le cours d ès que vous rencontrez une difficulté : vous
essayez de répondre à tout ce que vous pouvez sans regarder la reponse
´ ou les él éments qui
vous manquent. C’est seulement une fois que vous avez repondu´ à tout et que vous avez mis
en place un raisonnement rigoureux sur chaque item, que vous pouvez alors globalement cor-
riger vos réponses, et consulter les cours pour ré-apprendre les parties concern ées.

☛ Apprendre en s’entraı̂nant
Cette m éthode peut s’avérer utile pour les étudiants qui sont dans l’incapacité d’apprendre
par cœur leurs cours.
fig 2 : Chronologie pour apprendre en s’entraı̂nant
5

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Dans cette approche, vous int égrez sans les dissocier, l’apprentissage du cours et le travail
sur les QCM.

Méthodologie
Apprendre en s’entraı̂nant permet de retenir des
À retenir : cours de façon plus ludique et vari ée, car vous al-
ternez le type de supports de travail.

• Pour qui ?
Cette méthode est adaptée :
➣ D’une part, pour les étudiants qui ont du mal à apprendre par cœur des notions rebutantes.
➣ D’autre part pour tous les étudiants, dans les matières à application numérique ou à exer-
cices concrets, comme dans l’UE3 (a et b), l’UE4, et dans une partie de l’UE1. Dans ces
matières, les comp étences demandées doivent être travaillées de manière spécifique, en même
temps que le cours, au travers d’exercices d’application.
• Comment s’y prendre ?
Vous alternez l’usage des deux types de supports :
➣ Vous lisez votre cours, et vous essayez de l’apprendre le mieux possible, sans trop vous y
attarder.
➣ Vous faites les QCM qui se rapportent à la portion de cours que vous venez de travailler.
➣ Vous revoyez le cours au fur et à mesure que les QCM mettent en lumière les points qui
n écessitent un apprentissage supplémentaire.
➣ Après plusieurs aller-retours entre le cours et les exercices, vous devriez maı̂triser votre
leçon. Vous introduisez alors une distraction (toujours dans le but de vider la m émoire à court
terme), puis vous vous entraˆınez sur des supports différents pour vérifier ce qui a été retenu.
Ainsi, le cours aura été appris en variant les supports et en y intégrant les exercices. Dans
certaines matières, cette méthode procure de très bons r ésultats car elle facilite les liens
entre le contenu du cours et les exercices d’applications, c’est-à-dire entre connaissances
et compétences.
6

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


1.2 Pendant la phase de révision (deuxième moitié du
semestre)
Lorsque vos cours auront été vus une première fois, vous allez progressivement en avançant
dans l’ann ée, intégrer des phases de r évision. Ces phases doivent être placées de mani ère
stratégique de façon à vous permettre de revoir ensemble des cours appartenant à un même
thème. Ce livre, en vous proposant justement les QCM classés par thème, facilite ce travail.
En général, cette phase de l’année commence mi octobre, et s’étend jusqu’au concours.
Notons que la phase précédente et celle-ci peuvent se chevaucher : entre mi octobre et d ébut
d écembre, vous aurez des nouveaux cours que vous verrez pour la première ET des phases
de révision avec de l’entrainement portant sur des chapitres déjà vus.

☛ Un entrainement progressif
À mesure que vous vous rapprochez du concours, la part de votre travail consacrée à l’entrai-
nement doit augmenter. Votre préparation sera progressive, découp ée en 2 phases :
1. Entraı̂nement sans temps limité : tout d’abord, vous prendrez le temps dont vous avez
besoin pour r épondre aux questions, sans vous soucier du temps officiellement alloué. Cela
permet de mettre en place les raisonnements justifiant vos réponses, et d’apprendre à reactiver
´
les connaissances emmagasinees.´
2. Entra ı̂nement dans le temps imparti : petit à petit, vous devrez gagner en rapidité, et être
capable de répondre aux questions dans le temps fixé au concours. Ce  travail de la rapidité 
est indispensable pour mener une préparation efficace.

☛ Une réflexion sur les erreurs


Chaque créneau d’entrainement doit intégrer un moment o ù vous analysez vos résultats. En
effet, toute r éponse fausse a` un QCM vient d’un apprentissage et/ou d’une m éthode inappro-
prié.
À la fin de votre séance de QCM, vous prévoirez donc un moment pour :
➣ Corriger vos réponses fausses, et comprendre d’où viennent vos erreurs. Cela vous per-
mettra, le cas échéant, de proposer une m éthode de travail plus adaptée.
➣ Remplir une  fiche d’erreurs fréquentes  . Ce document, complété au fur et à mesure de
vos entrainements, regroupe les notions que vous avez du mal à assimiler et qui nécessitent
un travail supplémentaire. Vous pourrez ainsi le relire fréquemment, et petit à petit retenir ce
qui vous posait problème.

M ême si le temps consacré à l’étude de vos


r éponses est conséquent, il n’est pas perdu : Lorsque
À retenir : vous aurez identifi é les causes de vos erreurs, vous
pourrez les corriger et vous gagnerez en efficacité.
7

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


☛ Pour finir

Méthodologie
L’entraı̂nement est fondamental à tous les stades de l’ann ée, mais pas de la même façon.
Chaque étape doit être validée par une forme d’entraı̂nement adaptée. Ainsi vous mettez
toutes les chances de votre c ôté en limitant au maximum la possibilité d’accumuler des la-
cunes.

2. Le QCM
Le QCM, qui représente l’essentiel de l’évaluation en PACES, est une forme de question à
laquelle les étudiants en première année ne sont que tres
` peu habitués. En effet, il est utilis é de
façon très épisodique en lycée. Pour cette raison, le carabin devra s’entrainer et rapidement
s’habituer à la gymnastique mentale nécessaire au traitement du QCM.
Au niveau du concours, les épreuves de QCM peuvent être notées de deux manières :
1. Selon un mode binaire : Soit l’étudiant propose toutes les réponses exactes et uniquement
celles-ci (ce que l’on nomme la  combinaison exacte  ) et il obtient un point, soit ce n’est
pas le cas et il obtient 0.
2. Par comparaison : Le nombre de points attribués s’échelonne entre 0 et 1 en fonction du
nombre d’erreurs par rapport a` la combinaison attendue.
Avant de vous lancer dans la préparation de votre concours, renseignez vous aupr ès de votre
Universit é pour déterminer le mode de notation en vigueur. Celui-ci influence votre façon de
répondre : en effet, si votre notation intègre des points n egatifs
´ en cas d’erreur à un item, vous
aurez intérˆet à n’y répondre qu’en cas de quasi-certitude. En revanche, en l’absence de points
n égatifs, il faudra proposer une réponse, quitte à ce qu’elle soit dictée par le hasard.

2.1 Les différentes formes de QCM


Malgré son apparence stable, le QCM peut prendre des formes tr ès vari´ ees. En effet, les pro-
fesseurs d’Universit é ont une imagination débordante lorsqu’il s’agit d’ évaluations ; ils sont
capables de proposer des formes de QCM originales, afin d’évaluer différentes compétences
chez les étudiants tout en respectant l’impératif de correction par lecture optique.
Quelle que soit sa forme, un QCM est toujours compos é d’affirmations, appelées items, qui
sont justes au fausses.
Voyons les principales formes qu’il peut revêtir.

☛ Le QCM de cause à effets

C’est une forme de QCM plutôt ancienne, mais qu’on continue de retrouver aujourd’hui en-
core, de façon plus anecdotique.
Ce type de QCM présente une structure stable :
➣ Une première phrase, appelée :  le fait 
➣ Une seconde phrase, censée expliquer la première, appelee ´ :  la raison 
➣ Entre les deux, la locution  parce que  mat´erialise un lien de cause à effet potentiel.
8

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• Schéma de réponses

Fait Raison Lien de cause à effet Réponse


VRAI VRAIE VRAI A
VRAI VRAIE FAUX B
VRAI FAUX Sans objet C
FAUX VRAIE Sans objet D
FAUX FAUX Sans objet E

• Exemple 1 : Anatomie (UE 5)


Une l ésion du genou de la capsule interne donne une hémiplégie contro-lat érale avec
atteinte du membre sup érieur et inférieur
parce que
les fibres de la voie motrice principale v éhiculant la motricité des membres passent par
la capsule interne.

Ici, le fait et la raison sont vrais. Donc la réponse est A ou B. Dans la mesure o ù il n’y a pas
de lien de cause à effet, la réponse attendue est B.
Ce type de QCM est avantageux pour l’étudiant car il n’a qu’à considérer 2 items, par opposi-
tion aux autres formes qui en proposent souvent 4, parfois 5. Proportionnellement, il dispose
donc de davantage de temps.
De plus, le lien de cause à effet n’est à étudier que dans le cas o ù les 2 phrases sont justes.
Dans la plupart des cas, il n’est pas utile de se pencher sur cette question, puisque vous serez
souvent confrontés à un fait et/ou une raison faux.
• Techniques de résolution du QCM de cause à effet
Il est important de respecter une certaine chronologie pour ne pas perdre un temps précieux
lors de la r éponse à ce type de QCM.
➣ Lecture indépendante de chaque item
La premi ère étape est de lire chaque phrase de façon indépendante et de considérer si elle est
vraie ou fausse.
Je vous conseille de noter directement sur votre sujet un petit  V  ou  F  sous la phrase
concernée.
➣ Détermination du lien de cause à effet potentiel
Dans le cas o ù les deux phrases sont justes, alors il faut vous pencher sur l’existence d’un
lien de cause à effet. C’est clairement la partie la plus complexe. Posez vous la question  la
raison (phrase 2) apportée est-elle la cause du fait observe´ (phrase 1) ? 
Si c’est le cas, cela signifie que, dans un sch éma logique, la raison est située avant le fait.
On pourrait résumer la démarche globale par la figure suivante.
fig 3 : Démarche de réponse pour le QCM de cause à effet
9

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Méthodologie
Pour conclure, le QCM de cause à effet est plutôt moins complique´ que les autres formes,
mais il nécessite un entrainement particulier car la démarche qui mène à la bonne réponse ne
s’acquière qu’au prix d’une certaine pratique.

☛ Le QCM classique
Ce type de QCM est le plus frequent.
´ Il est toujours compose´ d’une m ême structure gén érale.
• Exemple 2 : Biologie du développement et de la reproduction (UE 2)
Quelles cellules poss èdent le complexe enzymatique aromatase permettant de transfor-
mer les androgènes en oestrogènes (testostérone en estradiol ou delta 4-androst énedione
en estrone) ?

❑ a. Cellules épididymaires. ❑ b. Cellules adipeuses.


❑ c. Cellules gonadotropes. ❑ d. Cellules musculaires.
❑ e. Tous les items préc édents sont
faux.

• Exemple 3 : Anatomie (UE 5)


Quelle est la proposition exacte qui se rapporte au cœur :

❑ a. La valve mitrale est entre le ventricule gauche et l’aorte.


❑ b. La valve tricuspide est entre le ventricule droit et l’artère pulmonaire.
❑ c. Les cordages empêchent l’inversion des valves aortiques et pulmonaires
après la contraction ventriculaire.
❑ d. Le faisceau atrio-ventriculaire de His passe par le septum interventriculaire.
❑ e. Le noeud sino-atrial est dans la paroi du sinus coronaire.
10

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


fig 4 : Structure des QCM

Ces QCM comportent deux parties :


➣ un contexte, qui donne des informations et aide l’étudiant à savoir à quelle partie de son
cours se rapportent les items ;
➣ des items, qui sont des affirmations vraies ou fausses.
• Le contexte
Pos é en préambule aux affirmations, il est indiqu é en gras dans les exemples ci-dessus.
➣ Ce contexte est fondamental car il va conditionner les affirmations que vous cocherez sur
votre feuille réponse. Par exemple, il pourra vous demander les affirmations exactes ou in-
exactes.
➣ Il pourra aussi vous donner des informations utiles. Par exemple :  Donnez l’affirmation
exacte qui se rapporte...  Vous savez alors qu’il n’y aura qu’une seule r éponse à cocher.
➣ Il pourra être restrictif à une situation ou un organe bien précis. Par exemple :  Parmi les
voies métaboliques ci-dessous, quelles sont celles qui se rapportent au foie en phase post-
prandiale ? 
Une lecture correcte de ce contexte est donc une condition sine qua non à la bonne réponse au
QCM. Si on vous demande une voie se déroulant dans le foie alors que vous cochez un item
juste en théorie, mais qui concerne une voie ne se déroulant que dans le muscle, vous perdez
votre point. De même si on vous demande les items justes et que vous s électionnez les faux.
• Plusieurs affirmations
Celles-ci sont au nombre de 4 ou 5, selon le type de QCM. Elles peuvent être exactes ou
inexactes et il vous appartient de cocher celles qui sont demand ées par le contexte.
Parfois, le dernier item est  Toutes les reponses
´ précedentes
´ sont fausses  . Cela vous permet
quand même de cocher une case sur votre feuille réponse même si la totalité des items est
fausse.
11

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


2.2 Techniques de réponses aux QCM

Méthodologie
Il est important de disposer d’une démarche que vous appliquerez de façon automatique pour
pouvoir répondre rapidement et juste, à vos QCM. En effet, ces deux él éments doivent être
réunis pour accéder à un bon résultat : la rapidité permet de traiter un maximum de QCM, la
justesse d’y apporter la réponse attendue. Cependant, ne perdez jamais de vue qu’aller dou-
cement permet, au final, de gagner du temps. Nous allons voir comment.
La m éthode de résolution des QCM s’articule autour de 3 fondamentaux :
1. Une lecture performante, qui permet de repérer rapidement les él éments discriminants
pour fournir la bonne réponse.
2. Une étude attentive de la phrase de contexte pour en extraire les renseignements utiles
pour la résolution.
3. Un raisonnement rigoureux basé sur une connaissance du cours pour apporter la bonne
réponse aux items composant le QCM.

☛ Lecture lente et attentive


Beaucoup d’ étudiants, pris par le stress de l’épreuve, se precipitent
´ sur leur sujet et ne lisent
que très (trop ?) rapidement les énoncés. Or c’est une erreur majeure. Car, si vous êtes dans
ce cas de figure, vous vous apercevrez rapidement que vous devrez revenir plusieurs fois sur
ce qui a d éjà été lu, ce qui constitue, au final, une perte de temps considérable.
Donc, prenez bien votre temps pour lire correctement vos QCM dès la première fois. Vous
formulez votre réponse, et vous n’avez plus besoin d’y revenir.
Une lecture attentive est basée sur un questionnement portant sur les mots clés, c’est- à-dire
qu’une fois identifiés, vous devrez vous rappeler leurs définitions. C’est fondamental pour
v érifier si celle-ci est cohérente avec le contexte énoncé dans l’item. Si ce n’est pas le cas,
c’est que l’item est faux !
Exemple : Biologie cellulaire (UE2)
On retrouve des réticulocytes dans le sang
Vous devez vous rappeler ce qu’est un réticulocyte avant de chercher s’il se retrouve dans le
sang ou pas. Cette étape peut aller tr ès vite, mais elle est indispensable.
Si vous adoptez cette démarche dès la première lecture, vous gagnerez un temps précieux car
vous ne ferez pas  d’aller-retour  sur vos questions.
La vérification, en PACES, est une illusion (au moins sur les matières à QCM). Vous n’avez
pas le temps de relire votre sujet et de vérifier vos r éponses à la fin de votre épreuve : l’ob-
jectif est de donner directement la bonne réponse.
Voyons maintenant comment adapter cette lecture attentive aux deux parties du QCM : la
phrase de contexte, et les items.

☛ Travail de la phrase de contexte


La phrase de contexte est souvent n égligée, alors qu’elle apporte des renseignements dont
il serait dommage de se passer. Le temps investi dans la lecture attentive de cette partie du
QCM permet de déterminer beaucoup plus rapidement sa bonne réponse.
fig 5 : Les étapes du travail de la phrase de contexte
12

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Rappelons que cette phrase de contexte est situee
´ en pr éambule au QCM, et qu’elle précède
les items.
• Mettre en évidence les mots clés
Le fait de surligner ou de faire ressortir par le moyen de votre choix les mots clés qui la com-
posent, vous aidera à sélectionner les items attendus. Il s’agit donc d’une phase de préparation
à la réponse.
Voici quelques exemples de phrases de contexte dans la colonne de gauche, dont on a fait
ressortir les mots clés dans celle du milieu. Essayez de vous entraˆıner à les rep érer en cachant
cette colonne, et en vous demandant quels sont les mots que vous auriez sélectionnés.

Phrase de contexte avec


Phrase de contexte Remarque
 brute 
mots clés mis en evidence
´

En ayant identifi é ces 2


Lors d’une transformation Lors d’une transformation
mots cl és, vous r éactiverez
spontanée, comment varie spontanée, comment varie
le cours concern é par ces
l’entropie de l’univers. l’entropie de l’univers.
notions.

Parmi les propositions sui- Parmi les propositions sui-


vantes concernant la mise vantes concernant la mise Il faudra garder en
en culture des fibroblastes en culture des fibroblastes mémoire ce qui touche
primaires, quel est le grou- primaires, quel est le grou- sp écifiquement ce type de
pement de propositions pement de propositions cellules.
exactes ? exactes ?

Parmi les propositions sui- Parmi les propositions sui- On sait qu’il ne faudra co-
vantes, une seule concerne vantes, une seule concerne cher qu’une seule r éponse.
le muscle. Laquelle ? le muscle. Laquelle ?

Classer par ordre d’ap- Classer par ordre d’ap-


parition les étapes de la parition les étapes de la Cela conditionne les
formation des cristaux formation des cristaux r eponses
´ formul ées.
d’hydroxyapatite. d’hydroxyapatite.
13

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


La scissure calcarine du Vous r éactivez votre cours
La scissure calcarine du

Méthodologie
cerveau est située : cerveau est située : concernant cette zone du
cerveau.

Il faut tenir compte des 2


À propos des hormones po- À propos des hormones `
criteres énoncés : le type
lypeptidiques sécr étées par polypeptidiques s´
ecr étées d’hormones (ici, polypepti-
le placenta. par le placenta. diques) et l’organe produc-
teur (ici le placenta).

Quelles sont les proposi- Quelles sont les proposi-


Il faudra penser à
tions inexactes qui se rap- tions inexactes qui se rap-
s électionner les items
portent aux cellules de Ser- portent aux cellules de Ser-
FAUX.
toli ? toli ?
La raison de cette étape est simple : lorsque vous lisez vos 4 ou 5 items, il arrive que, sans
vous en apercevoir, vous ayez oublié le contexte que vous avez lu au début.
Exemple classique : le contexte demande les r éponses fausses, mais arrivé au bout de votre
QCM, vous l’avez oublié et vous reportez machinalement sur votre feuille réponse les items
vrais. . .
La lecture attentive de cette phrase favorise aussi la reponse
´ directe aux items qui suivent.
Nous allons voir comment.
• Réactiver la mémoire
Prenez quelques secondes, lorsque la phrase de contexte a ét é lue et analysée, pour faire re-
venir à votre conscience la portion de cours concernée par ce QCM.
L’identification des mots clés a pour but justement de vous permettre de faire émerger les
notions apprises.
Il est essentiel de commencer par réactiver sa mémoire avant de lire les items, car ceux-ci
sont souvent plausibles, meme
ˆ lorsqu’ils sont faux. En conséquence, ils pourront instiller un
doute dans votre esprit, alors même que vous connaissez la bonne réponse. En ayant réactivé
votre mémoire sans avoir lu les items, vous ne vous laissez pas induire en erreur, et vous
augmentez vos chances de répondre correctement.
Dans les exemples ci-dessus, après avoir lu les phrases de contexte, vous allez puiser dans
votre mémoire les informations relatives aux mots clés mis en évidence.
Dans le cas de la première phrase proposée, vous allez mentalement faire les liens corres-
pondant à la transformation spontanée d’une réaction (quelles sont les différentes causes et
conséquences d’une transformation spontanée ? Dans quel contexte se produit-elle ?).
Cela vous permettra, lors de la lecture ult érieure des items, d’avoir des connaissances direc-
tement accessibles et claires, ce qui favorisera une reponse
´ rapide et juste.
Une fois cette étape effectu ée, vous pouvez lire la suite du QCM, et vous pencher sur les
items qui le composent.
14

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


☛ Détermination des items à sélectionner
Les affirmations représentent l’essentiel du QCM. La méthode d’étude des items est très pro-
gressive :
1. Pour chaque item, on repère d’abord les points d’erreurs potentielles.
2. On lève les ambiguı̈tés au moyen d’un raisonnement rigoureux et des connaissances issues
de l’apprentissage du cours.
3. On sélectionne les réponses attendues, en lien avec le contexte posé par la phrase d’intro-
duction du QCM.

• Repérer les  points d’erreurs potentielles 

Lorsque vous lisez un item, il faut être capable rapidement de d´ eterminer sur quel(s) point(s)
peuvent porter les erreurs : c’est ce que j’appelle les points d’erreurs potentielles.
Par exemple, si on vous dit  le taux de progestérone diminue dans la deuxi ème partie du
cycle menstruel  , il faut se demander si, dans le contexte posé par l’affirmation (ici, dans la
deuxième partie du cycle menstruel), le taux de cette hormone augmente ou diminue.
Dans ce cas, c’est relativement simple, car cet item ne comporte qu’une seule erreur poten-
tielle.
Mais vous rencontrerez aussi des items plus complexes, avec plusieurs erreurs potentielles.
Par exemple :  l’activation du système nerveux parasympathique, par l’intermédiaire du nerf
vague, favorise la miction 2  . Pour répondre correctement à cet item, il y a en réalité 3 ques-
tions, de complexité croissante, à se poser :
1. L’activation du parasympathique favorise-t-elle la miction ? =⇒ OUI
2. Le nerf vague appartient-il au système nerveux parasympathique ? =⇒ OUI
3. La vessie est-elle innervée par le nerf vague ? =⇒ NON
Donc cet item sera faux. Vous remarquez que les questions posées sont de plus en plus com-
plexes : si vous répondez NON à la premiere,
` inutile d’aller plus loin et de perdre du temps à
réfléchir aux suivantes !

• Conclure : L’item est-il vrai ou faux ?


Une fois identifiés, les points d’erreurs potentielles doivent etre ˆ éclaircis, permettant d’abou-
tir à la conclusion : l’item est-il vrai ou faux ?
Quel que soit l’item, vous pourrez toujours transformer le ou les erreurs potentielles en une
ou plusieurs question(s). Le fait de répondre à ces questions permet de décomposer un rai-
sonnement, et de fournir de façon beaucoup plus probable la bonne réponse.
Le danger en PACES est de fournir une réponse basee ´ sur l’intuition, et non sur un rai-
sonnement rigoureux. Méfiez-vous des réponses que vous donnez rapidement, sans trop y
réfléchir... Olivier Houdé a beaucoup travaillé sur les erreurs de raisonnement chez l’adulte,
et il a montr é que lors d’une r´ eponse fausse à une question de logique, les aires cérébrales
responsables de la réflexion (cortex pré-frontal) n’étaient quasiment pas activées. A l’inverse,
celles-ci étaient très actives si la réponse était bonne 3 .

2. La miction désigne le fait d’uriner


3. O. Houd é, Le Raisonnement, Puf, coll. Que sais-je ?, 2014
15

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Justement, en mettant en place un raisonnement rigoureux pour étudier votre item, vous acti-
vez les aires de la réflexion, et vous augmentez les chances d’ éviter les pièges.

Méthodologie
La mise en place d’un raisonnement logique passe souvent par un enchainement de questions
qui permettent de fournir une réponse argument ée, dont on sera a` peu près s ûr. C’est le cas
de l’exemple précédent à propos de la miction.
En voici quelques autres pour que vous vous habituiez à identifier rapidement les points d’am-
biguité sur un item, et à mettre en place le raisonnement adapté.
Questions pour
Item avec points d’ambi- d éterminer si l’item
Item  brut 
guité mis en évidence est vrai ou pas
Pour la mise en place Pour la mise en place
de la circulation fœtale, de la circulation fœtale,
on constate que les vais- on constate que les vais- O ù ces vaisseaux se
seaux allantoı̈diens se sont seaux allantoı̈diens se d éveloppent-ils ?
développ és dans le pédicule sont développés dans le
embryonnaire. pédicule embryonnaire.

La premi ère division La première division 1. Y a-t-il brassage


méiotique réalise un bras- méiotique réalise un bras- g énétique au cours de
sage génétique important au sage génétique important au la prophase 1 ?
cours de la prophase grâce cours de la prophase grâce 2. Ce brassage est-il inter
a` des échanges de segments à des échanges de segments ou intra-chromosomique ?
entre les chromatides entre les chromatides

La modulation de 1. La modulation de
La modulation de l’adh ésion est-elle
l’adhésion des poly-
l’adhésion des poly- d épendant ou ind épendante
nucléaires neutrophiles
nucléaires neutrophiles à de l’expression de
à l’endothélium vascu-
l’endothélium vasculaire r ecepteurs
´ ?
laire est indépendante
est indépendante de l’ex- 2. Est-ce valable sur les
de l’expression des
pression des récepteurs en- cellules endoth éliales et/ou
récepteurs endotheliaux
´ et
dothéliaux et leucocytaires sur les leucocytes ?
leucocytaires

Les solutions mi- Les solutions mi-


cromoléculaires sont cromoléculaires sont Les particules de ces solu-
constituées de particules constituées de particules tions sont-elles visibles ou
visibles au microscope visibles au microscope invisibles ?
electronique.
´ électronique.
16

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• Conclure : Formuler sa réponse
Deux étapes permettent de fournir une réponse définitive, probablement juste.
➣ Déterminer si chaque item est vrai ou faux
De façon générale, il est beaucoup plus facile de se demander si un item est faux que de se
demander s’il est vrai. Vous considérerez que s’il n’est pas faux, c’est qu’il est vrai. Cette
technique est particulièrement utile sur les formulations que vous jugez ambigües.
Voici les étapes de l’analyse d’un item :
1. Il faut, lors d’une première lecture, souligner ou entourer les points d’erreur potentielle.
Votre entrainement régulier vous aura permis de repérer du premier coup d’œil les mots sur
lesquels les enseignants font souvent porter les erreurs. Par exemple, sachez qu’un item com-
portant les mots  jamais  ou  toujours  est souvent (mais pas toujours) faux. En effet, rares
sont les domaines des sciences expérimentales et surtout médicales, où l’on ne rencontre pas
d’exceptions . . .
2. Lors d’une deuxième lecture, vous appliquez votre cours à propos des points d’ambiguité
relevés. Vous décidez si l’item est vrai ou faux.
3. Enfin, il suffit de noter en marge de chaque item un petit  V  ou  F  selon votre conclu-
sion.
fig 6 : Les étapes du travail sur les items

Cette chronologie peut sembler laborieuse, surtout au regard du faible temps dont on dispose
pour répondre aux QCM. Pourtant, c’est justement cette rigueur dans la démarche et le rai-
sonnement appliqué, qui garantit une réponse rapide car argument ée et définitive. Ainsi, vous
n’avez pas besoin de revenir sur les réponses d éja` donn ées.
➣ Fournir la bonne réponse, en accord avec le contexte
A la fin de ce travail sur les items, il faudra revenir sur le contexte du QCM. C’est à ce
moment-là que vous sélectionnerez les items demandes
´ (les vrais ou les faux).

Adoptez un fonctionnement qui sera valable quel


À retenir : que soit le contexte du QCM : mettez un V devant
un item juste, et un F devant un faux.

Certains étudiants en PACES choisissent d’adapter leur démarche en fonction de ce qui est
demandé dans le contexte. Par exemple, si on demande les vraies, ils entourent les items vrais,
mais si on demande les fausses, ils entourent les fausses.
Je vous déconseille fortement cette technique, car il y a de fortes chances qu’en cours de
route, vous oubliiez qu’on demandait les items faux et que vous vous retrouviez à entourer
les vrais...
Voilà pourquoi il est beaucoup plus sûr de :
− Mettre une lettre (V ou F) en regard de l’item, en fonction de votre conclusion, sans vous
soucier de ce que l’on demande.
17

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


− Sélectionner les items vrais ou faux en fonction de ce qui est demand´
e.

Méthodologie
Vous comprenez aussi l’intér êt d’avoir mis en évidence certains mots clés dans la phrase de
contexte : cela vous permet de ne pas oublier, à la fin du QCM, de sélectionner les réponses
attendues !

2.3 Les écueils à éviter


La réponse aux QCM ne devrait plus avoir de secrets pour vous si vous appliquez les préceptes
énoncés jusqu’ici. Voici quelques écueils à éviter qui vous aideront à faire la différence, aussi
bien lors de votre entrainement que devant votre sujet de concours.

☛ Voir des pièges partout


Le premier point sur lequel je souhaitais particulièrement insister est le fait que les profes-
seurs d’Université cherchent à tester votre capacité d’apprentissage et de réflexion et à évaluer
votre degré de compréhension du cours, mais pas à vous piéger à tout prix.
En conséquence, les QCM qui sont posés vont dans le même sens : ils permettent de discri-
miner les étudiants qui ont travaillé en profondeur des autres.
Or, beaucoup d’étudiants en PACES trouvent des pi èges partout, et cherchent tellement la
petite bete
ˆ qu’ils voient des ambiguı̈tés à tous les mots. Ce fonctionnement est très domma-
geable : ils se posent des questions qu’ils ne devraient pas se poser, élaborent un raisonnement
sur des notions inutiles, et au final, sont tellement embrouilles ´ qu’ils ne sont plus capables de
donner la bonne réponse.
Ne perdez pas de vue que la majorité des QCM est simple pour celui qui a appris son cours
et qui s’est entraˆıné.

Éviter de voir des pi èges partout vous permettra de


À retenir : vous focaliser sur les notions fondamentales, sans
perdre de temps sur les autres.

De plus, n’oubliez pas qu’un item dont la reponse


´ n’est pas évidente (avec le cours) est tr ès
g ênant pour les professeurs : en effet, vous pouvez alors contester le sujet, et obtenir une an-
nulation de l’épreuve concern ée (c’est arrivé à Nice en 2010). C’est pourquoi les enseignants
sont très attentifs à proposer des items qui soient incontestables, et donc à éviter les formula-
tions pouvant donner lieu à plusieurs interprétations.
Ces r éserves émises, il faut admettre qu’il est toujours possible de tomber sur un item présentant
plusieurs interprétations possibles, même si ce cas de figure est exceptionnel.
Dans ce cas, il vous faudra essayer de trouver le sens voulu par l’enseignant. La meilleure
façon est de chercher dans votre mémoire dans quel contexte il a abordé cette notion.
Cela vous aidera à lui donner un sens en cohérence avec le cours. Vous pouvez aussi vous
remémorer le sens des mots en français : il arrive que les étudiants en médecine maı̂trisent tel-
lement le vocabulaire technique qu’ils négligent le vocabulaire courant. Or, revenir aux fon-
damentaux et vous interroger sur le sens de tel ou tel mot vous permettra souvent d’acquérir
une certitude quant à la signification voulue par le professeur.

☛ Vous focaliser sur les mots que vous ne connaissez pas


Lorsqu’un item contient un mot compliqu é, vous êtes normalement capable de lui donner un
sens en utilisant votre cours. De façon générale, les mots techniques se rapportant à une no-
tion précise ont ét é définis par le professeur. Cependant, il peut arriver que vous soyez passés
à côt é de la définition donnée dans le cours, ou que vous l’ayez simplement oubliée.
fig 7 : Conduite à tenir devant un mot complique´
18

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Voici la démarche qui vous tirera d’affaire si vous vous trouvez dans ce genre de situation.
1. Vous pouvez déduire le sens du mot inconnu par le contexte (de la phrase ou de l’intitul é
du QCM). Dans ce cas, il n’y a pas de problème : vous pourrez y r épondre en ayant tous les
él éments nécessaires.
2. Vous ne pouvez pas déduire par le contexte : vous n’avez pas d’autre choix que de fournir
une réponse en ignorant ce mot. Vous faites purement et simplement comme s’il n’était pas
là. Vous verrez, dans la plupart des cas, les mots complexes apportent des informations qui
sont seulement complémentaires par rapport à la phrase, ce qui signifie qu’ils ne sont pas
indispensables à sa compréhension générale.
Exemple : Dans les phrases ci-dessous, si les mots en gras vous sont inconnus :
− En considérant le sang comme un liquide idéal, calculez la diff érence de pression qui règne
entre...
− L’ossification endoconjonctive est produite a` partir de cellules m ésenchymateuses situ ées
dans le périchondre
− Les  gap jonctions  et les nexus sont des jonctions communicantes.
Remplacez ces phrases par :
− Calculez la différence de pression qui règne entre...
− L’ossification endoconjonctive est produite à partir de cellules m ésenchymateuses
− Les  gap jonctions  sont des jonctions communicantes.
De cette façon, vous arriverez éventuellement à répondre à l’item. Peut-être que la partie
ignorée était importante, mais quel autre choix avez-vous que de ne pas en tenir compte ?

Évidemment, il est conseill é de connaitre la


définition de tous les mots appartenant au vocabu-
laire technique, pour pouvoir r épondre aux QCM en
disposant de tous les éléments.
À retenir :
Ne pas tenir compte d’un mot inconnu pr ésent dans
un item n’est qu’un pis-aller qui permet, dans une
situation extrême, de fournir une r éponse ayant des
chances d’ être correcte.

Parfois, la technique énoncée ci-dessus ne fonctionne pas, et il est indispensable de connaitre


19

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


le sens du mot compliqué pour pouvoir répondre à l’item.

Méthodologie
Exemple 1 : Biochimie (UE1)
Dans le fonctionnement de l’enzyme pyruvate désyhydrogénase, le FAD est un coenzyme
stoéchiom étrique.
Ici, il est impossible de répondre à cet item si vous ne savez pas ce qu’est un coenzyme
stoéchiométrique (notion définie en cours)
Exemple 2 : Biophysique (UE3)
Le coefficient d’atténuation lineique
´ du b éton est de 0, 14 cm−1 dans le contexte donné.
De même, il est impossible de répondre à cet item si vous ne savez pas ce qu’est le coefficient
d’atténuation linéique, et comment il se calcule.
L’essentiel est donc de réussir a` r éfléchir malgre´ un mot inconnu dans la phrase, et d’arriver
à proposer une réponse raisonnée, ayant le maximum de chances d’être celle attendue.

☛ Effectuer directement des QCM en temps limité


Afin de tirer tout le profit possible du travail sur les QCM, il est important de respecter une
progression en deux temps :
1. Tout d’abord un travail où vous consacrez le temps nécessaire à la résolution de chaque
QCM. Cela va vous permettre de trouver les bons raisonnements, et de réactiver de façon
efficace les connaissances acquises lors de la phase de travail de votre cours.
2. Ensuite, un travail en temps limité, qui permettra de travailler la rapidité et de vérifier que
les connaissances sont bien accessibles en un temps reduit.
´
Il ne faut pas faire l’impasse sur la première phase en pensant gagner du temps par un travail
direct en temps limité. Ces deux étapes sont fondamentales, et jouent chacune un rôle bien
précis dans votre préparation.

☛ Pour finir
N’oubliez jamais qu’un QCM réussi vous permet de valider le raisonnement que vous avez
mis en place dans sa résolution, bas é sur une bonne connaissance du cours.
fig 8 : Les deux éléments dont d écoulent la bonne réponse à un item

Au contraire, s’il est rat é, il faudra comprendre d’où vient votre erreur (probl ème d’appren-
tissage de cours ? Raisonnement erroné ? les deux ?). Si vous répondez instinctivement à un
item, sans mettre en place de raisonnement spécifique ou sans réactiver votre cours, quel sens
pouvez vous donner à sa correction ?
C’est par cette rigueur dans l’entraı̂nement que vous serez fin pr êt le jour du concours. Cet
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
ouvrage, en compilant de nombreux QCM de tous horizons, constitue un formidable outil
pour votre préparation.
20
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
UE 1
Atome, biomolécules,
génome, bioénergétique,
métabolisme

Louis Joseph Gay-Lussac (1178-1850),


chimiste et physicien français, connu
pour ses travaux sur la physique des gaz.
En chimie, il découvre le bore, le cyanogène
et l’acide cyanhydrique. Et n’oubliez pas
le « degré Gay-Lussac » qui mesure la
concentration en alcool des boissons.
22

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Table de l’UE 1
Énoncés des QCM classés
1. Chimie générale 23
Atomistique 23
Cinétique 28
Thermochimie 32
Solutions aqueuses 38
2. Chimie organique 45
Structure, nomenclature, isomérie et réactivité 45
Réactions en chimie organique 53

3. Biochimie 60
Glucides 60
Acides amines´ 66
Lipides 71
Peptides et protéines 78
Enzymologie 83
Métabolisme 90

4. Biologie moléculaire 92
ADN, génome et chromosomes 92
Réplication 98
Réparation, mutations 102
Transcription 106
Traduction 111
Régulation, expression génétique 115
Techniques d’analyse du genome
´ 118

Énoncés des concours blancs 129

Corrigés des QCM classés 180

Corrigés des concours blancs 269

document établi par Alexandre Fradagrada et Michel Métrot, agr égés


UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
UE 1 QCM classés (énoncés)

Pour chaque QCM, sauf mention contraire, cochez la (ou les) réponse(s) exacte(s).

1. Chimie générale
Atomistique
1 On s’intéresse aux quatre éléments suivants : béryllium (Be) – fluor (F) – oxygène (O) et
strontium (Sr). Parmi les propositions suivantes, indiquez la (les) proposition(s) exacte(s), en
réalisant une lecture du texte de gauche à droite :
❑ a. Sr-Be-O-F sont classés par ordre d’ électronégativité croissante,
❑ b. Sr-Be-O-F sont classés par ordre de caractère oxydant croissant,
❑ c. F-O-Be-Sr sont classés par ordre de caractère métallique croissant
❑ d. Be-O-F-Sr sont classés par ordre de rayon atomique croissant,
❑ e. F-O-Sr-Be sont classés par ordre d’ énergie de 1ère ionisation croissante.
D’après concours Rouen

2 L’isotope le plus répandu du fer est 56


26 Fe. Pour cet isotope, parmi les propositions sui-
vantes, indiquez la (les) proposition(s) exacte(s) :
❑ a. Fe3+ possède 26 protons, 30 neutrons et 23 électrons.
❑ b. Fe a la configuration électronique : 1s2 2s2 2p 6 3s2 3p 6 3d 8.
❑ c. Fe3+ a la configuration électronique : 1s 2 2s 2 2p6 3s2 3p 6 4s 2 3d 3 .
❑ d. Fe2+ a la structure électronique : 12 2s2 2p 6 3s2 3p6 3d6.
❑ e. L’ion Fe2+ est plus stable que l’ion Fe3+ .
D’après concours Rouen

3 On s’intéresse au mercure 80Hg et à l’or 79 Au. Il est à noter que l’or a une configuration
en ns 1(n − 1)d10 . Parmi les propositions suivantes, indiquez la (les) proposition(s) exacte(s).
❑ a. L’énergie de première ionisation du mercure est l’ énergie associée à la réaction :
Hg(l) → Hg+(l) + e−
❑ b. L’énergie de première ionisation de l’atome de mercure est plus elev
´ ée que celle
de l’atome d’or.
❑ c. L’énergie de deuxième ionisation de l’atome de mercure est plus faible que celle
de l’atome d’or.
❑ d. L’énergie de première ionisation de l’or consiste en l’arrachement d’un électron
appartenant à une des orbitales de type  d  .
❑ e. L’énergie de deuxième ionisation du mercure consiste en l’arrachement d’un
électron appartenant à une des orbitales de type  s .
D’après concours Rouen
24 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


4 On considère l’entité chimique suivante 62
28Ni . Parmi les propositions suivantes, indiquez
+

la (les) proposition(s) exacte(s).


❑ a. Cette entité chimique contient 62 protons.
❑ b. Cette entité chimique contient 29 électrons.
❑ c. Cette entité chimique contient 35 neutrons.
❑ d. Cette entité chimique contient 28 neutrons.
❑ e. Cette entité chimique est isoélectronique de 60
27Co.
D’après concours Rouen

5 On considère l’Indium de symbole atomique 49In. Parmi les propositions suivantes, indi-
quez la (les) proposition(s) exacte(s).
❑ a. In a pour configuration électronique réduite [Kr] 5s 2 5d10 5p1.
❑ b. In a pour configuration électronique
1s2 2s 2 2p 6 3s2 3p6 4s 2 3d 10 4p6 5s 2 4d10 5p 1.
❑ c. In possède exactement un électron de valence.
❑ d. In3+ a pour configuration électronique réduite [Kr] 4d 10.
❑ e. In3+ a pour configuration électronique
1s2 2s 2 2p 6 3s2 3p6 4s 2 3d 10 4p6 5s 2 4d8
D’après concours Rouen

6 Parmi les propositions suivantes, indiquez la(les) proposition(s) exacte(s) :


❑ a. L’atome 19K poss ède deux électrons de valence.
❑ b. L’atome 40Zr poss ède 4 électrons de valence.
❑ c. L’atome 71Lu possède 2 électrons de valence.
❑ d. Les ions 17 Cl− et 16S2− sont isoelectroniques.
´
❑ e. Les ions 9 F et 8 O2− sont isoélectroniques.

D’après concours Rouen

7 On considère plusieurs éléments du tableau périodique notés X1 , X 2, X 3, X 4, X 5 et on


s’intéresse aux principales propriétés périodiques gén érales. Leur position dans le tableau est
la suivante (groupe ↔ colonne, période ↔ ligne) :

X5
X1 X4 X3
X2
Parmi les propositions suivantes, indiquez la (les) proposition(s) exacte(s) :
❑ a. X 5 a une énergie d’ionisation plus élevée que X4.
❑ b. X 2 a un rayon atomique plus élevé que X3 .
❑ c. X 3 a un rayon atomique plus élevé que X1 .
UE 1 • énoncés 25

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. X 4 est plus électronégatif que X 3.
❑ e. Si X3 et X2 appartiennent au bloc p, X2 possède un caractère métallique plus
accentué que celui de X3.
D’après concours Rouen

8 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Le tritium et le deutérium ont le même nombre de neutrons.
❑ b. L’hydrogène et le tritium ont la même masse atomique.
❑ c. Le deutérium et le tritium ont les m êmes propri´et és chimiques.
❑ d. L’hydrogène et le deutérium ont les mêmes propriét és physiques.
❑ e. L’hydrogène et le deutérium ont le m ême nombre de proton(s).
D’après concours Nancy

9 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Le nombre quantique principal est appelé n.
❑ b. Pour une valeur donnée du nombre n, le nombre l varie de 0 à n + 1.
❑ c. 14 électrons peuvent être caractérises
´ par les nombres n = 4 et l = 3.
❑ d. L’orbitale 4s est l’une des quatorze orbitales de la couche n = 4.
❑ e. Pour des valeurs données de n et l, le nombre de valeurs permises de m d éfinit
le nombre d’orbitales de même énergie.
D’après concours Nancy

10 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. L’atome 25Mn a la configuration 1s 2 2s 2 2p6 3s2 3p6 3d 7.
❑ b. Soit les atomes 36 Kr et 54 Xe, alors Xe a la configuration [Kr] 4d 10 6s2 6p 6.
❑ c. L’atome 20Ca fait partie des métaux alcalins.
❑ d. L’ion 16S 2− est isoélectronique de 20Ca 2+.
❑ e. L’atome 12Mg a la configuration 1s 2 2s 2 2p8 .
D’après concours Nancy

11 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Le potentiel d’ionisation de 11 Na est supérieur à celui de 12Mg.
❑ b. Le caractère électropositif de 11 Na est inférieur à celui de 12 Mg.
❑ c. L’affinit é électronique du 9F est supérieure à celle du 8O.
❑ d. L’affinité électronique du 9F est supérieure à celle du 11 Na.
❑ e. L’électronégativité du 9 F est supérieure a` celle du 35Br.
D’après concours Nancy
26 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


12 Quel est le numéro atomique de l’élément situé dans la 4e colonne, 4e période de la
classification périodique ?
❑ a. 22 ❑ b. 24 ❑ c. 32 ❑ d. 34
❑ a. Aucune des quatre propositions précédentes n’est correcte.
D’après concours Grenoble

13 L’élément rubidium existe sous deux formes isotopiques 85 Rb et 87 Rb. Sa masse mo-
laire vaut 85, 5g.mol−1 . Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. 85 et 87 sont des nombres atomiques.
❑ b. Deux isotopes n’ont pas le même nombre de neutrons.
❑ c. La proportion isotopique ( 85 Rb/87 Rb) vaut 1.
❑ d. La proportion isotopique ( 85 Rb/87 Rb) vaut 3.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

14 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. La configuration électronique du rubidium dans son état fondamental est
1s2 2s 2 2p 6 3s2 3p6 3d 10 4s2 4p6 4d 1.
❑ b. La configuration électronique de l’élément césium 55 Cs dans son état fonda-
mental est [54 Xe] 4 f 1.
❑ c. Le sodium est l’élément de numéro atomique Z = 11.
❑ d. L’atome de potassium possède 19 électrons.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

15 On s’intéresse à quelques éléments de la colonne des alcalins. Le tableau suivant donne


la période de chacun de ces el´ éments dans la classification périodique.

él ément Sodium Na Potassium K Rubidium Rb C ésium Cs


Période 3 4 5 6

Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Tous ces éléments possèdent un électron de valence.
❑ b. Tous ces éléments sont des m étaux tr`
es r éducteurs.
❑ c. Parmi ces él éments le sodium possède la plus petite énergie de première
ionisation.
❑ d. Le sodium, est parmi ces él éments, celui qui possède le plus grand rayon
atomique.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble
UE 1 • énoncés 27

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


16 L’arsenic est l’él ément de Z = 33. Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Dans son état fondamental l’arsenic a pour configuration électronique
[18 Ar ] 3d10 4s2 4p3 .
❑ b. Dans son état fondamental l’arsenic a 3 électrons de valence.
❑ c. L’arsenic appartient à la 5e colonne de la classification p ériodique.
❑ d. L’arsenic est dans la 4e période de la classification p ériodique.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

17 On appelle X l’élément situé dans la même colonne que l’arsenic mais dans la deuxi ème
ligne de la classification périodique. Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. L’arsenic faisant partie du bloc d, X n’existe pas.
❑ b. X est le bore 5B.
❑ c. X est l’azote 7 N.
❑ d. X est le fluor 9 F.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

18 On s’intéresse à l’élément soufre 16 S qui possède 4 isotopes 32 S, 33S, 34 S et 36 S.


Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Sachant que la masse molaire atomique est de 32, 06 g.mol −1 , l’isotope le plus
abondant naturellement est le 34S.
❑ b. L’atome de soufre possède 16 électrons et 17 protons.
❑ c. Dans son état fondamental, le soufre a une valence égale à 2.
❑ d. Le soufre est plus électronégatif que le fluor.
❑ e. L’anion divalent S2− a une configuration électronique plus stable que l’atome
de soufre dans son état fondamental.
D’après concours Nancy

19 On s’intéresse à la formation des ions les plus probables pour quelques éléments :
Césium 55Cs, le Baryum 56Ba, l’iode 53 I et le cérium 58 Ce.
❑ a. Le Césium peut donner l’ion Cs 2+.
❑ b. Le Baryum peut donner l’ion Ba2+.
❑ c. L’iode peut donner l’ion I2− .
❑ d. Il y a deux cations possibles pour le cuivre 29Cu.
❑ e. Le Cérium peut donner l’ion Ce 2+.
D’après concours Nancy
28 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


20 Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. L’élément X de configuration électronique fondamentale
1s2 2s 2 2p 6 3s2 3p6 4s 2 est un métal de transition.
❑ b. L’élément Y de configuration électronique fondamentale
1s2 2s 2 2p 6 3s2 3p6 4s 2 3d 10 4p5 est un halogène.
❑ c. L’élément X possède trois électrons célibataires à l’état fondamental.
❑ d. L’élément X est moins électronegatif
´ que l’ élément Y.
❑ e. L’élément Y peut facilement donner un cation Y+ .
D’après concours Nancy

21 Quel niveau d’énergie est utilisé, une fois que la sous couche 4s est pleine ?
❑ a. 3d ❑ b. 4d ❑ c. 4p ❑ d. 5s ❑ e. 6s
D’après concours Paris 13

22 Parmi les valeurs suivantes, indiquez celle qui correspond au nombre d’orbitales dans
la sous-couche 4 f :
❑ a. 7 ❑ b. 3 ❑ c. 1 ❑ d. 5 ❑ e. 8
D’après concours Paris 13

Cinétique
23 Concernant l’énergie d’une réaction chimique, quelle(s) est (sont) la (les) proposi-
tion(s) exacte(s) :
❑ a. Un état de transition est un état de haute énergie.
❑ b. La diff érence d’énergie entre l’état de transition et l’état initial est appel ée
énergie d’activation.
❑ c. Une réaction endothermique libère de la chaleur.
❑ d. Un état de transition est un état stable.
❑ e. Après l’état de transition, la reaction
´ évolue vers un état plus stable.
D’après concours Dijon

24 Trouvez le nombre de réponses exactes relatives aux r éactions élémentaires :


1. Une réaction él émentaire est une réaction qui implique 2 réactifs et conduit à la formation
de 2 produits.
2. L’ordre d’une réaction élémentaire est égal à la molécularité.
3. Si la somme des coefficients stœchiométriques d’une r éaction est égale à l’ordre global, on
peut en déduire que la réaction est élémentaire.
4. Une réaction él émentaire fait intervenir un changement de structure minimal.
5. La réaction : 2NO+O2 −→ 2NO 2 est très probablement élémentaire.

❑ a. 1 ❑ b. 2 ❑ c. 3 ❑ d. 4 ❑ e. 5
D’après concours Lille
UE 1 • énoncés 29

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


25 Quelle est l’unité d’une vitesse de reaction
´ ?

❑ a. mol.L−1 .s ❑ b. s−1 ❑ c. mol.L−1.s −1 ❑ d. mol −1 .L −1.s −1


❑ e. Cela dépend des ordres partiels.
D’après concours Lille

26 On étudie la cinétique de la réaction d’hydrolyse en solution aqueuse acide de l’adénosine


triphosphate (ATP), à 50, 5 ◦ C :
ATP + H2 O  ADP + H3 PO4 Ea = 91, 3 kJ.mol−1

[ATP] (mol.L−1) 0, 0198 0, 0183 0, 0159 0, 0145 0, 0100


Temps (s) 0 5 400 15 000 21 400 46 800
Quelle(s) est (sont) la (les) proposition(s) correcte(s) ?
❑ a. La réaction est d’ordre 1 et k50,5 = 1, 46.10 −5 s −1 à 0, 01.10−5 s−1 près.
❑ b. La réaction est d’ordre 2 et k50,5 = 8, 79.10 −4 s −1 à 0, 01.10−4 s−1 près.
`
❑ c. à 40 ◦ C, k40 = 4, 67.10−6 s−1 à 0, 01.10 −6 pres.
❑ d. à 40 ◦ C, k40 = 2, 81.10−4 L.mol−1.s−1 à 0, 01.10 −4 près.
❑ e. Dans une cinétique d’ordre 0, la constante k est ind épendante de la concentra-
tion initiale.
D’après concours Nantes

QCM n◦ 27 à 28 : On étudie la réaction :


4NO + O 2 + 6H2 O −→ 4NO 2 +4H3 O⊕ . .
Cette réaction n’est pas élémentaire mais admet une étape cinétiquement déterminante
dont la constante de vitesse est k et la vitesse de disparition de NO a pour expression :
v = k[NO]α [O2 ]β .
Dans une première série d’expériences, on détermine que l’ordre partiel pour O2 est égal à
1.
Dans une seconde série d’expériences, on maintient la solution saturée en O2, telle que la
concentration en O2 dissout soit égale à 3, 0.10−5 mol.L−1 .
La mesure de la vitesse initiale vi de disparition de NO est reportée en fonction de la
concentration de NO dans le tableau ci-dessous :

[NO] (mol.L−1 ) 3, 0.10 −5 1, 0.10 −5 0, 3.10−5 0, 1.10−5 0, 03.10−5


vi (mol.L −1 .s−1 ) 135.10 −9 15.10−9 1, 35.10−9 0, 15.10−9 0, 013.10−9

D’après concours Paris 5

27 Cochez la (les) proposition(s) correcte(s) concernant l’expression de la constante de


vitesse apparente k app dans ces conditions expérimentales :
❑ a. α=2 et k = kapp [O2 ]2 .
❑ b. α=1 et kapp = k[O2 ].
30 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. α = 2 et kapp = k[O2 ].
❑ d. kapp = k
❑ e. Aucune de ces quatre propositions n’est correcte.

28 Cochez la (les) proposition(s) correcte(s) concernant la valeur de la constante de vitesse


apparente kapp dans ces conditions expérimentales :
❑ a. kapp = 150.10−3 L.mol−1 .s−1
❑ b. kapp = 150 s−1
❑ c. kapp = 150.10−3 s−1
❑ d. kapp = 150 L.mol −1.s−1
❑ e. Aucune de ces quatre propositions n’est correcte.

29 La décomposition d’un antibiotique dans l’eau à 20 ◦ C est une réaction du premier


ordre. Déterminez la concentration en antibiotique au bout de 3 mois, puis au bout de 1 an,
sachant que le temps de demi-vie et la concentration initiale en antibiotique sont respective-
ment de 0, 420 an et 6.10−3 mol.L −1 .
❑ a. 3, 9.10 −3 mol.L −1 et 1, 15.10−3 mol.L−1
❑ b. 4, 3.10 −3 mol.L −1 et 1, 15.10−3 mol.L−1
❑ c. 5, 0.10−3 mol.L −1 et 1, 65.10−3 mol.L−1
❑ d. 5, 98.10 −3 mol.L −1 et 5, 94.10 −3 mol.L−1
❑ e. 0, 4.10−3 mol.L −1 et 1, 65.10−3 mol.L−1
D’après concours Lille

30 Quelle proposition au sujet d’un catalyseur est inexacte ?


❑ a. Les enzymes sont les catalyseurs du vivant.
❑ b. Un catalyseur ne subit pas de transformation chimique nette dans le bilan
global.
❑ c. Un catalyseur augmente l’énergie cinétique des réactifs.
❑ d. Un catalyseur abaisse l’énergie d’activation d’une réaction.
❑ e. Un catalyseur ne change pas la constante d’équilibre d’une r éaction.
D’après concours Lille

QCM n◦31 à 32 : Le diiode peut être préparé à partir des ions iodure en faisant intervenir
les ions peroxodisulfate dont l’équation-bilan est :
2I− + S2 O 2− 2−
8  I2 +2SO4 .

Cinq expériences sont réalisées pour étudier la cinétique de cette réaction. Les conditions
expérimentales sont décrites dans le tableau ci-dessous. [I− ]0 et [S2O 2−
8 ]0 sont les concentra-
tions initiales. Les variations de la concentration de I2 en fonction du temps sont rassemblées
sur le graphique ci-dessous.
UE 1 • énoncés 31

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Exp. [I−] 0 (mol.L−1 ) [S2 O2−
8 ] 0 (mol.L )
−1
T (◦C) Composés ajoutés
1 0, 02 0, 01 20 aucun
2 0, 04 0, 02 20 aucun
3 0, 02 0, 01 35 aucun
4 0, 04 0, 02 35 aucun
5 0, 02 0, 01 20 Fe 2+

D’après concours Nantes

31 Quelle(s) est (sont) la (les) proposition(s) correcte(s) ?


d[I 2 ]
❑ a. La vitesse de formation du diiode est égale à ·
dt
❑ b. La détermination de la vitesse à partir des graphiques se fait en établissant
l’équation des courbes.
❑ c. La vitesse de formation du diiode augmente avec la concentration des réactifs.
❑ d. La vitesse de formation du diiode diminue avec la température.
❑ e. Les ions Fe2+ agissent comme catalyseur.

32 Quelle(s) est (sont) la (les) proposition(s) correcte(s) ?


❑ a. La vitesse de la r éaction de l’expérience 4 est 100 fois sup érieure à la vitesse
de l’expérience 1.
❑ b. Les conditions optimales pour cette réaction sont celles combinant les condi-
tions de température et de concentration de l’expérience 4 avec la condition
spécifique de l’expérience 5.
❑ c. L’élévation de température augmente le nombre de collisions moléculaires.
❑ d. L’effet de la température permet de d´eduire que la r éaction est endergonique.
❑ e. L’allure des courbes permet de déduire l’ordre de la reaction.
´
32 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Thermochimie
33 Soit la réaction suivante : I2(g) + H 2(g) 2 1 2 HI(g)
Dans le sens 1 à 298 K et à P ◦, on a : ∆G◦r éaction = −2, 72 kJ
et ∆H ◦ = −9, 4 kJ.
réaction
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. L’enthalpie libre de la réaction dans le sens 1, est égale à
∆H◦ − ∆S ◦ .
r éaction réaction
❑ b. La réaction est endothermique.
❑ c. La réaction dans le sens 1, à 298 K, est non spontanée.
❑ d. À l’équilibre, à P◦ = 1 atm, la pression partielle de H2 dans le mélange des gaz
est de 0, 5 atm.
❑ e. Aucune des propositions précédentes n’est exacte.
D’après concours Paris 13

34 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Une réaction dont la variation d’énergie libre standard est négative est dite  en-
dothermique  .
❑ b. Un réactif nucléophile possède toujours une case quantique vide.
❑ c. Le carbocation éthyle est plus stable que le carbocation cation méthyle.
❑ d. Le tétrapropylammonium est un réactif électrophile.
❑ e. Les acides de Lewis sont des composés neutres possédant une orbitale vacante.
D’après concours Paris 13

35 Soit la réaction de combustion totale d’une mole de glucose C6 H12 O6 ;


∆H ◦ = −2810 kJ.mol−1 .
❑ a. Elle produit trois moles de dioxyde de carbone.
❑ b. Elle produit 12 moles d’eau.
❑ c. Elle nécessite l’apport de 6 moles de dioxygène.
❑ d. La réaction est endothermique.
❑ e. La calorie est l’unité de mesure de la chaleur dans le système international (S.I).
D’après concours Nancy

36 Concernant la constante d’équilibre K d’une réaction :


❑ a. Une valeur de K supérieure à 104 indique qu’à l’équilibre les réactifs
prédominent.
❑ b. Une valeur de K supérieure à 104 correspond à une valeur d’énergie de Gibbs
∆G de cette réaction positive.
❑ c. La réaction de dissociation d’un acide faible dans l’eau correspond à une valeur
de K supérieure à 10 4 .
UE 1 • énoncés 33

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Lors d’une réaction r édox la valeur de K dépend des valeurs des potentiels de
chacun des couples.
❑ e. L’activité d’une esp èce en solution tend vers sa concentration molaire lorsque
celle-ci est très élevée.
D’après concours Nancy

37 Concernant les enthalpies de transformation physique et atomique :


❑ a. Les enthalpies de fusion et de liquefaction
´ ont le meme
ˆ signe.
❑ b. L’enthalpie de sublimation est la différence entre les enthalpies de fusion et de
vaporisation.
❑ c. L’enthalpie de vaporisation d’un corps pur est une fonction d’état.
❑ d. L’enthalpie d’ionisation d’un atome à l’état gazeux est exothermique.
❑ e. L’enthalpie de première ionisation d’un atome à l’état gazeux est supérieure à
celle de la deuxième ionisation.
D’après concours Nancy

38 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. ´
L’enthalpie est égale à la somme de l’energie interne et du produit de la pression
par le volume.
❑ b. La variation d’entropie permet de conclure sur la spontanéité d’une réaction.
❑ c. Une réaction dont la variation d’ enthalpie est positive dégage de la chaleur lors
de son déroulement.
❑ d. Une réaction exothermique dont le bilan est A(s) −→ B(l) + C(g) est spontan ée
quelle que soit la température.
❑ e. L’enthalpie, l’entropie et le travail sont des fonctions d’état.
D’après concours Nantes

2
39 Soit l’équilibre : CaCO3(s)  1 CO2(g) + CaO (s)
avec K p la constante d’ équilibre.
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. K p = ( pCaCO (s) × pCO2(g) ) / pCaCO 3(s) .
❑ b. K p = pCO2(g).
❑ c. D’après les règles de solubilité, CaCO3(s) est soluble dans l’eau.
❑ d. D’après les règles de solubilité, CaCO3(s) est insoluble dans l’eau.
❑ e. En augmentant la pression totale à volume et température constants, l’équilibre
est déplac é dans le sens direct 1.
D’après concours Nantes

40 On donne :
2
➣ l’équilibre (1) : acide pyruvique + NADH + H +  1 acide lactique + NAD +
➣ les potentiels standards des couples redox suivants à pH = 0 et à 298 K :
E ◦1 (acide pyruvique/acide lactique) = 0, 23 V ; E◦2 (NAD+/NADH) = −0, 11 V ;
34 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


➣ à 25 ◦C : pKa (acide pyruvique/pyruvate) = 2, 5 ;
pKa (acide lactique/lactate) = 3, 9 ;
➣ les formules suivantes :

Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Acide lactique  acide pyruvique +2e − + 2 H+ .
❑ b. Dans l’équilibre (1), le carbone b de l’acide lactique subit une oxydation (sens
2).
❑ c. La molécule d’acide pyruvique présente un système conjugué.
❑ d. Les nombres d’oxydation des carbones a et b de l’acide pyruvique ne varient
pas au cours de la réaction d’oxydo-r éduction.
❑ e. Dans les conditions standards, le sens spontané de la r éaction est celui qui cor-
respond à l’oxydation de NADH par l’acide pyruvique.
D’après concours Nantes

41 Soit l’équilibre (2) :


2
Pyruvate + NADH + H+  1 Lactate + NAD+ à pH = 7 et a` 298 K.
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Les potentiels apparents à pH = 7 sont
E◦1(pyruvate/lactate) = −0, 19 V et E◦2 (NAD+/ NADH) = −0, 32 V.
❑ b. Les potentiels apparents à pH = 7 sont
E◦1 (pyruvate/lactate) = 0, 65 V et E ◦2 (NAD+/ NADH) = 0, 1 V.
❑ c. Soit ∆G ◦2 le ∆G ◦ de l’équilibre (2) dans le sens direct ;
on a : ∆G◦2 = −25 090 J.
❑ d. La variation d’entropie standard dans ces conditions (pH = 7 et 298 K)
étant nulle, une augmentation de la température à pression constante déplace
l’équilibre (2) dans le sens direct 1.
❑ e. Soit les constantes de l’équilibre (2) dans le sens direct 1, Kc (pH7) à pH = 7 et
Kc (pH10) à pH = 10. On observe que Kc (pH7) > Kc (pH10).
D’après concours Nantes

42 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Un système fermé peut échanger de l’énergie mais pas de matière avec
l’extérieur.
❑ b. La variation d’enthalpie d’une réaction de combustion est toujours positive.
❑ c. L’entropie absolue d’un corps simple est toujours positive.
UE 1 • énoncés 35

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Les variations d’entropie et d’enthalpie sont ind´ ependantes du chemin parcouru
entre l’état initial et l’état final.
❑ e. La variation d’entropie associée à la réaction A(g) −→ A(l) est positive.
D’après concours Nantes

QCM n◦ 43 et44 : Soit la réaction R à 25 ◦C :


H 2(g) + I2(g) 2 1 2 HI (g).
Lorsque l’équilibre est atteint dans un récipient de 10 L, la quantité de matière de chacun
des réactifs et des produits est : 0, 100 mol de H2 ; 0, 100 mol de I2 ;
0, 740 mol de HI.
D’après concours Nantes

43 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. La constante d’équilibre K c de la réaction R est comprise entre 1, 80 et 1, 85.
❑ b. Les constantes d’equilibre
´ K c et K p ont les mêmes valeurs.
❑ c. L’ajout d’un gaz inerte dans le recipient
´ à pression constante déplace l’équilibre
dans le sens 1.
❑ d. L’ajout de H 2 dans le recipient
´ à pression constante déplace l’ équilibre dans le
sens 1.
❑ e. L’ajout de HI dans le récipient à pression constante déplace l’ équilibre dans le
sens 1.

44 Un ajout au système de 0, 500 mol de HI(g) est réalisé dans le r écipient à pression
constante. Cochez les propositions suivantes concernant l’état du système au nouvel équilibre
qui sont vraies.
❑ a. La valeur de la constante d’équilibre K c de la réaction R reste inchangée.
❑ b. L’équilibre est un équilibre homogène.
❑ c. La concentration de HI est comprise entre 1, 1330 et 1, 1340 mol.L −1.
❑ d. La concentration de I2 est égale à celle de H2.
❑ e. La concentration de I2 est comprise entre 0, 0152 et 0, 0155 mol.L−1 .

45 Quelle(s) est (sont) la (les) proposition(s) exacte(s) parmi les suivantes ?


❑ a. Un système isol é ne transfère ni matière ni énergie avec l’extérieur.
❑ b. Une quantité de matière est une grandeur intensive.
❑ c. La pression est une variable d’état.
❑ d. Une fonction d’état est indépendante du chemin suivi entre l’état initial et l’état
final.
❑ e. Une réaction présentant une variation d’enthalpie positive (∆r H > 0) est qua-
lifiée d’exothermique.
D’après concours Limoges
36 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


46 Quelle est la proposition exacte ?
❑ a. Lors d’une réaction endothermique, l’énergie du produit final est plus basse que
l’énergie du substrat.
❑ b. L’énergie d’activation d’une réaction correspond à la différence d’énergie entre

|
m
o
le substrat et le produit final.

c
t.
o
p
s
❑ c. Lors d’une réaction exothermique, l’énergie du produit final est plus basse que

g
lo
.b
l’énergie du substrat.

s
in
c
e
d
Lors d’une réaction endothermique, on observe un dégagement de chaleur.

e
❑ d.

m
s
e
rd
❑ e. Lors d’une réaction exothermique, l’énergie du produit final est plus haute que

o
s
e
tr
l’énergie du substrat.

e
/l
:/
p
tt
h
D’après concours Dijon

|
m
o
.c
s
s
re
47 On connaˆıt les variations d’enthalpie (∆rH) des deux combustions suivantes :

p
rd
o
.w
C2 H4 + 3O2 −→ 2CO2 + 2H 2O ∆r H1 = −331, 6 kcal

s
in
c
e
d
C2 H4 Cl 2 + 3O2 −→ 2CO2 + 2H 2O + Cl2 ∆ r H2 = −367, 1 kcal
e
m
s
e
rd

On donne : ∆ f H(Cl2 ) = 0
o
s
e
tr
e
/l
:/

Parmi les propositions suivantes concernant la valeur de l’enthalpie de la réaction suivante :


p
tt
h

C2H4 + Cl 2 −→ C2H 4Cl2, cochez la proposition exacte :


|
s
in
c
e
d
e

698, 6 kcal −35, 5 kcal 35, 5 kcal


M

❑ a. ❑ b. ❑ c.
s
e
rD
o
s
re

Parmi les propositions suivantes concernant la valeur de l’enthalpie de formation de C2 H4 ,


T
e
/L

cochez la proposition exacte :


s
p
u
ro
/g

❑ d. 14, 4 kcal
m
o
.c
k

Elle n’est pas calculable à l’aide des données fournies.


o

❑ e.
o
b
e
c
a

D’après concours Brest


.f
w
w
w
|
s
in
c

QCM n◦ 48 à 50 : On considère le transfert du groupement phosphoryle mettant en jeu la


e
d
e
M

phosphocréatine P-CREA2− et l’adénosine triphosphate ATP 4− à pH 7, à une température


s
e
rD

de 300 K, qui forme respectivement la créatine (CREA) et l’adénosine diphosphate ADP3− ,


o
s
re
T

selon leur réaction d’hydrolyse respective :


e
/L
m
o

(1) ATP4− + 2H2O  ADP 3− + HPO2− + 


.c

4 + H3 O ∆r G ◦1 = −34, 5 kJ.mol −1
k
o
o
b

(2) P − CREA2− + H2 O  CREA + HPO2−



∆r G ◦2 = −42, 0 kJ.mol −1
e
c
a

4
.f
w
w
w

D’après concours Paris 5


|

48 Cochez la (les) proposition(s) correcte(s) concernant les réactions (1) et (2) :


 
❑ a. ∆ rG ◦1 (pH = 8) < ∆ rG ◦1 (pH = 6).

❑ b. Pour les réactions (1) et (2), comme ∆rG ◦ < 0, alors ces r éactions sont
nécessairement exothermiques dans les conditions standard biologiques.
❑ c. La réaction (2) n’est pas réalisable dans les conditions standard.
Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
UE 1 • énoncés 37

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Dans les conditions standard biologiques, l’hydrolyse de la P-CREA2− est ther-
modynamiquement favorisée par rapport à celle de l’ATP4− .
❑ e. Aucune de ces quatre propositions n’est correcte.

49 Cochez la (les) proposition(s) correcte(s) concernant l’enthalpie libre et la constante


d’équilibre de la réaction spontanée (3) dans les conditions standard biologiques entre les
espèces ATP4− , ADP 3− , P-CREA2− et CREA :
❑ a. ∆ rG◦3 = −76, 5 kJ.mol−1 et K8 = 19, 5.1012 .


❑ b. ∆ rG◦3 = −7, 5 kJ.mol−1 et K8 = 20.
❑ c. La valeur de K3 est indépendante du pH.
❑ d. K3 = 10 7 K3.
❑ e. Aucune de ces quatre propositions n’est correcte.

50 Dans le muscle au repos, les concentrations à l’ état stationnaire des différentes espèces
sont les suivantes :
[ATP 4−] = 5, 0 × 10−3 mol.L −1 [ADP3− ] = 5, 0 × 10−4 mol.L−1
[P-CREA2− ] = 2, 0 × 10 −2 mol.L −1 [CREA]= 1, 0 × 10−2 mol.L−1
Cochez la (les) proposition(s) correcte(s) concernant l’enthalpie libre de la réaction (3) pour
le muscle au repos a` pH = 7 :
❑ a. ∆ rG3 = 0 car c’est un état d’ équilibre.

❑ b. ∆ rG3 = ∆rG◦3
❑ c. ∆rG3 = −3, 5 kJ.mol−1
❑ d. ∆rG3 = −73, 5 kJ.mol−1
❑ e. Aucune de ces quatre propositions n’est correcte.

51 On considère l’équilibre suivant : 2 CO(g)2 1 CO2(g) + C (s).


À 600 K, la pression totale d’équilibre du gaz dans le récipient est de 4 atm et le coefficient
de dissociation de CO vaut 0, 4 avec ∆r H < 0. Déterminez le sens dans lequel se d éplace
l’équilibre quand la température augmente.
❑ a. L’équilibre n’évolue pas.
❑ b. L’équilibre évolue dans le sens exothermique 1.
❑ c. L’équilibre évolue dans le sens exothermique 2.
❑ d. L’équilibre évolue dans le sens endothermique 1.
❑ e. L’équilibre évolue dans le sens endothermique 2.
D’après concours Lille

52 En utilisant les énergies de dissociation en kJ.mol−1 présent ées dans le tableau ci-
dessous, déterminez l’enthalpie de combustion de l’acétone (CH 3 COCH3 ).
38 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


C=O O=O O−H C−H C−C C=C C≡C
732 498 460 410 350 611 835

❑ a. −1593 kJ.mol −1 ❑ b. +1593 kJ.mol −1 ❑ c. −1268 kJ.mol −1


❑ d. −3204 kJ.mol −1 ❑ e. +1550 kJ.mol −1
D’après concours Lille

53 On considère la réaction de formation de l’ammoniac gazeux à 298 K :


Donn ées à 298 K NH3(g) N2(g) H 2(g)
N2(g) + 3H2(g)  2NH 3(g) S◦ (J.K −1.mol−1 ) 192, 5 191, 6 130, 7
∆ f H ◦ (kJ.mol−1) −46, 1 - -

On considère ces gaz comme étant des gaz parfaits. Quelle est la variation d’enthalpie libre
standard en kJ.mol−1 à 298 K ?
❑ a. 22 ❑ b. −33 ❑ c. 44 ❑ d. −55 ❑ e. 66
D’après concours Limoges

54 Dans quelles réactions la formation des produits est-elle favorisee


´ par une diminution
de la pression ?
1. CO2(g) + C(s) −→ 2CO (g) ∆H ◦ = +172, 5 kJ
2. N2(g) + 3H2(g) −→ 2NH3(g) ∆H ◦ = −91, 8 kJ
3. CO(g) + 2H2(g) −→ 2CH3OH (g) ∆H ◦ = −21, 7 kJ
4. N2(g) + O 2(g) −→ 2NO (g) ∆H ◦ = 484, 6 kJ

❑ a. 1 et 5 ❑ b. 3 et 4 ❑ c. 3
❑ d. 2 et 4 ❑ e. 2 et 3
D’après concours Lille

Solutions aqueuses
55 L’acide nitreux, molécule instable, doit être préparé in situ en solution aqueuse selon la
réaction :
NO−2 + H3O + = HNO2 + H 2O (constante d’ équilibre à 298 K, K◦ = 103,3).
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Le pK a du couple HNO2/NO −2 vaut −3, 3 à 298 K.
❑ b. Le pK a du couple HNO2/NO −2 vaut 3, 3 a` 298 K.
❑ c. HNO2 est un acide fort en solution aqueuse.
❑ d. Le couple HNO 2/NO−2 est un couple acide faible/base faible en solution
aqueuse.
UE 1 • énoncés 39

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. Tous les items qui précèdent sont faux.
D’après concours Grenoble

56 HNO2 intervient dans de nombreux couples redox comme par exemple dans les couples
HNO2/NO(g) et NO−3 /HNO 2. On note P NO la pression partielle de NO(g) exprimée en bar.
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. La demi-équation redox du couple HNO 2 /NO(g) écrite pour une mole de HNO2
et de NO(g) fait apparaı̂tre un électron, un H+(aq) (ou 1 H3 O+ ) et de l’eau.
❑ b. La demi-équation redox du couple NO−3 /HNO2 écrite pour une mole de HNO2
et une mole de NO−3 fait apparaı̂tre 2 électrons, 2 H+(aq) (ou 2 H3 O+) et de l’eau.
❑ c. L’équation de Nernst associé au couple HNO 2/NO (g) s’écrit :
 
E◦HNO/NO(g) + 0, 06 log PNO/[HNO2 ] .

❑ d. L’équation de Nernst associé au couple NO −3 /HNO 2 s’ écrit :


 
E◦HNO+ /HNO2 + 0, 03 log [NO −3 ] × [H3O +] 3/[HNO 2] .
3
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

57 L’instabilité de HNO2 vient du fait qu’il se dismute (c’est- à-dire qu’il participe à une
réaction ou il joue à la fois le r ôle d’oxydant et de réducteur). On donne les potentiels stan-
dards suivants :
E ◦(HNO2 /NO(g)) = 0, 99 V et E ◦ (NO−3 /HNO 2) = 0, 94 V
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Les valeurs de E ◦ sont en accord avec la dismutation de HNO2 en solution
aqueuse.
❑ b. Le nombre d’oxydation de l’azote dans HNO 2 vaut +V.
❑ c. Lors de la dismutation, HNO2 s’oxyde en NO −3 et se réduit en NO(g) .
❑ d. La réaction de dismutation peut s’ecrire
´ :
3 HNO 2 = NO−3 + NO(g) + H 3O +.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

58 La cystéine est un acide amin é présentant un groupe thiol SH (pK a = 6, 8) ; la cystine


correspond à sa forme disulfure. Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Le nombre d’oxydation de l’élément soufre ne varie pas entre cystéine et
cystine.
❑ b. La forme moléculaire du groupe thiol prédomine à pH = 7, 4.
❑ c. Le potentiel est indépendant du pH de la solution.
❑ d. Lorsque la concentration en cystéine diminue dans une solution contenant en
mélange cystéine et cystine le potentiel augmente.
❑ e. La relation de Nernst prend en compte la température.
D’après concours Nancy
40 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


59 Soit la réaction d’oxydation de H2 O2 par MnO −4 en milieu acide. Les couples sont O2(g)
/H2O 2(l) et MnO−4 / Mn2+ .
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Le nombre d’oxydation de l’oxygène dans H2 O2 est -II.
❑ b. Le nombre d’électrons échang és au cours de la réaction est égal à 10.
❑ c. L’oxydation d’une mole de H 2O2 entraˆıne le dégagement de 1 mole de O2.
❑ d. Le potentiel du couple Mn2+ / MnO −4 est ind épendant du pH.
❑ e. Le potentiel du couple O2(g) /H2O2(l) s’écrit :
 
E O◦ 2(g)/H2 O2(l) − 0, 03 log PO 2 × [H+ ] 2/[H 2O 2] .
D’après concours Nantes

60 On plonge une plaque de plomb dans une solution contenant des ions Ag+ .
Données :
Pb2+ / Pb (s) E◦1 = −0, 12 V Pb4+ / Pb2+ E2◦ = 1, 80 V
Pb4+ / Pb (s) E◦3 Ag + / Ag(s) E4◦ = 0, 80 V
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Pb2+ est l’oxydant le plus fort.
❑ b. E ◦3 = E ◦1 + E ◦2.
❑ c. E ◦3 = 0, 84 V.
❑ d. La plaque de plomb est le siège de l’oxydation.
❑ e. Des ions Pb2+ sont produits lors de la réaction spontanée.
D’après concours Nantes

61 Soit la réaction de l’acide chlorhydrique sur une timbale de cuivre. Connaissant le


potentiel standard par rapport à l’électrode normale à hydrogène des couples suivants : Cu2+ /
Cu (s) = 0, 34 V et H+ /H 2(g) = 0, 0V, Cochez les propositions suivantes qui sont vraies dans
les conditions standards à 25 ◦C.
❑ a. La solution aqueuse de HCl est un acide faible.
❑ b. 2 H+ + Cu −→ Cu 2+ + H2
❑ c. Dans les conditions standards, la réaction 2 H+ + Cu −→ Cu2+ + H2 est spon-
tanée.
❑ d. L’atome de cuivre a un nombre d’oxydation +II dans le cuivre solide.
❑ e. L’atome Cl a un nombre d’oxydation -I dans HCl.
D’après concours Nantes

62 On donne : E ◦1(NO −3 /HNO2) = 0, 94 V E◦2(NO−3 /NO) = 0, 96 V


et E◦3 (HNO2 /NO). Cochez les propositions suivantes qui sont vraies à 25 ◦ C.
❑ a. L’atome d’azote a un nombre d’oxydation de +III dans NO−3 .
❑ b. HNO2 est l’espèce oxydante dans le couple NO −3 /HNO2.
UE 1 • énoncés 41

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. NO + H2 O −→ HNO2 + H+ + e− est une réaction redox.
 
❑ d. E ◦3 HNO2 /NO = 1, 00 V à 0, 01 V près.
 
◦ [NO]
❑ e. E 3 = E 3 + 0, 06 log
[HNO2 ] [H+ ]
D’après concours Nantes

63 La cocaı̈ne symbolisée par B est une base faible en solution aqueuse selon Bröensted
(pKa = 8, 7 a` 25 ◦C).
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Une solution aqueuse de cocaı̈ne à une concentration de 10 −3 mol.L−1 a un pH
acide.
❑ b. Une solution de chlorhydrate de coca¨ıne à une concentration de 10−3 M a un
pH neutre.
❑ c. Le pKb de la coca¨ıne est égale à 5, 3.
❑ d. La constante de basicité de la cocaı̈ne est K b = 10−8,7 .
❑ e. Le pH d’une solution aqueuse de cocaı̈ne depend
´ de son pK a et de sa concen-
tration.
D’après concours Nancy

64 L’acide carbonique (H2CO 3 ) est un diacide faible en solution aqueuse.


Données : pK a1 = 6, 4 pK a2 = 10, 2 à 25◦ C.
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. À pH = 7, l’acide carbonique est l’espèce prédominante.
❑ b. L’espèce pr édominante à pH = 7 est l’ion hydrogénocarbonate HCO−3 .
❑ c. L’ion carbonate CO2− 3 est l’espece
` prédominante à pH = 7.
❑ d. Pour une solution aqueuse d’acide carbonique a` une concentration de 0, 01 M
le pH est supérieur à pKa1 .
❑ e. À pH = 6, 4 on a [H2CO 3 ] = [HCO−3 ].
D’après concours Nancy

65 On souhaite préparer 1 litre d’une solution tampon de pH compris entre 6, 9 et 7, 1. On


donne :
   
pK a NH+4 /NH 3 = 9, 2 pKa CH3COOH/CH3 COO− = 4, 8
   
pK a H 2PO −4 /HPO2−
4 = 7, 2 pKa HPO2−
4 /PO 3− = 12, 4
4

Cochez les mélanges suivants qui permettent d’obtenir cette solution tampon.
❑ a. 0, 02 mol de Na2 HPO4 et 0, 03 mol de NaH2PO4 .
❑ b. 0, 03 mol de Na2 HPO4 et 0, 02 mol de NaH2PO4 .
❑ c. 0, 05 mol de Na2 HPO4 et 0, 03 mol de HCl.
❑ d. 0, 05 mol de Na2 HPO4 et 0, 03 mol de NaOH.
❑ e. 0, 025 mol de NH3 et 0, 025 mol de CH3COOH.
D’après concours Nantes
42 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


66 On considère les couples acide/base suivants :
Acide/Base HF/F − HNO2 /NO−2 HClO/ClO −
pKa 3, 2 3, 3 7, 5
Acide/Base NH +4/NH3 H 2 S/HS − HS−/S 2−
pKa 9, 2 7, 1 12, 9
Parmi les les composés suivants, en solution aqueuse, cochez ceux qui donnent une solution
basique.
❑ a. Ca(OH) 2 ❑ b. NH4NO 2 ❑ c. NaHS ❑ d. HF ❑ e. NaClO
D’après concours Nantes

67 L’amphétamine a une masse molaire de 135 g.mol−1 et un pK a = 10. On considère que,


dans l’estomac, les sécrétions de HCl donnent un pH de 1.

Soit une solution A contenant 135 mg d’amphétamine dans 100 mL d’eau. Cochez la(ou les)
affirmation(s) exacte(s) :
❑ a. La concentration de la solution A d’amphétamine est de 10−3 mol.L−1 .
❑ b. La solution A d’amphétamine a un pH = 11.
❑ c. La solution A d’amphétamine a un pH = 6.
❑ d. Si la solution A est diluée par 10, on a la formule :
1
pH = 7 + (pKa + log C)
2
❑ e. L’amphétamine se retrouve dans l’estomac sous forme de chlorhydrate.
D’après concours Nantes

68 Choisissez la (les) proposition(s) correcte(s) concernant les composés azotés :

❑ a. La réaction de dissociation de l’ion ammonium dans l’eau s’ écrit :


NH3 + H2O  NH +4 + H2O.
❑ b. La réaction de dissociation de l’ammoniac dans l’eau s’écrit :
NH3 + H3O +  NH +4 + HO− .
❑ c. NH3 est un composé amphotère.
❑ d. L’ammoniac liquide peut réagir selon la réaction : 2NH3  NH +4 + NH −2 ; il
s’agit d’une réaction hétérolytique.
❑ e. Les espèces chimiques NH 3, NH2 et NH +4 ont le m ême nombre d’électrons.
D’après concours Nantes
UE 1 • énoncés 43

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


QCM n◦ 69 et 70 : Soit une base B dont la constante de basicité est K = 10−5 .
D’après concours Lille

69 On réalise une solution aqueuse 0, 05 M de B. Quel est le pH de la solution ?


❑ a. 12, 7 ❑ b. 11, 2 ❑ c. 10, 8 ❑ d. 8, 8 ❑ e. 7, 7
70 À un litre de la solution précédente, on ajoute sous un volume n égligeable 0, 05 mole
du chlorure NaCl. Quel est le pH de cette nouvelle solution ?
❑ a. 12, 7 ❑ b. 11, 2 ❑ c. 10, 9 ❑ d.8, 8 ❑ e. 7, 7
71 La phosphocréatine sert à régénérer l’ad énosine triphosphate (ATP) utilisé par la contrac-
tion musculaire. Sa formule non chargée est :

Sachant que les pKa des couples acido-basiques sont 2, 0 et 4, 5 pour le groupe phosphorique,
2, 7 pour la fonction carboxylique et 11, 0 pour le groupe guanidyle, cochez la (les) propo-
sition(s) correcte(s) concernant la forme prédominante de la phosphocreatine
´ à pH 7 dans
l’eau :

❑ a. Le zwittérion

❑ b. Le zwittérion

❑ c. Le zwittérion
44 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. L’ampholyte

❑ e. Aucune de ces quatre propositions n’est correcte.


D’après concours Paris 5

72 On considère les deux couples rédox suivants :


Zn2+ + 2 e − −→ Zn E ◦1 = −0, 76 V.
[Ag(NH3) 2] +
−→ Ag + 2 NH3 E ◦2 = 0, 373 V.
La réaction couplée ayant lieu spontanément sera :
❑ a. [Ag(NH3 ) 2 ]+ + Zn −→ Zn2+ + Ag + 2 NH3 .
❑ b. [Ag(NH3 ) 2 ]+ + Zn 2+ −→ Zn + 2 NH3 + Ag +.
❑ c. 2 [Ag(NH3 )2 ]+ + Zn −→ Zn2+ + 2 Ag + 2 NH 3.
❑ d. Zn2+ + 2 Ag + 4 NH 3 −→ Zn + 2 [Ag(NH3) 2 ]+
❑ e. 2 [Ag(NH3 )2 ]+ + Zn −→ Zn2+ + 2 Ag + 4 NH 3.
D’après concours Brest

73 Le diiode peut être préparé à partir d’ions iodate IO−3 selon la r éaction :
2IO−3 + 5HSO−3 + 2H 2O  I 2 + 5SO2−
4 + 3H3 O
+

o ù interviennent les couples IO−3 /I2 (iodate/diiode)


et SO2−
4 /HSO3 (sulfate/hydrog énosulfite).

Choisissez la (les) proposition(s) correcte(s) :


❑ a. La réaction de synth èse du diiode est une réaction acide-base.
❑ b. La réaction de synth èse du diiode est une réaction d’oxydoréduction.
❑ c. L’addition d’acide aura un effet défavorable sur la production de diiode.
❑ d. L’addition d’une base n’aura pour effet que de neutraliser le milieu réactionnel.
❑ e. Le potentiel du couple IO−3 /I 2 est inférieur au potentiel du couple SO2− −
4 /HSO3
dans les conditions de la réaction favorable.
D’après concours Nantes

74 On prépare 1, 00 litre d’une solution aqueuse contenant :


0, 10 mole de Br−CH2 COONa, 0, 15 mole de HCl, 0, 10 mole de NaOH et 0, 35 mole de
NaCl.
On donne pKa (Br−CH2 COOH / Br−CH2 COO− ) = 2, 7.
Parmi les affirmations suivantes, laquelle ou lesquelles sont exactes ?
UE 1 • énoncés 45

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. La solution obtenue est acide, avec pH = 2, 7.
❑ b. La solution obtenue est basique, avec pH = 9, 7.
❑ c. On obtient une solution tampon avec pH = pKa du couple Br−CH 2COOH /
Br−CH2 COO−.
❑ d. On obtient une solution neutre, avec pH = 7.
❑ e. Aucune de ces propositions n’est exacte.
D’après concours Dijon

75 Quelle(s) est (sont) la (les) proposition(s) exacte(s) parmi les suivantes ?


❑ a. La somme algébrique des nombres (ou degr és) d’oxydation des différents
éléments présents dans une espèce chimique non chargée est égale à zéro.
❑ b. L’électrode standard à hydrog ène a un potentiel égal à zéro si : p(H2) = 1 atm
et [H3 O +] = 1 mol.L−1 .
❑ c. Le fluor est le réducteur le plus puissant.
❑ d. Une oxydation correspond à une diminution du nombre (ou degré) d’oxydation.
❑ e. Le nombre (ou degré) d’oxydation d’un corps simple est nul.
D’après concours Limoges

76 Soit la série des composés suivants de l’azote : N 2 , NO, HNO2 et NO −3 . Parmi les pro-
positions suivantes donnant respectivement les nombres (ou degrés) d’oxydation de l’azote
dans ces différentes espèces, indiquez la proposition correcte.
❑ a. +I, +II, +III, +IV ❑ b. +I, +II, +III, +V
❑ c. 0, +II, +III, +V ❑ d. 0, +II, +IV, +V
❑ e. 0, +II, +III, +IV
D’après concours Limoges

77 Parmi les quatre réactions représent ées ci-dessous, quelle(s) est(sont) la(les) réaction(s)
r édox ?
❑ a. Fe3+ + 2 H 2O −→ Fe(OH) 2+ + H 3 O+
❑ b. 2 I − + 2 Fe 3+ −→ I2 + 2 Fe2+
❑ c. NH3 + HCHO −→ H2N − CH 2 − OH
❑ d. CH4 + Cl2 −→ CH3Cl + HCl
❑ e. Aucune de ces propositions n’est exacte.
D’après concours Dijon

2. Chimie organique
Sructure, nomenclature, isomérie et réactivité

78 Soit la molécule suivante :


46 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Parmi les propositions suivantes concernant le nom de la mol écule en nomenclature interna-
tionale, cochez la (les) proposition(s) exacte(s) :
❑ a. 6-propyl-3, 8-diméthylnonane
❑ b. 3-tert-butyl-2, 6-diméthyloctane
❑ c. 6-(1-méthyléthyl)-3, 8-diméthylnonane
❑ d. 4-propyl-2, 7-diméthylnonane
❑ e. Aucune de ces propositions n’est exacte.
D’après concours Brest

79 D’après les règles de la nomenclature officielle, quel est le nom du compos é suivant :
HOCH2 −CHOH−CHCl−CHOH−CHO ?
❑ a. 4-chloro-3, 5, 6-trihydroxyhexanal
❑ b. 3-chloro-1, 2, 3-trihydroxypentanol
❑ c. 3-chloro-2, 4, 5-trihydroxypentanal
❑ d. 3-chloro-1, 2, 4-trihydroxypentanal
❑ e. 3-chloro-2, 4, 5-trihydroxypentanol
D’après concours Créteil

80 Cochez la (les) proposition(s) correcte(s) concernant la créatinine dont la formule est :

❑ a. Le cycle de la créatinine est aromatique.


❑ b. Tous les atomes de carbone et d’azote sont hybridés sp 2.
❑ c. La forme tautomère

est aromatique.
❑ d. Le squelette σ du cycle de la créatinine est plan.
❑ e. Aucune de ces propositions n’est correcte.
D’après concours Paris 5
UE 1 • énoncés 47

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


81 La spongiacystéine a été isolée d’une éponge marine, elle possède la structure suivante :

❑ a. La spongiacystéine possède quatre atomes de carbone asym étriques.


❑ b. La spongiacystéine renferme deux fonctions alcool tertiaire.
❑ c. La spongiacystéine renferme une fonction amide secondaire.
❑ d. La spongiacystéine renferme une fonction thio éther.
❑ e. La spongiacystéine renferme une fonction cetone.
´
D’après concours Nantes

82 Concernant les deux formes de la molécule suivante, indiquer la (les) proposition(s)


exacte(s).

❑ a. Le composé 1 possède une fonction aldéhyde.


❑ b. L’atome de chlore exerce un effet mésomère attracteur -M.
❑ c. Les formes 1 et 2 sont deux formes tautomères.
❑ d. La forme 2 est la forme limite de résonance de 1 qui correspond à la
délocalisation maximale des électrons.
❑ e. Le composé 1 est la 3-chloro-2-éthylbut-2-enone.
´
D’après concours Limoges

83 Concernant le propène, quelle est la proposition exacte ?


❑ a. Tous les atomes sont coplanaires.
❑ b. La molécule est le siège d’un phénomène de résonance.
❑ c. L’effet inductif +I du groupement méthyle entraı̂ne une polarisation de la
double liaison.
❑ d. Toutes les liaisons présentent une libre rotation.
❑ e. Il existe un effet mésomère dont la force motrice est l’effet +I du groupement
méthyle.
D’après concours Dijon
48 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


84 Quelle est la proposition exacte ?
❑ a. Dans une liaison polarisée, la densité électronique est plus forte du côté de
l’atome le plus électropositif.
❑ b. Les atomes d’halogène n’ont pas d’effet inductif.
❑ c. L’effet inductif donneur d’électron stabilise les carbocations.
❑ d. L’effet mésom`ere ne se manifeste que dans les di ènes.
❑ e. Le 6-méthylhepta-2, 4-diène ne pr ésente pas d’effet mésomère.
D’après concours Dijon

85 Classez les conformères suivants par stabilité croissante :

❑ a. 3, 4, 5, 6 ❑ b. 3, 5, 6, 4 ❑ c. 3, 6, 4, 5 ❑ d. 6, 3, 5, 4
❑ e. 6, 5, 4, 3
D’après concours Lille

QCM n◦ 86 et 87 : La forme non cyclique du D-ribose est :

D’après concours Paris 5


86 Cochez la (les) proposition(s) correcte(s) concernant le D-ribose :
❑ a. Le ribose poss ède un plan de symétrie.
❑ b.

est une représentation de Cram du D-ribose.


❑ c.
UE 1 • énoncés 49

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


est une représentation de Cram du D-ribose.
❑ d.

est un sucre de série L.


❑ e. Aucune de ces quatre propositions n’est correcte.
D’après concours Paris 5

87 Cochez la (les) proposition(s) correcte(s) concernant la relation entre le D-ribose et


certains isomères :

❑ a. 7 est un stéréoisomère du D-ribose.


❑ b. 8 est un diastéréoisomère du D-ribose.
❑ c. 9 est un énantiomère du D-ribose.
❑ d. 10 est un diaster´ éoisomère du D-ribose.
❑ e. Aucune de ces quatre propositions n’est correcte.

88 Parmi les affirmations suivantes, laquelle (lesquelles) est (sont) vraie(s) ?


❑ a. Une molécule dextrogyre est une molécule qui d évie la lumière polarisée vers
la droite et la valeur de son pouvoir rotatoire sp´
ecifique est n égative.
❑ b. Une molécule lévogyre poss ède la configuration absolue S et dévie la lumière
polarisée vers la gauche.
❑ c. Un composé ayant trois atomes de carbone asymétriques possède au maximum
six isomères.
❑ d. Une molécule poss édant deux atomes de carbone asymétriques est toujours
chirale.
❑ e. Deux isomères de position possèdent la même chaˆıne hydrocarbonée et les
mêmes fonctions.
50 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


D’après concours Dijon

89 Parmi les cinq structures suivantes, laquelle (lesquelles) est (sont) chirale(s) ?
❑ b.
❑ a.

❑ c.
❑ d. ❑ e.

D’après concours Lyon


90 Soit les trois composés suivants :

Parmi les propositions suivantes, cochez la (les) proposition(s) exacte(s) :

❑ a. Les 3 composés présentent une isomérie géométrique.


❑ b. Le composé 11 est un isomère cis.
❑ c. Le composé 12 est un isomère E ou trans.
❑ d. Le composé 13 poss ède une activité optique.
❑ e. Le composé 11 est chiral.
D’après concours Brest

91 Parmi les cinq structures suivantes, laquelle (lesquelles) représente(nt) l’énantiomère


du composé :
UE 1 • énoncés 51

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. ❑ b. ❑ c.

❑ d. ❑ e.

D’après concours Lyon


92 La guanosine-3’, 5’-monophosphate cyclique ou GMP cyclique (notée GMPc) est synthétisée
par les guanylate cyclases à partir du GTP et a pour formule :

Les configurations absolues des atomes de carbone numérotés (C1), (C2) et (C4) du ribofu-
ranose de GMPc sont respectivement :
❑ a. S, S et S. ❑ b. S, S et R. ❑ c. R, S et R.
❑ d. R, R et S. ❑ e. R, R et R.
D’après concours Paris 5

93 Concernant les molécules suivantes 1 et 2, indiquez la (les) proposition(s) exacte(s).

❑ a. Le composé 15 est la représentation exacte du composé 14 en projection de


Fisher.
❑ b. Le composé 14 est une représentation de Cram de la (2S)-leucine.
❑ c. Le composé 15 est de configuration L selon la projection de Fisher.
❑ d. La configuration du composé 15 permet de déduire le signe du pouvoir rotatoire
spécifique de ce composé.
❑ e. Le composé 14 est l’acide (2S)-4-amino-2-méthylbutanoı̈que.
D’après concours Limoges
52 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


QCM n◦ 94 et 95 : Parmi les structures suivantes :

D’après concours Lille

94 Identifiez la proposition qui associe deux diastéréoisomères.


❑ a. 16 et 17 ❑ b. 16 et 19 ❑ c. 17 et 19
❑ d. 18 et 20 ❑ e. 16 et 20

95 Identifiez la proposition qui associe deux énantiomères.


❑ a. 16 et 17 ❑ b. 16 et 19 ❑ c. 17 et 19
❑ d. 18 et 20 ❑ e. 16 et 20

D’après concours Limoges

96 Indiquez la (les) proposition(s) exacte(s).


❑ a. 21 et 22 sont isomères de conformation.
❑ b. 21 et 23 sont énantiomères.
❑ c. 21 et 24 sont diastéreoisom
´ ères.
❑ d. 21 et 24 sont énantiomères.
❑ e. 21 est de configuration 3R, 4R.

97 L’action de KCN dans le DMSO sur le composé 21 permet d’obtenir le composé 25,
indiquez la (les) proposition(s) exacte(s).
❑ a. La réaction est une réaction de substitution nucléophile de type 1 (SN 1).
❑ b. La réaction a lieu en une seule étape.
UE 1 • énoncés 53

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. Le DMSO est un solvant aprotique qui favorise la solvatation du cation K+ et
facilite ainsi la libération de l’anion CN− .
❑ d. L’anion nucléophile CN− attaque du même côté que celui du groupement par-
tant Br− .
❑ e. Le composé 25 obtenu possède une fonction nitrile.

Réactions en chimie organique


98 La synthèse des hormones thyroı̈diennes comporte une étape d’iodation de la tyrosine,
fixation de l’iode sur le noyau benzénique de l’acide aminé. Choisissez la (les) proposition(s)
correcte(s).
❑ a. Il s’agit d’une réaction de substitution.
❑ b. Il s’agit d’une réaction d’addition.
❑ c. Il s’agit d’une réaction d’élimination.
❑ d. Le mécanisme de cette r éaction peut être qualifié de nucléophile.
❑ e. Le mécanisme de cette r éaction peut être qualifié d’électrophile.
D’après concours Nantes

99 Quelle(s) est (sont) la (les) les propositions correcte(s) concernant les fonctions amine
et amide ?
❑ a. Les amines sont nucléophiles.
❑ b. Il existe trois classes d’amines selon le degré de substitution de l’atome d’azote.
❑ c. La fonction amide n’est pas ionisée au pH physiologique.
❑ d. La fonction amide n’est pas hydrolysable.
❑ e. La fonction amide donne lieu au phénom ène de résonance.
D’après concours Nantes

100 Soit la réaction suivante :

Quelle(s) est (sont) la (les) proposition(s) exacte(s) ?


❑ a. La réaction est une réaction d’addition nucléophile.
❑ b. Le composé majoritaire obtenu est le 2-chloro-1-méthoxypropane.
❑ c. Le groupement OCH3 possède un effet m ésomère donneur.
❑ d. Le produit de départ est le 3-methoxyprop-2-
´ ène.
❑ e. Il est possible d’écrire une autre forme limite pour le produit de départ.
D’après concours Nantes

101 Soit la réaction suivante, quelle(s) est (sont) la (les) proposition(s) exacte(s) concer-
nant le produit obtenu ?
54 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. Il est obtenu par réaction de type addition électrophile.
❑ b. Il ne possède pas d’atome de carbone asymétrique.
❑ c. Il s’agit du 2-bromo-3-éthylpentane.
❑ d. Il s’agit du 1-méthyl-1-éthyl-1-bromopropane.
❑ e. Il s’agit du 3-bromo-3-méthylpentane.
D’après concours Dijon

102 Qu’obtient-on lors de la réaction suivante :


(Z) but-2-ène + OsO4 (puis hydrolyse si nécessaire)

❑ a. ❑ b. ❑ c.

❑ d. ❑ e.

D’après concours Lille


103 Soit la réaction suivante :

29 est optiquement actif et 30 peut additionner une molécule de dihydrogène. Indiquez la


(les) proposition(s) correcte(s).
❑ a. La réaction qui conduit à 29 est une SN 2.
❑ b. La réaction qui conduit à 30 est une E1.
❑ c. Le mécanisme qui permet d’obtenir 29 et 30 passe par un intermédiaire
carbocation.
❑ d. Avec du tertiobutylate de potassium (CH3 )3 CO , K⊕ à la place de l’ éthanolate
de sodium, on obtient uniquement le composé 30.
❑ e. Le composé 30 poss ède une stéréochimie E.
D’après concours Nantes
UE 1 • énoncés 55

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


104 Concernant la réaction entre le 3-bromo-3-méthylhexane de configuration absolue S
et la soude (NaOH) pour donner un alcool majoritaire et un alcène minoritaire, quelle(s) est
(sont) la (les) proposition(s) exacte(s) ?
❑ a. Il s’agit d’une réaction de type SN 2 et l’alcool obtenu est de configuration S.
❑ b. L’alcool est obtenu par une réaction de type SN 1 et l’alcène par une réaction de
type E2.
❑ c. L’alcool est obtenu par une réaction de type SN 1 sous la forme d’un énantiomère
de configuration R.
❑ d. L’alcool est obtenu par une reaction
´ de type S N1 sous la forme d’un mélange
racémique.
❑ e. Dans cette réaction, S N1 et E1 sont les deux mécanismes mis en jeu.
D’après concours Dijon

105 Quelle(s) est (sont) la (les) proposition(s) exacte(s) concernant les réactions d’élimination
E1 ?
1. Elles font intervenir un intermédiaire identique à celui des réactions S N 1.
2. Elles sont stéréosélectives et donnent des dériv és soit Z, soit E.
3. Elles sont favorisées par le départ d’un bon nucléofuge.
4. Elles s’effectuent facilement sur des dérivés halogén és tertiaires.

❑ a. 1, 2, 3, 4 ❑ b. 2, 4 ❑ c. 2, 3
❑ d. 4 ❑ e. 1, 3, 4
D’après concours Lille

QCM n◦106 à 108 :

H2 O 32 (réaction 1)

R HBr, peroxyde
1
CH3 33 (réaction 2 : E2) 34 (réaction 3)
H3 C Cl CH3
CH3
31

D’après concours Limoges

106 Concernant la réaction 1, indiquez la (les) proposition(s) exacte(s).


❑ a. Le composé 31 est le (1R)-1-isopropyl-1-chloro-1-ph ényléthane.
❑ b. La réaction 1 est une réaction bimoléculaire de type SN1.
❑ c. La réaction 1 a lieu via un intermédiaire carbocationique.
❑ d. Dans la réaction 1, l’eau joue a` la fois le r ôle de réactif nucléophile et de solvant
protique.
❑ e. La réaction 1 permet d’obtenir le 3, 3-diméthyl-2-phénylbutan-2-ol sous forme
d’un mélange racémique.
56 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


107 Concernant la réaction 2, indiquez la (les) proposition(s) exacte(s).
❑ a. L’équation de vitesse de la réaction 2 obéit à la loi suivante :
v = k[substrat].[réactif].
❑ b. La réaction 2 se déroule selon un mécanisme concerté.
❑ c. Le réactif R1 peut être de l’acide chlorhydrique concentr é.
❑ d. Le réactif R1 peut être de la soude concentr ée.
❑ e. Le composé 33 est un alcyne.

108 Concernant la réaction 3, indiquez la (les) proposition(s) exacte(s).


❑ a. La réaction 3 est une addition ionique électrophile.
❑ b. La réaction 3 a lieu selon un processus homolytique.
❑ c. La réaction 3 obéit à la règle de Markovnikov.
❑ d. La réaction 3 permet d’obtenir le 1-bromo-3, 3-diméthyl-2-phénylbutane.
❑ e. La réaction 3 permet d’obtenir le 2-bromo-3, 3-diméthyl-2-phénylbutane.

109 Quel est le composé obtenu après action de l’acide 2-m éthylpropanoı̈que sur le propan-
2-ol ?
❑ a.

❑ b.

❑ c.

❑ d.

❑ e.

D’après concours Créteil


UE 1 • énoncés 57

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


110 Soit la réaction suivante :

Quelle(s) est (sont) la (les) proposition(s) correcte(s) ?


❑ a. Le composé 35 est le bromure d’allyle.
❑ b. 35 possède une st éréochimie E au niveau de sa double liaison.
❑ c. La première étape consiste en la formation d’un organomagn´esien.
❑ d. Le produit formé 36 est un alcoolate.
❑ e. 36 possède un atome de carbone asymétrique.
D’après concours Nantes

QCM n◦ 111 à 113 : Soit la séquence réactionnelle suivante :

Parmi les composés suivants :

D’après concours Créteil

111 Quelle est la formule de 37 ?

❑ a. ❑ b. ❑ c. ❑ d. ❑ e.
112 Quelle est la formule de 38 ?
❑ a. ❑ b. ❑ c. ❑ d. ❑ e.
58 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


113 Quelle est la formule de 39 ?
❑ a. ❑ b. ❑ c. ❑ d. ❑ e.
114 Laquelle (lesquelles) de ces propositions concernant la molécule 40 ci-dessous est
(sont) exacte(s) ?

❑ a. La structure suivante est une forme mésomere


` de 40 :

❑ b. La structure suivante est une forme mésomere


` de 40 :

❑ c. 40 peut être obtenue par réaction entre la N, N-diméthylméthanamine (ou


triméthylamine) et la propanone (ou acétone) en milieu H⊕ catalytique.
❑ d. 40 contient une double liaison stéréogène.
❑ e. La structure suivante est une forme tautomère de 40 :

D’après concours Lyon

115 Les propositions suivantes concernent les réactions ci-dessous. Laquelle (lesquelles)
est (sont) exacte(s) ?
UE 1 • énoncés 59

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. Le composé 41 est un ester.
❑ b. Le composé 41 est un amide.
❑ c. Le composé 41 poss ède la structure suivante :

❑ d. Le composé 42 est une amine.


❑ e. Le composé 42 poss ède la structure suivante :

D’après concours Lyon

116 La transformation biologique d’un aldéhyde en thioester se déroule en deux étapes


indiquées dans le schéma ci-dessous :

NAD + = Nicotinamide Ad énine Dinucléotide sous sa forme oxydée.


Parmi les affirmations suivantes, laquelle (lesquelles) est (sont) exacte(s) ?
❑ a. La première étape est une addition nucléophile du thiol sur l’ald éhyde.
❑ b. La première étape correspond à une substitution nucléophile.
❑ c. La deuxième étape correspond à une réaction d’oxydation de l’h émithioacétal
par le NAD+ .
❑ d. La deuxième étape correspond à une réaction de r éduction de l’h émithioacétal
par le NAD+ .
❑ e. Aucune de ces propositions n’est exacte.
D’après concours Dijon

117 Qu’obtient-on quand on fait réagir l’époxyde ci-dessous avec de l’éthanol en milieu
acide ?
60 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


D’après concours Lille

3. Biochimie
Glucides
Niveau facile

118 Concernant la structure des oses :


❑ a. Le glucose est un céto-hexose.
❑ b. Le fructose est un céto-hexose.
❑ c. Le glucose sous forme pyranique possède deux carbones asymétriques
supplémentaires par rapport à la forme linéaire.
❑ d. Dans la cellulose, les molécules de glucose sont reliées par des liaisons α1-4.
❑ e. Dans le glycogène, les mol écules de glucose sont reliées par des liaisons α1-4
ou α1-6.
D’après concours Paris 6

119 Considérant les 4 structures suivantes :


UE 1 • énoncés 61

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. (1) et (2) sont enantiom
´ ères.
❑ b. (3) et (4) sont epim
´ ères.
❑ c. (4) est le β-L-Glc.
❑ d. L’anomère β de (3) est pr ésent dans le lactose.
❑ e. (3) et (4) sont anomères.
D’après concours Paris 11

120 L’amidon est un polysaccharide. Quelle est la proposition exacte :


❑ a. Il est composé de glucose et de fructose.
❑ b. Il est composé d’amylose et d’amylopectine.
❑ c. Il est composé de glucose et de galactose.
❑ d. Il est composé uniquement de maltose.
❑ e. Autre réponse.
D’après concours Strasbourg

121 Le glucose et le fructose sont des hexoses. Quelle est la proposition fausse ?
❑ a. Ils ont la même formule chimique, ainsi que le même poids moléculaire.
❑ b. En solution aqueuse, ils peuvent se retrouver sous forme linéaire, pyranosique
ou furanosique.
❑ c. Ils ont le même nombre de carbone(s) asymetrique(s).
´
❑ d. Ils peuvent s’associer pour donner un disaccharide.
❑ e. Autre réponse.
D’après concours Strasbourg

122 Indiquez la proposition exacte :


❑ a. Le glucose est un sucre comprenant 6 fonctions alcool et un groupement
aldéhydique.
❑ b. Le saccharose est un sucre réducteur.
❑ c. La liaison osidique est caractéristique des polysaccharides.
❑ d. L’isoamylose est un polysaccharide linéaire.
❑ e. Autre réponse.
D’après concours Strasbourg
62 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


123 L’amidon :
❑ a. est constitué d’alpha-amylose et d’amylopectine.
❑ b. ne forme pas de micelles dans l’eau à température ambiante.
❑ c. est constitué d’alpha-D-glucose sous forme pyranose.
❑ d. épaissit les sauces  Béchamel  lors de leur chauffage par formation de mul-
tiples liaisons de type hydrog`
ene avec l’eau.
❑ e. est constitué de polymères comportant des liaisons osidiques alpha (1-4) et al-
pha (1-6).
D’après concours Nancy

124 À propos des sucres, soit le mannose X :

❑ a. Le mannose est un aldopentose.


❑ b. X est le D-mannose.
❑ c. Y est une forme anomère α.
❑ d. Y est la forme pyranose de X.
❑ e. Le mannose peut exister sous 2 formes anomères grâce à la mutarotation.
D’après concours Nancy

125 Parmi les molécules suivantes, indiquez le (les) épimère(s) du glucose :


❑ a. Mannose. ❑ b. Fructose. ❑ c. Ribose. ❑ d. Galactose.
❑ e. Xylose.
D’après concours Rouen

126 Parmi les propositions suivantes, indiquez la (les) proposition(s) exacte(s) :


❑ a. Le saccharose est composé uniquement de molécules de glucose.
❑ b. Le saccharose contient du fructose.
❑ c. Le lactose contient du fructose.
❑ d. Le galactose contient du glucose.
❑ e. Le glycogène est composé uniquement de molecules
´ de glucose.
D’après concours Rouen
UE 1 • énoncés 63

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Niveau intermédiaire

127 Cochez la (ou les) réponse(s) exacte(s).


❑ a. Les glycoprotéines possèdent une (ou plusieurs) cha ı̂ne glycanique liée par des
liaisons non covalentes.
❑ b. Le mécanisme d’action des lectines met en jeu l’interaction de la cha ı̂ne glyca-
nique d’une glycoprotéine avec une protéine.
❑ c. De nombreuses proteines
´ membranaires sont des glycoprotéines.
❑ d. Dans une structure de type bi-antennée, le glycane est lié par son extrémité non
réductrice.
❑ e. Les sucres des glycanes des glycoprotéines sont souvent utilisés par la cellule
comme signaux de reconnaissance.
D’après concours Lille

128 Concernant les oses :


❑ a. Les osidases sont spécifiques d’un type de liaison osidique (par exemple α1-4
ou β1-3).
❑ b. La cellulose est une molécule ramifiee.´
❑ c. L’acide hyaluronique est une molécule hydrophobe.
❑ d. Lors de la digestion, la dégradation de l’amidon en glucose requiert une unique
osidase.
❑ e. Le lactose est formé d’une molecule
´ de galactose et d’une molécule de glucose.
D’après concours Paris 6

129 Concernant les glucides alimentaires :


❑ a. Le saccharose est formé d’une molécule de glucose et d’une molécule de
fructose.
❑ b. L’amidon est un polymère de molécules de glucose reli ées entre elles dans la
chaı̂ne principale par des liaisons béta 1-4.
❑ c. Le fructose est un cétohexose.
❑ d. La principale source de glucides alimentaires est le glucose libre.
❑ e. Le lactose est hydrolysé en glucose et galactose par une béta 1-4 galactosidase.
D’après concours Paris 6

130 Soit les monosaccharides (1) et (2).


64 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. (1) a une conformation en chaise 1 C4 .
❑ b. (1) est du D-Glc.
❑ c. (1) et (2) sont chacun des anomères β.
❑ d. (2) est l’énantiomère du L-ribose.
❑ e. Aucune réponse exacte.
D’après concours Paris 11

131 Les osides :

❑ a. Le sucre représenté ci-dessus est un disaccharide réducteur.


❑ b. L’Homme possède les enzymes nécessaires à la dégradation de l’amidon.
❑ c. La chitine est constituée d’unités saccharidiques associées par des liaisons β1-6.
❑ d. Le sucre représenté ci-dessus peut être hydrolysé par une lactase.
❑ e. Aucune proposition exacte.
D’après concours Paris 11

132 Cette molécule :

❑ a. Est un épim ère du glucose, dont il diffère par la configuration du carbone 4.


❑ b. La forme représentée ici est l’anomère alpha.
❑ c. La substitution d’une fonction hydroxyle par une amine permet d’obtenir une
mannosamine.
❑ d. Peut être libérée à partir du lactose sous l’effet d’une beta-galactosidase.
❑ e. Est stockée dans l’organisme humain sous forme de glycog ène.
D’après concours Rouen

Niveau difficile

133 Cochez la (ou les) réponse(s) exacte(s).


❑ a. L’amidon est une forme de réserve de glucose présente dans les tissus humains.
❑ b. L’amylopectine est un polymère ramifié.
UE 1 • énoncés 65

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. Le glycogène contient des molécules de glucose toutes reliées entre elles par
des liaisons béta 1 → 4.
❑ d. L’intestin ne peut dégrader la cellulose car la muqueuse intestinale humaine ne
possède pas de béta-glucosidase.
❑ e. Une molécule de glycogène possède plusieurs extrémit és réductrices.
D’après concours Lille

134 Parmi les propositions suivantes, indiquez celle qui est exacte.

❑ a. Glc-1P et Glc-6P sont interchangeables par mutarotation.


❑ b. La réaction du D-Glc avec la liqueur de Fehling conduit au composé ci-dessus.
❑ c. La chitine est un polymère d’acide uronique.
❑ d. Le tréhalose est un disaccharide réducteur.
❑ e. Les bactéries dégradent la cellulose en maltose.
D’après concours Paris 11

135 Soit l’oligosaccharide suivant :

❑ a. Il est hydrolysable par une alpha amylase.


❑ b. C’est un sucre non reducteur.
´
❑ c. Les résidus qui composent (a) sont dans la conformation bateau 1 C4.
❑ d. Il est hydrolysable par une β 1-4 glucosidase.
❑ e. Il est un produit de dégradation de la cellulose.
D’après concours Paris 11
66 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


136 A propos du raffinose, triholoside d’origine veg
´ étale dont l’appellation est :
α-D-galactopyranosyl-(1-6)-α-D-glucopyranosyl-(1-2)-β-D-fructofuranoside :
❑ a. C’est un triholoside réducteur.
❑ b. Son hydrolyse par une b-fructosidase libère une molécule de lactose.
❑ c. Son hydrolyse par une α-galactosidase libère une molécule de saccharose.
❑ d. Après perméthylation suivie d’une hydrolyse acide on retrouve entre autres du
2, 3, 4, 6 tétra-O-méthyl-D-galactopyranose.
❑ e. Après perméthylation suivie d’une hydrolyse acide on retrouve entre autres du
1, 2, 4, 6 tétra-O-méthyl-D-fructofuranose.
D’après concours Montpellier I

137 La partie aglycone d’un hétéroside :


❑ a. Possède la propriété de réduire les sels m étalliques.
❑ b. Correspond à la partie non-glucidique de cet hetéroside.
´
❑ c. Est represent
´ ée par les bases et les phosphates dans le cas des acides nucléiques.
❑ d. Correspond aux tanins pour l’amygdaline.
❑ e. Ne peut en aucun cas être de l’acide cyanhydrique.
D’après concours Nancy

Acides aminés
Niveau facile

138 Parmi les acides aminés qui suivent, lequel(lesquels) poss ède(nt) une fonction alcool ?

❑ a. Alanine. ❑ b. Thréonine. ❑ c. Proline.


❑ d. Tyrosine. ❑ e. Lysine.
D’après concours Lille

139 Cochez la (ou les) réponse(s) exacte(s).


❑ a. Les acides aminés sont les constituants élémentaires des proteines.
´
❑ b. Tous les acides aminés possèdent une fonction carboxyle.
❑ c. La phénylalanine est un acide aminé hydrophile.
❑ d. La sérine est un acide aminé hydrophobe.
❑ e. La lysine est un acide aminé basique.
D’après concours Lille

140 Concernant les structures des acides aminés :


❑ a. La phénylalanine possède un noyau phénol.
❑ b. Le tryptophane poss ède un noyau indole.
❑ c. L’histidine ne possède pas de noyau aromatique.
UE 1 • énoncés 67

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. La tyrosine possède un groupement benzène.
❑ e. La méthionine poss ède un groupement thioéther.
D’après concours Dijon

141 Concernant les acides aminés naturels :


❑ a. Les acides aminés sont incolores.
❑ b. La leucine est un acide aminé indispensable.
❑ c. La chaˆıne latérale de la glycine est un atome d’hydrogène.
❑ d. La valine est un acide aminé aliphatique.
❑ e. La lysine porte deux groupements NH2.
D’après concours Rouen

142 Dans une chromatographie sur une résine échangeuse de cations, quels sont parmi les
acides aminés suivants ceux qui sont retenus par la colonne à pH 6 ?
❑ a. Acide glutamique.
❑ b. Histidine.
❑ c. Lysine.
❑ d. Acide aspartique.
❑ e. Arginine.
D’après concours Rouen

143 Concernant les acides aminés naturels :


❑ a. Tous les acides aminés ont un carbone asymétrique.
❑ b. Les acides aminés protéinog ènes sont des acides gamma aminés.
❑ c. L’alanine est le plus petit acide aminé protéinog ène.
❑ d. Le tryptophane absorbe la lumière à 280 nm.
❑ e. L’isoleucine est un acide aminé essentiel.
D’après concours Rouen

144 Quelle est la proposition exacte ?


❑ a. Valine, leucine et isoleucine sont des acides aminés polaires non ionisables.
❑ b. Les protéines qui sont formées entre autres de s érine et de thréonine peuvent
être glycosylées ou phosphorylées.
❑ c. Certaines sérines peuvent être glycosylées avant d’être intégrées dans les
protéines au moment de l’étape de traduction.
❑ d. Dans les protéines, les boucles sont essentiellement constitués d’acides aminés
fortement hydrophobes.
❑ e. Autre r éponse.
D’après concours Strasbourg
68 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


145 Concernant la méthionine :
❑ a. Sa chaı̂ne latérale est polaire.
❑ b. Elle ne contient pas de carbone asymétrique.
❑ c. C’est après un résidu de méthionine qu’une chaı̂ne polypeptidique est coup ée
par le bromure de cyanogène.
❑ d. Elle peut former un pont disulfure avec un r´
esidu de cyst éine.
❑ e. Elle contient un atome de soufre.
D’après concours Paris 6

146 À propos des acides aminés :


❑ a. Les acides aminés sont les constituants de base des protéines.
❑ b. La configuration du carbone alpha permet d’obtenir deux isomères : L et D.
❑ c. Les acides aminés sont des acides protoniques forts.
❑ d. Les acides aminés ne sont pas ionisables.
❑ e. Les acides aminés sont des composés amphotères.
D’après concours Nancy

Niveau intermédiaire

147 Concernant l’acétylcholine :


❑ a. C’est le neurotransmetteur de la jonction neuro-musculaire.
❑ b. C’est un neurotransmetteur inhibiteur.
❑ c. Il possède une fonction ester.
❑ d. Il est produit dans le cerveau.
❑ e. Il agit comme neurotransmetteur dans le système nerveux orthosympathique.
D’après concours Lille

148 Soit la courbe de titration de l’acide glutamique :

❑ a. Le plateau 1 correspond au pKa de la fonction amine.


❑ b. Le point 4 correspond au point isoélectrique (pI).
UE 1 • énoncés 69

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. Le plateau 3 correspond au point isoélectrique (pI).
❑ d. La molécule d’acide glutamique porte deux charges négatives au niveau 5.
❑ e. L’acide glutamique est un acide aminé neutre à pH 7, 0.
D’après concours Paris 11

149 On considère les acides aminés suivants :

❑ a. La molécule de glycine possède un carbone asymétrique.


❑ b. À partir de la glycine et de l’alanine, on ne peut synthétiser qu’un seul dipeptide.
❑ c. À pH = 6, 1, l’alanine existe sous forme de zwitterion.
❑ d. Dans la molécule de glycine, le pKa2 de 9, 7 correspond à la fonction acide
carboxylique.
❑ e. À pH = 11, la glycine est majoritairement sous la forme d’un anion.
D’après concours Bordeaux

´ és d’acides aminés :


150 Concernant les acides aminés et deriv
❑ a. La tyrosine correspond à une molécule de phénylalanine hydroxyl ée.
❑ b. La thréonine est un acide amine´ soufré.
❑ c. Les hormones thyroı̈diennes dérivent de tyrosine iodées portées par la
thyroglobuline.
❑ d. La cystéine entre dans la composition du glutathion.
❑ e. La phénylcétonurie est une maladie liée à l’absence de phénylalanine hydroxy-
lase.
D’après concours Rouen

151 Quelles sont les propositions exactes ?


❑ a. Les acides amines
´ sont des mol écules amphotères qui possèdent un groupement
carboxyle acide et une fonction amine primaire basique.
❑ b. Le carbone alpha des acides aminés est d’hybridation sp2.
❑ c. À pH acide, les acides aminés sont sous forme d’anions.
❑ d. Les acides aminés sont hydrophiles.
❑ e. Autre réponse.
D’après concours Strasbourg
70 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


152 Concernant le métabolisme des acides aminés :
❑ a. La proline est synthétisée à partir de l’acide glutamique.
❑ b. La tyrosine est le précurseur de la dihydroxyphénylalanine.
❑ c. La méthionine remplit des fonctions de transfert de groupements soufr és par
l’intermédiaire du PAPS.
❑ d. Les acides aminés ramifiés sont tous des acides aminés cétogènes et
glucoformateurs.
❑ e. La mélatonine est synthétisée à partir de la tyrosine.
D’après concours Dijon

153 Indiquez la bonne association de propositions exactes :


1 : L’alanine présente une chaı̂ne latérale ramifiée.
2 : La leucine est un acide aminé hydrophobe.
3 : L’isoleucine possède 2 carbones asymétriques.
4 : L’isoleucine est nécessaire à la formation de l’hémoglobine.
5 : Le tryptophane est un acide aminé très présent dans la constitution des protéines.
6 : Le tryptophane est un acide aminé soufré.
❑ a. 1, 3, 6 ❑ b. 2, 3, 5 ❑ c. 2, 3, 4
❑ d. 3, 4, 6 ❑ e. 1, 2, 5
D’après concours Amiens

154 Indiquez la bonne association de propositions exactes :


1 : La serotonine
´ est obtenue par décarboxylation du tryptophane hydroxylé en position 5 du
benzène.
´
2 : La serotonine joue un rôle essentiel dans la biosynthèse de la m élanine.
3 : La lysine est un précurseur d’hormones thyroı̈diennes.
4 : La maladie de Basedow est caractérisée par une hyperthyroı̈die.
5 : L’hyperthyroı̈disme peut provoquer des changements du rythme cardiaque.
6 : L’histamine est une histidine carboxylée.

❑ a. 1, 4, 6 ❑ b. 4, 5, 6 ❑ c. 1, 2, 4
❑ d. 1, 4, 5 ❑ e. 1, 2, 6
D’après concours Amiens

Niveau difficile

155 Cochez la (ou les) réponse(s) exacte(s).


❑ a. L’histidine est un acide α-aminé polaire possédant un noyau imidazole sur la
chaı̂ne latérale.
❑ b. L’arginine est l’acide α-aminé le plus basique car il peut fixer 3 protons sur son
groupement guanidium.
UE 1 • énoncés 71

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. La lysine est un acide α-amin é indispensable à chaı̂ne latérale linéaire.
❑ d. Leucine et isoleucine sont des acides α-aminés hydrophobes ayant la même
formule brute.
❑ e. Aucune de ces propositions n’est exacte.

|
m
D’après concours Brest

o
c
t.
o
p
s
g
lo
.b
156 L’acide aminé ci-dessous :

s
in
c
e
d
e
m
s
e
rd
o
s
e
tr
e
/l
:/
p
tt
h
|
m
o
.c
s
s
re
p
rd
o
.w
s
in
c
e
d
e
❑ a. est le (2S)-Trp. m
s
e
rd
o
s

❑ b. contient deux carbones asymétriques.


e
tr
e
/l
:/

❑ c. présente un maximum d’absorption à 210 nm.


p
tt
h
|

❑ d. est le précurseur de l’histamine.


s
in
c
e
d

❑ e. est favorable à une structure secondaire en hélice α.


e
M
s
e
rD

D’après concours Paris 11


o
s
re
T
e
/L
s

157 Soit le peptide VDYKHG. Seuls sont protonés les 1e , 3 e, 4e et 5 e acides aminés. Parmi
p
u
ro

les domaines de pH suivants, lequel est compatible avec cette distribution de charge ?
/g
m
o
.c

❑ a. pH inférieur à 4. ❑ b. pH compris entre 5 et 6.


k
o
o
b
e

❑ c. pH compris entre 7 et 8. ❑ d. pH compris entre 9 et 10.


c
a
.f
w
w

❑ e. pH superieur
´ à 11.
w
|
s
in

D’après concours Paris 11


c
e
d
e
M
s
e

Lipides
rD
o
s
re
T
e

Niveau facile
/L
m
o
.c
k
o

158 Concernant les lipoprotéines :


o
b
e
c
a
.f

Les HDL permettent le transport du cholestérol de l’intestin vers les tissus


w

❑ a.
w
w

périph ériques.
|

❑ b. Les LDL sont plus denses que les chylomicrons.


❑ c. Les apolipoprotéines sont des lipides spécifiques se fixant sur les protéines.
❑ d. Dans le sang humain, le cholestérol est surtout sous forme estérifiée.
❑ e. Le  bon cholestérol  est le cholestérol des lipoprot éines qui ont subi des oxy-
dations.
D’après concours Brest
Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
72 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


159 Concernant les sphingolipidoses :
❑ a. Ce sont des maladies de stockage.
❑ b. Elles résultent d’un excès de synthèse des sphingolipides.
❑ c. Elles touchent particulièrement le sytème nerveux central.
❑ d. Elles peuvent être confirmées par la mise en évidence d’une augmentation de
l’activité de l’enzyme responsable sur des leucocytes ou fibroblastes.
❑ e. Elles incluent la maladie de Gaucher.
D’après concours Dijon

160 Une lipoprotéine contient :


❑ a. Un cœur hydrophobe et riche en proteines.
´
❑ b. Une surface hydrophile et riche en triglycérides.
❑ c. Du cholestérol non estérifié.
❑ d. Du cholestérol est érifié.
❑ e. Des phospholipides.
D’après concours Dijon

161 Concernant la sphingomyéline :


❑ a. C’est un constituant majeur de la moelle osseuse.
❑ b. C’est un glycérophospholipide.
❑ c. Elle est synthétisée à partir d’un céramide et d’une phosphatidylcholine.
❑ d. Elle sert de récepteur pour la toxine du cholera.´
❑ e. Elle peut être dégradée par la sphingomyélinase.
D’après concours Dijon

162 Chez l’homme, la formation de doubles liaisons sur les chaı̂nes carbonées des acides
gras est possible grâce aux désaturases suivantes :
❑ a. delta 5. ❑ b. delta 6. ❑ c. delta 9. ❑ d. delta 12.
❑ e. delta 15.
D’après concours Dijon

163 Les acides gras suivants possèdent 20 atomes de carbone :


❑ a. Acide eicosanoı̈que. ❑ b. Acide arachidique.
❑ c. Acide ol éique. ❑ d. Acide linole´ı̈que.
❑ e. Acide arachidonique.
D’après concours Dijon

164 Concernant les leucotriènes :


❑ a. Ce sont des molécules cycliques.
UE 1 • énoncés 73

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. Ils possèdent au moins trois doubles liaisons conjuguees.´
❑ c. Ils sont formés sous l’action de la 5-lipoxygénase.
❑ d. Ils ont des effets pro-inflammatoires.
❑ e. Ils sont biosynthétisés en particulier dans les leucocytes.
D’après concours Dijon

165 Concernant les triglycérides :


❑ a. Ce sont les constituants majoritaires des chylomicrons et des VLDL.
❑ b. Ils sont hydrophobes.
❑ c. Ils ont comme précurseur le 1, 2 diacylglycérol.
❑ d. Ils sont hydrolysés dans le compartiment intravasculaire par la lipase
hormonosensible.
❑ e. Ils sont chargés négativement.
D’après concours Dijon

166 Cochez la (ou les) réponse(s) exacte(s).


❑ a. Le cholestérol est une molécule amphipathique.
❑ b. De nombreux stéroı̈des exercent une fonction hormonale.
❑ c. Les acides biliaires sont des détergents libérés dans l’estomac.
❑ d. Le cholestérol régule la fluidité des membranes.
❑ e. La testostérone d érive d’un noyau à 18 carbones.
D’après concours Lille

167 Le cholestérol
❑ a. Est un sphingolipide constitué de 27 atomes de carbone.
❑ b. Transporte divers ions dans les membranes cellulaires.
❑ c. Est toujours estérifi é par un acide gras.
❑ d. Agit comme co-enzyme dans la formation d’AMPc.
❑ e. Est le précurseur des androgènes.
D’après concours Paris 11

168 Parmi les acides gras suivants, lequel est utilisé par la cyclo-oxygénase pour la synthèse
de la prostaglandine E3 ?
❑ a. C20 : 5∆5,8,11,14,17 ❑ b. C18 : 3∆ 6,9,12
❑ c. C18 : 3∆9,12,15 ❑ d. C20 : 3∆ 8,11,14
❑ e. C20 : 4∆5,8,11,14
D’après concours Paris 13
74 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Niveau intermédiaire

169 Cochez la (ou les) réponse(s) exacte(s).


❑ a. Le cholestérol poss ède un groupement hydroxyle en position 5.
❑ b. Le cholestérol est un pr écurseur de la vitamine D.
❑ c. L’oestradiol possède un méthyle sur le carbone 10.
❑ d. L’acide cholique possède 3 groupements hydroxyles.
❑ e. Le stigmastérol (un phytostérol) possède une double liaison entre les carbones
5 et 6.
D’après concours Brest

170 Concernant les propriétés de l’acide γ-linol énique :


❑ a. C’est un lipide complexe.
❑ b. Il appartient à la famille n-6.
❑ c. Il possède des doubles liaisons de type malonique.
❑ d. C’est un acide gras indispensable chez l’homme.
❑ e. Il peut etre
ˆ pr écurseur de l’acide arachidonique.
D’après concours Brest

171 Concernant les chylomicrons :


❑ a. Ils sont riches en triglycérides.
❑ b. Ils contiennent l’apolipoprotéine CH, cofacteur de la lipoprot éine lipase.
❑ c. Ils sont riches en cholestérol.
❑ d. Ils sont pauvres en phospholipides.
❑ e. Ils contiennent l’apolipoprotéine B48.
D’après concours Dijon

172 Concernant les globosides :


❑ a. Ce sont des glycosphingolipides.
❑ b. Ils comportent une chaı̂ne oligosaccharidique neutre.
❑ c. Ils portent les antigènes des groupes sanguins ABO.
❑ d. Ils nécessitent l’intervention de glycosyltransférases pour leur synthèse.
❑ e. Ils sont synthétisés à partir de glucocer´ ébroside.
D’après concours Dijon

173 Les triglycérides :


❑ a. Peuvent être impliqu és dans les maladies cardiovasculaires.
❑ b. ´
Ont un pouvoir energ étique meilleur que le glycogène.
❑ c. Sont des molécules hydrophobes.
UE 1 • énoncés 75

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Représentent le constituant majeur des chylomicrons et des VLDL.
❑ e. Sont hydrolysés au sein de l’adipocyte en période postprandiale en raison d’une
activation de la lipase hormonosensible.
D’après concours Dijon

174 Les microdomaines lipidiques :


❑ a. Sont riches en cholestérol et sphingolipides.
❑ b. Jouent un rôle important dans la transduction du signal.
❑ c. Ne peuvent pas contenir du 7-déhydrocholest érol.
❑ d. Contiennent des protéines ancrées par des résidus glycosyl-phosphatidyl-
inositol.
❑ e. Constituent un assemblage dynamique de lipides désordonnés.
D’après concours Dijon

175 Concernant le cholestérol :


❑ a. Il est absent de la structure des membranes cellulaires.
❑ b. Il possède une structure polycyclique.
❑ c. Il peut etre
ˆ stock é sous forme d’esters d’acides gras.
❑ d. Il provient exclusivement du foie.
❑ e. Le cholestérol peut être transporté dans le sang par les LDL.
D’après concours Lille

176 L’acide linoléique :


❑ a. est le C18 : 2∆9,12,15
❑ b. appartient à la série des ω-3.
❑ c. est l’acide octadécanoı̈que.
❑ d. a un point de fusion inférieur à celui de l’acide stéarique.
❑ e. est le précurseur de l’acide palmitique.
D’après concours Paris 11

177 Quelle est la proposition fausse ?


❑ a. Les lipides se caracterisent
´ par une diversite´ de structure.
❑ b. L’acide palmitique est aussi appelé l’acide hexadécanoı̈que et comporte 18
carbones.
❑ c. L’acide oléique est un acide gras insaturé essentiel.
❑ d. L’acide alpha linolénique est un acide gras insaturé indispensable.
❑ e. Autre réponse.
D’après concours Strasbourg

178 Concernant les propriétés communes aux sphingomyélines et aux phosphati dylcho-
76 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


lines :
❑ a. Elles contiennent de la choline.
❑ b. Elles contiennent deux acides gras à longue chaı̂ne.
❑ c. Ce sont des précurseurs de médiateurs.
❑ d. Ce sont des glycérophopholipides.
❑ e. Elles contiennent de la sphingosine.
D’après concours Paris 6

179 Concernant l’acide arachidonique :


❑ a. C’est une molécule amphiphile.
❑ b. Il contient 4 doubles liaisons.
❑ c. C’est acide gras polyinsaturé de la famille ω-3.
❑ d. C’est un produit de l’hydrolyse des glycérophospholipides par la phospholipase
C.
❑ e. C’est un substrat de la cyclo-oxygenase.
´
D’après concours Paris 6

180 Concernant le composé suivant :

❑ a. Sur la ligne 1 se trouve un ester de l’acide palmitique.


❑ b. Sur la ligne 2 se trouve un ester de l’acide linolé¨ıque.
❑ c. Il s’agit de la phosphatidylcholine.
❑ d. L’hydrolyse de la liaison ester de la ligne 2 libère un acide gras de la série ω-9.
❑ e. Il s’agit d’un composé amphipathique.
D’après concours Bordeaux

181 Concernant l’acide γ-linolénique :


❑ a. C’est un acide gras insaturé à 18 carbones.
❑ b. Il renferme 2 doubles liaisons.
❑ c. C’est un ω-3.
❑ d. C’est un ω-6.
❑ e. Il permet la synthèse d’acide arachidonique.
D’après concours Rouen
UE 1 • énoncés 77

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Niveau difficile

182 Cochez la (ou les) réponse(s) exacte(s).


❑ a. L’hydrolyse de la lécithine par la phospholipase C conduit à la formation
d’acide phosphatidique et de choline.
❑ b. L’acide phosphatidique est le précurseur des triglyc érides et des lipides com-
plexes de la famille des glycérophospholipides.
❑ c. Les cérebrosides
´ sont des compos és amphipatiques et amphotères à charge
électrique globale nulle.
❑ d. Les céramides resultent
´ de l’estérification d’une fonction alcool de la sphingo-
sine par une molécule d’acide gras.
❑ e. Tous les gangliosides sont formés de sphingosine, acides gras, galactose, fruc-
tose et acide neuraminique.
D’après concours Brest

183 Parmi les composés suivants, cochez le composé commun aux lécithines et sphin-
gomyélines :
❑ a. Acide phosphatidique. ❑ b. Acétylcholine.
❑ c. Phosphorylcholine. ❑ d. Glycérol.
❑ e. Phosphatidyléthanolamine.
D’après concours Brest

184 Concernant la lipoprotéine lipase :


❑ a. Elle est synthétisée principalement par le foie.
❑ b. Elle se fixe à la surface des parois vasculaires par interaction ionique gr âce à
des arginines et des lysines.
❑ c. Elle possède le m ême triade catalytique que les protéases à s érine.
❑ d. Elle hydrolyse les triglycérides en 1, 3 diacylglyc érol et acides gras.
❑ e. Elle participe au catabolisme des chylomicrons et VLDL.
D’après concours Dijon

185 Concernant les alcools constitutifs des lipides :


❑ a. Le glyc´
erol est un élément de la phosphatidyl-choline, de l’acide phosphati-
dique et des triglycérides.
❑ b. L’éthanolamine se retrouve préferentiellement
´ au sein des phospholipides
présents sur le feuillet externe des membranes cellulaires.
❑ c. Les phosphatidyl-cholines libèrent de la choline sous l’action de la phospholi-
pase C au niveau cér ébral.
❑ d. L’estérification de la sphingosine par un acide gras saturé à longue chaˆıne donne
un céramide.
❑ e. L’inositol triphosphate en 1, 3 et 5 est un médiateur d’activation cellulaire.
D’après concours Montpellier 1
78 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


186 À propos du cholestérol et de ses dérivés :
❑ a. Les acides biliaires sont produits uniquement dans le foie.
❑ b. Les hormones stéroı̈diennes sont produites dans plusieurs organes.
❑ c. Les hormones stéroı̈diennes utilisent plus de cholestérol que les sels biliaires
pour leur production.
❑ d. Les sels biliaires permettent une assimilation plus rapide des triglycérides
alimentaires.
❑ e. Le cholestérol cutan é est une source importante de vitamine D.
D’après concours Nancy

187 À propos des triglyc´erides dans l’organisme humain :


❑ a. Les triglycérides (ou triacylglycérols) sont solubles dans les solvants
organiques.
❑ b. Les triglycérides (ou triacylglycérols) ne contiennent pas d’acides gras insa-
turés de la série ω-3.
❑ c. Seul le tissu adipeux peut synthétiser des triglycérides (ou triacylglycérols).
❑ d. Les triglycérides (ou triacylglycérols) peuvent etre
ˆ observ és en petite quantité
dans les membranes cellulaires.
❑ e. Plusieurs lipases différentes hydrolysent les tri- et diglycérides (ou triacyl- et
diacylglycérols) dans l’organisme humain.
D’après concours Nancy

Peptides et protéines
188 Concernant la structure tertiaire des protéines :
❑ a. Elle peut être liée à la présence de liaisons hydrog ènes, électrostatiques, de
forces hydrophobes et parfois de ponts disulfures.
❑ b. C’est une structure figée qui ne peut ni se tordre ni se déformer.
❑ c. Elle correspond à la structure tridimensionnelle de la protéine.
❑ d. Une protéine soluble va se replier de façon à ce que les r´esidus les plus polaires
soient au contact de l’eau.
❑ e. Une protéine hydrophobe va se replier de façon à ce que les résidus les plus
polaires soient au contact des lipides qui l’entourent.
D’après concours Dijon

189 Concernant l’hélice α :


❑ a. La structure en hélice α est absente des prot éines globulaires.
❑ b. Elle comporte en moyenne 3, 6 résidus par tour d’helice.
´
❑ c. Elle est riche en proline.
❑ d. Les chaˆınes latérales des acides aminés la composant sont orientées vers
l’intérieur de l’hélice.
❑ e. L’hélice α est stabilis ée par des interactions hydrogène intercatétaires.
D’après concours Nantes
UE 1 • énoncés 79

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


190 Concernant le glutathion :
❑ a. Il s’agit d’un petit peptide de seulement 4 acides aminés.
❑ b. La liaison entre les 2 premiers acides aminés est une liaison peptidique.
❑ c. La liaison entre les 2 derniers acides aminés est une liaison pseudo-peptidique.
❑ d. C’est la présence d’une Cys qui confère au glutathion son rôle de transporteur
d’hydrogène car elle a la possibilité d’adopter deux formes : oxydée et réduite.
❑ e. Il ne peut être considéré comme un peptide au sens littéral du terme car le
premier composant est un dérivé d’acide aminé.
D’après concours Brest

191 Cochez la (ou les) réponse(s) exacte(s).


❑ a. La ghréline est un peptide anorexigène.
❑ b. L’angiotensine II est un peptide vaso-actif.
❑ c. Le glucagon stimule la lipolyse du tissus adipeux.
❑ d. Les endorphines se lient à leur récepteur grâce à la présence de 2 acides aminés
aromatiques essentiels de leur séquence.
❑ e. L’insuline est secrétée par le pancréas exocrine.
D’après concours Lille

192 Concernant les immunoglobulines :


❑ a. Les immunoglobulines M sont des glycoprotéines.
❑ b. ` identiques et
Les immunoglobulines comportent toutes deux chaı̂nes lég eres
deux chaı̂nes lourdes identiques.
❑ c. Les chaı̂nes lourdes des immunoglobulines ne contiennent pas de cystéine.
❑ d. Les immunoglobulines A sériques sont formées de deux tétramères associés au
peptide J.
❑ e. Il existe 6 types d’immunoglobulines : IgM, IgG, IgA, IgD, IgE, IgH.
D’après concours Limoges

193 Concernant la structure des protéines :


❑ a. La quantité d’acides aminés entrant dans une hélice α varie d’une prot éine à
l’autre.
❑ b. La formation d’une hélice α r ésulte d’interactions entre les groupements phos-
phates des acides aminés phosphorylés.
❑ c. L’hélice α est stabilis ée par la présence de thr éonine.
❑ d. L’hémoglobine est un hétérotétramère constitue´ de 2 sous-unités α et 2 sous-
unités β.
❑ e. Les coudes γ r ésultent de la présence de ponts disulfures.

D’après concours Limoges


80 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


194 Concernant les protéines :
❑ a. L’hélice α caract érise la structure tertiaire des protéines.
❑ b. La proline est incompatible avec une structure en helice ´ α.
❑ c. La teneur en motifs structuraux α et β est extrêmement r égulière.
❑ d. Les coudes β stabilisent la structure secondaire.
❑ e. L’association hélice α - feuillet β - hélice α constitue un domaine de la structure
tertiaire.
D’après concours Nantes

195 Concernant les protéines :


❑ a. Les ponts disulfures peuvent participer à la structure quaternaire des protéines.
❑ b. Le pont disulfure représente la liaison la plus forte stabilisant la structure
tridimensionnelle.
❑ c. Les résidus m éthionine et cystéine sont localisés en périphérie des prot éines
globulaires.
❑ d. L’hydrolyse totale des protéines coupe les ponts disulfures.
❑ e. Les ponts disulfures peuvent être coupés in vivo par une enzyme.
D’après concours Nantes

196 Concernant l’insuline :


❑ a. Elle inhibe la MTP (protéine de transfert microsomale des triglyc érides).
❑ b. Elle favorise la synthèse des triglycérides.
❑ c. Elle favorise l’oxydation mitochondriale des acides gras.
❑ d. Elle favorise la mise en réserve intrahépatique des triglycérides.
❑ e. Elle favorise la lipogénèse.
D’après concours Dijon

197 Le récepteur de l’insuline :


❑ a. Comporte des sous-unités α, β et γ.
❑ b. Lie l’insuline sur ses sous-unités α extracellulaires.
´
❑ c. Se dimerise apr ès fixation de l’insuline.
❑ d. Acquiert, après fixation de son ligand, une activité tyrosine kinase sur ses sous-
unités 1 3 qui permet la phosphorylation réciproque de la portion intracytoplas-
mique de ces deux sous-unités.
❑ e. Est susceptible d’être inactivé lorsqu’il est phosphorylé par des sérine/thréonine
kinases.
D’après concours Dijon

198 Concernant l’hémoglobine :


❑ a. C’est une protéine fibrillaire.
❑ b. La partie protéique possède une structure globulaire, riche en hélices alpha.
UE 1 • énoncés 81

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. Elle est fonctionnelle sous forme monomérique.
❑ d. Une molécule d’hémoglobine est capable de fixer 4 molecules
´ de dioxyg ène.
❑ e. C’est la protéine de stockage de l’oxygène dans le muscle.
D’après concours Nantes

199 L’hémoglobine est une métalloprotéine. Précisez si les propositions suivantes concer-
nant le fer dans l’hémoglobine sont vraies ou fausses.
❑ a. Le complexe formé du noyau porphine et de l’ion ferreux Fe2+ s’appelle
hématine.
❑ b. Le fer se place au centre du plan défini par les 4 noyaux imidazoles.
❑ c. Le fer est lié par des liaisons de coordinence aux atomes d’azote des
hét érocycles.
❑ d. La méth émoglobine correspond à la molécule contient du fer sous forme Fe 3+ .
❑ e. Dans la myoglobine, l’atome de fer est remplacé par un atome de cuivre.
D’après concours Nantes

200 Concernant la protéine prion :


❑ a. C’est une protéine allostérique.
❑ b. La protéine prion infectieuse a une séquence en acides aminés différente de
celle de la protéine prion normale.
❑ c. La protéine prion infectieuse contient beaucoup plus d’hélices α que prot éine
prion normale.
❑ d. ´
La protéine prion infectieuse est le resultat d’une mutation ponctuelle dans le
gène correspondant.
❑ e. La conversion de la forme normale en forme infectieuse est facilitée par la
forme infectieuse de la protéine.
D’après concours Paris 6

201 L’analyse d’une préparation purifi ée d’hémoglobine par SDS-PAGE révèle la présence
d’une bande de 17000 Daltons. Parmi les propositions suivantes concernant la masse moléculaire
des protéines et l’électrophor èse SDS-PAGE, cochez celles qui sont vraies.
❑ a. Un Dalton correspond à la masse d’un atome de carbone.
❑ b. Un Dalton correspond à la masse d’un atome d’hydrog ène.
❑ c. Le SDS est un détergent ionique.
❑ d. La dénaturation des prot éines permet de dissocier les chaı̂nes peptidiques li ées
par des ponts disulfures.
❑ e. L’absence d’effet du traitement par un composé réducteur permet de démontrer
qu’une protéine ne contient pas de cystéine.
D’après concours Nantes

202 Concernant les méthodes de séparation des protéines :


82 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. L’électrophorèse sur gel de polyacrylamide fractionne les protéines en fonction
de leur charge uniquement.
❑ b. La chromatographie d’affinité permet de s éparer des enzymes.
❑ c. La chromatographie sur résine echangeuse
´ d’ions fait intervenir la formation de
liaisons covalentes entre les protéines et la résine.
❑ d. La technique de gel filtration permet de fractionner les protéines en fonction de
leur caractère hydrophile.
❑ e. L’électrophorèse sur gel de polyacrylamide associée à l’utilisation du SDS,
sépare les prot éines en fonction de leur taille apparente uniquement.
D’après concours Dijon

203 On dispose d’un mélange de 3 protéines globulaires (a), (b) et (c) à pH 8.


La protéine (a) est un homotétramère de 120 kDa dont le pI est 7.
La protéine (b) est un monomère de 30 kDa dont le pI est 4.
La protéine (c) est un monomère de 30 kDa dont le pI est 11.
Parmi les propositions suivantes, indiquez celle qui est exacte.
❑ a. La solubilité de la protéine (b) est maximale à pH 4.
❑ b. À pH 8, seule la protéine (c) a une charge nette négative.
❑ c. Si le mélange est soumis à une chromatographie d’exclusion st érique, l’ordre
d’élution des protéines du mélange sera (b) et (c) simultanément, suivi de (a).
❑ d. Si le mélange est soumis à une chromatographie échangeuse de cations, seule
la protéine (c) interagira avec la phase stationnaire.
❑ e. Si le mélange est soumis à une électrophor èse sur gel de polyacrylamide, en
présence de SDS et de β-mercaptoéthanol, on observera 2 bandes après colora-
tion au bleu de Coomassie.
D’après concours Paris 11

204 Les LDL (lipoprotéines de basse densité) :


❑ a. Ont une densité” inf´erieure à celle des VLDL.
❑ b. Sont issues des VLDL formées par le foie.
❑ c. Transportent du cholestérol communément appel é  mauvais cholestérol  .
❑ d. Sont caractérisées par la présence d’une protéine appelée apo B100.
❑ e. Toutes les propositions précédentes sont fausses.
D’après concours Grenoble

205 À propos des techniques d’analyse des protéines, le (lesquels) de ces items est (sont)
exact(s) :
❑ a. En chromatographie d’échange d’ions, l’ élution est indépendante du pHi de la
protéine.
❑ b. En ultrafiltration, les petites protéines sont ralenties par rapport aux grosses
protéines et sont éluées après celles-ci.
UE 1 • énoncés 83

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. En chromatographie d’exclusion, les petites protéines sont ralenties par le gel.
❑ d. Au cours de l’électrophorèse dénaturante, le sodium dodécyl sulphate (SDS)
permet une migration indépendante de la charge.
❑ e. Toutes les propositions précédentes sont fausses.
D’après concours Grenoble

Enzymologie
206 Généralités sur les enzymes :
❑ a. Les enzymes sont des catalyseurs biologiques qui apparaissent dans les produits
de la réaction.
❑ b. Elles interviennent en augmentant l’énergie d’activation ainsi que la vitesse de
la réaction.
❑ c. Les enzymes permettent aux réactions ayant un ∆G > 0 (endothermique) de
se réaliser, alors qu’elles seraient thermodynamiquement impossibles à l’état
naturel.
❑ d. Les réactions chimiques sont régies par la loi d’action de masse.
❑ e. Les enzymes sont dans plus de 90 % des protéines et pour une très faible partie
des ARN à activité catalytique.
D’après concours Dijon

207 Pour un enzyme, on étudie l’évolution de la vitesse initiale V 0 en fonction de la


concentration en substrat. Les valeurs mesurées sont donn ées dans le tableau suivant :

[S ] (en µmol/L) 1 3 6 10 30 500 1000

V0 (en µmol/min) 2, 05 5, 10 7, 35 9, 30 12, 9 14, 7 14, 7

Quelle est la valeur exacte du Km de l’enzyme (en µmole/L) ?

❑ a. 2, 05 ❑ b. 5, 10 ❑ c. 6 ❑ d. 9, 30 ❑ e. 500
D’après concours Amiens
208 Cochez la (ou les) réponse(s) exacte(s).
❑ a. La vitamine C est indispensable à la formation du collag ène.
❑ b. Une carence en vitamine B6 conduit à des troubles hémorragiques.
❑ c. La vitamine B2 donne naissance à des cofacteurs nécessaires à l’action de dés-
hydrog´enases.
❑ d. Une carence en vitamine B12 peut apparaı̂tre en cas de régime végétalien total.
❑ e. La forme active de la vitamine B1 joue un rôle dans la transmission de l’influx
nerveux.
D’après concours Brest
84 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


209 Concernant les proenzymes :
❑ a. Ce sont des protéines sans activité qui, après avoir subi une protéolyse limitée,
acquièrent une activité enzymatique.
❑ b. L’activation des proenzymes est réversible.
❑ c. La chymotrypsine est une proenzyme.
❑ d. Le pepsinogène est une proenzyme.
❑ e. La sécr étion de certaines enzymes protéolytiques sous la forme de leurs proen-
zymes permet la protection des tissus qui les sécr ètent.
D’après concours Dijon

210 Concernant la cinétique enzymatique de type allosérique :


❑ a. La cinétique allostérique ne peut s’observer qu’avec des enzymes mul-
timériques.
❑ b. Le modèle de la cinétique allostérique a été proposé par Michaëlis et Menten.
❑ c. La cinétique allostérique traduit une coopérativité et une interaction entre les
unités de l’enzyme.
❑ d. La cinétique allostérique se traduit par une courbe sigmoı̈de lorsqu’on exprime
la vitesse initiale V0 en fonction de la concentration de substrat S .
❑ e. La cinétique allostérique d’une enzyme est repr ésentee
´ par une droite dans les
coordonnées de Lineweaver-Burk.
D’après concours Limoges

211 Deux enzymes sont extraites de deux façons différentes. Ces deux enzymes catalysent
la même réaction chimique, toutes les deux avec une cinetique
´ micha ëlienne. On se demande
si les deux enzymes sont identiques ou si elles sont differentes.
´
Dans un même volume, on met l’une ou l’autre enzyme et on mesure leurs activités enzyma-
tiques respectives qui sont données dans le tableau suivant :

Enzyme A Enzyme B

Activité catalytique maximale 334 ncat 40 UI

Quantité de prot éines dans le volume 150 mg 300 mg

Km 10 −7 mol/L 5 × 10−8 mol/L

❑ a. L’activité de l’enzyme A est supérieure à l’activité enzymatique de l’enzyme B


pour le volume considéré.
❑ b. L’activité de l’enzyme B est supérieure à l’activité enzymatique de l’enzyme A
pour le volume considéré
❑ c. L’activité spécifique de l’enzyme A est de 2, 227 ncat/mg de prot éines.
❑ d. L’activité spécifique de l’enzyme B est de 26, 6 UI/mg de prot éines.
❑ e. Ces deux enzymes sont des molécules distinctes mais sont des isoenzymes.
D’après concours Limoges
UE 1 • énoncés 85

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


212 Indiquez la bonne association de propositions exactes :
1 : La vitesse d’une réaction enzymatique est indépendante de la température du milieu
réactionnel.
2 : La vitesse d’une réaction enzymatique dépend du pH du milieu réactionnel.
3 : L’unité d’activité enzymatique utilisée en biologie médicale est l’unité internationale (UI)
qui correspond à la quantité d’enzyme nécessaire pour transformer une micromole de substrat
par minute.
4 : La vitesse maximale d’une réaction enzymatique (Vmax est la vitesse initiale mesurée à
concentration saturante en substrat.
5 : Un inhibiteur non compétitif modifie la constante de Michaelis sans changer la vitesse
maximale.
6 : Dans l’inhibition compétitive, l’affinité de l’enzyme pour le substrat reste inchangée quelle
que soit la concentration de l’inhibiteur.

❑ a. 1, 2, 3 ❑ b. 1, 2, 4 ❑ c. 2, 3, 4 ❑ d. 3, 4, 5 ❑ e. 1, 5, 6
D’après concours Amiens
213 Cochez la(les) proposition(s) exacte(s) :
❑ a. Les ribozymes sont des protéines douées d’une activité catalytique.
❑ b. Les enzymes sont détruits au cours des réactions qu’ils catalysent.
❑ c. Les enzymes augmentent la vitesse des réactions qu’ils catalysent.
❑ d. Les enzymes sont spécifiques d’une r éaction chimique définie réalisée sur un
type de substrat(s) donné.
❑ e. Le site actif d’un enzyme correspond à la partie de la protéine capable de re-
connaı̂tre et de transformer le(s) substrat(s).
D’après concours Paris 6

214 Concernant les enzymes à régulation allostérique (système K) :


❑ a. L’expression de la vitesse de la réaction en fonction de la concentration du
substrat est repr´esentée par une courbe sigmoı̈de.
❑ b. Un effecteur allostérique présente des affinit és différentes pour la forme R (  re-
lachée  douée d’une forte activité) et la forme T ( tendue  douée d’une faible
activité) de l’enzyme.
❑ c. L’affinit é de l’enzyme pour le substrat et la vitesse maximale (Vmax) de la
réaction diminuent en présence d’un inhibiteur allostérique.
❑ d. Un activateur allostérique favorise sa propre fixation sur l’enzyme.
❑ e. Un inhibiteur allostérique favorise sa propre fixation sur l’enzyme.
D’après concours Paris 6

215 Cochez la(les) proposition(s) exacte(s) :


❑ a. Un enzyme augmente l’énergie d’activation d’une réaction chimique.
❑ b. Un enzyme diminue l’énergie libre d’une réaction chimique.
❑ c. Un enzyme catalyse une réaction chimique définie à partir d’un ou plusieurs
substrats donn´
es.
86 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. La FAD (flavine adénine dinucléotide) est le coenzyme de certaines oxy-
doréductases.
❑ e. Une lyase est un enzyme qui enlève un groupement au substrat en créant une
double liaison ou qui fixe un groupement sur une double liaison.
D’après concours Paris 6

216 Les enzymes sont classées selon la réaction catalys ée. On donne 5 affirmations :
1. La classe 1 des enzymes regroupe les hydrolases.
2. La classe 2 des enzymes regroupe les transférases.
3. Parmi les ligases, on trouve des synthétases.
4. Les amı́notransférases sont des lyases.
5. Les peptidases font partie de la classe 3 des enzymes.
Parmi les combinaisons suivantes, indiquez celle dont toutes les affirmations sont exactes.
❑ a. 1, 2, 4. ❑ b. 2, 4, 5. ❑ c. 1, 3, 4. ❑ d. 2, 3, 5. ❑ e. 3, 4, 5.
D’après concours Paris 11

217 Parmi les propositions suivantes concernant le mécanisme catalytique de la chymo-


trypsine, inqiquez celle qui est exacte :
❑ a. Le mécanisme covalent d épend d’un résidu cystéine du site actif.
❑ b. L’acylation de l’enzyme est réversible.
❑ c. Le trou oxyanionique qui se forme transitoirement dans le site actif voit un
atome d’oxygène tétravalent stabilisé par deux liaisons hydrogène.
❑ d. La molécule d’eau intervient dans la premi`
ere étape de la catalyse.
❑ e. La liaison peptidique hydrolysée se situe en amont (n− 1) du r ésidu acide aminé
aromatique (n) reconnu dans le site actif.
D’après concours Paris 11

218 Parmi les propositions suivantes concernant les inhibiteurs non compétitifs, indiquez
celle qui est exacte :
❑ a. Dans le graphe de Michaelis-Menten, ils diminuent la valeur de Mm.
❑ b. Dans le graphe de Lineweaver-Burk, ils augmentent la pente de la droite.
❑ c. Dans le graphe d’ Eadie-Hofstee (v0 /[S ] = f (v 0)), ils diminuent la pente de la
droite.
❑ d. Ils se lient au site actif de l’enzyme à la place du substrat.
❑ e. Le méthotrexate est un inhibiteur non competitif
´ de la dihydrofolate-réductase.
D’après concours Paris 11

219 À propos de la mesure d’une vitesse initiale, indiquez celle qui est exacte :
❑ a. Le pH doit être au point isoélectrique de l’enzyme.
❑ b. La température n’a pas d’importance.
❑ c. La concentration du substrat doit être grande devant celle de l’enzyme.
UE 1 • énoncés 87

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Elle nécessite la présence d’un inhibiteur compétitif.
❑ e. La vitesse initiale n’existe pas pour une enzyme allostérique.
D’après concours Paris 11

220 Parmi les propositions suivantes concernant la vitesse de réaction d’une enzyme mi-
chaelienne, indiquez celle qui est exacte :
❑ a. La vitesse maximale est indépendante de la temp érature.
❑ b. L’expression des vitesses initiales en fonction de la concentration de substrat
donne une courbe sigmoı̈de.
❑ c. Pour une enzyme donnée, à une concentration donnée et avec un substrat donné,
la vitesse initiale dépend de la concentration de substrat.
❑ d. La vitesse est indépendante du pH de la solution dans laquelle se fait la réaction.
❑ e. Pour déterminer une vitesse initiale, on peut mesurer la disparition du produit
tant qu’elle reste linéaire en fonction du temps.
D’après concours Paris 11

221 On compare les propriétés enzymatiques de 3 enzymes, chacune vis- à-vis de son
substrat spécifique. On dispose des valeurs suivantes :
K M (M) k cat (s −1 )
Enzyme 1 1 × 10−5 15 × 106
Enzyme 2 2 × 10−5 6 × 108
Enzyme 3 5 × 10−5 1 × 104
Parmi les propositions suivantes, indiquez celle qui est exacte :
❑ a. L’enzyme 1 possède plus d’affinit é pour son substrat que l’enzyme 3.
❑ b. L’enzyme 1 possède un nombre de turnover sup érieur à celui de l’enzyme 2.
❑ c. L’enzyme 2 possède la plus grande efficacité cataclytique.
❑ d. L’enzyme 2 possède l’affinité pour son substrat la plus élevée.
❑ e. L’efficacit é catalytique réprésenre K M /kcat.
D’après concours Paris 11

222 Parmi les propositions suivantes concernant la vitesse de réaction d’une enzyme de
type michaelien, laquelle est exacte ?
❑ a. Pour de très faibles concentrations de substrat, la vitesse est inversement pro-
portionnelle à la concentration de substrat.
❑ b. Au delà d’une température appelée température optimale, la vitesse augmente.
❑ c. Pour une enzyme donnée et un substrat donné, la vitesse maximale (v max) est
indépendante de la concentration en enzyme.
❑ d. La vitesse maximale est donnée par la relation vmax = k+2 .[Et ] dans laquelle
k+2 est la constante de vitesse de la réaction d’apparition du produit et [Et ] la
concentration totale en enzyme.
88 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. La vitesse est indépendante du pH du mileu dans lequel se fait la réaction.
D’après concours Paris 11

223 Sachant que la constante de Michaélis (Km ) d’une enzyme pour un substrat donné
est de 5 µM et sa vitesse maximale (vmax ) de 50 µmol.min−1 , quelle est la concentration de
substrat nécessaire pour que la vitesse initiale (vi ) soit de 25 µmol.min−1 ?
❑ a. 50 µM. ❑ b. 20 µM. ❑ c. 10 µM. ❑ d. 5 µM. ❑ e. 2 µM.
D’après concours Paris 11

´
224 Soit la réaction catalys ée par l’alanine-aminotransferase (ALAT) :
Alanine + α-cétoglutarate −→ pyruvate + glutamate
Parmi les propositions suivantes, indiquez celle qui est exacte :
❑ a. L’ α-cétoglutarate est un donneur de groupement amin é.
❑ b. L’activité ALAT peut être déterminee
´ par dosage du pyruvate en ajoutant du
NAD et de la lactico-déshydrogénase.
+

❑ c. Dans cette réaction, la coenzyme indispensable est le phosphate de pyridoxal.


❑ d. L’ALAT appartient à la classe 1 des enzymes.
❑ e. L’ALAT catalyse aussi la réaction de transamination de l’aspartate en oxa-
loacétate.
D’après concours Paris 11

225 Au sujet de l’aspartate-transcarbamylase, quelle est l’affirmation exacte :


❑ a. Elle est formée de deux chaı̂nes polypeptidiques.
❑ b. Sous forme entière, elle présente des effets cooperatifs
´ positifs vis- à-vis de
l’aspartate.
❑ c. Le CTP en est un activateur allostérique.
❑ d. Elle est une enzyme allostérique de type V.
❑ e. L’ATP en est un inhibiteur allostérique.
D’après concours Paris 11

226 Une enzyme :


❑ a. est une protéine.
❑ b. est spécifique de la réaction qu’elle catalyse.
❑ c. augmente la vitesse d’une réaction chimique.
❑ d. augmente l’énergie d’activation d’une réaction chimique.
❑ e. est toujours dégradée à la fin de la réaction qu’elle catalyse.
D’après concours Nancy

227 Propriétés catalytiques d’une enzyme :


❑ a. Une enzyme ne possède le plus souvent qu’un seul substrat.
UE 1 • énoncés 89

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. Dans le modèle de Koshland, on assiste à des modifications conformationnelles
lors de l’association enzyme/substrat.
❑ c. Dans l’organisme les réactions enzymatiques sont généralement réversibles.
❑ d. La spécificité des réactions enzymatiques se caractérise par une spécificité de
réaction du substrat ainsi qu’une stéréosp écificité.
❑ e. Le site actif de la cholinestérase comporte un site anionique de liaison du sub-
strat ainsi qu’un site catalytique constitué de deux groupements fonctionnels.
D’après concours Nancy

228 La vitamine C :
❑ a. est une gamma-lactone.
❑ b. est une molécule appartenant à la série L.
❑ c. est cofacteur d’une réaction enzymatique permettant l’augmentation du Tm du
collagène.
❑ d. prévient la survenue du scorbut.
❑ e. n’est pas couplée à la vitamine E lors de la rég énération des lipides peroxydés.
D’après concours Nancy

229 À propos de la vitamine B2 (riboflavine) :


❑ a. Les coenzymes flaviniques transportent deux électrons par réduction du ribitol
phosphate.
❑ b. La flavine mononucléotide (FMN) est le groupement prosthétique du complexe
I de la chaı̂ne respiratoire.
❑ c. La flavine adénine dinucléotide (FAD) est le coenzyme de l’acyl-CoenzymeA.
❑ d. Les coenzymes B2 participent a` la desamination
´ des acides amin és.
❑ e. Les électrons de FADH 2 cytoplasmique sont transférés par une navette sur le
NADH, H+ mitochondrial.
D’après concours Nancy

230 Cinétique enzymatique :


❑ a. La phase stationnaire de la réaction enzymatique correspond aux conditions de
mesure de la vitesse initiale
❑ b. À l’état d’équilibre de la réaction enzymatique, la vitesse continue à augmenter.
❑ c. Le Km est souvent appelé  constante d’association apparente  d’une enzyme.
❑ d. Selon l’equation
´ de Michaelis-Menten, pour des concentrations élevées en sub-
strat, la vitesse est alors directement proportionnelle à la concentration en
substrat.
❑ e. Le Katal est la quantité d’enzyme qui transforme une mole de substrat par mil-
ligramme de protène.
D’après concours Nancy
90 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


231 Inhibition des enzymes de cinétique michaelienne :
❑ a. L’aspirine est un inhibiteur enzymatique réversible.
❑ b. L’éthanol est un inhibiteur compétitif de l’alcool déshydrogénase qui
métabolise le m´
ethanol en formald éhyde.
❑ c. Lors d’une inhibition non compétitive, Km n’est pas modifié, Vmax est aug-
mentée.
❑ d. Dans l’inhibition incompétitive, l’inhibiteur n’agit qu’après la formation du
complexe enzyme-substrat.
❑ e. Une inhibition compétitive peut être levée par l’ajout de substrat en excès.
D’après concours Nancy

232 À propos du coenzyme A :


❑ a. Le site actif du coenzyme A est un groupe thiol.
❑ b. La liaison thioacyl du coenzyme A avec les acides gras se fait par une réaction
qui consomme une liaison riche en énergie.
❑ c. L’acide pantothénique est un amide de l’acide pantoı̈que.
❑ d. Le coenzyme A comporte un nucléotide ad énine.
❑ e. Le coenzyme A intervient dans la réaction catalysée par la pyruvate
déshydrog énase.
D’après concours Nancy

Métabolisme
233 Cochez la (ou les) réponse(s) exacte(s).
❑ a. La proline peut etre
ˆ synth étisée à partir de l’acide glutamique.
❑ b. L’acide glutamique est le précurseur du GABA par désamination.
❑ c. L’acide glutamique est un précurseur de l’acide folique.
❑ d. La glutamine est synthétisée à partir de l’acide glutamique et de l’asparagine.
❑ e. L’acide glutamique est le précurseur de la β-alanine, constituant du CoASH.
D’après concours Dijon

234 Quels sont les acides aminés à la fois c étogènes et glucoformateurs ?


❑ a. Leucine. ❑ b. Trytophane. ❑ c. Acide glutamique. ❑ d. Tyrosine.
❑ e. Lysine.
D’après concours Dijon

235 Cochez la (ou les) réponse(s) exacte(s).


❑ a. Le premier azote de l’urée provient de l’ammoniaque.
❑ b. L’ammoniaque est libéré par le glutamate sous l’action de la glutamate
déshydrog énase.
UE 1 • énoncés 91

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. La glutamate déshydrogénase est une enzyme du cytoplasme des cellules
rénales.
❑ d. Le glutamate peut être formé par le transfert d’une fonction amine sur l’acide
alphacétoglutarique.
❑ e. Le transfert d’une fonction amine sur l’acide alphacétoglutarique met en jeu
une enzyme utilisant le tétrahydrofolate comme coenzyme.
D’après concours Dijon

236 Concernant la cétogenèse :


❑ a. Elle a lieu dans le foie et dans le cerveau.
❑ b. Elle peut fournir des substrats énergétiques à diff érents tissus en période de
jeûne.
❑ c. Elle produit des dérivés hydrosolubles des acides gras qui pourront rejoindre
les tissus utilisateurs par la circulation sanguine.
❑ d. Elle permet la formation d’acétoacétate et d’hydroxybutyrate, ainsi que
d’acétone.
❑ e. Les corps cétoniques formés permettent de fournir des l’acétyl-CoA au cycle
de Krebs dans les tissus utilisateurs.
D’après concours Limoges

237 Interrelations métaboliques


Parmi les propositions suivantes, indiquez celle qui est exacte.
❑ a. Foie, muscle squelettique, cœur et cerveau consomment préférentiellement des
acides gras comme substrat énergétique.
❑ b. Les corps cétoniques sont synthétisés et d égradés dans le foie.
❑ c. Les réserves énergétiques protéiques et glucidiques sont limitées.
❑ d. En période post-prandiale, l’organisme utilise le glucose comme substrat
énergétique.
❑ e. Le globule rouge dégrade le glucose au cours de la glycolyse aérobie.
D’après concours Paris 11

238 Action de l’insuline sur le métabolisme


On donne les cinq affirmations suivantes :
1. L’insuline active le transporteur du glucose GLUT4 dans le muscle squelettique.
2. L’insuline active la synthèse de glucose à partir de substrats non glucidiques au cours de la
n éoglucogenèse.
3. L’insuline active la synthèse de glycogène.
4. L’insuline active la glycogénolyse.
5. L’insuline active la glycolyse.
Parmi les combinaisons suivantes, indiquez celle dont toutes les affirmations sont exactes :
❑ a. 1, 2, 3. ❑ b. 1, 2, 5. ❑ c. 1, 3, 5. ❑ d. 2, 3, 5. ❑ e. 3, 4, 5.
D’après concours Paris 11
92 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


239 Concernant la 5-lipoxygénase :
❑ a. Elle intervient dans la synthèse des thromboxanes.
❑ b. Elle enlève un atome d’hydrogene ` sur le carbone 5 des acides gras en C 2 0.
❑ c. Elle est inhibée par l’aspirine.
❑ d. Elle enlève deux doubles liaisons à l’acide gras.
❑ e. Toutes les propositions précédentes sont fausses.
D’après concours Grenoble

240 On considère la molécule suivante :

Quels atomes de carbone, numérotés ici 3, 4, 5, 7, 8, 9 doit-on remplacer par un atome d’azote
pour obtenir la molecule
´ d’ad énine ?
❑ a. 3, 5, 9 ❑ b. 4, 5, 7, 9 ❑ c. 3, 5, 7, 9 ❑ d. 3, 7, 8, 9
❑ e. 3, 4, 7, 8
D’après concours Amiens

4. Biologie moléculaire
ADN, génome et chromosomes
Niveau facile

241 Concernant les généralités et la nomenclature du génome :


❑ a. L’ADN est le support de l’information génétique de tout organisme cellulaire.
❑ b. La guanosine est un nucléotide dont la base azotée est une guanine.
❑ c. Un ADN double brin de 1 kb est compose´ de 2000 désoxyribonucl éotides.
❑ d. L’existence d’une liaison 1’-9 dans un nucléotide implique une base azotée
pyrimidique.
❑ e. Dans un ADN double brin une base purique est appari ée à une base pyrimi-
dique.
D’après concours Paris 11

242 Concernant les propriétés physico-chimiques du génome :


❑ a. Il est possible de dénaturer un ADN double brin en modulant le pH.
❑ b. Toute méthylation d’un ADN est physiologique.
❑ c. La densité d’un ADN est inversement proportionnelle au % en AT.
❑ d. Les bases azotées sont responsables de l’absorption UV des acides nucléiques.
UE 1 • énoncés 93

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. Les super-tours d’un ADN circulaire sont génér és par des hélicases.
D’après concours Paris 11

243 Au sujet de la molécule suivante :

❑ a. Il s’agit d’un ribose car il possède une fonction hydroxyle en 3’.


❑ b. L’association de ce sucre avec une base pyrimidique se fait entre le C5’ et le N9
de la base.
❑ c. L’association de ce sucre avec une base pyrimidique se fait entre le C1’ et le N1
de la base.
❑ d. Cette molécule est retrouvée dans l’ADN.
❑ e. Cette molécule est retrouvée dans l’ARN.
D’après concours Paris 11

244 Cochez la (ou les) réponse(s) exacte(s).


❑ a. La thymine et la guanine sont les deux bases puriques de l’ADN.
❑ b. Le 2’désoxyribose est le pentose de l’ARN.
❑ c. Une des caracteristiques
´ de l’ADN est d’ être un polymère constitué d’un
nombre extrêmement élev é de nucl éotides : un chromosome peut atteindre le
milliard de paires de bases.
❑ d. La traduction est le passage de l’ADN à l’ARN.
❑ e. La taille de l’ADN d’un virus est généralement de l’ordre du millier de paires
de bases.
D’après concours Paris 7

245 Cochez la (ou les) réponse(s) exacte(s).


❑ a. Les bases de la double hélice d’ADN absorbent plus de lumi ère UV que ne le
font les bases quand l’ADN est simple brin.
❑ b. La double hélice de l’ADN peut être dénaturée de façon réversible.
❑ c. La dénaturation de l’ADN par la chaleur est un phénomène coopératif.
❑ d. La température de denaturation
´ d’une molécule d’ADN est independante
´ de la
composition en bases mais dépend simplement de la longueur de la molécule.
❑ e. Le processus de dénaturation de la double hélice d’ADN dans la cellule requiert
de l’énergie.
D’après concours Paris 7
94 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


246 L’ADN mitochondrial :
❑ a. Est un ADN double brin circulaire.
❑ b. Il en existe une copie par mitochondrie.
❑ c. Il contient, comme l’ADN nucléaire, des séquences promotrices et des introns.
❑ d. Il permet la transcription de 13 ARNm codants des protéines et de 24 ARN
non-codants.
❑ e. Le taux de mutation dans l’ADN mitochondrial est très faible par rapport à
l’ADN nucléaire.
D’après concours Lyon 1

247 Cochez la (ou les) réponse(s) exacte(s).


❑ a. La désoxyribose ne possède pas de substituant hydroxyle en 3’.
❑ b. Dans la double hélice d’ADN de type B, il existe 5 paires de bases par tour.
❑ c. La thymine est remplacée par l’uracile dans l’ARN.
❑ d. La taille du génome humain est inf érieure à 3 m égabases.
❑ e. Dans l’ADN humain, il existe autant d’uracile que d’adénine.
D’après concours Lille

248 L’ATP :
❑ a. Est un ribonucléotide.
❑ b. Possède une seule liaison phosphoanhydre.
❑ c. Est indispensable pour fournir de l’énergie.
❑ d. Comporte de l’adénine.
❑ e. Comporte une liaison phosphodiester.
D’après concours Nancy

249 L’ADN naturel :


❑ a. Est le support de l’herédité
´ chez les Eucaryotes.
❑ b. Est composé de 2’-désoxyribonucléosides.
❑ c. Est de type hélicoı̈dal droit.
❑ d. Possède 12 paires de bases par pas d’h élice.
❑ e. A un diamètre de 2 nanomètres.
D’après concours Nancy

250 Les acides ribonucléiques peuvent :


❑ a. Former des doubles hélices intra-moléculaires.
❑ b. Hydrolyser la liaison N-osidique du nucléoside.
❑ c. Constituer le génome de certains virus.
❑ d. Jouer un rôle essentiel dans la stabilisation et la traduction des ARN.
UE 1 • énoncés 95

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. Autre réponse
D’après concours Strasbourg

251 Quelle est la proposition exacte ?


❑ a. L’uridine est un constituant des ADN.
❑ b. La désamination de la méthyl-cytosine conduit à la présence d’une base rare
dans les ADN.
❑ c. La conformation B de la double hélice est définie par la présence de dix paires
de bases par tour d’hélice.
❑ d. La température de fusion d’un ADN simple brin dépend de la fr équence des
purines présentes.
❑ e. e. Autre réponse.
D’après concours Strasbourg

252 Quelle est la proposition fausse ?


❑ a. Les ARN messagers sont présents en faible quantit é par rapport aux ARN
ribosomiques.
❑ b. Dans des cellules eucaryotes, les ARN non codants peuvent être impliqués dans
la régulation de la transcription comme de la traduction.
❑ c. La présence d’un hydroxyle sur le carbone 2’ du ribose est essentielle pour
l’activité ribozyme de certains ARN.
❑ d. Les appariements de bases adénine-thymine sont plus stables que les apparie-
ments de bases guanine-cytosine.
❑ e. Autre réponse.
D’après concours Strasbourg

253 Concernant le génome humain :


❑ a. Il comporte environ 3 fois moins de gènes que celui du maı̈s (Zea mays).
❑ b. Il comporte environ 3 fois plus de gènes que celui du ma ı̈s (Zea mays).
❑ c. Il comporte environ 20 fois moins de gènes que celui de la levure (Saccharo-
myces cerevisiae).
❑ d. Il comporte autant de gènes que celui de la souris (Mus musculus).
❑ e. e. Il comporte environ 10 fois plus de gènes que celui de la mouche du vinaigre
(Drosophilia melanogaster).
D’après concours Strasbourg

Niveau intermédiaire

254 Concernant la structure de l’ADN :


❑ a. La longueur d’un ADN db de 10 pb est de 34 nm.
❑ b. La liaison entre le sucre et la base azotée se nomme liaison phosphodiester.
96 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. Le diamètre d’une double hélice d’ADN est inférieur au pas de cette double
hélice.
❑ d. Le pas d’une double hélice d’ADN est supérieur à la hauteur d’un nucléosome.
❑ e. L’épaisseur d’un nucléosome est supérieure à la hauteur d’un nucléosome.
D’après concours Paris 11

255 Concernant la structure et organisation des gènes :


❑ a. Une unité de transcription eucaryote débute toujours par le codon d’initiation
de la traduction.
❑ b. La densité des gènes dans l’ADN de levure est supérieure à celle observ ée chez
l’homme.
❑ c. Le génome humain compte autant de g ènes que de pseudogènes.
❑ d. Près de 50% du génome humain est constitué d’éléments g énétiques répétés.
❑ e. Une mutation ponctuelle réduisant la taille d’une protéine est obligatoirement
une dél étion.
D’après concours Paris 11

256 Parmi les propositions suivantes, indiquez celle qui est exacte.
❑ a. Tous les gènes codent des polypeptides.
❑ b. Les séquences SINE sont group ées en tandem au niveau des centromères.
❑ c. Les pseudogènes codent les ARNi.
❑ d. L’ADN VNTR est localisé pres ` des télom ères.
❑ e. Certaines copies LINE sont capables de se transposer.
D’après concours Paris 11

257 Parmi les propositions suivantes concernant une molécule d’ADN double brin circu-
laire contenant 21% d’adénosine, laquelle est exacte ?
❑ a. Elle contient 10, 5% de guanosine.
❑ b. Elle contient 21% de guanosine.
❑ c. Elle contient 29% de guanosine.
❑ d. Elle contient 58% de guanosine.
❑ e. Le pourcentage de guanosine dans la molécule d’ADN ne peut être déterminé
à partir des données fournies.
D’après concours Paris 11

258 Organisation du génome humain :


❑ a. De façon générale, la majorité de la séquence d’un gène n’est pas codante.
❑ b. Les pseudogènes sont des copies non fonctionnelles d’un gène.
❑ c. Les gènes des ARN non codants sont la plupart du temps uniques.
UE 1 • énoncés 97

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Les microstallites sont des séquences non-codantes, repétées
´ en tandem, et dis-
persées dans tout le g énome.
❑ e. Des séquences LTR-transposons sont retrouvées dans le génome humain.
D’après concours Lyon 1

259 Le nucléoı̈de bactérien :


❑ a. Est constitué uniquement d’ADN double brin circulaire.
❑ b. Ne possède pas de membrane nucléaire et est organise´ en domaines.
❑ c. Sa réplication est semi-conservatrice et bidirectionnelle.
❑ d. Présente des caractéristiques qui lui permettent une expression g énétique lente.
❑ e. Comporte une origine de réplication oriC et une origine de terminaison terC.
D’après concours Nantes

260 Concernant la chromatine :


❑ a. Son degré de compaction peut être en relation avec l’expression des gènes.
❑ b. Il y a 5 types d’histones principaux.
❑ c. La chromatine est constituée d’unités de compaction r épétitives séparées cha-
cune d’environ 146 pb d’ADN.
❑ d. L’histone H3 fait partie du tétramère constituant le cœur du nuclésome.
❑ e. L’euchromatine est la forme condens´
ee de l’ADN.
D’après concours Dijon

Niveau dificile

261 Concernant les polymorphismes du génome humain :


❑ a. Les SNP sont plus souvent des transversions que des transitions.
❑ b. Les CNV correspondent à des polymorphismes li és à des substitutions
nucléotidiques.
❑ c. Les groupes sanguins correspondent à des SNP si égeant dans des exons
codants.
❑ d. Les CNV sont plus nombreux que les SNP.
❑ e. Trois SNP proches permettent de définir theoriquement
´ six haplotypes.
D’après concours Paris 5

262 Concernant l’acide urique :


❑ a. C’est le produit de catabolisme des purines chez l’homme.
❑ b. C’est un acide faible.
❑ c. La diminution de son taux dans le plasma peut être responsable du dép ôt ex-
tracellulaire de cristaux insolubles.
❑ d. Il est formé par l’action de la xanthine oxydase.
❑ e. C’est un nucléoside.
D’après concours Lille
98 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


263 Les séquences considérées comme hautement r épétees
´ dans les génomes eucaryotes
sont :
❑ a. Les séquences CEN.
❑ b. Les séquences Alu.
❑ c. Les minisatellites ou VNTR.
❑ d. Les mı́crosatellites ou STR.
❑ e. Les él éments dispersés courts ou séquences SINE.
D’après concours Paris 11

Réplication
Niveau facile

264 Concernant l’ADN polymérase delta :


❑ a. Elle synthétise l’ADN du brin direct.
❑ b. Elle synthétise l’ADN du brin indirect ou retardé.
❑ c. Elle synthétise l’ADN des télomères.
❑ d. Les deux brins de l’ADN parental lui servent de matrice.
❑ e. Elle se fixe sur une amorce d’ARN pour commencer sa synthèse d’ADN.
D’après concours Paris 6

265 Concernant la réplication du génome :


❑ a. Sur chacun des 2 brins d’un chromosome, la néosynth èse d’ADN est à la fois
continue et discontinue.
❑ b. Une ADN polymérase synthétise de 5’P en 3’OH une séquence d’ADN iden-
tique a celle au brin matrice.
❑ c. La télomérase est indispensable à la terminaison de la réplication du chromo-
some bactérien.
❑ d. Le cycle de reproduction des rétrovirus passe par un stade ADN.
❑ e. Aucune proposition exacte.
D’après concours Paris 11

266 La réplication du chromosome bact érien nécessite :


❑ a. Une primase pour détruire les amorces d’ARN.
❑ b. Des hélicases afin de stabiliser les simples brins d’ADN.
❑ c. Des protéines SSB (Single Strand Binding) qui séparent les brins d’ADN.
❑ d. De l’ATP fournissant de l’énergie.
❑ e. Des ligases pour lier les fragments d’Okazaki.
D’après concours Lyon 1
UE 1 • énoncés 99

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


267 Au cours de la réplication du chromosome bacterien
´ :
❑ a. L’ADN polymérase I dégrade les amorces d’ARN et les remplace par de
l’ADN.
❑ b. La protéine initiatrice de ce processus est la primase.
❑ c. L’hélicase s épare les deux brins d’ADN parental.
❑ d. Les ligases lient les fragments d’Okazaki entre eux sur le brin retardé.
❑ e. L’ADN polymérase III synth étise le brin complémentaire de l’ADN (activité
exonucléasique 3’ → 5’).
D’après concours Nantes

268 Concernant la réplication :


❑ a. La réplication de l’ADN aboutit a` la duplication des chromatides de chaque
chromosome.
❑ b. Lors de la réplication de l’ADN, le brin matrice est lu par la polymérase dans
le sens 5’-3’.
❑ c. La réplication imparfaite des t élomères serait à l’origine du vieillissement nor-
mal des cellules humaines.
❑ d. L’activité de correction d’épreuve associ ée à la réplication est liée à la po-
lymérase alpha.
❑ e. Toutes les propositions précédentes sont fausses.
D’après concours Nice

269 Concernant la réplication de l’ADN chez les eucaryotes, quelle est la proposition
fausse :
❑ a. Un ADN double brin sous forme d’hélice de conformation B ne peut être
réplique´ sans dénaturation préalable.
❑ b. La synthèse d’un acide désoxyribonucléique s’effectue en répliquant un ADN
matriciel qui sera lu dans le sens 5’ vers 3’.
❑ c. Deux ADN polymérases ADN-dépendantes de type distinct sont responsables
de la réplication simultanée des deux brins d’ADN d’un réplicon.
❑ d. Plusieurs origines de réplication sont regroup ées dans des foyers de réplication
stables où elles seront activées en même temps.
❑ e. Autre réponse.
D’après concours Strasbourg

Niveau intermédiaire

270 Concernant la biosynthèse de l’ADN et la réplication :


❑ a. Dans une cellule, la réplication requiert des nucléotides tri-phosphates aussi
bien ribo-, que désoxyribo-.
❑ b. Les seules protéines requises pour la réplication sont de nature enzymatique.
100 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. La néosynth èse d’ADN est entièrement discontinue sur un brin d’un chromo-
some et continue sur l’autre.
❑ d. Les ADN polymérases des r éplications eucaryotes sont plus rapides que leurs
homologues procaryotes.
❑ e. Les séquences promotrices et introniques ne sont pas r epliquées.
´
D’après concours Paris 11

271 Concernant la réplication du chromosome circulaire d’Escherichia coli :


❑ a. L’origine de réplication oriC contient des sites de liaison pour la protéine
 DnaA  .

❑ b. Les protéines SSB (Single Strand Binding protein) se lient aux r égions double
brin de l’ADN.
❑ c. Le collier coulissant  clamp  aide l’ADN polym érase III à se déplacer sur
l’ADN double brin.
❑ d. ´ és de façon s équentielle et sont reli és
Les fragments d’Okazaki sont synthetis
par une ADN ligase.
❑ e. La matrice du brin fils discontinu est hydrolysée avant l’action de l’ADN ligase.
D’après concours Paris 11

272 Le chromosome de Escherichia coli :


❑ a. Comporte un ADN circulaire unique.
❑ b. ´
A une replication bidirectionnelle à partir de 2 origines de r éplication oriC et
oriT.
❑ c. La fourche de réplication qui se déplace dans un sens synthétise 2 brins fils
de polarité oppos ée parce que l’ADN polymérase I synth étise en 5  =⇒ 3 et
l’ADN polymérase III synthétise en 3 =⇒ 5  .
❑ d. Il y a beaucoup plus de fragments d’Okazaki au niveau du brin principal que du
brin retardé.
❑ e. La fonction de la topoisomérase II est de lever les tours d’hélices
supplémentaires créés par l’hélicase.
D’après concours Nantes

273 Concernant les mécanismes de réplication de l’ADN chez les eucaryotes :


❑ a. La synthèse d’un acide désoxyribonucléique nécessite une amorce amenant une
extrémité 3’OH libre.
❑ b. Les réplicons sont des segments d’ADN plus ou moins grands qui peuvent être
localisés sur un même ADN bicaténaire, dont la réplication peut se faire de
façon simultanée.
❑ c. La polymérisation d’un acide nucl éique s’effectue dans l’orientation 5’ vers 3’
du brin synthétisé dans le même sens que celui de lecture du brin matriciel.
UE 1 • énoncés 101

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Des activités endonucléasiques sont associées aux ADN polymérases-ADN
dépendantes pour permettre la réparation des erreurs d’appariements fr équentes
au cours de la synthèse d’un ADN.
❑ e. Autre réponse.
D’après concours Strasbourg

Niveau difficile

274 Concernant la réplication chez les procaryotes ou les eucaryotes, choisir la ou les
proposition(s) exacte(s) :
❑ a. L’ADN polymérase ε possède une activité exonucléase 5’ vers 3’.
❑ b. L’ADN polym érase III est moins rapide que la polymérase I dans son action de
polymérisation.
❑ c. Les ADN polymérases s’accrochent généralement sur un ADN simple brin.
❑ d. La fixation d’une tyrosine sur l’ADN est un év énement nécessaire à l’action de
la topoisomérase I.
❑ e. La télom érase synthétise les s´
equences t élomériques à partir d’une molécule
d’ADN matrice faisant partie de sa propre structure.
D’après concours Montpellier 1

275 À propos de la réplication et des modifications de l’ADN qui lui font suite :
❑ a. Les protéines SSB permettent de stabiliser la s éparation des 2 brins d’ADN.
❑ b. La primase synthétise une amorce d’ADN nécessaire au démarrage de l’activité
de l’ADN polymérase I.
❑ c. Les fragments d’Okazaki synthétis és par l’ADN polymérase I sont dégrad és
par l’action d’une ADN-exonucléase sur l’ADN r épliqué.
❑ d. L’ADN polymérase III corrige ses propres erreurs (proofreading).
❑ e. La méthylation de l’ADN se fait par transfert du groupement méthyle de la S-
adénosylméthionine sur la cytosine des ilots cytosine-phospho-guanine (CpG)
D’après concours Nancy

276 Concernant les mécanismes de réplication de l’ADN chez les eucaryotes, quelle est
la proposition fausse :
❑ a. La réaction de polymérisation des acides nucléiques par les ADN polymérases
ADN-dépendantes et par les ARN polym érases ADN-dépendantes est catalysée
à partir d’un groupement 3’OH.
❑ b. La synthèse d’un ADN bicaténaire à partir d’une origine de réplication est bi-
directionnelle et simultanée sur les deux brins.
❑ c. Les fragments d’Okazaki sont des fragments longs d’ADN, synthétises
´ par
l’ADN polymérase epsilon (ε).
❑ d. La réparation par correction d’épreuve (proofreading) permet de corriger les er-
reurs d’incorporation de nucléotides effectuées par l’ADN polymérase au cours
de la réplication.
102 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. e. Autre réponse.
D’après concours Strasbourg

Réparation - Mutations
Niveau facile

277 Une mutation ponctuelle introduit un codon TAA dans une séquence nucléique codant
pour une protéine :
❑ a. Elle conduit à un arrêt de la traduction en raison d’un codon stop prématuré.
❑ b. Elle conduit à une modification du cadre de lecture.
❑ c. Elle conduit à une mutation faux sens.
❑ d. Elle conduit à une mutation non sens.
❑ e. Elle constitue un événement rare.
D’après concours Nantes

278 Les mutations pouvant entraı̂ner un décalage du cadre de lecture :


❑ a. Une microinsertion de 2 paires de bases.
❑ b. Une mutation non sens.
❑ c. Une microinsertion de 3 paires de bases.
❑ d. Une mutation faux sens.
❑ e. Une microdélétion d’une paire de bases.
D’après concours Nantes

279 Quelle est la proposition fausse :


❑ a. Une mutation non-sens entraı̂ne l’apparition d’un codon stop.
❑ b. Une mutation non-sens dans un gène non r épété est souvent pathologique.
❑ c. Une variation faux-sens est tres
` souvent pathologique.
❑ d. Certaines variations faux-sens entrainent des pertes de fonction partielles.
❑ e. Autre réponse.
D’après concours Strasbourg

Niveau intermédiaire

280 Cochez la (ou les) réponse(s) exacte(s).


❑ a. Les mutations spontanées sont représent ées uniquement par les erreurs de
réplication.
❑ b. Après la survenue d’une erreur lors d’une réplication de l’ADN, une molécule
d’ADN sur les deux produites lors de la réplication suivante aura fixé la
mutation.
❑ c. La substitution d’une adénine par une guanine est une transition.
❑ d. La substitution d’une thymine par une cytosine est une transversion.
UE 1 • énoncés 103

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. Les microsatellites sont une source de polymorphisme de l’ADN dans l’espèce
humaine.
D’après concours Paris 7

281 Concernant la réparation et la recombinaison du génome :


❑ a. Les agents mutagènes sont exclusivement de nature physique ou chimique.
❑ b. Les seules enzymes de réparation de l’ADN sont des ADN polym érases et des
ligases.
❑ c. Les él éments génétiques mobiles transposons sont pr ésents chez les eucaryotes
et les procaryotes.
❑ d. La recombinaison génétique est un processus spécifique aux eucaryotes.
❑ e. Aucune réponse exacte.
D’après concours Paris 11

282 Une mutation :


❑ a. Faux-sens aboutit à l’obtention d’une prot éine tronquée.
❑ b. Par insertion d’un nucléotide dans un gène entraı̂ne un décalage du cadre de
lecture.
❑ c. Peut se faire lors de la réplication d’un ADN pr ésentant des adduits.
❑ d. Correspond toujours à un changement ph énotypique.
❑ e. Est une transversion si une base purique est remplacée par une base pyrimi-
dique.
D’après concours Nancy

283 Concernant la réparation de I’ADN :


❑ a. La réparation peut se faire au cours de la réplication.
❑ b. L’altération de prot éines de la réparation n’induit pas de pathologies.
❑ c. L’exposition aux UV entraˆıne l’alkylation de I’ADN.
❑ d. Le système NER permet la réparation par excision d’une base.
❑ e. Le système BER permet la réparation par excision d’une base.
D’après concours Rouen

284 Concernant les mécanismes de r éparation et de recombinaison de l’ADN, quelle est


la proposition fausse :
❑ a. La réparation par excision de base (BER) concerne majoritairement des lesions
´
d’origine endog` ene comme la réparation de site abasique obtenu par rupture de
la liaison N-glycosidique du nucléotide.
❑ b. La réparation par excision de nucl éotide (NER) nécessite la reconnaissance du
brin néosynthétisé.
❑ c. Les ADN polymérases-ADN dépendantes impliquées dans la r éplication de
l’ADN peuvent aussi être impliqu ées dans les mécanismes de réparation.
104 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Un événement de recombinaison gen ´ érale homologue peut être visualisé au
cours de la méiose par la formation d’un chiasma entre deux chromosomes.
❑ e. Autre réponse.
D’après concours Strasbourg

285 Concernant les mécanismes de r éparation et de recombinaison de l’ADN, quelle est


la proposition fausse :
❑ a. Les mécanismes de sauvegarde de l’intégrité des ADN font intervenir en par-
ticulier les enzymes de détoxification (cytochomes P450) pr´ esents dans les
cellules.
❑ b. La plupart des mécanismes de réparation peuvent fonctionner en absence d’un
ADN matriciel ou homologue.
❑ c. Le test de Ames (test de mutagénicité) permet de mettre en évidence les pro-
priétés mutag ènes directes ou indirectes d’une mol écule.
❑ d. La recombinaison générale homologue peut avoir lieu pendant la méiose ou en
phase G2 de la mitose.
❑ e. Autre réponse.
D’après concours Strasbourg

Niveau difficile

286 Cochez la (ou les) réponse(s) exacte(s).


❑ a. La dépurination conduit à un arr êt de la réplication.
❑ b. La désamination oxydative de la cytosine conduit à une transversion.
❑ c. Le 5-bromo-uracile est un agent mutagène car il a tendance à être plus
fréquemment sous forme cétone que la thymine.
❑ d. La désamination de l’adénine par l’acide nitreux conduit à une transition
A-G =⇒ G-C.
❑ e. L’inactivation par les UV entraˆıne deux liaisons covalentes entre deux r´
esidus
pyrimidiques adjacents le long du brin d’ADN.
D’après concours Paris 7

287 Cochez la (ou les) réponse(s) exacte(s).


❑ a. Le systeme
` de r éparation des mésappariements (SRM) détecte les erreurs
de réplication : bases mal appari ées et petites mutations/delétions
´ de 1 à 3
nucléotides.
❑ b. Chez la bactérie Escherichia coli, le SRM est compos é de trois protéines prin-
cipales : MutS, MutL et MutH.
❑ c. Des mutations dans les gènes humains homologues des gènes codants pour les
protéines MutS et MutL chez Escherichia coli entraı̂nent une forme particulière
de cancer du colon.
UE 1 • énoncés 105

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Des mutations dans le gène codant pour la prot éine MutS chez les bactéries
peuvent leur être avantageuses dans certaines conditions comme les traitements
antibiotiques.
❑ e. Pour que SRM puisse fonctionner, il faut qu’il ait un moyen de reconnaitre le
brin néosynthétisé.
D’après concours Paris 7

288 Concernant la réparation de l’ADN :


❑ a. Les protéines MutS et MutL détectent les mésappariements de l’ADN.
❑ b. Lors de l’activation du système SOS, la protéine Rec A est capable de dégrader
son répresseur la protéine LexA.
❑ c. Les mésappariements produits lors de la replication
´ sont corrigés par le système
de réparation par excision-réparation de base (BER).
❑ d. Les dimères de thymine sont corrigés par l’action d’une ADN glycosylase.
❑ e. Le systeme` de r éparation par excision de nucléotides (NER) reconnaı̂t les bases
altérées.
D’après concours Paris 11

289 Concernant la réparation de l’ADN :


❑ a. Les analogues de bases, comme le 5-bromouracile ou la 2-aminopurine, sont
des agents mutagènes qui s’intercalent dans la double hélice d’ADN et créent
des insertions ou des délétions.
❑ b. La réparation par excision de base met en jeu des enzymes de modification
de l’ADN comme les DNA N-glycosylases, les AP endonucléases et les ADN
polymérases.
❑ c. La réparation des mésappariements permet de corriger une base mal appariée
située sur le brin d’ADN méthyl é.
❑ d. Xeroderma pigmentosum est une maladie her ´ éditaire de la réparation de l’ADN
causée par un dysfonctionnement du syst ème NER (nucleotide excision repair).
❑ e. Le cancer colo-rectal hér éditaire non polypomateux (HNPCC) est causé par
des mutations qui perturbent le fonctionnement du système de r éparation des
mésappariements.
D’après concours Paris 12

290 Concernant les dimères de thymine :


❑ a. Leur formation est induite par l’absorption de rayons X par les bases de l’ADN.
❑ b. Ces dimères interfèrent avec la transcription et la réplication de l’ADN.
❑ c. Dans l’espèce humaine, les liaisons covalentes qui forment les dimères peuvent
être réparées directement par photoréactivation.
❑ d. Chez E. coli, la réparation de ces lésions de l’ADN met en jeu un mécanisme
enzymatique.
❑ e. Le mécanisme appel é  Uvr ABC répare ces lésions après les avoir excisées.
D’après concours Paris 12
106 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


291 Concernant les mécanismes de réparation des mutations :
❑ a. L’ADN photolyase est l’enzyme de réparation des dim ères de thymine.
❑ b. L’excision de nucléotides n’est jamais utilisée pour la réparation des dimères
de thymines.

|
m
o
c
❑ c. L’excision d’une mutation C=⇒U utilise une uracile glycosylase.

t.
o
p
s
g
❑ d. Le Xeroderma pigmentosum est une maladie génétique humaine caractéris ée

lo
.b
s
par un défaut d’activité du systeme
` d’excision de nucléotides.

in
c
e
d
e
Les mutations peuvent être provoquées par des radiations ionisantes.

m
❑ e.

s
e
rd
D’après concours Lille

o
s
e
tr
e
/l
:/
p
Transcription

tt
h
|
m
o
.c
Niveau facile

s
s
re
p
rd
o
292 Concernant la transcription et la maturation des ARN :

.w
s
in
c
e
Le facteur sigma est indispensable à l’élongation de la transcription chez la
d
❑ a.
e
m
s
bactérie.
e
rd
o
s

L’ARN polymérase I eucaryote est insensible à l’actinomycine D.


e

❑ b.
tr
e
/l
:/
p

❑ c. L’ARN polymérase I eucaryote transcrit l’ensemble des gènes des ARN


tt
h
|

ribosomaux.
s
in
c
e
d

❑ d. Les régions introniques d’un gène sont toujours présentes dans l’ADN après
e
M
s
e

épissage.
rD
o
s
re

❑ e. Toute néosynthèse d’acide nucléique procède d’un allongement 5’P vers 3’OH.
T
e
/L
s

D’après concours Paris 11


p
u
ro
/g
m
o
.c

293 Concernant la transcription chez les eucaryotes :


k
o
o
b
e
c

❑ a. Les gènes des ARN ribosomaux et des prot´


eines sont transcrits par diff érentes
a
.f
w
w

ARN polymérases.
w
|
s
in

❑ b. La poly- adénylation en 3’OH des ARN messagers résulte de la transcription


c
e
d
e

d’une séquence polyT.


M
s
e
rD

❑ c. La coiffe des ARN messagers résulte de l’ajout d’un nucléotide 7-méthyl GTP.
o
s
re
T

❑ d. La transcription eucaryote n’est pas initiée par la protéine sigma.


e
/L
m
o

❑ e. La synthèse d’une amorce est nécessaire.


.c
k
o
o
b

D’après concours Paris 11


e
c
a
.f
w
w
w

294 Les exons :


|

❑ a. font partie du brin sens des gènes.


❑ b. font partie du brin antisens des gènes.
❑ c. font partie des transcrits primaires.
❑ d. font partie des ARN messagers (ARNm).
❑ e. sont tous codants.
D’après concours Paris 6
Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
UE 1 • énoncés 107

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


295 Cochez la (ou les) réponse(s) exacte(s).
❑ a. Les facteurs généraux de transcription sont utilisés pour initier la fixation de
l’ARN polymérase sur l’ADN.
❑ b. L’ARN polymérase ne recopie jamais les introns.
❑ c. La coiffe consiste en une modification chimique de l’extrémité 5’ du pré-
ARNm.
❑ d. La polyadénylation modifie l’extrémité 5’ du pr é-ARNm.
❑ e. Lors de la formation de la coiffe, une 7-méthylhistidine est incorporée sur le
pré-ARNm.
D’après concours Lille

296 Concernant les ARNm eucaryotes et les gènes qui les codent :
❑ a. Un facteur d’initiation de la traduction interagit avec la coiffe des ARN
messagers.
❑ b. Certaines protéines se liant à la séquence poly-A des ARN messagers protègent
ceux-ci de la dégradation.
❑ c. Chaque gène codant pour un ARN messager est transcrit à partir d’un promo-
teur unique.
❑ d. L’épissage alternatif ne concerne que les régions 3’ non codantes des pré-ARN
messagers.
❑ e. L’épissage alternatif ne se déclenche que dans les cellules cancéreuses.
D’après concours Strasbourg

297 Un segment de la séquence d’un gène de souris est schématisé ci-dessous. L’adénosine
A soulignée correspond au site d’initiation de la transcription :
5’-CTATAATGATCCGACGCACGTGGGACCGGCATGCC-3’
Parmi les propositions suivantes, lesquelles sont exactes :
❑ a. Ce segment fait partie d’un enhancer.
❑ b. Ce segment fait partie d’un promoteur.
❑ c. La séquence contactée par la protéine TBP est présente dans le segment
schématisé.
❑ d. La séquence contactée par la protéine TBP est en aval, c’est-a-dire
` au-del à et à
droite du dernier nucléotide 3’ schématisé.
❑ e. Après transcription de 3 nucléotides, l’ARN est un trinucléotide 3’-AUG-5’.
D’après concours Strasbourg

298 Concernant les ARN non codants appelés micro-ARN :


❑ a. Ils agissent en inhibant la transcription des gènes cibles.
❑ b. Ils agissent en inhibant la traduction d’ARN messagers cibles.
❑ c. Ils agissent en induisant la dégradation d’ARN messagers cibles.
108 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Ils se lient souvent à des séquences situées dans les régions 3’ non traduites des
gènes.
❑ e. Ils se lient souvent à des séquences situées dans les régions 3’ non traduites des
ARN messagers.
D’après concours Strasbourg

299 Concernant les réactions d’excision des introns et d’épissage des exons :
❑ a. Le snRNA U1 s’apparie aux nucléotides du site de branchement.
❑ b. Au cours de la deuxième r éaction de transestérification, une adénosine faisant
partie du site de branchement réagit au niveau de son groupement OH en 3’.
❑ c. Le site de branchement est en général plus proche du site accepteur que du site
donneur d’épissage.
❑ d. Après les réactions de transestérification, l’ADN exonique a une structure ra-
mifiée dite en lasso.
❑ e. Autre réponse.
D’après concours Strasbourg
Niveau intermédiaire

300 Cochez la (ou les) réponse(s) exacte(s).


❑ a. La taille moyenne d’un gène humain est de 30 Kb.
❑ b. Les introns ont toujours une taille moyenne inférieure a` celle des exons.
❑ c. Les ARNr entrent dans la composition des ribosomes.
❑ d. Les miRNA sont de petites molécules simple brin.
❑ e. Deux gènes chevauchant sont toujours transcrits à partir du même brin.
D’après concours Lille

301 Le facteur TFIID :


❑ a. est un facteur de transcription.
❑ b. se fixe sur le promoteur des genes.`
❑ c. est une protéine de liaison à l’ADN.
❑ d. interagit avec la boı̂te CAAT.
❑ e. est associé à l’ARN polymérase II jusqu’a` la fin de la transcription.
D’après concours Paris 6

302 À propos de la séquence GTTACCAAC située en amont du codon initiateur ATG


dans le deuxième exon du gène de l’apolipoprotéine A-II :
❑ a. Les deux brins d’ADN de cette séquence sont unis par 22 liaisons hydrogènes.
❑ b. Sur le brin sens, cette séquence est situ ée en 3’ par rapport au premier intron.
❑ c. Cette séquence se retrouvera dans le transcrit primaire.
❑ d. Cette séquence se retrouvera dans l’ARNm.
❑ e. Cette séquence sera traduite.
D’après concours Paris 6
UE 1 • énoncés 109

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


303 Sachant que la séquence du brin sens correspondant au premier nucléotide transcrit
du gène de l’apolipoprotéine A2 est 5’-AGGCACAGAC-3’, indiquez la/les proposition(s)
exacte(s) :
❑ a. Cette séquence fait partie de la région 5’ non codante du gène.
❑ b. Cette séquence est située à plusieurs centaines de nucl éotides de la boite TATA.
❑ c. Cette séquence sert de matrice à l’ARN polymérase II pour la synthèse d’ARN
messager.
❑ d. La double hélice d’ADN correspondant à cette séquence comporte 24 liaisons
hydrog`
enes.
❑ e. Dans l’ARNm de l’apolipoprotéine A2, la coiffe 7-méthyl-guanosine triphos-
phate est liée à un adénylate.
D’après concours Paris 6

304 Concernant les microARN :


❑ a. Ce sont des ARN non codant.
❑ b. Ce sont des ARN codant de petite taille.
❑ c. Ils sont synthétisés par l’ARN polymérase II.
❑ d. La maturation du pri-miARN en pré-miARN a lieu dans le noyau.
❑ e. Leur rôle est d’activer la traduction.
D’après concours Paris 11

305 Concernant les modifications de l’extrémité 5’ des ARNm :


❑ a. Une hélicase intervient lors de cette modification.
❑ b. Une liaison 5’ → 3’ triphosphate se forme entre du GMP et l’extrémité 5’ du
transcrit primaire.
❑ c. La guanosine terminale est m éthylée sur sa guanine.
❑ d. Les enzymes nécessaires à cette modification font partie du splicéosome.
❑ e. Ces modifications évitent à l’extrémité 5’ d’être digérée par les enzymes de
restriction.
D’après concours Paris 11

306 Cochez la (ou les) réponse(s) exacte(s).


❑ a. Le promoteur d’un gène détermine l’endroit reconnu par le complexe
transcriptionnel.
❑ b. L’ARN polymérase transcrit toujours les deux brins de l’ADN.
❑ c. Lors de la transcription, le brin d’ARN synthétise´ poss ède un message
gén étique complémentaire du brin d’ADN matrice.
❑ d. L’ARN polymérase recopie le brin codant de l’ADN.
❑ e. L’ARN polymérase libère une molécule d’ARN double-brin.
D’après concours Lille
110 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


307 Concernant l’extrémité C terminale phosphorylée de l’ARN polymérase II, choisir la
ou les proposition(s) exacte(s).
❑ a. Elle favorise la liaison des facteurs généraux de la transcription à l’ARNpol II.
❑ b. Elle facilite la liaison de l’ARN pol II avec des facteurs d’élongation.
❑ c. Elle lie des facteurs indispensables à la maturation de l’ARN messager.
❑ d. Elle lie des facteurs permettant la polyadénylation de l’ARN messager.
❑ e. Elle effectue la traduction de l’ARN messager.
D’après concours Montpellier 1

Niveau difficile

308 Concernant le processus de régulation de l’expression g énique :


❑ a. TFIIB comprend la sous-unité TBP.
❑ b. TBP ne se lie pas à l’ADN.
❑ c. Chez les eucaryotes, il existe de nombreux facteurs de transcription.
❑ d. La phosphorylation du domaine CTD par TFIIH permet le déplacement de
l’ARN polymérase alpha jusqu’au lieu d’origine de la transcription.
❑ e. L’ARN polymérase II se fixe sans protéines intermédiaires (facteurs de trans-
cription) sur l’ADN.
D’après concours Dijon

309 Concernant le mécanisme d’épissage :


❑ a. Plusieurs snRNP catalysent la réaction d’épissage par excision.
❑ b. Les snRNP sont constitués de petits ARNsno et de prot éines.
❑ c. Le spliceosome réalise l’épissage d’un pré-ARNm donné pour produire tou-
jours le même ARNm mature.
❑ d. Le snRNP U2 reconnaı̂t le site A de branchement.
❑ e. Il nécessite l’hydrolyse de nombreuses molécules d’ATP.
D’après concours Lyon 1

310 L’épissage alternatif :


❑ a. Peut entraı̂ner l’excision d’un exon.
❑ b. Peut entraı̂ner l’épissage de deux introns.
❑ c. A lieu dans le cytoplasme.
❑ d. Peut entraı̂ner la synthèse d’ARN messagers différentsà partir d’un même gène.
❑ e. Peut entraı̂ner la synthèse de protéines différentes à partir d’un même gène.
D’après concours Paris 6
UE 1 • énoncés 111

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


311 Au cours de l’épissage des transcrits primaires :
❑ a. La reconnaissance du site donneur par le snRNP U1 est facilitée par le facteur
protéique ASF/SF2.
❑ b. Le snRNP U4 est un inhibiteur du snRNP U6.
❑ c. Les snRNP U1, U5 et U6 interagissent avec le site d’épissage 5’.
❑ d. Le snRNP U5 facilite l’alignement des exons.
❑ e. La première liaison de transestérification est une liaison phosphodiester 2’-5’
entre une adénine du site de branchement et une guanine appartenant à l’exon
en amont
D’après concours Nancy

Traduction
Niveau facile

312 Concernant la séquence codante d’un gène :


❑ a. Elle fait partie de l’ARNm.
❑ b. Elle est traduite par les ribosomes au cours de la traduction.
❑ c. Elle est située entre le codon AUG et le codon stop.
❑ d. Elle ne comprend pas d’introns.
❑ e. Elle comprend tous les exons dans leur intégralité.
D’après concours Paris 6

313 Concernant la traduction :


❑ a. Excepté le tryptophane, chaque acide amine´ est spécifi é par plusieurs codons.
❑ b. La coiffe d’un ARN messager eucaryote participe à l’initiation de la traduction.
❑ c. La lecture d’un ARN messager s’effectue de 3’OH vers 5’P.
❑ d. D’une séquence peptidique unique, on peut remonter à plusieurs séquences
d’ADN.
❑ e. D’une s´
equence nucléotidique unique, on peut former plusieurs séquences pep-
tidiques différentes.
D’après concours Paris 11

314 Le polynucléotide 5’-CCCAUGUUUAAAAGAUGAAUGUAG-3’ code pour le tétrapeptide :


Met-Phe-Lys-Arg. Le A souligné est transformé en G par mutation.
Le peptide synthétis é sera :
❑ a. Met-Phe-Lys-Arg.
❑ b. Met-Phe-Lys-Arg-Met-Trp.
❑ c. Met-Phe-Lys-Arg-Trp-Met.
❑ d. Met-Phe-Lys-Arg-Trp-Met-Trp.
❑ e. Met-Phe-Lys-Arg-Trp.
D’après concours Paris 11
112 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


315 Cochez la (ou les) réponse(s) exacte(s).
❑ a. L’aminoacyl-ARNt-synthétase de l’arginine reconnaı̂t aussi la lysine.
❑ b. L’ARN polymérase II permet la transcription des ARNs prémessagers.
❑ c. Un même messager peut donner naissance à des proteines
´ diff érentes dans des
tissus différents.
❑ d. La traduction nécessite de l’énergie sous forme de GTP .
❑ e. La polyadénylation des ARN prémessagers se fait dans le cytoplasme.
D’après concours Paris 12

316 Concernant le code génétique :


❑ a. La séquence nucléotidique est lue sur l’ARN messager sous forme de codons
successifs de 3 nucléotides non chevauchants.
❑ b. Certains acides aminés peuvent être codés par des codons multiples dits
synonymes.
❑ c. La propriét é de non-dégénérescence implique que deux codons différents ne
peuvent pas coder pour un même acide aminé.
❑ d. d. La propriété de non-ambigu¨ıté implique qu’un codon donn é ne peut pas coder
pour deux ou plusieurs acides aminés.
❑ e. e. Les signaux dits de ponctuation sont des codons d’initiation et de terminaison
qui ne codent pour aucun acide aminé.
D’après concours Strasbourg

317 Quelle est la proposition fausse :


❑ a. Les ARN de transfert portent a` l’extrémit é 3’ une séquence CCA ajout´
ee par
modification post-transcriptionnelle.
❑ b. Il y a pour chaque acide aminé autant d’amino-acyl ARNt synthétases
différentes que d’ARNt iso-accepteurs diff érents.
❑ c. L’acide aminé est transféré sur l’ARNt à partir d’une forme activée amino-acyl
adénylate.
❑ d. C’est l’alignement précis de l’extrémité 3’ des 2 ARNt par rapport au grand
ARN de la grande sous-unité ribosomique qui permet la synthèse de la liaison
peptidique.
❑ e. e. Autre réponse.
D’après concours Strasbourg

Niveau intermédiaire

318 Concernant l’étape de traduction d’un gène dont le début de la séquence codante est
représenté ci-dessous à partir du codon initiateur :
ATGAAGCTGCTCGCAGCAACTGTGCTACTCCTCACCATCTGCAGCCTTGAA
❑ a. Au cours de la traduction, le premier ARNt qui se fixera sur le site A du ribo-
some aura pour anticodon la séquence UUC.
UE 1 • énoncés 113

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. Le peptide synthétis e´ débutera par la séquence Met-Phe-Val-Val.
❑ c. La traduction de cette séquence nécessitera le cofacteur eIF2.
❑ d. La traduction de cette séquence nécessitera le cofacteur eEF2.
❑ e. Cette séquence peut coder pour un peptide signal.
D’après concours Paris 6

319 La séquence complémentaire d’un ADN codant 4 m éthionines consecutives


´ est :
❑ a. 5’P-ATGATGATGATG-3’OH ❑ b. 5’P-GTAGTAGTAGTA-3’OH
❑ c. 5’P-TACTACTACTAC-3’OH ❑ d. 5’P-CATCATCATCAT-3’OH
❑ e. 5’P-AUGAUGAUGAUG-3’OH
D’après concours Paris 11

320 Concernant la traduction et le code génétique :


❑ a. Procaryotes et eucaryotes utilisent UAG comme codon d’initiation de la
traduction.
❑ b. La synthèse peptidique procède d’un allongement du NH2 vers le COOH.
❑ c. La liaison peptidique est catalysée dans le ribosome par une amino-acyl ARNt
synthétase.
❑ d. Le code génétique est qualifi é de dégén éré car un m ême codon peut sp´
ecifier
plusieurs acides aminés.
❑ e. Les ARN messagers codant les protéines ribosomales sont traduits dans le
noyau.
D’après concours Paris 11

321 L’ARNt :
❑ a. est appelé  t  à cause de sa structure en feuille de trefle.
`
❑ b. ne présente que des structures hélicoı̈dales.
❑ c. possède des bases atypiques comme l’inosine ou la dihydrouridine.
❑ d. possède en moyenne 20% de nucléotides invariants.
❑ e. possède toujours une boucle de l’anticodon impliquée dans la traduction du
message gén étique.
D’après concours Nancy

322 Concernant la boucle anticodon, quelle est la proposition fausse :


❑ a. La séquence anticodon est portée par la boucle d’une structure en épingle à
cheveux de l’ARNt.
❑ b. L’anticodon s’apparie de façon complémentaire et antiparall èle avec un codon
de l’ARNm.
❑ c. La base en position 1 de l’anticodon peut être l’hypoxanthine.
❑ d. Un anticodon portant une guanine en position 1 peut s’apparier avec n’importe
lequel des quatre codons codant pour un meme
ˆ acide aminé.
114 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. Autre réponse.
D’après concours Strasbourg

Niveau difficile

323 L’ARN de transfert (ARNt) dont l’anticodon est CGA :


❑ a. lie un acide aminé à son extrémité 5’ .
❑ b. lie un acide aminé par l’intermediaire
´ d’une liaison anhydride.
❑ c. est un substrat de la Sérine ARNt synthétase.
❑ d. comporte une base flottante qui est l’adénine.
❑ e. peut occuper le site P des ribosomes.
D’après concours Paris 6

324 L’ARNti-méthionine :
❑ a. Consomme 2 liaisons riches en énergie pour sa synthèse à partir de l’ARNt et
de la méthionine.
❑ b. Comporte l’anticodon UAC.
❑ c. Comporte une base flottante.
❑ d. Sa liaison à l’ARNm détermine le cadre de lecture.
❑ e. Peut occuper le site P du ribosome.
D’après concours Paris 6

325 Le code génétique a été élucidé en partie à l’aide d’expériences dans lesquelles des
polynucléotides de séquences répétées ont été utilisés comme ARNm pour diriger la synthèse
protéique.
Les expériences ont ét é menées in vitro à l’aide d’extraits acellulaires. La présence d’un
codon d’initiation de la traduction n’est pas nécessaire dans les conditions expérimentales
utilisées.
Choisissez la ou les proposition(s) exacte(s) à proposdes séquences suivantes :
(1) UUUUUUUUUUUU...
(2) AUAUAUAUAUAU...
(3) AUCAUCAUCAUC...
❑ a. L’ARN (1) permet la synthèse d’un polymère de phénylalanine.
❑ b. L’ARN (2) code pour un polymère d’isoleucine et de tyrosine alternées.
❑ c. Tous les peptides synthétisés à partir de l’ARN (2) commenceront par une
isoleucine.
❑ d. La traduction de l’ARN (3) peut conduire à un mélange de peptides qui diffèrent
par la nature des acides aminés qu’ils contiennent.
❑ e. Dans le deuxième cadre de lecture, l’ARN (3) code pour un peptide composé
de sérine.
D’après concours Montpellier 1
UE 1 • énoncés 115

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


326 À propos des facteurs impliqués dans l’initiation de la traduction chez les eucaryotes :

❑ a. Le facteur eiF2 permet le chargement du premier ARNt sur la petite sous-unité


ribosomale.
❑ b. La phosphorylation de eiF2 bloque la traduction en empêchant la formation du
complexe eiF2-GTP.
❑ c. Le facteur eiF4 est composé de 3 sous-unités dont une possède une activité
hélicase qui aide à localiser le codon initiateur de la traduction.
❑ d. Le facteur eiF4E reconnaı̂t la coiffe en 5’ du transcrit.
❑ e. L’insuline favorise l’interaction entre eiF4E et eiF4G.
D’après concours Nancy

Régulation - expression génétique


Niveau facile

327 Cochez la (ou les) réponse(s) exacte(s).


❑ a. Un gène peut coder plusieurs formes d’une même proteine.
´
❑ b. Sur un chromosome, les deux brins de l’ADN sont porteurs de gènes chez les
eucaryotes.
❑ c. La méthylation du promoteur d’un g ène de l’ADN influence le niveau de trans-
cription de ce gène.
❑ d. Des éléments influençant la transcription d’un g ène peuvent se trouver à dis-
tance de celui-ci.
❑ e. Chez les eucaryotes l’organisation des gènes est monocistronique.
D’après concours Paris 12

328 Concernant la méthylation de l’ADN des mammifères, quelle est la proposition fausse :

❑ a. La méthylase de l’ADN ajoute un groupement méthyle aux cytosines et aux


guanines des dinucléotides CpG et GpC.
❑ b. La désamination d’une cytosine donne un uracile.
❑ c. La désamination d’une cytosine méthylée donne une thymine.
❑ d. Les dinucléotides CpG sont des points chauds de mutation.
❑ e. e. Autre réponse.
D’après concours Strasbourg

Niveau intermédiaire

329 Un gène inductible de procaryote comporte :


❑ a. un opérateur inactivable par le répresseur.
❑ b. un promoteur, site de fixation de l’ARN polymérase.
❑ c. un répresseur, pouvant être inactivé par un substrat.
116 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. un cistron, codant pour plusieurs protéines.
❑ e. un signal d’attenuation,
´ constitué d’un excès de substrat
D’après concours Paris 5

330 Un gène répressible de procaryote comporte :


❑ a. une région promotrice en amont du g ène.
❑ b. un promoteur où se fixe l’ARN polymérase.
❑ c. un opérateur qui fixe le répresseur.
❑ d. un répresseur inactivé par le substrat.
❑ e. des séquences traduites mais non transcrites.
D’après concours Paris 5

331 Dans la régulation de l’opéron lactose plusieurs facteurs interviennent :


❑ a. L’AMP cyclique induit la répression de la transcription de l’opéron.
❑ b. Le lactose induit l’activation de l’operon.
´
❑ c. L’AMP cyclique interagit avec le répresseur LacI.
❑ d. Le lactose induit l’inactivation du répresseur LacI.
❑ e. Le glucose inactive directement l’ARN polymérase.
D’après concours Lyon 1

332 Cochez la ou les proposition(s) exacte(s) :


❑ a. L’expression d’un gène aboutit toujours à la formation d’une protéine.
❑ b. La transcription d’un gène d ébute au niveau du signal ATG (codon d’initiation)
❑ c. Un même gène ne peut coder pour des prot éines distinctes.
❑ d. La régulation de l’expression des gènes par les micro-ARNs s’exerce à un ni-
veau post-traductionnel.
❑ e. Toutes les propositions précédentes sont fausses.
D’après concours Nice

333 Concernant les facteurs de régulation transcriptionnelle agissant par liaison directe à
l’ADN :
❑ a. La plupart d’entre eux sont recrutés par le facteur TFIID et se lient à l’ADN du
promoteur.
❑ b. La plupart d’entre eux se lient à l’ADN des enhancers caractérisés par leur
séquence r ép étée (100 à 200 r épétitions de dinucl éotides CpG).
❑ c. Parmi eux on trouve les récepteurs à la vitamine D et aux hormones
thyro¨ıdiennes.
❑ d. Parmi eux on trouve les récepteurs à l’insuline et aux facteurs de croissance
FGF.
❑ e. Parmi eux on trouve des protéines à homéodomaines.
D’après concours Strasbourg
UE 1 • énoncés 117

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


334 Quelle est la proposition fausse ?
❑ a. La régulation transcriptionnelle des gènes eucaryotes transcrits par l’ARN po-
lymérase II fait intervenir un grand nombre de protéines.
❑ b. Les protéines à activité histone acétyl-transférase ont en général un rôle inhibi-
teur de la transcription.
❑ c. Des protéines dites corepresseurs peuvent jouer un rôle inhibiteur de la trans-
cription en l’absence de toute liaison à l’ADN.
❑ d. Des protéines activatrices de la transcription peuvent dans certains cas avoir un
effet inhibiteur de la transcription.
❑ e. Autre réponse.
D’après concours Strasbourg

Niveau difficile

335 La boˆıte TATA :


❑ a. Est un facteur trans-régulateur.
❑ b. Interagit avec TFIID par l’intermédiaire des 2 brins de l’ADN.
❑ c. Son accessibilité au complexe d’initiation de la transcription est conditionn ée
par l’état de la chromatine.
❑ d. Est localisée en 5’ par rapport à la boı̂te CAAT sur le brin sens.
❑ e. Est localisée en 5’ par rapport au site d’initiation de la transcription sur le brin
anti-sens.
D’après concours Paris 6

336 Indiquez la famille de protéines régulatrices de l’expression des gènes qui se dimérisent
par l’intermédiaire d’interactions hydrophobes.
❑ a. Les protéines à motif à doigts de zinc.
❑ b. Les protéines à motif à rép étition de leucine.
❑ c. Les protéines à motif hélice-tour-hélice.
❑ d. Les facteurs de transcription eIF2 et eIF2B.
❑ e. Les protéines à motif hélice-boucle-hélice.
D’après concours Paris 11

337 Lors du fonctionnement de l’opéron tryptophane d’Escherichia coli, une mutation


dans le gène r égulateur a conduit à la synthèse d’un répresseur qui s’est fixé à I’ADN en
l’absence de tryptophane.
❑ a. Toutes les enzymes de la voie de biosynthèse du tryptophane sont synthétisées
en permanence.
❑ b. Deux des cinq enzymes de la voie de biosynthèse du tryptophane ne sont plus
synthétisées en permanence.
❑ c. Les enzymes de la voie de biosynthèse du tryptophane ne sont plus synthétisées.
118 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Un plasmide introduit dans la bacterie
´ avec un g ène régulateur fonctionnel peut
corriger cette anomalie.
❑ e. Un plasmide introduit dans la bactérie avec un g ène régulateur fonctionnel ne
peut pas corriger cette anomalie.
D’après concours Paris 11

338 Concernant la transcription :


❑ a. Dans la majorité des cellules, la plupart des gènes est constamment exprimée.
❑ b. L’acétylation des lysines des histones influence l’état de condensation de la
chromatine.
❑ c. La méthylation de I’ADN est une modification h éréditaire.
❑ d. Le  remodelage de la chromatine  est irréversible.
❑ e. La durée de vie des ARNm est régulée.
D’après concours Rouen

Techniques d’analyse du génome


Niveau facile

339 Le gel de polyacrylamide réalisé pour d éterminer la séquence d’un fragment d’ADN
selon la méthode de Sanger est présenté ci-dessous. Chaque indication en haut du gel : G, A,
T, C correspond à l’incubation en pr ésence de l’un des 4 didésoxynucléosides triphosphate.

La séquence du fragment d’ADN matrice est :


❑ a. 5’-GGGCCCACTGAGACATTTGTA-3’
❑ b. 5’-CCCGGGTGACTCTGTAAACAT-3’
❑ c. 5’-ATGTTTACAGAGTCACCCGGG-3’
❑ d. 5’-TACAAATGTCTCAGTGGGCCC-3’
❑ e. 5’-GGGGGAAAAATTTTTCCCCCC-3’
D’après concours Paris 11
UE 1 • énoncés 119

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


340 Une recherche de paternité a été r éalisée par la technique d’empreinte gén étique. Une
réaction de PCR utilisant des amorces encadrant un locus microsatellite a été effectu ée sur des
échantillons d’ADN provenant de la mère (M), de l’enfant (E) et de cinq hommes différents
(a, b, c, d, e). Parmi les 5 pères proposés, lesquels pouvez-vous éliminer ?

❑ a. Individu a ❑ b. Individu b ❑ c. Individu c


❑ d. Individu d ❑ e. Individu e
D’après concours Paris 11

341 Concernant la PCR :


❑ a. La dénaturation de l’ADN s’effectue par la soude.
❑ b. L’enzyme utilisée est une ADN polymérase d égradée par la chaleur.
❑ c. Les amorces sont des molécules d’ADN simple brin
❑ d. Une des 2 amorces est étendue par I’ADN polym érase de 5’ en 3’ et l’autre de
3’ en 5’.
❑ e. Chaque cycle comprend 3 étapes dans l’ordre suivant : hybridation des amorces,
dénaturation, extension des amorces.
D’après concours Rouen

342 Concernant le séquençage de I’ADN selon la méthode de Sanger :


❑ a. Des brins d’ADN double brin sont synth étisés par I’ADN polymérase à partir
d’une amorce d’ADN simple brin.
❑ b. Des brins d’ADN complémentaires de l’ADN séquencé sont synthétisés.
❑ c. Lorsqu’un désoxyribonucl éotide est incorporé, la synthèse peut continuer.
❑ d. Lorsqu’un didésoxyribonucléotide est incorporé, la synthèse peut continuer.
❑ e. Chaque désoxyribonucléotide est marqué par un fluorophore différent.
D’après concours Rouen

343 Parmi les propositions suivantes, indiquez la ou les proposition(s) exacte(s) :


❑ a. Les enzymes de restriction sont des endonucléases d’origine virale.
❑ b. Les enzymes de restriction utilisés couramment en biologie moléculaire recon-
naissent une structure palindromique
❑ c. La reverse transcription permet de synthétiser une molecule
´ d’ARNm.
❑ d. La reverse transcription nécessite une amorce ou des amorces d’oligonucléotide
simple brin.
❑ e. La reverse transcription peut être suivie de PCR ce qui permet, indirectement,
d’amplifier l’ARNm.
D’après concours Rouen
120 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


344 Concernant les vecteurs utilisés en biologie moléculaire :
❑ a. Les plasmides sont des petites molécules d’ADN monocaténaire.
❑ b. Les plasmides sont d’origine bactérienne.
❑ c. Les plasmides contiennent des gènes de résistance aux antibiotiques.
❑ d. Les plasmides permettent de cloner des fragments de l’ordre de 1000 kb.
❑ e. Les plasmides contiennent des séquences télomériques
D’après concours Rouen

345 Concernant la méthode de Southern :


❑ a. La méthode de Southern s’effectue sur l’ADN.
❑ b. La méthode de Southern n écessite d’amplifier l’ADN.
❑ c. La méthode de Southern nécessite de digérer l’ADN avec des enzymes de
restriction.
❑ d. La migration électrophorétique s’effectue apres
` le transfert de l’ADN du gel
vers un film.
❑ e. Le transfert de l’ADN du gel vers un film après migration s’effectue après avoir
dénatur é l’ADN par la chaleur.
D’après concours Rouen

346 Parmi les propositions suivantes, indiquez la (les) proposition(s) exacte(s) :


❑ a. Les 3 étapes de chaque cycle de PCR sont dans l’ordre : hybridation des
amorces, dénaturation de l’ADN extension des amorces.
❑ b. Dans la PCR, la séquence cible est amplifiée avec des amorces double brin.
❑ c. Dans la PCR la séquence cible est amplifiée de façon linéaire.
❑ d. Dans le séquençage de l’ADN par la méthode de Sanger, la réaction s’arrête
lorsqu’un désoxyribonucléotide est incorporé.
❑ e. Dans le séquençage de l’ADN par la méthode de Sanger, la réaction s’arrête
lorsqu’un didésoxyribonucléotide est incorporé.
D’après concours Rouen

347 Quelle paire d’amorces permet d’amplifier par PCR la séquence d’ADN ci-dessous ?
(NB : un seul brin est représenté ; les r égions ciblées pour définir les amorces sont indiquées
en gras).
5’-GGTAAGGGCGGTCGCCTGGCGCTCCACTGTAGTGGGCGAGCCTGCA
GACGACCGCACGGCAGCTCCGGAGTCGGCGGCTCCAGGCTCCCTCCCCG
GAATCACATTCCAGAATCCCCGCACGGCTTCCCAGTGCAGATT-3’
❑ a. 5’-GGTAAGGGCG-3’ et 5’-AGTGCAGATT-3’
❑ b. 5’-CCATTCCCGC-3’ et 5’-AATCTGCACT-3’
❑ c. 5’-CGCCCTTACC-3’ et 5’-AGTGCAGATT-3’
❑ d. 5’-GGTAAGGGCG-3’ et 5’-AATCTGCACT-3’
❑ e. Autre réponse.
D’après concours Strasbourg
UE 1 • énoncés 121

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


348 Parmi les propositions suivantes concernant le clonage d’un acide nucléique dans un
plasmide, laquelle est fausse :
❑ a. Il fait intervenir des bactéries.
❑ b. Il nécessite une s élection par un antibiotique pour éliminer les bactéries qui
n’ont pas intégré le plasmide.
❑ c. Il permet d’amplifier une molécule d’ADN donnée.
❑ d. L’acide nucléique inséré dans le plasmide peut être un ADN ou un ARN.
❑ e. Autre réponse.
D’après concours Strasbourg

349 Concernant l’hybridation moléculaire :


❑ a. C’est une technique spécifique aux acides nucléiques animaux.
❑ b. L’acide nucléique hybride formé apparie les bases A avec G et C avec T des
deux brins d’orientation parallèle.
❑ c. L’hybridation moléculaire résulte en la formation de liaisons covalentes entre
les bases A et T et G et C respectivement, des deux brins d’acide nucléique
d’orientation antiparallèle.
❑ d. La température d’hybridation dépend de la composition en bases, de la longueur
des acides nucléiques, et de la force ionique du milieu d’hybridation.
❑ e. Autre réponse.
D’après concours Strasbourg

350 Concernant la technique de PCR :


❑ a. Il s’agit de la Polymérisation des Cartes de Restriction établie en utilisant plu-
sieurs enzymes de restriction pour reconstituer la carte physique du gène étudié.
❑ b. C’est la synthèse du brin compl émentaire à la matrice d’ADN, en utilisant les
didésoxynucléotides (ddNTP) comme substrats.
❑ c. C’est l’amplification exponentielle d’un fragment d’ADN spécifiquement born é
par des amorces choisies.
❑ d. C’est une technique qui permet d’analyser les acides nucléiques quelle que soit
leur origine (animale ou végétale, vivant ou mort).
❑ e. Autre réponse.
D’après concours Strasbourg

Niveau intermédiaire
122 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


QCM n◦ 351 à 353 : L’effet hypertenseur d’AGTII comme celui d’AGTIII est médié par un
récepteur, le récepteur de l’angiotensine II (AGTR1), possédant sept domaines transmem-
branaires et couplé aux protéines G.
Le gène codant pour ce récepteur est localisé en 3q21 et possède plusieurs exons répartis sur
55 kilobases.
Sa transcription peut produire quatre variants d’épissage AGTR1A à D, le variant A étant le
plus court, les variants B, C et D étant de plus en plus longs.
La protéine traduite à partir de la forme B possède une affinité plus faible pour l’angiotensine
II que la forme A.

D’après concours Paris 12

351 Quelle(s) est(sont) la(les) propositions(s) exacte(s) ?


❑ a. L’exon 4 de la forme A code pour l’intégralité de la prot éine mature AGTR1A.
❑ b. L’exon 3 possède un site initiateur de traduction qui explique pourquoi le pro-
duit du t transcrit B est plus long que le transcrit A
❑ c. On peut déduire de la figure ci-dessus que si AGTR1B possède une affinité plus
faible pour AGTII que AGTR1A, alors AGTR1D aura une affinité plus faible
pour AGTII que AGTR1C.
❑ d. On peut expliquer la différence d’expression tissulaire entre les différents va-
riants par la variabilité importante qu’ils présentent à leur extrémité 3’ non
codante.
❑ e. Le signal de polyadénylation est retrouv é dans l’exon 4.
UE 1 • énoncés 123

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


352 Un polymorphisme en position 1166 (c.1166A>C, substitution simple de A par C) est
retrouvé avec une frequence
´ d’h étérozygotie anormalement élevée dans la population cauca-
sienne. Ce polymorphisme est associé à la survenue d’une hypertension art érielle essentielle.
Cochez la (ou les) réponse(s) exacte(s).
❑ a. Ce polymorphisme est présent dans la région 5’ non codante du g ène.
❑ b. Ce polymorphisme peut être visualisé apr ès RT-PCR par séquençage.
❑ c. Ce polymorphisme modifie un site donneur d’épissage et produit une forme
tronquée du récepteur qui présente une affinité modifiée pour l’angiotensine II.
❑ d. Le produit du gène portant le polymorphisme peut être diff érencié de la forme
normale par Western-Blot.
❑ e. L’utilisation d’enzymes de restriction spécifiques peut permettre de visualiser
ce polymorphisme sur l’ADN.

353 Une autre mutation responsable d’hypertension artérielle et de prééclampsie (hyper-


tension lors de la grossesse) a été mise en évidence sur le gène codant pour l’angiotensi-
nogène.
Cette mutation touche le nucléotide signalé par un caractère gras dans les séquences sui-
vantes.
Angiotensinogène mature sauvage : GAC CGG GTG TAC ATA CAC CCC TTC CAC CTC
GTC ATC CAC AAT GAG AGT ACC TGT . . .
Angiotensinogène mature muté : GAC CGG GTG TAC ATA CAC CCC TTC CAC TTC GTC
ATC CAC AAT GAG AGT ACC TGT . . .
Cochez la (ou les) réponse(s) exacte(s).
❑ a. La mutation produit un décalage du cadre de lecture.
❑ b. La mutation est silencieuse.
❑ c. La mutation est faux sens.
❑ d. La mutation est non sens.
❑ e. La mutation transforme une leucine en phénylalanine.

354 Soit la séquence suivante codant pour une partie du peptide Rn :


5’ . . . CAT-ACC-TTA-TTC-GAA-CGT-TCA-GGT-TAT-CGC-G . . . 3’.
Chez certains individus, une mutation ponctuelle peut survenir. Cette séquence devient :
5’. . . CAT-ACC-TTA-TTC-GAA-CGT-ACA-GGT-TAT-CGC-G . . . 3’.
Parmi les enzymes de restriction proposées ci-dessous, lesquelles permettent d’étudier cette
mutation ponctuelle (la flèche verticale indique le site de coupure de l’enzyme) ?
❑ a. Pvu II 5’CAG↓CTG 3’
❑ b. Msp I 5’C↓CGG 3’
❑ c. Rsa I 5’G↓TAC 3’
❑ d. Ac II 5’AA↓CGTT 3’
❑ e. Aucune des propositions précédentes.
D’après concours Paris 11
124 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


355 Considérons que l’obstructine est une protéine fabriqu ée par le poumon qui, dans cer-
tains cas, peut obstruer les voies respiratoires. Un siRNA est synthetis
´ é dans le but d’inhiber
l’expression du gène de l’obstructine. Le brin d’ARN antisens destiné à se fixer sur l’ARNm
de l’obstructine a la séquence suivante :
5’ ACC UGC UAA CGA . . . 3’.

❑ a. Avant d’être pris en charge par le complexe RISC (RNA Induced Silencing
Complex), les siRNA ont une extrémité 3’-OH libre à bouts coh ésifs.
❑ b. Le segment d’ARNm ciblé par l’ARN antisens anti-obstructine décrit ci-dessus
a la séquence suivante : 5’ UCG UUA GCA GGU . . . 3’.
❑ c. Dans le gène de l’obstructine, le brin transcrit produisant le segment d’ARN
ciblé par l’ARN anti-sens anti-obstructine décrit ci-dessus a la séquence sui-
vante : 5’ ACC TGC TAA CGA. . . 3’.
❑ d. Les ARN antisens peuvent se fixer sur une r égion complémentaire dans la partie
codante de l’ARN entraı̂nant ainsi la dégradation du transcrit.
❑ e. Les ARN antisens peuvent se fixer sur une r égion complémentaire dans la partie
3’ non traduite de l’ARN et empêcher ainsi la traduction du gène.
D’après concours Nancy

Niveau difficile

356 La sequence
´ nucléotidique d’un gène X a ét é déterminée par la méthode de Sanger,
chez un individu normal et chez un malade portant un gène X d élét é.
En vous appuyant sur la figure ci-dessous montrant les gels de séquence du gène X normal
et du gène X muté, pr écisez quelle est, parmi les séquences nucleotidiques
´ propos ées, celle
correspondant à la partie du gène X présente chez le sujet normal et délet´ ée chez le malade ?

❑ a. 5’-GAGCAGGTCGAAGGGGATGGCCACCATGTCGATGAGGAA
CCAGCC-3’
❑ b. 5’-CGACCAAGGAGTAGCTGTACCACCGGTAGGGGAAGCTG
GACGAG-3’
❑ c. 5’-GAGCAGGTCGAGGAACCAGCC-3’
UE 1 • énoncés 125

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. 5’-GAAGGGGATGGCGGCCACCATGTCGAT-3’
❑ e. 5’-TAGCTGTACCACCGGCGGTAGGGGAAG-3’
D’après concours Paris 11

QCM n◦357 à 360 : Pour étudier la structure du ou des gènes codant la carnitine-palmityl
transférase (CPT) ainsi que le profil d’expression tissulaire, des chercheurs disposent d’une
banque d’expression réalisée à partir d’un mélange de tissus (foie, muscle, muscle cardiaque)
ainsi que, pour le criblage, d’un anticorps anti CPT de lapin. Cette banque d’expression
utilise un système bactérien comme cellules hôtes.
D’après concours Paris 5

357 Indiquez la/les proposition(s) exacte(s) :


❑ a. On réalise une banque d’expression après extraction des acides nucléiques sui-
vie d’une transcription in vitro puis synthèse des ADNc et clonage.
❑ b. On réalise une banque d’expression après insertion de l’ensemble des ADNc
obtenus à partir du mélange dans un phage comportant un gène codant la bêta
galactosidase sous le contrôle du promoteur d’un  gène domestique  humain.
❑ c. On réalise une banque d’expression apr ès insertion des ADNc obtenus à partir
du mélange, chacun dans un vecteur comportant un g ène codant la bêta galac-
tosidase sous le contrôle d’un promoteur de l’opéron lactose.
❑ d. La protéine produite est en général une protéine de fusion.
❑ e. Tous les ADNc insérés correspondant à CPT, exprimeront la protéine CPT.

358 Le criblage à l’aide de l’anticorps a permis d’identifier deux clones recombinants (X


et Y). Chacun de ces clones est amplifié apr ès culture en milieu bactérien et les inserts sont
extraits et isolés du vecteur. Chacun des inserts (ADNc) des clones X et Y est marqué de
mani ère radioactive et utilisé comme sonde pour r éaliser un Northern blot à partir d’extraits
de différents tissus.
Après hybridation avec l’ADNc du clone X et lavages, l’autoradiographie montre les résultats
indiqués dans la figure ci-dessous :

(GB globules blancs. La ligne en pointillés fins est un simple guide d’alignement.)
Les résultats observés sont compatibles avec :
❑ a. Une transcription sp écifique de tissu.
❑ b. Une réplication spécifique de tissu.
❑ c. Une utilisation de promoteurs alternatifs.
❑ d. Une maturation spécifique de tissu des ARNm.
126 énoncés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. L’absence du signal au niveau du muscle ne peut s’expliquer que par des
artéfacts liés à la qualité de l’anticorps utilisé pour le criblage de la banque
d’expression.

359 La membrane du northern-blot est débarrassée (déshybridée) de la sonde ADNc du


clone X puis ré-hybridée avec l’ADNc du clone Y. Les resultats
´ obtenus sont indiqués ci-
dessous :

Les résultats des deux Northern blots sont compatibles avec :


❑ a. L’utilisation de sites d’initiation de la traduction différents selon les tissus.
❑ b. L’utilisation de promoteurs alternatifs selon les tissus.
❑ c. L’utilisation de sites d’épissage différents selon les tissus.
❑ d. L’utilisation de sites de polyadénylation différents selon les tissus.
❑ e. L’ensemble de tous ces mécanismes.

360 L’ensemble des résultats permettent à ce stade d’affirmer que les ADNc des clones X
et Y :
❑ a. Sont les produits de deux gènes différents.
❑ b. Sont issus d’un seul et même gène.
❑ c. Correspondent à des expressions différentes au cours du développement.
❑ d. Sont les produits d’une même famille de gènes.
❑ e. Aucune de ces propositions n’est exacte.

QCM n◦361 à 362 : L’isocitrate déshydrogénase (IDH) est une enzyme intervenant dans le
métabolisme du citrate et du glutamate.
Pour caractériser et mieux comprendre les effets de différentes anomalies moléculaires, on
décide de réaliser la séquence d’IDH à partir de différentes tumeurs par la technique de
pyroséquençage.
Les résultats permettent de distinguer cinq séquences différentes comme l’indiquent les tracés
des pyrogrammes (tracés 2 à 6 de la figure).
Les seules différences observées par rapport à la séquence normale (tracé 1 de la figure) se
situent sur le même exon, c’est pourquoi nous ne représentons que les codons 131, 132 et 133
parmi les 414 codons du gène.
D’après concours Paris 5
UE 1 • énoncés 127

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


361 Au vu des résultats présentés dans la figure, quelle est la ou quelles sont les proposi-
tion(s) exacte(s) ?
❑ a. Le principe de la technique de pyroséquençage repose sur la détection de l’in-
corporation d’un nucléotide par la mesure de la taille des fragments en cours
d’élongation.
❑ b. Dans la technique de pyroséquençage, les nucléotides ne sont pas ajoutés en
même temps mais l’un à la suite de l’autre.
❑ c. Lors de la réaction de pyrosequençage,
´ l’incorporation d’un nucléotide dans
la séquence en cours d’ élongation, implique la libération de pyrophosphate
inorganique.
❑ d. Dans la technique de pyroséquencage, le pyrophosphate inorganique sert à
synthétiser de l’ATP grâce à l’ATP phosphorylase en présence d’Adénosine
5’phosphosulfate.
❑ e. Dans la technique de pyroséquençage, la quantité d’ATP produite lors de la
réaction est directement proportionnelle à la quantité de photons d étectés et
donc à la quantité de nucl éotides incorporés.

362 Au vu des résultats présentés dans la figure, quelle est la ou quelles sont les proposi-
tion(s) exacte(s) ?
❑ a. Des résultats identiques auraient pu être observés après s équençage par la tech-
nique de Sanger.
❑ b. Les variations de séquences observées ne sont pas délétères puisqu’elles
gén èrent toutes des variations faux-sens.
❑ c. On observe sur les pyrogrammes présentés des délétions et des duplications.
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
La technique de PCR seule aurait permis d’obtenir les mêmes résultats.
Aucune de ces propositions n’est exacte.
énoncés • UE 1

❑ d.
❑ e.
128
UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
UE 1 Concours blancs (énoncés)

Pour chaque QCM, sauf mention contraire, cochez la (ou les) réponse(s) exacte(s).

Concours n ◦ 1 (durée 2 h)

Chimie
1 Soit l’atome 63
27 Co. Parmi les propositions suivantes, donnez la (les) proposition(s) exacte(s) :

❑ a. Cet atome est constitué de 27 neutrons, 36 protons, 36 électrons.


❑ b. Cet atome est constitué de 63 nucl éons, 27 protons, 27 électrons.
❑ c. Cet atome est constitué de 27 neutrons, 63 nucleons,
´ 36 électrons.
❑ d. Cet atome est constitué de 36 neutrons, 63 nucleons,
´ 27 protons.
❑ e. Cet atome est constitué de 27 nucl éons, 36 protons, 36 électrons.
D’après concours Limoges

2 Quelle(s) est (sont) la (les) série(s) de valeurs de nombres quantiques possible(s) ?


❑ a. n = 0  = 0 m = 0 ❑ b. n = 2 =0 m = 0
❑ c. n = 2  = 2 m = 0 ❑ d. n = 2 =1 m = −1
❑ e. n = 3  = 1 m = −2
D’après concours Créteil

3 Sachant que Z(Fe) = 26, cochez la (les) proposition(s) correcte(s) :


❑ a. L’ion Fe3+ a 6 électrons dans ses orbitales d.
❑ b. L’ion Fe2+ a 6 électrons dans ses orbitales d.
❑ c. La configuration de l’ion Fe2+ est [Ar]3d 5 4s1.
❑ d. La configuration de l’ion Fe3+ est [Ar]3d 6 4s0.
❑ e. Aucune de ces quatre propositions n’est correcte.
D’après concours Paris 5

4 Soit l’atome d’azote (Z=7) à l’état fondamental. Cochez la (ou les) réponse(s) exacte(s) :

❑ a. Cet atome possède trois électrons célibataires.


❑ b. Ces électrons célibataires sont caractérisés par un nombre quantique secondaire
égal à 3.
❑ c. Cet atome appartient à la 2e p ériode de la classification périodique.
❑ d. L’azote et l’antimoine (Z=51) appartiennent au groupe VB de la classification
périodique.
❑ e. Le rayon atomique de l’azote est inférieur à celui de l’antimoine.
D’après concours Limoges
130 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


5 Concernant une orbitale moléculaire antiliante :
❑ a. Elle ne contient jamais d’électrons.
❑ b. Elle possède une énergie plus faible que celle des atomes pris à l’ état isolé.
❑ c. Elle contient toujours deux électrons de spin identique.
❑ d. Elle est plus stable que l’orbitale moléculaire liante correspondante.
❑ e. Elle peut contenir zéro, un ou deux électrons.
D’après concours Limoges

6 Cochez la (ou les) réponse(s) exacte(s) :


❑ a. Une géométrie trigonale implique trois orbitales atomiques hybrides sp 2 ,
situées dans le même plan.
❑ b. À une triple liaison entre deux atomes de carbone, correspond une hybridation
de type sp3
❑ c. On ne peut mettre au maximum que deux électrons par orbitale atomique
hybride.
❑ d. Un atome de carbone hybridé sp ne peut former qu’une liaison π.
❑ e. Les quatre orbitales atomiques hybrides sp3, d’un atome de carbone isolé, sont
strictement équivalentes.
D’après concours Limoges

7 Cochez la (ou les) réponse(s) exacte(s) :


❑ a. Dans la molécule CH3 Cl, l’atome de carbone 6C est hybridé sp 3.
❑ b. Dans la molécule CH3 OH l’atome de carbone 6C est hybridé sp 3 .
❑ c. Dans la molécule CH3 NH2, l’atome de carbone 6 C est hybridé sp.
❑ d. Dans la molécule CH3 NH2, l’atome d’azote 7 N est hybridé sp 3 .
❑ e. Dans la molécule HCOOH l’atome de carbone 6 C est hybridé sp2.
D’après concours Nancy

8 Cochez la (ou les) réponse(s) exacte(s) :


❑ a. Un carbone digonal est hybridé sp2.
❑ b. Pour un carbone trigonal il y a possibilité de trois liaisons identiques de types
σ et une liaison latérale de type π.
❑ c. Un carbone asymétrique est un carbone trivalent.
❑ d. Un racémique dévie le plan de polarisation de la lumière vers la gauche.
❑ e. Tous les items précédents sont vrais
D’après concours Nancy

9 Cochez la (ou les) réponse(s) exacte(s) :


❑ a. Le nombre quantique de spin, pour un électron, peut prendre les valeurs
1 1
− , 0, ·
2 2
❑ b. Le brome 35 Br appartient à la 4e periode
´ de la classification périodique.
UE 1 • Concours blancs 131

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. Les électrons d sont toujours des électrons de valence.
❑ d. Il est plus coûteux en énergie d’arracher un électron à un atome en début de
période qu’ à un atome en fin de période.
❑ e. Le rayon d’un cation est toujours supérieur a` celui de l’atome neutre.
D’après concours Nancy

10 Cochez la (ou les) réponse(s) exacte(s) :


❑ a. L’énergie d’ionisation de l’atome d’hydrogène est l’énergie de la r éaction
H(l) → Hg) + e −.
❑ b. L’atome d’hydrogène dans son état fondamental absorbe un photon de longueur
d’onde λ = 85 nm, l’électron est arraché.
❑ c. L’énergie de l’atome d’hydrogène est donn ée par la relation de Bohr
En = −13, 6/n2 (J).
❑ d. L’atome d’hydrogène, pour se désexciter de son état excité 4 s, ne peut le faire
qu’en une seule étape.
❑ e. L’ion 3Li 2+ est un ion hydrogenoı̈de.
´
D’après concours Nancy

11 On donne les énergies de liaison : E C−O = 806, 4 kJ.mol−1 ;


EC−C = 346, 9 kJ.mol−1 ; E O−O = 500, 2 kJ.mol−1 ; EO−H = 464, 5 kJ.mol −1.
❑ a. La combustion complète d’un hydrocarbure saturé a pour équation de réaction :
3n + 1
Cn H2n+2 + O2 → nCO 2 + (n + 1) H2 O
2
❑ b. La variation d’enthalpie standard à 298 K correspondant à cette combustion est
donnée par :
∆cH ◦ = −615, 6n − 196, 8 kJ.mol−1 .
❑ c. La variation d’enthalpie standard à 298 K correspondant à cette combustion est
donnée par :
∆cH ◦ = 615, 6n − 196, 8 kJ.mol−1 .
❑ d. Pour le 2-méthylbutane ∆c H ◦ = 2374, 8 kJ.mol−1 .
❑ e. Tous les items précédents sont faux.
D’après concours Nancy

12 Cochez la (ou les) réponse(s) exacte(s) :


❑ a. L’entropie augmente lors de la fusion d’un corps pur.
❑ b. L’entropie diminue quand un corps pur à l’etat
´ liquide bout.
❑ c. L’entropie d’un corps pur parfaitement cristallin est nulle à T = 0 K.
❑ d. L’enthalpie libre n’est pas une fonction d’état.
❑ e. Une réaction exothermique pr ésente une variation d’enthalpie standard positive.
D’après concours Nancy

13 Parmi les propositions suivantes relatives au couple MoO2 / HMoO−4 , quelle(s) est
(sont) celle(s) qui est (sont) juste(s) ?
132 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. Ce couple est un couple acide-base.
❑ b. Ce couple est un couple d’oxydo-réduction.
❑ c. Des deux espèces, MoO2 est la base conjuguée de l’acide HMoO −4 .
❑ d. Des deux espèces, MoO2 est le réducteur et HMoO −4 l’oxydant.
❑ e. Toutes les propositions précédentes sont fausses.
D’après concours Grenoble

14 On s’intéresse au couple rédox MoO2−


4 / MoO 2 en solution aqueuse, dont on note E
c irc

le potentiel standard.
❑ a. Le nombre d’oxydation du molybdène est de +VI dans MoO2−
4 et 0 dans MoO 2 .
❑ b. Pour écrire la demi-équation de ce couple r édox on place deux électrons du côté
de MoO2 de manière à équilibrer la charge −2 de l’ion MoO 2− 4 .
❑ c. L’équation de Nernst relative à ce couple en solution aqueuse est :
E = E◦ + 0, 03 log ( [MoO2− + 4
4 ].[H3 O ] ) / [MoO 2 ]
❑ d. L’équation de Nernst relative à ce couple en solution aqueuse est :
E = E◦ + ln ( [MoO2−4 ].[H3 O ] ) / [MoO2 ]
+

❑ e. Toutes les propositions précédentes sont fausses.


D’après concours Grenoble

15 Cochez la (ou les) réponse(s) exacte(s) :


❑ a. Une réduction est une perte d’électrons.
❑ b. Un réducteur donne des électrons a` un oxydant.
❑ c. Un réducteur capte des électrons provenant de l’oxydant.
❑ d. Un oxydant est d’autant plus oxydant que son potentiel rédox est bas.
❑ e. Lors d’une réaction rédox c’est le réducteur le moins fort qui est oxydé.
D’après concours Grenoble

16 Le bromure de cobalt(II) est un corps composé de l’él ément brome 35 Br et de l’élément


cobalt 27Co au degré d’oxydation +II. La formule du bromure de cobalt est :
❑ a. CoBr ❑ b. Co 2Br ❑ c. CoBr2 ❑ d. Co2Br 2
❑ e. Toutes les propositions précédentes sont fausses.
D’après concours Grenoble

17 On considère une solution aqueuse d’un acide faible HA de pKa = 3, 00. La ou (les-
quelles) de ces propositions est (sont) vraie(s) :
❑ a. Le pH d’une solution de concentration c = [HA] = 3, 0 × 10−1 mol.L−1 est
pH = 1, 76.
❑ b. Pour déterminer le pH d’ une solution de cet acide de concentration
c = [3 × 10−5 ] mol.L−1 on peut utiliser directement pH = pc.
❑ c. L’autoprotolyse de l’eau est toujours négligeable devant la r éaction
HA + H2 O = A− + H3O +.
UE 1 • Concours blancs 133

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. La base conjuguée A− est une base forte.
❑ e. Le pH d’une solution de cet acide à 10−8 mol.L −1 est 7, 6.
D’après concours Limoges

QCM n◦ 18 à 20 : On considère les deux molécules suivantes K et L.

et les stéréo-isomères suivants des composés K et L.

D’après concours Limoges

18 Cochez la (ou les) réponse(s) exacte(s) :


❑ a. Le composé K existe sous la forme de quatre ster
´ éo-isomères.
❑ b. Le composé K existe sous la forme de deux couples d’ énantiomères.
❑ c. Deux diastéréoisomères sont deux st éréo-isomères qui présentent une relation
d’image dans un miroir l’un par rapport à l’autre.
❑ d. Le composé L existe sous forme de trois st éréo-isomères dont un seul est achiral
optiquement actif.
❑ e. Le composé L existe sous la forme de trois stér éo-isomères dont un couple
d’énantiomères.

19 Concernant les composés K1 et K 2, indiquez la (ou les) proposition(s) exacte(s) :


❑ a. Le composé K 1 est le 2, 3, 4-trihydroxypropanal.
❑ b. Le composé K 1 est de configuration 2S, 3R.
❑ c. Le composé K2 est la représentation exacte du composé K1 en projection de
Fischer.
134 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Le composé K 2 est un ose de la série D.
❑ e. Les composés K 1 et K2 sont énantiomères.

20 Concernant les composés L1 , L2 et L3, indiquez la (ou les) proposition(s) exacte(s).


❑ a. Le composé L1 est de configuration 2R, 3R.
❑ b. Le composé L2 est de configuration 2R, 3S.
❑ c. Le composé L2 est un compos é méso chiral.
❑ d. Les composés L 1 et L3 sont conformères.
❑ e. Les composés L 1 et L3 sont diast ér éoisom ères.

21 Soit les quatre molécules suivantes, indiquez la (ou les) proposition(s) exacte(s).

❑ a. Ces quatre molécules sont des 2-aminoacides.


❑ b. La nomenclature officielle de la lysine est l’acide 2, 6-diaminohexanoı̈que.
❑ c. La glutamine présente deux fonctions amine, une fonction aldéhyde et une fonc-
tion acide carboxylique.
❑ d. Ces quatre molécules pr ésentent un carbone chiral et sont optiquement actives.
❑ e. À l’état naturel, la tyrosine presente
´ un carbone asymétrique de configuration S
et correspond à la L-tyrosine.
D’après concours Limoges
UE 1 • Concours blancs 135

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


QCM n◦ 22 et 23 : On considère les 5 molécules suivantes F, G, H, I et J.

D’après concours Limoges

22 Concernant ces 5 composés, cochez la (ou les) proposition(s) exacte(s).


❑ a. Les deux composés F et G sont deux composés chimiques différents, isomères
géom étriques l’un de l’autre.
❑ b. Le composé F est le trans-pent-3-ènal.
❑ c. Les composés F et H sont des isomères de constitution.
❑ d. Les composés F et I sont des isom ères de position.
❑ e. Il existe une relation isomérique appelée tautomérie entre les composés I et J.

23 Soit les deux ecritures


´ suivantes concernant les formes limites de r ésonance du composé
I:

Cochez la (ou les) propositions exacte(s).


❑ a. Le composé I est la cis-pent-2- ène-4-one.
❑ b. Il existe au sein du composé I (forme a) une conjugaison πσn.
❑ c. En tenant compte des effets électroniques, l’écriture (1) est exacte.
❑ d. En tenant compte des effets électroniques, l’écriture (2) est exacte.
136 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. Le groupement carbonylé exerce un effet attracteur -M vis à vis de la double
liaison.

24 Cochez la (ou les) propositions exacte(s) :

❑ a. Le nom de la lévodopa selon la nomenclature IUPAC est : acide 2-amino-3-(3,


4-dihydroxyphényl)propano¨ıque.
❑ b. Le nom de la lévodopa selon les règles IUPAC est : acide 2-amino-2-(3, 4-
dihydroxybenzyl)éthano¨ıque.
❑ c. Les 2 groupements −OH sont situés en méta l’un de l’autre sur le cycle
aromatique.
❑ d. Le carbone asymétrique de la l´
evodopa est de configuration absolue S.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

25 Parmi les propositions suivantes, indiquez celle(s) qui est (sont) exacte(s).
❑ a. Deux composés isomères de constitutions sont toujours isomeres` de position.
❑ b. Des isomères de position sont également appelés régioisomères.
❑ c. Deux composes ´ isom ères de conformation ne peuvent être, en aucun cas,
également isomères de configuration.
❑ d. Deux composés isomères de configuration ne peuvent être en aucun cas
également isomères de conformation.
❑ e. Une molécule avec un seul carbone asym étrique dans sa structure ne peut exis-
ter que sous deux conformations, nommées R et S.
D’après concours Lyon

26 Concernant l’halogénation :
❑ a. L’halogénation d’un alcène est une réaction électrophile.
❑ b. L’halogénation d’un alcane est une syn addition.
❑ c. L’halogénation d’un alcène passe toujours par un intermédiaire ponté.
❑ d. L’halogénation d’un alcane dans un alcool peut conduire à la formation d’un
éther.
❑ e. La bromation du benzène est une SN.
D’après concours Nancy
UE 1 • Concours blancs 137

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


27 Concernant le composé suivant :

❑ a. Il possède une double liaison carbone-carbone st éréogène.


❑ b. Il est chiral.
❑ c. Il est en configuration  E  .
❑ d. C’est la (E)-3-éthyl-1-hydroxypent-3-èn-2-one.
❑ e. C’est la (Z)-3-éthyl-5-hydroxypent-2-èn-4-one.
D’après concours Lyon

28 On solubilise totalement 1 g d’un médicament de masse molaire 250 g.mol−1 dans


0, 1 dm 3 d’eau. Puis, au cours d’une exp érimentation réalisée à température constante, on
suit la cinétique de dégradation de ce médicament en mesurant sa concentration en solution
aqueuse[C], en fonction du temps t.
❑ a. Pour obtenir une réponse biologique il faut que le médicament se lie avec son
récepteur.
❑ b. Une base de Lewis BL est une espèce chimique présentant un doublet
d’électrons libres.
❑ c. La solubilité d’un soluté dans un solvant est la quantité minimale de soluté
qu’on peut solubiliser dans un volume donné de solvant.
❑ d. La concentration initiale du médicament dans l’eau vaut
[C0] = 4 × 10 mol.dm .
−2 −3

❑ e. Si la réaction de dégradation suit une loi cinétique d’ordre 1, alors


[C] = [C0] + kt avec k = constante de vitesse.
D’après concours Bordeaux

29 Soit la réaction homogène en phase gazeuse suivante, r éalisée à température constante


dans un récipient indilatable :
W  X+2Z
W, X et Z seront assimilés à des gaz parfaits.
Au temps t = 0, on introduit dans le récipient n 0 moles du réactif W et l’on mesure avant
réaction la pression initiale P0. La réaction ayant atteint l’état d’équilibre, on définit par x le
nombre de moles du produit X formé.
❑ a. Quand la réaction a atteint l’état d’équilibre, le nombre de moles de W est égal
à n0 − 3x.
❑ b. Quand la réaction a atteint l’état d’ équilibre, l’enthalpie libre de la réaction vaut
∆rG = 0.
❑ c. Soit p w, p x et p z les pressions partielles respectives de W, X et Z mesurées à
(p ) (p z) 2
l’équilibre. La constante d’équilibre vaut K p = x
pw
❑ d. Quand la réaction a atteint l’etat´ d’équilibre, la fraction molaire de Z vaut
2x
fz =
n 0 + 2x
138 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. Quand la réaction a atteint l’état d’equilibre,
´ la pression partielle de Z vaut
pz = f z 0 ( fz repr ésentant la fraction molaire de Z).
.P
D’après concours Bordeaux

30 La catalase est une enzyme qui catalyse la décomposition du peroxyde d’hydrogène


H2O 2 suivant la réaction qui peut être schematisée
´ selon :
2H2O 2(liq) → 2H2O(liq) + O2(g)
Données numériques :
Dans des conditions standard  l’enthalpie
 de la réaction vaut
◦ ◦
∆r H = −196 kJ.mol ; ∆ f H2 O(liq) = −286 kJ.mol−1 .
−1

Masses atomiques (en g.mol−1 ) : H = 1, O = 16.


❑ a. L’enthalpie
 standard de formation du peroxyde d’hydrogène H 2O2 vaut
∆ f H2 O 2(liq) = −208 kJ.mol .
◦ −1

❑ b. La température influe sur la vitesse d’une reaction


´ chimique.
❑ c. La vitesse de la décomposition du peroxyde d’hydrogène H2 O2(liq) est propor-
tionnelle à la concentration molaire de H2 O2(liq) élevée à une puissance simple.
❑ d. Si la réaction est réalisée à partir de 34 g de H2O 2 et qu’il se forme 4 g de O 2 ,
alors le rendement de la réaction est de 50%.
❑ e. La catalase permet d’augmenter le rendement de la réaction de d écomposition
du peroxyde d’hydrogène H2 O 2.
D’après concours Bordeaux

Biochimie
31 La myosine purifiée à partir du muscle squelettique est analysée :
❑ a. L’analyse par chromatographie, par filtration sur gel, met en évidence une seule
protéine de 520 kD.
❑ b. La protéine peut être retenue sur une colonne d’affinité constituée de billes sur
lesquelles ont et´ é greffées des mol écules de troponine.
❑ c. L’analyse par électrophorèse SDS PAGE après traitement par le
β-mercaptoéthanol met en évidence deux bandes protéiques.
❑ d. L’analyse en électrophorèse bidimensionnelle met en évidence six taches.
❑ e. La myosine peut être dosée en utilisant son activité ATPasique.
D’après concours Paris 6

32 Concernant l’histidine :
❑ a. Sa chaı̂ne lat érale contient un cycle.
❑ b. À pH 7, sa charge globale est positive.
❑ c. Elle peut former une liaison de coordination avec un ion Fe ++.
❑ d. Sa chaı̂ne lat érale a un caractère aromatique.
❑ e. Elle est directement impliquée dans la s électivité ionique du pore du récepteur
nicotinique de l’acétylcholine.
D’après concours Paris 6
UE 1 • Concours blancs 139

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


33 Lors de l’arrivée de l’influx nerveux dans la terminaison du motoneurone :
❑ a. Les hélices M2 du récepteur nicotinique de l’acétylcholine changent de
conformation.
❑ b. Le flux de cations à travers le recepteur
´ de l’ac étylcholine est bloqué.
❑ c. La concentration en ions Ca augmente dans le cytoplasme de la cellule
++

musculaire.
❑ d. La troponine se dissocie de la myosine.
❑ e. La tropomyosine se dissocie de l’actine.
D’après concours Paris 6

34 Concernant l’hélice α :
❑ a. Dans chaque liaison impliquée, c’est un atome d’oxygène qui est donneur d’hy-
drogène et un atome d’azote qui est acepteur.
❑ b. Les valeurs des angles Ψ et Φ sont les mêmes que dans les feuillets β.
❑ c. Les chaı̂nes latérales sont dirigees
´ vers l’ext érieur de l’hélice α.
❑ d. C’est la structure secondaire qui entre dans la composition des motifs
immunoglobuliniques.
❑ e. Elle résiste à la dénaturation par l’urée 8M.
D’après concours Paris 6

35 Concernant le fragment S1 de la myosine :


❑ a. Il est obtenu par dissociation de la myosine par le SDS.
❑ b. Il possède un site de liaison pour la tropomyosine.
❑ c. Il peut exister sous deux états conformationnels.
❑ d. Il possède une activité enzymatique de type protéine-kinase.
❑ e. Il possède un site de fixation pour les ions Ca 2+ .
D’après concours Paris 6

36 Concernant le récepteur musculaire de l’acétylcholine :


❑ a. Chaque sous-unité est un polypeptide transmembranaire.
❑ b. C’est la dépolarisation de la membrane qui induit le changement de conforma-
tion des hélices M2.
❑ c. La sélectivité ionique du canal est modifiee
´ si on abaisse le pH du milieu à 2.
❑ d. Les auto-anticorps circulant dans le sang des malades atteints de myasthénie
bloquent la libération de l’acétylcholine par la terminaison nerveuse.
❑ e. Les auto-anticorps circulant dans le sang des malades atteints de myasthénie
bloquent de façon compétitive la fixation de l’acétylcholine.
D’après concours Paris 6

37 Indiquez, parmi les réponses suivantes, celle(s) qui est(sont) exacte(s) dans les deux
heures qui suivent le petit déjeuner :
140 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. Les acides gras qui proviennent des triglycérides alimentaires sont libérés dans
les vaisseaux lymphatiques sous la forme d’un complexe avec l’albumine.
❑ b. La translocation de la lipoprotéine lipase produite par les adipocytes sur la paroi
vasculaire est stimulée.
❑ c. Les concentrations hépatiques de malonyl-CoA sont élevées.
❑ d. L’acétyl-CoA carboxylase est inhibée dans le foie.
❑ e. Le foie produit des VLDL (very low density lipoprotein).
D’après concours Paris 6

38 Vers 13 h, avant le dejeuner


´ et 6 h après le petit déjeuner, vous décidez d’aller faire un
jogging. Indiquez, parmi les réponses suivantes, celle(s) qui est(sont) exacte(s) :
❑ a. Après 30 min de course à allure modérée, le cerveau augmente son utilisation
d’acides gras.
❑ b. Après 30 min de course à allure moder
´ ée, les fibres musculaires oxydatives sont
mises en jeu.
❑ c. On sait que l’exercice musculaire est ressenti comme un stress par l’organisme :
dans ces conditions, la lipase hormonosensible du tissu adipeux est activée.
❑ d. On sait que l’exercice musculaire est ressenti comme un stress par l’organisme :
dans ces conditions, la protéine kinase activée par l’AMPc est inhibée dans le
tissu adipeux.
❑ e. On sait que l’exercice musculaire est ressenti comme un stress par l’organisme :
dans ces conditions, la sécrétion de glucagon est inhib ée.
D’après concours Paris 6

39 Vous accélérez le rythme de votre course pour arriver hors d’haleine chez vous. La
capacité d’oxygénation de vos muscles est insuffisante. Ceci aura la(les) cons équence(s) sui-
vante(s) sur la dégradation du glucose :
❑ a. La dégradation du glucose en pyruvate sera accel´ éree.
´
❑ b. La dégradation du pyruvate en acétyl CoA sera accélérée.
❑ c. La dégradation du pyruvate en acétyl CoA sera ralentie.
❑ d. La dégradation de l’acétyl CoA dans le cycle de Krebs sera accélérée.
❑ e. Le pyruvate sera transformé en lactate.
D’après concours Paris 6

40 Concernant la séquence codante d’un gène :


❑ a. Elle fait partie de l’ARN messager.
❑ b. Elle est traduite par les ribosomes au cours de la traduction.
❑ c. Elle est située entre le codon AUG et le codon stop.
❑ d. Elle ne comprend pas les introns.
❑ e. Elle comprend tous les exons dans leur intégralité.
D’après concours Paris 6

41 Concernant la méthionine :
❑ a. Sa chaı̂ne latérale est polaire.
UE 1 • Concours blancs 141

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. Elle ne contient pas de carbone asymétrique.
❑ c. C’est après un résidu de méthionine qu’une chaı̂ne polypeptidique est coup ée
par le bromure de cyanogène.
❑ d. Elle peut former un pont disulfure avec un r´
esidue de cystéine

|
m
Elle contient un atome de soufre.

o
❑ e.

c
t.
o
D’après concours Paris 6

p
s
g
lo
.b
42 Cochez la(les) proposition(s) exacte(s) :

s
in
c
e
d
e
La liaison phosphate dans la molécule de glucose-6-phosphate est une liaison

m
❑ a.

s
e
rd
riche en énergie.

o
s
e
tr
e
❑ b. L’ATP possède deux liaisons phosphates riches en énergie.

/l
:/
p
tt
h
❑ c. La liaison thioester (par exemple dans l’acetyl-CoA)
´ est une liaison pauvre en

|
m
o
énergie.

.c
s
s
re
❑ d. L’hydrolyse d’une liaison riche en énergie est endergonique.

p
rd
o
.w
❑ e. Si on met en présence deux couples d’oxydoréduction AH2 /A et BH2 /B, le

s
in
c
e
transfert d’électrons et/ou de protons se fera vers celui qui a le potentiel redox
d
e
le plus élevé. m
s
e
rd
o
s

D’après concours Paris 6


e
tr
e
/l
:/
p
tt

43 À l’issue d’un sprint, on observe une accumulation de lactate dans les fibres muscu-
h
|
s

laires. Cochez la(les) proposition(s) exacte(s) :


in
c
e
d
e

Cette accumulation montre que la glycolyse fonctionne en aérobiose.


M

❑ a.
s
e
rD

Cette accumulation montre que la concentration d’oxygène dans le muscle est


o

❑ b.
s
re
T

suffisante pour dégrader la totalité du glucose en ac étyl-CoA.


e
/L
s
p
u

❑ c. Cette accumulation se produit dans la matrice mitochondriale.


ro
/g
m

❑ d. Le lactate est produit par la lactate dishydrogénase qui a pour substrat le


o
.c
k
o

pyruvate.
o
b
e
c
a

❑ e. La formation de lactate à partir de pyruvate permet de produire du NAD+ à


.f
w
w

partir de NADH, H+ .
w
|
s
in

D’après concours Paris 6


c
e
d
e
M
s
e

44 Concernant le cycle de Krebs :


rD
o
s
re
T

❑ a. Le cycle de Krebs est intramitochondrial.


e
/L
m
o

❑ b. Il est couplé à la formation de coenzymes oxydés.


.c
k
o
o

❑ c. Il permet l’oxydation d’acétyl-CoA en CO 2.


b
e
c
a
.f

❑ d. Un GTP est produit directement dans l’une des étapes du cycle de Krebs.
w
w
w
|

❑ e. En présence d’un inhibiteur du complexe I dans la cha ı̂ne respiratoire, le cycle


de Krebs est accél éré.
D’après concours Paris 6

45 Un patient présente un diabète de type 1 caractérisé par la destruction ciblée des cellules
β du pancréas endocrine.
Parmi les propositions suivantes concernant l’adipocyte de ce patient, indiquez celle(s) qui
est(sont) exacte(s) en situation post-absorptive.

Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :


| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
142 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. Les transporteurs GLUT4 sont principalement présents sur la membrane
plasmique.
❑ b. La lipase hormono-sensible est phosphorylee
´ en r éponse à l’adrénaline.
❑ c. La périlipine empêche l’action de la lipase hormono-sensible.
❑ d. La lipolyse permet la libération de 3 acides gras et d’une molécule de glycérol.
❑ e. La lipolyse est activée.
D’après concours Paris 6

46 Concernant la localisation des fonctions métaboliques :


❑ a. La glycolyse érythrocytaire est un métabolisme mitochondrial.
❑ b. La néoglucogenese
` est un métabolisme sp écifiquement musculaire et hépatique.
❑ c. Dans le foie, la biosynthèse des corps cétoniques est mitochondriale.
❑ d. Les glucides et les acides aminés en excès sont stockés dans le muscle.
❑ e. La β-oxydation des acides gras saturés à 16 carbones est précédée d’une étape
d’activation mitochondriale.
D’après concours Paris 11

47 Concernant la phosphorylation oxydative et la chaı̂ne respiratoire :


On donne les cinq affirmations suivantes :
1. La translocation de protons de la matrice mitochondriale vers l’espace intermembranaire
au niveau des complexes I, II et IV permet la synthèse d’ATP.
2. La synthèse d’ATP est localisée dans la matrice mitochondriale.
3. Le monoxyde de carbone se fixe sur le Fe3+ du Complexe IV (Cytochrome oxydase) blo-
quant le transfert d’électrons.
4. Le cyanure se fixe sur le Fe3+ du complexe IV (cytochrome oxydase) bloquant le transfert
d’électrons.
5. Le 2, 4-dinitrophénol et les hormones thyroı̈diennes sont des agents découplants court-
circuitant l’ATP synthase.
Parmi les combinaisons suivantes, indiquez celle dont toutes les affirmations sont exactes.
❑ a. 1, 2, 3. ❑ b. 1, 2, 4. ❑ c. 1, 3, 5. ❑ d. 2, 3, 5. ❑ e. 2, 4, 5.
D’après concours Paris 11
48 Parmi les propositions suivantes, concernant le métabolisme des glucides, indiquez
celle qui est exacte.
❑ a. La glycolyse aérobie s’effectue dans toutes les cellules de l’organisme.
❑ b. La glucokinase et l’hexokinase sont deux enzymes hépatiques de même affinité.
❑ c. Le citrate et l’ATP à forte concentration activent la glycolyse.
❑ d. La pyruvate carboxylase est une enzyme mitochondriale.
❑ e. La Phospho-Fructo-Kinase est une enzyme de la glycolyse et de la
néoglucogen èse.
D’après concours Paris 11
UE 1 • Concours blancs 143

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


49 Concernant la glycolyse :
❑ a. La glucokinase musculaire et l’hexokinase hépatique phosphorylent le glucose
en glucose-6-phosphate avec la même affinit é.
❑ b. L’énergie libérée par la conversion du 2, 3-bisphosphoglycérate en 3-
phosphoglycérate dans le globule rouge, génère la formation d’une mol écule
d’ATP.
❑ c. L’AMP et le fructose-2, 6-bisphosphate sont deux activateurs allostériques de
la phosphofructokinase-1, enzyme phosphorylant le fructose-6-phosphate en
fructose-1, 6-bisphosphate.
❑ d. Une pyruvate kinase active sous forme phosphorylée catalyse la synthèse de
pyruvate à partir de phosphoénolpyruvate avec formation d’ATP.
❑ e. Une glucose-6-phosphatase musculaire permet la libération de glucose dans la
circulation.
D’après concours Paris 11

50 Parmi les propositions suivantes concernant le métabolisme des lipoprotéines, indiquez


celle qui est exacte.
❑ a. Chylomicrons et VLDL transportent essentiellement des triglycérides prove-
nant de la digestion, vers le foie et les organes périphériques.
❑ b. L’apo CII est une apoprotéine activatrice de la lipoprotéine lipase.
❑ c. L’ensemble des lipoprotéines sont synthétisées dans le foie.
❑ d. Les HDL transportent uniquement des triglycérides.
❑ e. Toutes les lipoprotéines sont constitu ées d’apo A, B, C et D.
D’après concours Paris 11

Biologie moléculaire
51 Concernant la double hélice de l’ADN B :
❑ a. Elle est constituée de deux chaı̂nes polynucléotidiques orientées dans la même
direction.
❑ b. Le pas de l’hélice est gauche.
❑ c. Ses bases puriques et pyrimidiques sont parallèles à l’axe de l’hélice.
❑ d. Elle porte des charges négatives à pH 7 provenant des groupements ionisés
phosphate.
❑ e. Soit la séquence nucléotidique 5’-AGCTCG-3’ sur l’un de ses deux brins, la
séquence compl émentaire de l’autre brin est 5’-TCGAGC-3’.
D’après concours Paris 11

52 Une fois liée à sa s équence cible sur l’ADN, une protéine régulatrice peut moduler le
taux de transcription d’un gene` par plusieurs mécanismes. Parmi les propositions suivantes,
laquelle est inexacte ?
❑ a. Modulation par action sur le complexe d’initiation de la transcription.
❑ b. Modulation par action sur la structure chromatinienne.
144 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. Modulation par répression de la transcription.
❑ d. Modulation par l’intermédiaire de coactivateurs et de corépresseurs.
❑ e. Modulation par coupure de l’ADN.
D’après concours Paris 11

53 Dans les cellules eucaryotes :


❑ a. Un codon code pour différents acides amines. ´
❑ b. L’ARNm est traduit dans le sens 3’ vers 5’.
❑ c. Le cadre de lecture commence au niveau du site d’initiation de la transcription.
❑ d. Les codons  stop  sont reconnus par des ARNt.
❑ e. L’initiation de la traduction a lieu dans le cytoplasme.
D’après concours Rouen

54 Concernant la PCR (Polymerase Chain Reaction) :


❑ a. Elle permet d’amplifier un ADN double brin de façon exponentielle.
❑ b. Elle est utilisée pour l’identification mol éculaire des individus, en particulier
pour la recherche de paternité.
❑ c. Elle permet l’amplification d’un ADN génomique en présence d’oligo-
nucléotides amorces, des 4 ribonucléotides (NTP) et d’une ARN polym érase
thermo-résistante.
❑ d. Elle est une étape clé du Southern Blot.
❑ e. Autre réponse.
D’après concours Strasbourg

55 Quelle est la proposition exacte ?


❑ a. La reverse transcriptase est une ADN-polymerase
´ qui synth étise le nouveau
brin d’ADN de 3’ vers 5’.
❑ b. La ligase agit lors de la maturation des ARN, en créant la liaison covalente qui
lie deux exons successifs après l’excision de la séquence intronique.
❑ c. Les enzymes de restriction, isolées des bactéries, ne peuvent couper que des
ADN bactériens.
❑ d. Les enzymes de restriction sont des endonucléases qui reconnaissent une
séquence appel ée site de restriction et coupent l’ADN bicatenaire
´ dans ou au
voisinage de ce site.
❑ e. Autre r éponse.
D’après concours Strasbourg

56 Concernant les microARN :


❑ a. Ce sont des ARN non codants.
❑ b. Ce sont des ARN codants de petite taille.
❑ c. Ils sont transcrits par l’ARN polymérase II.
UE 1 • Concours blancs 145

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. Ils s’apparient avec des ARNm cibles dont ils sont complémentaires.
❑ e. Leur rôle est d’activer la traduction.
D’après concours Paris 11

57 Concernant le rôle de la m éthylation de l’ADN dans la transcription :


❑ a. Elle interfère avec la transcription de l’ADN, en bloquant l’appariement des
bases cytosine et guanine.
❑ b. Elle prévient les mutations de l’ADN.
❑ c. C’est un verrou pour empêcher l’expression des gènes.
❑ d. Elle active la transcription des gènes.
❑ e. Elle permet la mobilisation d’histones acétylases.
D’après concours Paris 11

58 Cochez la ou les proposition(s) exacte(s) :


❑ a. La modification de l’adénosine en inosine sur la base flottante du codon permet
la reconnaissance de trois nucléotides dans les règles du wobble : U, C et A.
❑ b. L’aminoacyl-ARNt est synthétis é par le ribosome.
❑ c. Le choix du codon initiateur au moment de la phase de balayage permet de
définir le cadre de lecture de l’ARNm.
❑ d. L’activité peptidyl-transférase est portée par l’ARNr 18S de la sous-unité 60S
du ribosome.
❑ e. Les protéines sont majoritaires en masse et en nombre dans le ribosome.
D’après concours Montpellier

59 Parmi les séquences suivantes, quelle est celle qui, appariée avec son brin complémentaire,
peut former une structure ressemblant à l’ADN Z ?
❑ a. GGCCGGGCCAAGTC.
❑ b. TATAATCACTACTA.
❑ c. TGAAGTATGTAAAT.
❑ d. GCATGCCAATAGAG.
❑ e. GCGCGCGCTGCACA.
D’après concours Paris 11

60 Concernant l’ARNt dont l’anticodon est 5’-CAU-3’ :


❑ a. Il sert de substrat à l’histidine ARNt synthétase.
❑ b. Sa liaison à un acide aminé consomme l’hydrolyse d’une liaison riche en
énergie.
❑ c. Il peut se lier à plusieurs codons.
❑ d. Il se lie au facteur eIF2-GTP.
❑ e. Il peut se lier au site A du ribosome.
D’après concours Paris 6
146 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Concours n ◦ 2 (durée 2 h)
Chimie
61 Parmi les propositions suivantes, cochez la (les) proposition(s) exacte(s) :
❑ a. La formule électronique 1s2 2s 22p63s2 3p 64s23d 8 n’est pas compatible avec la
règle de Hund (règle de r épartition des électrons parallèles sur des orbitales
énergétiquement dég énérées).
❑ b. L’atome de sodium Na possède 11 électrons, l’ion Na+ a donc pour formule
électronique 1s22s2 2p6 .
❑ c. Quand deux orbitales atomiques fusionnent pour donner une orbitale
moléculaire, c’est toujours l’orbitale anti-liante qui résulte de la fusion.
❑ d. Dans un atome non hybridé, la répartition des orbitales atomiques qui peuvent
créer des liaisons σ avec des orbitales s d’atomes d’hydrogène est tétraédrique.
❑ e. Les orbitales atomiques sp 3 sont r éparties sur les hauteurs d’un tétraèdre
régulier.
D’après concours Brest

62 Parmi les affirmations suivantes, lesquelles sont vraies ?


❑ a. Dans une liaison polarisée entre deux atomes, l’él ément le plus électronégatif
présente un excès de charge négative.
❑ b. Dans l’échelle de Pauling, l’élément le plus électronégatif est le fluor.
❑ c. Dans l’échelle de Pauling, l’azote est l’atome le moins électron´
egatif.
❑ d. Le moment dipolaire est orienté de l’atome le moins électronégatif vers l’atome
le plus électronégatif.
❑ e. L’électronégativité caractérise la tendance qu’a un atome à repousser les
électrons.
D’après concours Dijon

63 Quelle(s) est (sont) la (les) proposition(s) exacte(s) concernant la molécule d’ammoniac


NH 3 ?
❑ a. NH3 présente une géométrie trigonale.
❑ b. La molécule d’ammoniac peut établir des liaisons hydrogène.
❑ c. La présence de liaisons polarisées suffit à rendre une molécule polaire.
❑ d. La polarité de la molécule NH 3 est en partie conditionnée par sa géométrie.
❑ e. La molécule adopte une géométrie qui minimise les répulsions électrostatiques
entre les doublets des liaisons et le doublet libre.
D’après concours Nantes

64 Parmi les valeurs suivantes, indiquez celle qui correspond au nombre d’orbitales dans
la sous-couche 4 f :
❑ a. 7 ❑ b. 3 ❑ c. 1 ❑ d. 5 ❑ e. 8
UE 1 • Concours blancs 147

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


D’après concours Paris 13

65 Cochez la(les) proposition(s) exacte(s) :


❑ a. Dans une double liaison C = C, les deux atomes de carbone sont hybridés sp.
❑ b. Dans une double liaison C = C, l’un des deux atomes de carbone peut être
asymétrique.
❑ c. Dans une double liaison C = C, la liaison π résulte de l’interaction latérale des
orbitales atomiques p de chaque atome de carbone.
❑ d. Une liaison σ résulte d’un recouvrement axial d’orbitales atomiques.
❑ e. La double liaison C = C a pour cons équence possible la stéréoisomérie R, S.
D’après concours Paris 6

66 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Le potentiel d’ionisation de 11 Na est supérieur à celui de 12Mg.
❑ b. Le caractère électropositif de 11Na est inf érieur à celui de 12 Mg.
❑ c. L’affinit é électronique du 9F est supérieure à celle du 8O.
❑ d. L’affinité électronique du 9F est supérieure à celle du 11 Na.
❑ e. L’électronégativité du 9 F est supérieure à celle du 35Br.
D’après concours Nancy

67 Quel est le numéro atomique de l’élément situé dans la 4e colonne, 4e période de la


classification périodique ?
❑ a. 22 ❑ b. 24 ❑ c. 32 ❑ d. 34
❑ a. Aucune des quatre propositions précédentes n’est correcte.
D’après concours Grenoble

68 L’élément rubidium existe sous deux formes isotopiques 85 Rb et 87 Rb. Sa masse mo-
laire vaut 85, 5g.mol−1 . Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. 85 et 87 sont des nombres atomiques.
❑ b. Deux isotopes n’ont pas le même nombre de neutrons.
❑ c. La proportion isotopique ( 85 Rb/87 Rb) vaut 1.
❑ d. La proportion isotopique ( 85 Rb/87 Rb) vaut 3.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

69 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. La configuration électronique du rubidium dans son état fondamental est
1s2 2s 2 2p 6 3s2 3p6 3d 10 4s2 4p6 4d 1.
❑ b. La configuration électronique de l’élément césium 55 Cs dans son état fonda-
mental est [54 Xe] 4 f 1.
148 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. Le sodium est l’élément de numéro atomique Z = 11.
❑ d. L’atome de potassium possède 19 électrons.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

70 On s’intéresse à quelques éléments de la colonne des alcalins. Le tableau suivant donne


la période de chacun de ces el´ éments dans la classification périodique.

Élément Sodium Na Potassium K Rubidium Rb Césium Cs


Période 3 4 5 6

Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Tous ces éléments possèdent un électron de valence.
❑ b. Tous ces éléments sont des m étaux très r éducteurs.
❑ c. Parmi ces éléments le sodium possède la plus petite énergie de première
ionisation.
❑ d. Le sodium, est parmi ces él éments, celui qui possède le plus grand rayon
atomique.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

QCM n◦ 72 et 73 : Soit la réaction R à 25 ◦C :


H2(g) + I2(g) 2 1 2 HI (g).
Lorsque l’équilibre est atteint dans un récipient de 10 L, la quantité de matière de chacun
des réactifs et des produits est : 0, 100 mol de H2 ; 0, 100 mol de I2 ;
0, 740 mol de HI.
D’après concours Nantes

71 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. La constante d’équilibre K c de la réaction R est comprise entre 1, 80 et 1, 85.
❑ b. Les constantes d’équilibre K c et K p ont les mêmes valeurs.
❑ c. L’ajout d’un gaz inerte dans le récipient à pression constante déplace l’équilibre
dans le sens 1.
❑ d. L’ajout de H 2 dans le récipient à pression constante déplace l’ équilibre dans le
sens 1.
❑ e. L’ajout de HI dans le récipient à pression constante déplace l’ équilibre dans le
sens 2.

72 Un ajout au système de 0, 500 mol de HI(g) est réalisé dans le r écipient à pression
constante. Cochez les propositions suivantes concernant l’état du système au nouvel équilibre
qui sont vraies.
❑ a. La valeur de la constante d’équilibre K c de la réaction R reste inchangée.
UE 1 • Concours blancs 149

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. L’équilibre est un équilibre homogène.
❑ c. La concentration de HI est comprise entre 1, 1330 et 1, 1340 mol.L −1.
❑ d. La concentration de I2 est égale à celle de H2.
❑ e. La concentration de I2 est comprise entre 0, 0152 et 0, 0155 mol.L−1 .
73 L’acide carbonique (H2CO 3 ) est un diacide faible en solution aqueuse.
Données : pK a1 = 6, 4 pK a2 = 10, 2 à 25◦ C.
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. À pH = 7, l’acide carbonique est l’espèce prédominante.
❑ b. L’espèce prédominante à pH = 7 est l’ion hydrogénocarbonate HCO−3 .
❑ c. L’ion carbonate CO2−3 est l’espece
` prédominante à pH = 7.
❑ d. Pour une solution aqueuse d’acide carbonique a` une concentration de 0, 01 M
le pH est supérieur à pKa1 .
❑ e. À pH = 6, 4 on a [H2CO 3 ] = [HCO−3 ].
D’après concours Nancy

74 On souhaite préparer 1 litre d’une solution tampon de pH compris entre 6, 9 et 7, 1. On


donne :
   
pK a NH+4 /NH 3 = 9, 2 pKa CH 3COOH/CH3 COO− = 4, 8
   
pK a H 2PO −4 /HPO2−
4 = 7, 2 pKa HPO 2− 3−
4 /PO 4 = 12, 4
Cochez les mélanges suivants qui permettent d’obtenir cette solution tampon.
❑ a. 0, 02 mol de Na2 HPO4 et 0, 03 mol de NaH2PO4 .
❑ b. 0, 03 mol de Na2 HPO4 et 0, 02 mol de NaH2PO4 .
❑ c. 0, 05 mol de Na2 HPO4 et 0, 03 mol de HCl.
❑ d. 0, 05 mol de Na2 HPO4 et 0, 03 mol de NaOH.
❑ e. 0, 025 mol de NH3 et 0, 025 mol de CH3COOH.
D’après concours Nantes

75 Cochez la, ou les, proposition(s) exacte(s) :


❑ a. Le pH de l’eau pure est toujours égale à 7, 0.
❑ b. Le pH, à 25 ◦C, d’une solution aqueuse d’un monoacide fort HA de concentra-
tion C = 1, 0 × 10−8 mol.L −1 est égal à 8, 0.
❑ c. Pour une solution de base faible peu protonée de concentration C le pH peut
1 
être calculé à partir de la relation : pH = (pKe + pKa ) - pC .
2
❑ d. Le pH d’une solution obtenue en mélangeant 0, 01 mol d’ions HO − et 0, 03 mol
d’ions NH+4 dans un litre d’eau, pK a (NH +4 /NH3 ) = 9, 2, est égal à 8, 9.
❑ e. Tous les items précédents sont faux.
D’après concours Limoges
150 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


76 Cochez la, ou les, proposition(s) exacte(s) :
❑ a. Plus le pKa d’un acide faible est faible, plus son acidite´ est forte.
❑ b. Le pH d’une solution d’acide faible peut être donné par la relation
1
pH = pK a +pC).
2
❑ c. Le suc gastrique a un pH très acide (pH  2).
❑ d. Le pH d’une solution d’acide fort est donné par la relation pH = log C .
❑ e. Le produit ionique de l’eau pure, à 25◦ C, a pour expression :
Ke = [H3 O+ ]. [HO− ]
D’après concours Limoges

77 À propos des systèmes tampons. La ou (lesquelles) de ces propositions est (sont)


vraie(s) :
❑ a. L’eau, espèce chimique amphotère, est un excellent tampon.
❑ b. Une solution contenant 50 mmol d’acide acetique
´ et 100 mmol d’ion d’ac étate
peut être consideré
´ comme un tampon.
❑ c. Une hyperventilation provoque une diminution de CO2 dissout dans le sang,
donc une rapide diminution du bicarbonate et de la concentration en proton
dans le sang.
❑ d. Une hyperventilation provoque une diminution du CO2 dissout dans le sang,
donc une rapide augmentation du bicarbonate et du pH sanguin.
❑ e. Toutes les propositions précédentes sont fausses.
D’après concours Grenoble

78 À propos des systèmes tampons. La ou (lesquelles) de ces propositions est (sont)


vraie(s) :
❑ a. L’hémoglobine est un tampon intracellulaire.
❑ b. Le pouvoir tampon( β ) du système CO2 /HCO−3 diminue de façon lin éaire avec
la concentration [HCO−3 ].
❑ c. Une hypoventilation diminue PCO 2 et augmente les ions HCO −3.
❑ d. Le pH normal de l’organisme (extracellulaire) est de 7, 40.
❑ e. La concentration des ions H+ est d’environ 40 mmol.L−1.
D’après concours Grenoble

79 On mélange 300 mL d’une solution S1 de NH +4 (pKa = 9, 28) de concentration


C1 = 1, 84 × 10−2 mol/L à 200 mL d’une solution S 2 de KOH à C2 = 1, 38 × 10−2 mol/L.
❑ a. Le pH de la solution S1 est 9, 28.
❑ b. Le pH du mélange obtenu est 5, 51.
❑ c. La solution obtenue est une solution tampon.
❑ d. Le pH des solutions tampons varie peu lors de l’ajout modéré d’une base ou
d’un acide mais est sensible à l’effet de dilution.
❑ e. Le pouvoir tampon des solutions tampons varie en fonction de la dilution.
D’après concours Montpellier
UE 1 • Concours blancs 151

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


80 Un patient ingère une grande quantité de barbiturique (R−COOH) dont le
pKa = 7, 6.
❑ a. La constante d’acidité de ce barbiturique est de 2, 5 × 10−8 .
❑ b. Au pH sanguin, la fraction diffusible est égale à 6 fois la fraction non diffusible.
❑ c. Pour limiter l’ intoxication, on place le patient en acidose.

On prépare un mélange équimolaire de cet acide barbiturique et de sa base conjuguée à 1


mol/L.

❑ d. Le pH de cette solution est de 7, 6.


❑ e. Le pH de 300 mL de cette solution dans laquelle on a ajouté 10−1 mol d’acide
chlorhydrique est égale à 7, 3.
D’après concours Montpellier

81 Après un exercice physique, un sujet absorbe une grande quantité d’eau minérale riche
en bicarbonates.
❑ a. Dans un premier temps, la PCO2 reste normale.
❑ b. Dans un premier temps, le pH sanguin diminue.
❑ c. Dans un premier temps, la concentration en H+ augmente.
❑ d. Dans un second temps, la compensation sera rénale avec diminution de la
sécrétion de protons.
❑ e. Dans un second temps, la compensation sera pulmonaire et se fera par hypo-
ventilation.
D’après concours Montpellier

82 Soit le principe de l’éthylotest chimique qui utilise le changement de couleur de l’anion


dichromate Cr 2O2−7 le transformant en cation Cr
3+
lors de la réaction avec l’éthanol qui est
transformé en acide acétique. Concernant cette réaction :
❑ a. Il s’agit d’une réaction d’oxydo-réduction.
❑ b. L’éthanol joue le rôle d’oxydant.
❑ c. Le nombre d’oxydation du chrome dans l’ion polyatomique dichromate est égal
à −II.
❑ d. Une réaction redox
´ nécessite toujours de l’oxygène.
❑ e. Le nombre d’oxydation du chrome dans Cr 3+ est +III.
D’après concours Limoges

83 En solution aqueuse, les dérivés halogénés interviennent dans de nombreux couples


acido-basiques et/ou r édox.
On considère les espèces HBr, Br−, HOBr, BrO−, Br 2 . Le pKa du couple HBr/Br − est de −9
à 25 ◦ C, celui du couple HOBr/BrO− est 8, 55 à 25◦ C.
Parmi les propositions suivantes, quelle(s) est (sont) celle(s) qui est (sont) juste(s).
❑ a. HBr est un acide fort en solution aqueuse, HOBr un acide faible en solution
aqueuse.
152 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. BrO− est une base faible en solution aqueuse, mais plus puissante que la base
Br−.
❑ c. Les nombres d’oxydation du brome dans HBr, Br− , HOBr et Br2 sont respecti-
vement de +I, −I, +I, +I, 0.
❑ d. L’écriture de la demi-équation entre BrO− et Br 2 écrite pour une mole de Br2
fait apparaı̂tre un électron, 2 H+(aq) et de l’eau.
❑ e. Tous les items préécdents sont faux. D’après concours Grenoble

84 On donne :
2
➣ l’équilibre (1) : acide pyruvique + NADH + H +  1 acide lactique + NAD +
➣ les potentiels standards des couples redox suivants à pH = 0 et à 298 K :
E ◦1 (acide pyruvique/acide lactique) = 0, 23 V ; E◦2 (NAD+/NADH) = −0, 11 V ;
➣ à 25 ◦C : pKa (acide pyruvique/pyruvate) = 2, 5 ;
pKa (acide lactique/lactate) = 3, 9 ;
➣ les formules suivantes :

Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Acide lactique  acide pyruvique +2e − + 2 H+ .
❑ b. Dans l’équilibre (1), le carbone b de l’acide lactique subit une oxydation (sens
2).
❑ c. La molécule d’acide pyruvique présente un système conjugué.
❑ d. Les nombres d’oxydation des carbones a et b de l’acide pyruvique ne varient
pas au cours de la réaction d’oxydo-réduction.
❑ e. Dans les conditions standards, le sens spontané de la r éaction est celui qui cor-
respond à l’oxydation de NADH par l’acide pyruvique.
D’après concours Nantes

85 Soit la réaction de dismutation à 25 ◦C de l’eau oxygénée non stabilisée :


H 2 O2 = H2 O + O2
Temps en h 0, 0 0, 5 1 2 4 6
[H2 O2 ] mol/L 1, 000 0, 794 0, 629 0, 396 0, 156 0, 062
Cochez la (ou les) propositions(s) exacte(s) :
❑ a. La constante de vitesse est k = 0, 46 h−1 .
❑ b. Le temps de demi-réaction T 1/2 est indépendant de la concentration initiale en
H2 O2 .
❑ c. Cette réaction de dismutation est du 2e ordre.
❑ d. T1/2 est compris entre 85 et 95 minutes.
UE 1 • Concours blancs 153

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. À t = 1, 5 h, la concentration en H2O 2 est de 0, 5 mol/L.
D’après concours Limoges

86 Concernant la réaction suivante :

❑ a. Le composé F est un alcool primaire.


❑ b. La réaction F → G est une substitution nucléophile.
❑ c. La réaction F → G est de mécanisme E1.
❑ d. Le composé G est chiral.
❑ e. La structure du composé G est la suivante :

D’après concours Lyon

87 Concernant la réaction suivante :

❑ a. F est une amine secondaire.


❑ b. F possède un carbone asymétrique.
❑ c. H est une imine (ou base de Schiff).
❑ d. Dans la première étape de la réaction (dans laquelle F réagit avec G), G se
comporte comme un nucléophile.
❑ e. H est en configuration  E  .
D’après concours Lyon

88 On considère les deux acides carboxyliques suivants :

Données numériques établies dans des conditions standards à 300 K :


154 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


∆ f H ◦ kJ.mol −1 S ◦ J.mol−1 .K−1
Acide fumarique −810 160
Acide maléique −790 180

❑ a. L’acide fumarique et l’acide maléique sont des isom ères de constitution.


❑ b. Dans des conditions standards à 300 K l’enthalpie libre standard de formation
de l’acide fumarique vaut −858 kJ.
❑ c. Dans des conditions standards à 300 K l’enthalpie libre standard de formation
de l’acide maléique vaut −858 kJ.
❑ d. Dans des conditions standards à 300 K l’acide fumarique se transforme spon-
tanément en acide maléique.
❑ e. Dans des conditions standards à 300 K l’acide maléique se transforme spon-
tanément en acide fumarique. D’après concours Bordeaux

Biochimie

89 Concernant les caractéristiques des lipoprotéines :


❑ a. Les HDL sont des Iipoprotéines de très basse densité.
❑ b. Les VLDL transportent majoritairement des triglycérides provenant de la di-
gestion vers le foie.
❑ c. Les VLDL sont constituées d’apoprotéines B48, CI, CII, CIII et E.
❑ d. Les IDL sont formées à partir des VLDL essentiellement par depart
´ progressif
du cholestérol.
❑ e. Les LDL sont constituées d’Apo B100.
D’après concours Paris 11

90 Concernant le métabolisme énergétique.


Pour produire de l’énergie, l’organisme activera :
❑ a. La glycogénogenèse. ❑ b. La synthèse d’ADN. ❑ c. La lipolyse.
❑ d. La synthèse des protéines. ❑ e. La lipogenèse. D’après concours Paris 11

91 Après un repas :
❑ a. La lipolyse est activée.
❑ b. Une glycogène phosphorylase permet le stockage de glucose sous forme de
glycogène.
❑ c. Une augmentation du rapport glucagon/insuline active la synthèse des lipides
et des protéines.
❑ d. Les differents
´ organes utilisent les substrats apportés par l’alimentation à l’ex-
ception du glucose qui sera réservé aux tissus gluco-dépendants.
❑ e. La glycolyse est activée, permettant la formation d’énergie sous forme d’ATP.
D’après concours Paris 11
UE 1 • Concours blancs 155

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


92 Métabolisme des acides gras.
Parmi les propositions suivantes, indiquez celle qui est exacte.
❑ a. Les propriét és détergentes des acides biliaires favorisent la digestion des
lipides.
❑ b. La synthèse d’un acide gras à 16 atomes de carbone est mitochondriale.
❑ c. Le NADH, H+ est indispensable à la synthèse des acides gras.
❑ d. Les acides gras a` longue chaˆıne sont activés dans la mitochondrie.
❑ e. La dégradation d’un acide gras à 6 atomes de carbone est moins énerg étique
que la dégradation d’une molecule
´ de glucose.
D’après concours Paris 11

93 Soit une hélice α dont la longueur est 7, 5Å


❑ a. Elle est constituée de 18 ± 1 résidus acides amin és.
❑ b. Elle comporte 7 ± 1 tours.
❑ c. Elle a un pas de 5, 4Å.
❑ d. Elle est plus étirée qu’un brin β constitué du même nombre de résidus.
❑ e. Elle contient 13 atomes pris dans la boucle fermée par une liaison hydrogène.
D’après concours Paris 11

´ est : (Asp, Gly, Lys, Met,


94 Soit l’octapeptide P dont la composition en acides amines
Thr 2, Tyr, Val). Son analyse a donné les r ésultats suivants :
1. l’action du réactif d’Edman sur le peptide P a libéré un PTH-Asp.
2. l’action de la carboxypeptidase A sur le peptide P a liber ´ é un acide aminé dépourvu de
pouvoir rotatoire.
3. le traitement de P par la chymotrypsine a donné deux tétrapeptides contenant, chacun, une
Thr.
4. l’action du bromure de cyanogène sur l’un des tétrapeptides libère un tripeptide dont le
résidu N-terminal est une valine.
5. l’action de la trypsine sur l’autre tétrapeptide a donné deux dipeptides.
Parmi les propositions ci-dessous, indiquez la séquence compatible avec ces résultats :
❑ a. D K T Y M V T G ❑ b. D T K Y V T M G ❑ c. D K T Y M V G T
❑ d. D Y T K M V T G ❑ e. D T K Y V M G T
D’après concours Paris 11

95 Peptide
Soit l’hexapeptide (a) de s équence : L A W Q P M
On donne les cinq affirmations suivantes :
1. La concentration de (a) en solution peut être obtenue par mesure de l’absorbance à 280 nm.
2. (a) peut être phosphoryle´ par une protéine kinase.
3. Le pI de (a) est égal à 3, 1 ± 1.
4. (a) a une masse de 6 kDa ± 1.
5. L’hydrolyse de (a) par HCl 6N à 110 ◦ C pendant 24 heures conduira au mélange d’acides
aminés suivant : Ala, Leu, Gln, Met, Pro
156 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Parmi les combinaisons suivantes, indiquez celle dont toutes les affirmations sont exactes :
❑ a. 1, 3, 5 ❑ b. 2, 3, 5 ❑ c. 4, 5 ❑ d. 1, 5 ❑ e. 1, 2, 3
D’après concours Paris 11

96 Peptide
Parmi les propositions suivantes, indiquez celle qui est exacte :
❑ a. La myoglobine contient un groupement prosthétique.
❑ b. Les immunoglobulines sont riches en hélices α.
❑ c. La structure secondaire du collagène est stabilisée par des liaisons hydrogène.
❑ d. La forme désoxy-hémoglobine (T) est stabilisée par des ponts disulfures.
❑ e. Le motif de structure secondaire prédominant dans la protéine PrPc normale est
le feuillet β.
D’après concours Paris 11

97 Le peptide : TERRIFICPACES
1. ne contient pas de résidu d’acide aminé aromatique.
2. absorbe la lumière dans l’UV à 210 nm.
3. a une masse de 140 ± 20 daltons.
4. peut théoriquement former un pont disulfure intrachaı̂ne.
5. interagit à pH 7, 5 avec une r ésine échangeuse d’ions de type DEAE (diéthylaminoéthyl).
Parmi les combinaisons suivantes, indiquez celle dont toutes les affirmations sont exactes.
❑ a. 1, 3, 5 ❑ b. 2, 3, 4, 5 ❑ c. 2, 3, 5 ❑ d. 2, 4 ❑ e. 3, 4, 5
D’après concours Paris 11

98 L’analyse d’un pentapeptide a donné les résultats suivants :


1. l’hydrolyse complète par HCI 6N pendant 24 h, sous vide à 110 ◦ C, a montré la présence
des acides aminés Ala, Gln, Phe, Tyr dans un rapport molaire de 2/1/1/1.
2. par une réaction adapt ée le PTH-Tyr a été mis en évidence.
3. l’hydrolyse partielle par la chymotrypsine a fourni un melange
´ de Tyr et de Gln et un pep-
tide dont l’hydrolyse ultérieure a mis en évidence les acides aminés Ala et Phe en proportion
molaire 2/1.
Parmi les propositions ci-dessous, laquelle est compatible avec ces observations ?
❑ a. F A A Y Q ❑ b. Q F A A Y ❑ c. F Q Y A A ❑ d. Y A A F Q
❑ e. Y Q A A F
D’après concours Paris 11

99 Fonction des transporteurs d’oxygène


1. L’affinité de l’hémoglobine A pour l’oxygène est supérieure à son affinit é pour le mo-
noxyde de carbone.
2. L’affinité de l’hémoglobine A pour l’oxygène diminue avec une élévation de la concentra-
tion en dioxyde de carbone.
3. En absence de 2, 3-bisphosphoglycérate (2, 3-BPG), l’hémoglobine perd ses propriét és de
coopérativité.
UE 1 • Concours blancs 157

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


4. La P50 (pression partielle en O2 donnant 50% de saturation) de l’hémoglobine fœtale est
supérieure à celle de l’hémoglobine A maternelle.
Parmi les combinaisons suivantes, indiquez celle dont toutes les affirmations sont exactes.
❑ a. 1, 2, 3, 4 ❑ b. 1, 2, 3 ❑ c. 2, 3, 4 ❑ d. 2, 3 ❑ e. 2, 4
D’après concours Paris 11

100 On considère les peptides : (1) L-W-K-P-E et (2) A-P-R-K-R-K-T-A


❑ a. À pH 7, (1) et (2) peuvent être séparés par chromatographie sur une résine
échangeuse d’anions.
❑ b. Au cours d’une chromatographie d’exclusion stérique, (1) est élué de la colonne
avant (2).
❑ c. (1) est sensible à l’action de la trypsine.
❑ d. La concentration de (1) en solution peut être d étermin ée en mesurant l’absorp-
tion de la solution à 280 nm.
❑ e. (2) adopte spontanément une structure en h élice α.
D’après concours Paris 11

101 À propos de l’ATP synthase :


❑ a. Les substrats nécessaires à la synth èse de l’ATP sont l’ADP3−, l’orthophosphate
(Pi2− ) et un proton H+.
❑ b. La réaction de synth èse de l’ATP est exergonique.
❑ c. La partie F0 participe au passage et à la regulation
´ des flux de protons.
❑ d. Le découplage entre F0 et F1 produit l’hydrolyse de l’ATP.
❑ e. L’exportation de l’ADP produit par la mitochondrie a un coût énergétique.
D’après concours Nancy

102 À propos des glycosaminoglycanes :


❑ a. Les glycosaminoglycanes sont des hétéropolymères ne comportant que deux
oses simples différents.
❑ b. Les glycosaminoglycanes sont des molécules neutres.
❑ c. Les glycosaminoglycanes sont solubles dans l’eau.
❑ d. Le cartilage contient des glycosaminoglycanes.
❑ e. Les enzymes qui dégradent les glycosaminoglycanes reconnaissent les formes
anométiques des oses dans dont le carbone anomérique est engagé dans la liai-
son osidique.
D’après concours Nancy
158 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


QCM n◦104 et 105 : On considère les brins ”+” suivants de deux fragments d’ADN double
brin formés de 30pb (par commodité seul un des brins est indiqué dans l’énoncé ci dessous) :
brin  +  du fragment n◦ 1 5’- ATCCTGCAGTCAGATGGAATCGACGGTAGT
brin  +  du fragment n◦ 2 5’- GATCAGTCACGCGCGCGCGCGCATGCACGT
Sachant par ailleurs, que la stabilité de la double hélice d’ADN est dépendante des forces de
liaison associant les brins, indiquez la(les) proposition(s) correcte(s).
D’après concours Paris 7

103
❑ a. La valeur attendue du Tm du fragment n◦ 2 sera supérieure à celle du fragment
n◦ 1.
❑ b. À la température de son Tm le fragment n◦2 sera totalement d énaturé.
 
❑ c. Le rapport nombre de bases puriques/ nombre de bases pyrimidiques est
constant dans les deux fragments.
❑ d. Le brin complémentaire du fragment n◦1 aura la séquence suivante :
5’- TAGGACGTCAGRCTACCTTAGCTGCCATCA
❑ e. Le nombre total de bases pyrimidiques du fragment n◦1 est 30.

104
❑ a. La séquence de l’ARNm obtenu lors de la transcription du fragment n◦1 sera :
5’- AUCCUGCAGUCAGAUGGAAUCGACGGUAGU
❑ b. La séquence de l’ARNm obtenue lors de la transcription du fragment n ◦1 sera :
5’- ACUACCGUCGAUUCCAUCUGACUGCAGGAU
❑ c. Le nombre total de liaison phospho-diester qui seront crées lors de la synthèse
de l’ARNm obtenu lors de la transcription du fragment n◦2 est 29.
❑ d. La molécule située à l’extr émité 3’ du brin d’ARN est caractérisée par la
présence de 2 groupements hydroxyle en position 2’ et 3’ du ribose.
❑ e. La présence d’un hydroxyle en position 2’ sur le ribose dans l’ARN confère
une grande stabilité a` la molécule d’ARN.

105 A propos du génome, lequel (lesquels) de ces items est (sont) exact(s) :
❑ a. Pour les gènes codant les protéines, le nombre d’exons est toujours proportion-
nel à la taille de la protéine.
❑ b. Chez l’homme, la partie du génome correspondant aux exons des gènes
représente environ 5% de la totalit é du génome.
❑ c. Chez l’homme, environ 50% du génome est constitué par des s équences
répétées.
❑ d. Les minisatellites sont des répétitions principalement concentrée au niveau des
régions télom ériques et subtélom ériques.
❑ e. Toutes les propositions précédentes sont fausses.
D’après concours Grenoble
UE 1 • Concours blancs 159

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


106 Les sulfatides :
❑ a. sont des sphingolipides.
❑ b. sont des glycolipides.
❑ c. sont des constituants de la myéline.
❑ d. sont électriquement neutres au pH physiologique.
❑ e. Toutes les propositions précédentes sont fausses.
D’après concours Grenoble

107 Concernant la testostérone :


❑ a. Le cholestérol est un précurseur de la synthèse de la testostérone.
❑ b. La prégnénolone est un précurseur de la testostérone.
❑ c. Le noyau de base des androgènes comporte 21 atomes C.
❑ d. La testostérone comporte deux fonctions alcool.
❑ e. Le cycle A de la testostérone est un noyau aromatique.
D’après concours Nantes

108 L’acide D-glucuronique :


❑ a. a un rôle d’élimination de compos és toxiques comme le phénol.
❑ b. intervient dans le métabolisme de la bilirubine.
❑ c. forme des éthers-oxydes après action d’une transférase.
❑ d. a un groupement carboxyle en C6.
❑ e. est à l’origine de la vitamine C chez certains vertébrés.
D’après concours Nancy

109 À propos des acides gras :


❑ a. La molécule d’acide gras comprend une partie hydrophile et une partie
hydrophobe.
❑ b. Un acide gras qui ne présente pas de double liaison est dit saturé.
❑ c. La double liaison d’un acide gras est obligatoirement entre le carbone alpha et
le carbone oméga.
❑ d. L’acide palmitoléı̈que est un acide gras saturé.
❑ e. L’acide stéarique est un acide gras saturé.
D’après concours Nancy

Biologie moléculaire

110 Parmi les propositions suivantes concernant le gel de séquence (méthode de Sanger)
représenté ci-dessous, lesquelles sont exactes ?
160 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. Un ADNc peut être séquenc é par cette technique.
❑ b. Dans ce gel, les fragments d’ADN sont séparés en fonction de leur taille.
❑ c. L’ADN déposé dans tous les puits a été synthétisé en présence de
didésoxycytosine triphosphate.
❑ d. L’ADN déposé dans tous les puits a été synthétisé en présence de
désoxycytosine triphosphate.
❑ e. La séquence analysée s’écrit 5’- GTGCTAGACTTGAGTACATGAT- 3’.
D’après concours Paris 11

111 Concernant la transcription du génome eucaryote :


❑ a. L’ARN polym érase II est activée par les facteurs généraux de transcription.
❑ b. L’ARN polymérase II lit le brin sens du gène.
❑ c. Les introns des gènes sont transcrits en ARN.
❑ d. Les ARNm sont minoritaires parmi l’ensemble des ARN cellulaires.
❑ e. Dans la bulle transcriptionnelle, les 2 brins de I’ADN sont transcrits.
D’après concours Rouen

112 Concernant les télomérases :


❑ a. Elles coupent réversiblement I’ADN.
❑ b. Elles fonctionnent essentiellement chez l’homme adulte.
❑ c. Elles permettent de répliquer les extrémités des chromosomes au niveau des
brins tardifs.
❑ d. Elles lient entre elles les extrémités des fragments d’Okazaki.
❑ e. Elles présentent dans leur structure une matrice d’ARN
D’après concours Strasbourg

113 Quelle(s) est (sont) le (les) proposition(s) exacte(s) ?


❑ a. Cloner un fragment nécessite au moins un ADN vecteur et des cellules hôtes
compatibles.
❑ b. Créer les liaisons covalentes pour construire un ADN recombinant se fait en
utilisant la réverse transcriptase.
UE 1 • Concours blancs 161

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. Un ADN-vecteur comporte au moins une origine de réplication et un marqueur
de sélection.
❑ d. Un plasmide bactérien peut servir d’ADN-vecteur pour cloner des fragments
d’ADN eucaryotes dans des cellules eucaryotes.
❑ e. Autre réponse.
D’après concours Strasbourg
114 Parmi les enzymes impliquées dans la réparation de la désamination oxydative de la
cytosine, on trouve :
❑ a. ADN hélicase. ❑ b. Endonucléase AP. ❑ c. ADN ligase.
❑ d. Exonucléase. ❑ e. Uracile ADN glycosylase.
D’après concours Paris 11
115 Les récepteurs nucléaires d’hormones :
❑ a. Ils sont activés par la fixation de l’hormone.
❑ b. Ils recrutent des corépresseurs pour activer la transcription de leurs gènes cibles.
❑ c. Leur domaine de liaison à I’ADN contient des motifs hélice tour hélice.
❑ d. Ils sont localisés dans la membrane cellulaire.
❑ e. Ils se fixent sur des séquences d’ADN appelées RE pour Response Element.
D’après concours Paris 11

116 Les protéines de régulation génique possèdent un domaine de liaison à l’ADN. Parmi
les domaines suivants, lesquels sont des domaines d’interaction avec l’ADN ?
❑ a. Domaine en doigt de zinc.
❑ b. Domaine riche en proline.
❑ c. Domaine acide.
❑ d. Domaine hélice-boucle-hélice.
❑ e. Domaine riche en glutamine.
D’après concours Paris 11

117 L’ADN :
❑ a. Est sensible à l’action de bases qui le dénaturent par rupture des liaisons de type
hydrog`ene.
❑ b. Est sensible à l’action de bases provoquant des coupures statistiques des brins.
❑ c. Est stable à cause de l’empilement des paires de bases.
❑ d. Est stable à cause des 3 liaisons de type hydrogene ` des CG appariés.
❑ e. Est stable car l’eau est très peu présente dans la zone centrale de la mol écule.
D’après concours Nancy

118 Un ARNm est transcrit par l’ARN polymérase II à partir de la matrice d’ADN sui-
vante : 5’CCCCGTTTATTCGAATGTTCAGGGTTT 3’.
Parmi les propositions suivantes concernant les caractéristiques de cet ARNm, lesquelles sont
inexactes ?
❑ a. Il possède un site donneur d’épissage.
162 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. Il possède un site accepteur d’ épissage.
❑ c. Il contient un signal de polyadénylation.
❑ d. Il contient un codon d’initiation de la transcription.
❑ e. Il contient un codon stop de terminaison de la traduction.
D’après concours Paris 11

119 Concernant le fragment d’ADN suivant situé à l’extrémité d’un chromosome :


- TTAGGGTTAGGGTTAGGGTTAGGGTTA-3’
- AATCCCA-5’ :
❑ a. Cet ADN fait partie d’un télomère.
❑ b. Cet ADN n’est pas transcrit.
❑ c. Cet ADN n’est pas codant.
❑ d. Cet ADN comporte une extrémité 5’ saillante.
❑ e. La portion double brin comporte 18 liaisons hydrogènes entre bases appariées.
D’après concours Paris 6

120 La synthèse d’ARN par copie (transcription) d’un ADN matriciel partage certaines
propriét és communes avec la synthèse d’ADN. Lesquelles ?
❑ a. La chaı̂ne d’acide nucléique synth étisée a une orientation antiparall èle à la
chaine d’acide nucléique matricielle.
❑ b. La chaı̂ne d’acide nucléique synth étisée comporte des groupements OH sur les
carbones 2’ des pentoses composant les nucléotides.
❑ c. Les nucléotides polymérisés sont ajoutes
´ à l’extrémit é 3’OH de la chaı̂ne
d’acide nucléique synthétisée.
❑ d. La réaction de synthèse démarre à partir d’une chaˆıne d’acide nucléique
(amorce) préexistante.
❑ e. Les enzymes impliquées (ADN et ARN polymérases) catalysent la synth èse de
liaisons phosphodiester.
D’après concours Strasbourg

Concours n ◦ 3 (durée 2 h)
Chimie
121 En considérant que l’électron célibataire est porte´ par l’atome d’azote, cochez la (les)
proposition(s) correcte(s) concernant le radical NO :
❑ a. NO peut être décrit en représentation de Lewis selon le schéma :
UE 1 • Concours blancs 163

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. Le degré d’oxydation de l’atome d’azote de NO est -I.
❑ c. NO et O2 sont tous deux des espèces radicalaires
❑ d. Tous les électrons de NO sont appariés.
❑ e. Aucune de ces quatre propositions n’est correcte.
D’après concours Paris 5

122 Quelle(s) est (sont) la (les) proposition(s) correcte(s) concernant l’ion nitrite NO−2 ?
❑ a. L’atome d’azote est hybridé sp2 .
❑ b. La charge négative est localisée sur l’atome d’azote.
❑ c. L’ion nitrite est de geométrie
´ linéaire.
❑ d. La charge n égative est délocalisable sur l’atome d’azote.
❑ e. Aucune de ces quatre propositions n’est correcte.
D’après concours Paris 5

123 Parmi les affirmation(s) suivantes, laquelle est vraie ?


❑ a. Les molécules de m éthane, d’ammoniac et d’eau possèdent le même angle de
valence de 109◦28  .
❑ b. La double liaison est constituee´ d’une liaison π et d’une liaison σ.
❑ c. La liaison σ est plus fragile que la liaison π.
❑ d. Une liaison π est constituée par recouvrement axial de deux orbitales atomiques
p.
❑ e. La double liaison C = C est plus longue que la simple liaison.
D’après concours Dijon

124 Choisissez la (les) proposition(s) exacte(s) :


❑ a. Les forces de Keesom s’établissent entre deux molécules apolaires.
❑ b. Les forces de Debye sont les plus stabilisantes des forces de Van der Waals.
❑ c. Les forces de London expliquent la cohésion du néon à l’état solide.
❑ d. La liaison hydrogène explique la structure dimérique des acides carboxyliques.
❑ e. La présence d’une liaison hydrogène intermoléculaire explique l’augmentation
de la solubilité d’un soluté dans un solvant polaire.
D’après concours Lille

125 Quel niveau d’énergie est utilisé, une fois que la sous couche 4s est pleine ?
❑ a. 3d ❑ b. 4d ❑ c. 4p ❑ d. 5s ❑ e. 6s
D’après concours Paris 13
126 Soit l’équilibre (2) :
2
Pyruvate + NADH + H+  1 Lactate + NAD+ à pH = 7 et à 298 K.
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Les potentiels apparents à pH = 7 sont
E◦1(pyruvate/lactate) = −0, 19 V et E◦2 (NAD+/ NADH) = −0, 32 V.
164 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. Les potentiels apparents à pH = 7 sont
E◦1 (pyruvate/lactate) = 0, 65 V et E ◦2 (NAD+/ NADH) = 0, 1 V.
❑ c. Soit ∆G ◦2 le ∆G ◦ de l’équilibre (2) dans le sens direct ;
on a : ∆G◦2 = −25 090 J.
❑ d. La variation d’entropie standard dans ces conditions (pH = 7 et 298 K)
étant nulle, une augmentation de la température à pression constante déplace
l’équilibre (2) dans le sens direct 1.
❑ e. Soit les constantes de l’équilibre (2) dans le sens direct 1, Kc (pH7) à pH = 7 et
Kc (pH10) à pH = 10. On observe que Kc (pH7) > Kc (pH10).
D’après concours Nantes

127 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. Un système fermé peut échanger de l’énergie mais pas de matière avec
l’extérieur.
❑ b. La variation d’enthalpie d’une réaction de combustion est toujours positive.
❑ c. L’entropie absolue d’un corps simple est toujours positive.
❑ d. Les variations d’entropie et d’enthalpie sont ind´ependantes du chemin parcouru
entre l’état initial et l’état final.
❑ e. La variation d’entropie associée à la réaction A(g) −→ A(l) est positive.
D’après concours Nantes

128 L’arsenic est l’élément de Z = 33. Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Dans son état fondamental l’arsenic a pour configuration électronique [18 Ar
] 3d10 4s 2 4p 3.
❑ b. Dans son état fondamental l’arsenic a 3 électrons de valence.
❑ c. L’arsenic appartient à la 5e colonne de la classification p ériodique.
❑ d. L’arsenic est dans la 4e période de la classification périodique.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

129 On appelle X l’élément situé dans la même colonne que l’arsenic mais dans la deuxième
ligne de la classification périodique. Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. L’arsenic faisant partie du bloc d, X n’existe pas.
❑ b. X est le bore 5B.
❑ c. X est l’azote 7 N.
❑ d. X est le fluor 9 F.
❑ e. Tous les items précédents sont faux.
D’après concours Grenoble

16 32 33 34 36
130 On s’intéresse à l’élément soufre S qui possede
` 4 isotopes S, S, S et S.
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Sachant que la masse molaire atomique est de 32, 06 g.mol −1 , l’isotope le plus
abondant naturellement est le 34S.
UE 1 • Concours blancs 165

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. L’atome de soufre possède 16 électrons et 17 protons.
❑ c. Dans son état fondamental, le soufre a une valence égale à 2.
❑ d. Le soufre est plus électronégatif que le fluor.
❑ e. L’anion divalent S2− a une configuration électronique plus stable que l’atome
de soufre dans son état fondamental.
D’après concours Nancy

131 On s’intéresse à la formation des ions les plus probables pour quelques éléments :
Césium 55Cs, le Baryum 56Ba, l’iode 53 I et le cérium 58 Ce.
❑ a. Le Césium peut donner l’ion Cs 2+.
❑ b. Le Baryum peut donner l’ion Ba2+.
❑ c. L’iode peut donner l’ion I2− .
❑ d. Il y a deux cations possibles pour le cuivre 29Cu.
❑ e. Le Cérium peut donner l’ion Ce 2+.
D’après concours Nancy

132 Cochez la(ou les) affirmation(s) exacte(s) :


❑ a. L’élément X de configuration électronique fondamentale
1s2 2s 2 2p 6 3s2 3p6 s2 est un métal de transition.
❑ b. L’élément Y de configuration électronique fondamentale
1s2 2s 2 2p 6 3s2 3p6 4s 2 3d 10 4p5 est un halogène.
❑ c. L’élément X possède trois électrons célibataires à l’état fondamental.
❑ d. L’élément X est moins électronégatif que l’ élément Y.
❑ e. L’élément Y peut facilement donner un cation Y+ .
D’après concours Nancy

133 On considère les couples acide/base suivants :


Acide/Base HF/F − HNO2 /NO−2 HClO/ClO −
pKa 3, 2 3, 3 7, 5
Acide/Base NH +4/NH3 H 2 S/HS −
HS−/S 2−
pKa 9, 2 7, 1 12, 9
Parmi les les composés suivants, en solution aqueuse, cochez ceux qui donnent une solution
basique.
❑ a. Ca(OH) 2 ❑ b. NH4NO 2 ❑ c. NaHS ❑ d. HF ❑ e. NaClO
D’après concours Nantes

134 L’amphétamine a une masse molaire de 135 g.mol −1 et un pK a = 10. On considère


que, dans l’estomac, les sécr étions de HCl donnent un pH de 1.
166 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Soit une solution A contenant 135 mg d’amphétamine dans 100 mL d’eau. Cochez la(ou les)
affirmation(s) exacte(s) :
❑ a. La concentration de la solution A d’amphétamine est de 10−3 mol.L−1 .
❑ b. La solution A d’amphétamine a un pH = 11.
❑ c. La solution A d’amphétamine a un pH = 6.
❑ d. Si la solution A est diluée par 10, on a la formule :
1
pH = 7 + (pKa + log C)
2
❑ e. L’amphétamine se retrouve dans l’estomac sous forme de chlorhydrate.
D’après concours Nantes

135 Considérons deux réactions élémentaires du type A → B + C. La première est d’ordre


1 par rapport à A, la seconde est d’ordre 2 par rapport à A. On désigne par C 0 , la concentration
initiale en réactif A et par C la concentration en réactif A à la date t. On désigne par t 1/4 , le
temps du quart de r éaction.
Parmi les propositions suivantes, indiquez la (les) proposition(s) exacte(s).
 
1 1
❑ a. Pour la réaction d’ordre 1 : t1/4 = ln .
k 4
 
1 4
❑ b. Pour la réaction d’ordre 1 : t1/4 = ln .
k 3
1
❑ c. Pour la réaction d’ordre 1 : t1/4 =
3kC0
 
1 3
❑ d. Pour la réaction d’ordre 2 : t1/4 = ln .
k 4
1
❑ e. Pour la réaction d’ordre 2 : t1/4 =
4kC0 D’après concours Rouen

136 On s’intéresse à la réaction :


2 Fe3+ + Sn2+ → 2 Fe 2+ + Sn4+ .
Pour une solution 1 contenant initialement des ions Fe 3+ à 1 mol.L −1 et des ions Sn2+ à 10 −2
mol.L−1 , le temps de demi-réaction est de 4 s. Si l’on double la concentration initiale de Sn2+ ,
t 1/2 ne change pas.
Pour une solution 2 contenant initialement Sn2+ en large excès, on constate que t1/2 double si
la concentration initiale en Fe3+ est divisée par deux.
Indiquez parmi les propositions suivantes celle(s) qui est (sont) juste(s).
❑ a. Deux électrons sont captés par l’ion Fe 3+ lors de cette réaction.
❑ b. ´ énérescence de l’ordre en Sn2+ pour la solution 1.
Il y a deg
❑ c. La vitesse de la réaction, pour la solution 1, s’écrit v = k app .[Sn2+ ].
UE 1 • Concours blancs 167

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


1
❑ d. Pour la solution 2, t1/2 est proportionnel à
[Fe3+ ]0
❑ e. L’ordre global de la réaction est 3.
D’après concours Rouen

137 Soit les molécules suivantes. Cochez la (ou les) propositions(s), exacte(s) :

❑ a. Le composé F ou ibuprofène possède un seul carbone asymétrique.


❑ b. Le composé F est un cyclohexane disubstitu é en para.
❑ c. Les composés F et G sont isomères de fonction.
❑ d. Le composé F possède une fonction acide carboxylique et le composé G une
fonction éther-oxyde.
❑ e. Les composés F et H sont des isomères structuraux.
D’après concours Limoges

138 Soit les trois équations de réaction suivantes. Cochez la (ou les) propositions(s),
exacte(s) :

❑ a. La réaction (1) est exacte.


❑ b. La réaction (2) est exacte.
168 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ c. La réaction (3) est exacte.
❑ d. La réaction (1) est une réaction d’addition ionique électrophile.
❑ e. Lors de l’addition électrophile de HX sur un alc ène, la règle de Markovnikov
indique que le proton H+ se fixe sur le carbone le moins substitué et l’anion X−
sur sur le carbone le plus substitué au niveau de la double liaison.
D’après concours Limoges

139 Considérons les additions radicalaires. Cochez la (ou les) propositions(s), exacte(s) :
❑ a. Les additions radicalaires se produisent surtout avec HCl.
❑ b. Elles se produisent en solvant apolaire en présence d’initiateurs de radicaux.
❑ c. Ces réactions sont st éréosélectives et régiosélectives.
❑ d. L’initiation de ces réactions se traduit par la réaction suivante :
R−O−O−R → 2 RO•

❑ e. Le peroxyde de benzoyle est un initiateur de réaction en donnant des radicaux
phényles C 6H•6 .
D’après concours Limoges

140 On considère le 3-méthylheptan-3-ol noté A dans la suite. On fait réagir A avec


l’acide iodhydrique HI en solution aqueuse. On obtient un composé B. L’étude cinétique
de la réaction montre que la vitesse ne dépend pas de [HI].
Cochez la (ou les) propositions(s), exacte(s) :
❑ a. A est un alcool secondaire de formule brute C8 H17OH.
❑ b. A présente une activité optique.
❑ c. A donne en présence de HI une réaction de substitution nucléophile SN 1.
❑ d. Le produit B obtenu est le suivant :

❑ e. Le passage par un carbocation fait qu’avec A on obtiendra un mélange


racémique.
D’après concours Limoges

141 Cochez la (ou les) propositions(s), exacte(s) :


❑ a. La capacité calorifique molaire à pression constante C p est donn ée par la rela-
tion : ∆Hm = Cp.(T f − T i).
❑ b. Pour un système isolé ∆S  0.
❑ c. L’entropie d’un gaz est inférieure à celle d’un solide.
❑ d. À 0◦ C tous les corps purs cristallisés ont une entropie nulle.
❑ e. L’entropie de réaction ∆rS renseigne sur la faisabilité d’une réaction.
D’après concours Limoges
UE 1 • Concours blancs 169

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


142 Substitution ; élimination. Cochez la (ou les) propositions(s), exacte(s) :
❑ a. La substitution nucléophile d’ordre 1 est une réaction en une seule étape.
❑ b. L’utilisation de solvant protique augmente la vitesse d’une réaction SN1.
❑ c. Les substitutions des halogenures
´ benzyliques ( C 6H 5−CH 2−X) sont des
réactions d’ordre 2.
❑ d. L’inversion de Walden sur un composé chiral conduit obligatoirement à une
inversion de configuration.
❑ e. La réaction d’élimination sur le bromure d’éthyle est une réaction d’ordre 2.
D’après concours Nancy

143 Géométrie de la molécule. Cochez la (ou les) propositions(s), exacte(s) :


❑ a. Dans la molécule CO2 l’atome de carbone est hybridé sp.
❑ b. La molécule CH3 Cl est apolaire.
❑ c. ´ AX 3E1, elle a une
D’apr ès la théorie VSEPR la molécule NH 3 a une géometrie
base triangulaire.
❑ d. L’ordre de grandeur d’un moment dipolaire est de 10−29 C.m soit 3 debye D.
❑ e. La mol écule de trichlorure d’aluminium (AX3E 0) est apolaire.
D’après concours Nancy

144 L’éphédrine. Elle a pour formule semi-développ´ee :

Cochez la (ou les) propositions(s), exacte(s) :


❑ a. En nomenclature systématique son nom est 1-phényl-2-(N-
méthyl)aminopropan-1-ol.
❑ b. ` 3 atomes de carbone asym étriques.
Cette molécule possede
❑ c. Cette molécule possede
` 4 st éréoisomères.
❑ d. Selon la règle de Cahn-Ingold-Prélog −OH > −C6H5
❑ e. La molécule possède 10 atomes de carbone.
D’après concours Nancy

145 La cocaı̈ne symbolis ée par B est une base faible en solution aqueuse selon Bröensted
(pKa = 8, 7 à 25◦C).
Cochez la(ou les) affirmation(s) exacte(s) :
❑ a. Une solution aqueuse de coca¨ıne à une concentration de 10 −3 mol.L−1 a un pH
acide.
170 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. Une solution de chlorhydrate de coca¨ıne à une concentration de 10−3 M a un
pH neutre.
❑ c. Le pKb de la coca¨ıne est égale à 5, 3.
❑ d. La constante de basicité de la coca ı̈ne est K b = 10−8,7 .
❑ e. Le pH d’une solution aqueuse de cocaı̈ne depend ´ de son pK a et de sa concen-
tration.
D’après concours Nancy

146 Dans un réacteur dont l’enceinte est indilatable, on effectue la r éaction suivante :
C3 H6(g) + H 2O(l)  C3H 8 O(l) ∆H r = +250 kJ

❑ a. Si on augmente la pression, la réaction est déplacée dans le sens direct.


❑ b. Si on diminue la température, la réaction est déplacée dans le sens direct.
❑ c. Si on ajoute du C3 H8O (l), la réaction est déplacée dans le sens direct.
❑ d. Si on ajoute du H2(g) , la réaction est déplacee
´ dans le sens indirect.
❑ e. Si on ajoute de l’eau dans le réacteur, la réaction est déplacée dans le sens
indirect.
D’après concours Lyon

147 Calculez le ∆H r de la réaction suivante :


2A + B + 3C  2D + E
On donne ∆H f (A) = 100 kJ.mol −1 ; ∆H f (B) = 50 kJ.mol −1
∆H f (C) = −200 kJ.mol−1 ; ∆H f (D) = 10 kJ.mol−1 ; ∆H f (E) = −20 kJ.mol−1 .
❑ a. ∆Hr = −100 kJ.mol−1 ❑ b. ∆Hr = +250 kJ.mol−1
❑ c. ∆Hr = +350 kJ.mol−1 ❑ d. ∆Hr = +500 kJ.mol−1
❑ e. ∆Hr = +750 kJ.mol−1
D’après concours Lyon
UE 1 • Concours blancs 171

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


148 On considère la réaction suivante qui conduit à un composé unique :

❑ a. Au cours de cette réaction, le produit formé est le composé X.


❑ b. Au cours de cette réaction, le produit formé est le composé Y.
❑ c. Au cours de cette réaction, le produit formé est le composé Z.
❑ d. Cette réaction est une addition nucléophile.
❑ e. L’atome de carbone dans la fonction carbolyne du compose´ unique obtenu est
hybridé sp 2.
D’après concours Bordeaux

Biochimie
149 À propos de la glycolyse :
❑ a. C’est une voie métabolique qui convertit un hexose en deux trioses.
❑ b. Elle aboutit à une molécule comportant une fonction acide.
❑ c. Elle permet la production de la plus grande partie de l’ATP cellulaire.
❑ d. Elle se déroule à la fois dans le cytosol et la mitochondrie.
❑ e. Les molécules de NaDHH + produites dans la deuxième partie de la glycolyse
traversent la membrane mitochondriale.
D’après concours Nancy

150 Le saccharose :
❑ a. Est composé de D-glucose et de L-fructose.
❑ b. Est un dimère d’alpha-D-glucose.
❑ c. Est un glucide réducteur.
❑ d. Est appelé en nomenclature systématique  béta-D-fructofuranosyl (1-1) alpha-
glucopyranoside  .
❑ e. Existe dans les cannes à sucre.
D’après concours Nancy
172 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


151 Quelle est la proposition fausse ?
❑ a. Les acides amines
´ sont des mol écules amphotères qui possèdent un groupement
carboxyle acide et une fonction amine primaire basique.
❑ b. À pH acide, l’acide aminé est sous forme d’anion.
❑ c. Les acides aminés possédant une chaı̂ne polaire sont hydrophiles.
❑ d. Les acides aminés possédant une chaı̂ne apolaire sont fortement hydrophobes
et solubles dans les solvants organiques.
❑ e. Autre r éponse.
D’après concours Strasbourg

152 Concernant l’acide amine´ méthionine :


❑ a. Il s’agit d’un acide aminé soufré.
❑ b. Il est essentiel chez l’homme.
❑ c. Il absorbe dans l’UV.
❑ d. Il participe à la biosynthèse de l’adr énaline.
❑ e. Il entre dans la structure d’un coenzyme du métabolisme de radicaux CH3.
D’après concours Bordeaux

153 L’acide linoléique est un acide carboxylique à chaine linéaire. Quelle est la proposi-
tion fausse ?
❑ a. La chaˆıne hydrocarbonée comprend 18 C.
❑ b. C’est un acide gras poly-insaturé.
❑ c. Il est aussi appelé acide octad écénoique.
❑ d. Son point de fusion est inférieur à celui de l’acide stéarique.
❑ e. Autre réponse.
D’après concours Strasbourg

154 Concernant les glucides alimentaires :


❑ a. La cellulose peut être hydrolys´
ee par l’amylase salivaire.
❑ b. L’hydrolyse totale de l’amidon requiert une alpha 1-4 glucosidase (amylase),
une alpha 1-6 glucosidase et une maltase.
❑ c. Le lactose est formé de deux molécules de galactose.
❑ d. Le galactose est un stéréoisomère du glucose.
❑ e. Le saccharose est formé d’une mol écule de glucose et d’une mol écule de fruc-
tose.
D’après concours Paris 6

155 Parmi les propositions suivantes concernant le glucose, laquelle est fausse :
❑ a. Il a le même poids moléculaire que le fructose.
UE 1 • Concours blancs 173

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. En solution acqueuse, il peut se trouver sous forme linéaire, pyranosique ou
furanosique.
❑ c. L’anomérie est due à la mutarotation.
❑ d. L’isomerisation
´ en fructose est impossible.
❑ e. Autre réponse.
D’après concours Strasbourg

156 Après avoir examiné la courbe de titration de l’histidine represent


´ ée ci-dessous, dites
si les affirmations suivantes sont vraies ou fausses.

❑ a. À un pH inférieur à 1, 82, les groupements ionisables sont proton és.


❑ b. Le pK de 1, 82 correspond à la dissociation du groupement COOH.
❑ c. À des valeurs de pH entre 6, 00 et 9, 17, l’histidine a une charge positive.
❑ d. Le point isoélectrique de l’histidine est égal à 6, 5.
❑ e. e. À pH inférieur au pHi, l’histidine possède une charge négative.
D’après concours Nancy

157 Concernant l’acide oléique, quelle est la proposition fausse ?


❑ a. La chaˆıne hydrocarbonée comprend 16 atomes de carbone.
❑ b. C’est un acide gras insaturé en ω9.
❑ c. Sa formule chimique est C18 : ∆9.
❑ d. Il est aussi appelé acide ∆-cis-9-octadéc é(mono)éno¨ıque.
❑ e. Autre réponse.
D’après concours Strasbourg

158 Concernant les polysaccharides :


❑ a. Le glycogène adopte préférentiellement une structure en fibrilles.
❑ b. La chitine est constituée d’unit és GlcNac associées par des liaisons β1-4 et β1-
6.
❑ c. La cellulose est un polyoside réducteur.
174 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ d. L’acide hyaluronique a un fort caractère cationique.
❑ e. L’héparine est un glycosamynoglycane qui induit la coagulation.
D’après concours Paris 11

159 À propos des séries d’acides gras insatures


´ :
❑ a. Il y a dans l’organisme humain quatre séries d’acides gras polyinsaturés
différentes.
❑ b. L’organisme humain peut synthétiser tous les acides gras insaturés de la série
ω-6.
❑ c. L’acide docosahexaénoı̈que (DHA) est l’acide gras le plus long trouv é dans les
glycérophospholipides membranaires.
❑ d. L’acide arachidonique est un acide gras de la série ω-3.
❑ e. L’acide oléique est un acide gras de la série ω-3.
D’après concours Nancy

160 À propos de l’estérification du cholestérol et des esters de cholestérol, dites si les


affirmations suivantes sont vraies ou fausses.
❑ a. L’estérification du cholestérol par un acide gras convertit un lipide amphiphile
en lipide hydrophobe.
❑ b. Les esters de cholestérol sont incorporés dans les membranes.
❑ c. Les esters de cholestérol sont des composants du noyau hydrophobe des lipo-
protéines avec les triglycérides.
❑ d. Le foie ne synthétise pas d’esters de cholest´erol.
❑ e. Le cholestérol ne peut être est érifié par des acides gras insaturés.
D’après concours Nancy

161 Concernant les cérébrosides :


❑ a. Ce sont des phospholipides.
❑ b. Ils peuvent renfermer de la phosphorylcholine.
❑ c. Ils peuvent renfermer du galactose.
❑ d. La liaison de l’ose est une liaison O-osidique.
❑ e. Ils renferment une molécule d’acide gras.
D’après concours Rouen

162 À propos des propriétés physicochimiques des acides gras :


❑ a. Le point de fusion d’un acide gras dépend de sa longueur et de son degré
d’insaturation.
❑ b. Tous les sels d’acides gras sont appelés savons.
❑ c. La partie apolaire des acides gras contient des atomes d’oxygène.
❑ d. Le pôle acide d’un acide gras peut s’associer à des molécules d’eau.
UE 1 • Concours blancs 175

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ e. Les acides gras à courte chaı̂ne (< 10 carbones) sont les plus abondants dans
les cellules.
D’après concours Nancy

163 À propos de l’acide arachidonique :


❑ a. L’acide arachidonique est un acide gras saturé.
❑ b. Certaines phospholipases A1 reconnaissent spécifiquement l’acide arachido-
nique.
❑ c. Les prostaglandines sont des dérivés de l’acide arachidonique.
❑ d. Les leucotriènes sont des dérives
´ de l’acide arachidonique.
❑ e. Les prostaglandines et les leucotriènes sont dégrad és rapidement.
D’après concours Nancy

164 Les sphingomyélines :


❑ a. Contiennent un groupement phosphate.
❑ b. Sont des lipides membranaires.
❑ c. Contiennent un glycérol.
❑ d. Contiennent deux acides gras.
❑ e. Contiennent un ou plusieurs oses.
D’après concours Paris 11

165 À propos des glycolipides :


❑ a. Leur partie lipidique est un céramide.
❑ b. La partie glucidique est synthétisée apr ès la partie lipidique.
❑ c. Ils sont synthétisés sous forme soluble dans le cytosol.
❑ d. La partie glucidique est toujours neutre électriquement.
❑ e. Des glycosidases lysosomales participent à leur dégradation.
D’après concours Nancy

166 À propos des médiateurs dérivés des lipides :


❑ a. L’acide arachidonique donne des dérivés linéaires ou contenant un cycle.
❑ b. L’action d’une phospholipase A2 est nécessaire en préalable à la production des
prostaglandines.
❑ c. L’action d’une phospholipase D sur une phosphatidylcholine donne un produit
soluble.
❑ d. L’action d’une phospholipase C sur un phosphatidylinositol biphosphate donne
un produit hydrophobe.
❑ e. La dégradation d’une sphyngomyéline par une sphingomyélinase donne une
phosphocholine.
D’après concours Nancy
176 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


167 Le D-mannitol est le produit de réduction des oses suivants : lesquels ?
❑ a. D-fructose ❑ b. D-glucose ❑ c. D-mannose ❑ d. D-galactose
❑ e. D-ribose

|
m
D’après concours Grenoble

o
c
t.
o
p
s
g
168 Parmi les oses et osides suivants, lesquels ont un pouvoir réducteur en solution aqueuse ?

lo
.b
s
in
c
❑ a. maltose ❑ b. amylopectine ❑ c. saccharose ❑ d. glucose

e
d
e
m
s
e
❑ e. cellulose

rd
o
s
e
D’après concours Grenoble

tr
e
/l
:/
p
tt
169 Dans la N-glycosylation des protéines, quelle est la nature de l’ose qui s’accroche en

h
|
m
premier sur le résidu asparagine de la séquence, Asn-X-Ser ?

o
.c
s
s
re
❑ a. mannose ❑ b. NAc-glucosamine ❑ c. Nac-galactosamine

p
rd
o
.w
s
❑ d. galactosamine ❑ e. glucoside.

in
c
e
d
D’après concours Grenoble
e
m
s
e
rd

Biologie moléculaire
o
s
e
tr
e
/l
:/
p

170 Parmi les propositions suivantes concernant les propriétés de l’ARN polym érase II
tt
h
|

des eucaryotes, lesquelles sont exactes ?


s
in
c
e
d

Elle effectue la synthèse de l’ARNm au niveau d’une bulle de transcription dans


e

❑ a.
M
s
e

laquelle l’ADN est transitoirement dénaturé.


rD
o
s
re

❑ b. Elle est formée d’une seule chaı̂ne polypeptidique, ce qui permet à l’ADN de
T
e
/L

se fixer facilement au site catalytique.


s
p
u
ro
/g

❑ c. Son mouvement sur la molécule d’ADN provoque l’accumulation d’un grand


m
o
.c

nombre de tours d’h´ elice en 5’ du site de polym érisation.


k
o
o
b
e

❑ d. Elle synthétise la chaı̂ne d’ARN dans la direction 5’ ?3’ en ajoutant les ribo-
c
a
.f
w

nucléotides à l’extrémité 3’.


w
w
|
s

❑ e. L’énergie nécessaire à son fonctionnement provient de l’hydrolyse des


in
c
e
d

précurseurs nucléotidiques.
e
M
s
e

D’après concours Paris 11


rD
o
s
re
T
e
/L

171 Dans une réaction de PCR :


m
o
.c
k
o

❑ a. À chaque cycle, la phase d’hybridation précède la phase de dénaturation.


o
b
e
c
a
.f

❑ b. Les amorces utilisées sont des molécules artificielles d’ADN double brin.
w
w
w

❑ c. La taille de la région amplifi ée est de l’ordre du million de paires de bases.


|

❑ d. L’ADN polym érase étend les amorces dans le sens 5’ vers 3’.
❑ e. L’ADN polymérase utilisée est thermostable.
D’après concours Rouen

172 Concernant la délétion d’un exon de 187 nucl éotides (exon présent au milieu d’un
g ène), quelle est la proposition fausse ?
Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
UE 1 • Concours blancs 177

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ a. L’ARN messager qui en résulte porte un décalage du cadre de lecture.
❑ b. Un codon stop en phase avec le cadre de lecture apparaitra rapidement en aval
de la dél étion.
❑ c. La proteine
´ traduite à partir de cet ARN messager n’aura pas la partie C-
terminale.
❑ d. La protéine traduite à partir de cet ARN messager sera de séquence différente
mais de taille normale.
❑ e. Autre réponse.
D’après concours Strasbourg

173 Concernant les mécanismes de r éparation et de recombinaison de l’ADN, quelle est


la proposition fausse ?
❑ a. La réparation par excision de nucleotides
´ (NER) concerne majoritairement des
lésions d’origine endog ène comme la réparation de site abasique.
❑ b. La réparation post-réplicative n écessite la reconnaissance du brin néosynthétisé,
soit par la présence d’encoche, soit par l’absence de méthylation selon les
espèces.
❑ c. Les mécanismes de sauvegarde peuvent etre ˆ d élétères en transformant une
molécule non excrétable en agent mutagène.
❑ d. Un événement de recombinaison générale homologue chez les procaryotes
nécessite la pr ésence de prot éine RecA qui permet l’appariement d’un brin ex-
posé au brin d’ADN homologue.
❑ e. Autre réponse.
D’après concours Strasbourg

174 Concernant le mécanisme d’épissage du transcrit primaire chez les eucaryotes :


❑ a. Il débute par un clivage en 3’ de l’intron.
❑ b. Le groupement OH en 2’ d’une adénosine du site de branchement forme une
liaison phosphodiester 2’-5’ avec le premier nucléotide de l’intron.
❑ c. Une liaison phosphodiester se forme entre le groupement OH en 3’ de l’exon
situé en amont de l’intron et le groupement phosphate 5’ de l’exon situé en aval
de l’intron.
❑ d. La reconnaissance de la partie 5’ de l’intron à exciser n écessite la présence de
la RNPsnU1.
❑ e. La reconnaissance de la partie 3’ de l’intron à exciser n écessite la présence de
la RNPsnU2.
D’après concours Paris 11

175 Le gène responsable d’une maladie neurodégénerative


´ contient une séquence nucléo-
tidique de plusieurs triplets CAG disposés en tandem. Cette séquence est localisée dans un
exon du gène.
178 Concours blancs • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Afin de détecter si cette séquence d’ADN est impliquée dans cette maladie, une amplification
de l’exon du g ène contenant cette répétition est effectuée chez deux sujets sains (S1 et S2)
et un sujet malade (M), suivie d’une mesure précise de la taille des fragments amplifiés par
électrophorèse sur un gel de polyacrylamide.
Les résultats de ces analyses sont reportés dans la figure ci-dessous :

Parmi les propositions suivantes lesquelles sont exactes ?


❑ a. Les exons des deux sujets sains sont identiques en taille et nombre de
répétitions.
❑ b. L’exon du sujet S2 est plus long que celui du sujet S1 et contient 40 répétitions
CAG supplémentaires.
❑ c. L’exon du sujet M est plus long que celui du sujet S1 et contient 100 répétitions
CAG supplémentaires.
❑ d. L’anomalie génétique est associée à une augmentation du nombre de triplets
CAG chez le sujet M.
❑ e. La technique utilisée ne permet pas la détection de cette maladie.
D’après concours Paris 11

176 Au cours de la réplication de l’ADN, le brin direct :


❑ a. Est synthétisé comme amorce.
❑ b. Est synthétisé dans le sens 3’ vers 5’.
❑ c. Est synthétisé à partir du même brin matrice de part et d’autre d’une origine de
réplication.
❑ d. Sert d’amorce à la primase.
❑ e. Sert de substrat à l’ADN ligase.
D’après concours Paris 6

177 Concernant la réplication de l’ADN chez les eucaryotes, quelle est la proposition
fausse ?
❑ a. La fourche réplicative se met en place par le recrutement au niveau de l’ori-
gine de réplication d’une enzyme helicase
´ capable de rompre les liaisons hy-
drogènes.
UE 1 • Concours blancs 179

UE1 | www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


❑ b. Un brin d’ADN matriciel est lu par une ADN polymérase ADN dépendante
dans le sens de lecture 3’OH vers 5’P.
❑ c. L’ADN polym érase delta synthétise des fragments longs d’ADN à partir du brin
matriciel lu dans le sens du déplacement de la fourche réplicative.
❑ d. Les télomères, localisés à l’extrémité des chromosomes, sont des séquences
répétées d’ADN qui permettent la réplication complète du brin tardif.
❑ e. Autre réponse.
D’après concours Strasbourg

178 Concernant l’initiation de la traduction chez les eucaryotes :


❑ a. L’ARNtmet se lie à la grande sous-unité ribosomale.
❑ b. L’ARNtimet et elF2-GDP s’associent pour former un complexe.
❑ c. La petite sous-unité ribosomale se positionne sur l’ARNm avant l’arrivée de la
grande sous-unité, puis celle de l’ ARNt met .
❑ d. Le facteur d’initiation elF4 possède une activité hélicase pour séparer les deux
brins de l’ARNm afin de le rendre accessible à la machinerie de la traduction.
❑ e. L’arrivée de la grande sous-unité ribosomale fait suite au depart
´ des facteurs
elF.
D’après concours Paris 11

179 À propos de l’ADN hautement et moyennement rép étitif :


❑ a. Les séquences satellites sont localis ées dans les centrom ères, les séquences mi-
nisatellites au niveau télom érique et les microsatellites sont dispersés dans le
génome.
❑ b. La maladie de Huntington correspond à une amplification de triplets CAG.
❑ c. Les séquences LINE comportent typiquement environ 300 paires de bases, avec
un site de restriction reconnu par les enzymes Alu.
❑ d. Les séquences LINE comportent des répétions du site cible à chaque extrémité,
une région UTR promoteur et deux cadres de lecture ORF1 et ORF2, dont l’un
code une transcriptase inverse.
❑ e. Les séquences LINE peuvent s’ins érer dans un g ène fonctionnel et invalider sa
fonction. Ce mécanisme a été décrit dans la maladie de Duchenne.
D’après concours Nancy

180 Concernant le génome humain, quelle est la proposition fausse ?


❑ a. Il contient environ 21 000 gènes codant pour des protéines.
❑ b. Les séquences codantes couvrent environ 2 % du g énome.
´ ét ées couvrent environ 6 % du g énome.
❑ c. Les séquences r ep
❑ d. Les gènes du génome présentant des homologies de s équence codante sont des
paralogues.
❑ e. Autre réponse.
D’après concours Strasbourg
180 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


UE 1 QCM classés (corrigés)

1. Chimie générale
Atomistique

1 ❑
✘a. ❑
✘b. ❑
✘ c. ❑ d. ❑ e.
4 Beet 38 Sr appartiennent à la colonne 2 (groupe IIA) ; 8O est dans la colonne 16 (groupe
VIA) ; 9F est dans la colonne 17 (groupe VIIA).
• La proposition a. est vraie. L’electronégativité
´ croı̂t le long d’une période et d écroı̂t lors-
qu’on descend une colonne. L’él ément le plus électronégatif est le 9 F.
• La proposition b. est vraie. Le caractère oxydant varie comme l’électronégativité.
• La proposition c. est vraie. Le caractère métallique est égal au caractère réducteur.
• La proposition d. est fausse. Le rayon atomique décroı̂t le long d’une période et il augmente
avec le nombre quantique principal n des OA de valence. On a donc l’ordre : F-O-Be-Sr.
• La proposition e. est fausse. L’ordre est : Sr-Be-O-F. La première ionisation croı̂t rapide-
ment le long d’une période et décroı̂t brusquement lorsque n augmente.

2 ❑
✘a. ❑ b. ❑ c. ❑
✘d. ❑ e.
• La proposition b. est fausse. La configuration est : [Ar] 3d 64s 2
• La proposition c. est fausse. La configuration est : [Ar] 3d5 4s0
• La proposition e. est fausse. Fe3+ est plus stable que Fe2+ car sa configuration électronique
ne présente que des sous-couches pleines ou à moitié pleines.

3 ❑ a. ❑b.
✘ ❑
✘c. ❑ d. ❑e.

• La proposition a. est fausse. la réaction est :
Hg(g) → Hg+(g) + e −
• La proposition b. est vraie.
Au, colonne 11, a pour configuration électronique : [Xe] 4 f 14 5d10 6s 1
Hg, colonne 12, a pour configuration électronique : [Xe] 4 f 14 5d10 6s 2.
• La proposition d. est fausse. Il s’agit d’un électron d’une orbitale s.

4 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
Rappel : Le symbole d’un nucléide est AZ X o ù A est le nombre de nucléons, Z nombre de protons, N
nombre de neutrons avec A = Z + N .

• La proposition a. est fausse : 28 protons.


• La proposition b. est fausse : 27 électrons.
• Les propositions c. et d. sont fausses : 34 neutrons.
• La proposition e. est vraie : 27 électrons.

5 ❑ a. ❑
✘ b. ❑ c. ❑
✘d. ❑ e.
UE 1 • Corrigés 181

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition a. est fausse. C’est : [Kr] 4d10 5s 25p1 .

Corrigés
• La proposition c. est fausse. Il possède 3 electrons
´ de valence.
• La proposition e. est fausse. C’est : 1s 2s 2p 3s 3p 64s2 3d 104p 64d 1.
2 2 6 2

6 ❑ a. ❑ b. ❑
✘c. ❑
✘d. ❑e.

• La proposition a. est fausse. La configuration est : [Ar] 4s 1.
• La proposition b. est fausse. La configuration : [ Kr] 4d25s 2 a 2 électrons de valence.
• La proposition c. est vraie. La configuration est : [Xe] 4 f 14 5d 16s 2.
• La proposition d. est vraie : 18 électrons.
• La proposition e. est vraie : 10 électrons.

7 ❑
✘a. ❑
✘b. ❑c.
✘ ❑ d. ❑e.

• La proposition d. est fausse. X4 et X 3 appartiennent à la même période mais X3 se trouve
après X 4 , donc il est plus électronégatif.

8 ❑ a. ❑ b. ❑
✘c. ❑ d. ❑
✘e.
• La proposition a. est fausse : 21H (deutérium) et 31H (tritium).
• La proposition b. est fausse : 11H et 31H .
• La proposition c. est vraie : même nombre d’ électron (1).
• La proposition d. est fausse : pas le même nombre de nucléons.
• La proposition c. est vraie : noyaux isotopes.

9 ❑
✘a. ❑ b. ❑
✘c. ❑ d. ❑e.

• La proposition b. est fausse. Pour n donné, l est compris entre et n − 1.
• La proposition c. est vraie. Avec n = 4 et l = 3, m prend 2l + 1 valeurs soit 7 OA dégénér ées
donc 14 électrons (sous-couche f ).
• La proposition d. est fausse. Le nombre d’orbitales est égal à n2 donc 16 orbitales.
• La proposition e. est vraie. On a : −l  m  l.
m étant indépendant de l’énergie les 2l + 1 OA sont toutes de même énergie avec des orienta-
tions spatiales différentes, elles sont dites dégénérées.

10 ❑ a. ❑ b. ❑ c. ❑d.
✘ ❑ e.
• La proposition a. est fausse. Dans 25 Mn [Ar] 3d54s2 , après 3p6 on passe à 4s.
• La proposition b. est fausse. Xe est un gaz noble (colonne 18) donc structure en ns 2 np6
avec n = 5, donc : [Kr] 4d10 5s 25p 6 .
• La proposition c. est fausse : Ca appartient à la colonne II alcalinoterreux.
• La proposition d. est vraie : 18 électrons.
• La proposition e. est fausse : avoir 8 électrons sur une OA p est impossible.

11 ❑ a. ❑ b. ❑c.
✘ ❑d.
✘ ❑
✘e.
• La proposition a. est fausse. 3s 1 est plus électropositif que 3s2 donc E i est inférieure.
• La proposition b. est fausse. C’est le contraire, cf. a.
182 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition c. est vraie. 9F est le plus électronégatif.
• La proposition e. est vraie. L’électronégativit é diminue lorsqu’on descend une colonne.

12 ❑a.
✘ ❑ b. ❑ c. ❑ d. ❑ e.
Dans la 4e colonne et la 4e période, on trouve : [Ar] 3d24s 2 , donc Z = 22.

13 ❑ a. ❑b.
✘ ❑ c. ❑d.
✘ ❑ e.
• La proposition a. est fausse. Il s’agit du nombre de nucléons.
• La proposition d. est vraie. On a : (3 × 85 + 1 × 87)/4 = 85.

14 ❑ a. ❑ b. ❑
✘ c. ❑
✘ d. ❑ e.
Il s’agit d’él éments alcalins : colonne 1, structure en ns 1.
• La proposition a. est fausse. On a : ........4s 24p 65s 1 , soit [Kr] 5s 1.
• La proposition b. est fausse. On a : [Xe] 6s1 .

15 ❑
✘ a. ❑
✘b. ❑ c. ❑ d. ❑ e.
• La proposition a. est vraie. On a une structure en ns1. Les éléments d’une même colonne
ont la même configuration électronique.
• La proposition b. est vraie. Ils sont électropositif.
• La proposition c. est fausse. Ei diminue lorsqu’on descend une colonne.
• La proposition d. est fausse. Le rayon atomique diminue lorsqu’on descend dans une co-
lonne.

16 ❑
✘ a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
• La proposition a. est vraie. As est dans la colonne 15 (groupe V A ), 4 e période.
• La proposition b. est fausse : 5 électrons de valence.

17 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
As est dans la colonne 15 (groupe V A ), 5e période.

• La proposition a. est fausse. As fait partie du bloc p (4s 24p 3).


• La proposition b. est fausse. B est en colonne 13 (groupe III A).
• La proposition d. est fausse. Le fluor appartient à la colonne 17 (groupe VII A).

18 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑
✘e.
• La proposition a. est fausse. L’isotope majoritaire est 32S.
• La proposition b. est fausse. 32
16 S possède x électrons et 16 protons.
• La proposition d. est fausse. 9 F est le plus électronégatif.
• La proposition a. est vraie : structure en 3s23p6 .

19 ❑ a. ❑b.
✘ ❑ c. ❑d.
✘ ❑
✘e.
• La proposition a. est fausse. On peut obtenir : Cs? [Xe] 6s 1.
UE 1 • Corrigés 183

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition b. est vraie. On peut obtenir : Ba2+ [Xe] 6s 2.

Corrigés
• La proposition c. est fausse. On peut obtenir : I− [Kr] 4d10 5s2 5p5 .
• La proposition d. est vraie. il s’agit de : Cu + et Cu2+ .
• La proposition e. est vraie. On peut obtenir : Ce2+ [Xe] 4 f 2 6s2, et aussi Ce3+ et Ce4+ .

20 ❑ a. ❑
✘ b. ❑ c. ❑
✘ d. ❑ e.
• La proposition a. est fausse. Il s’agit de 20Ca qui est un alcalinoterreux (colonne 2).
• La proposition b. est vraie. Il s’agit de 35 Br.
• La proposition c. est fausse. Il n’en possède aucun.
• La proposition d. est vraie. Les éléments de la colonne 2 sont électropositifs.
• La proposition e. est fausse. 35 Br− , de configuration 3p64s 2 , est électronégatif.

21 ❑
✘ a. ❑ b. ❑ c. ❑ d. ❑ e.
D’après la regle
` de Klechkowsky (principe de stabilit é), l’ordre de remplissage des niveaux
se fait selon (n + l) croissant.
Pour deux O.A de même (n + l) on remplit en premier celle qui possède la plus faible valeur
de n.
Pour la couche 4 p, on a : n = 4, l = 1 soit n + l = 5.
Pour la couche 3d, on a : n = 3, l = 2 soit n + l = 5.
La couche 3d donc est remplie avant 4 p d’ou la réponse a.

22 ❑
✘ a. ❑ b. ❑ c. ❑ d. ❑ e.
Pour la sous-couche 4 f , on a : n = 4 et l = 3. Le nombre quantique magnétique orbital ml
peut prendre 2l + 1 valeurs soit 7 valeurs. Il y a donc 7 O.A, ce qui correspond à 14 électrons.

Cinétique

23 ❑
✘ a. ❑
✘b. ❑ c. ❑ d. ❑
✘e.
• Un profil énerg étique consiste en un graphique repr´ esentant l’ evolution
´ de l’énergie du
système en fonction de la coordonnée de réaction (ou coordonnée réactionnelle), elle-m ême
liée aux distances et aux orientations des espèces pendant la réaction chimique. Pour une
`
r éaction se faisant en une seule étape (c’est-a-dire un seul processus él émentaire), on représente
à gauche les réactifs, à droite les produits et entre les deux l’état de transition.
Ce dernier est un état d’énergie plus haute que celles des réactifs et des produits donc moins
stable qu’eux. Par conséquent, les affirmations a. et e. sont vraies alors que l’affirmation d est
fausse.
• L’énergie d’activation est l’ énergie minimale qu’il faut apporter à la réaction pour qu’elle
puisse avoir lieu. C’est donc l’énergie qu’il faut fournir pour franchir le maximum (local
dans le cas d’une réaction comportant plusieurs actes él émentaires) au niveau de l’état de
transition, soit la différence d’énergie entre l’état initial (des réactifs) et l’état de transition.
La proposition b. est donc correcte.
• Une reaction
´ est endothermique si l’énergie des produits est supérieure à celle des réactifs.
Dans ce cas-là, le syst ème absorbe globalement de l’énergie entre l’ état initial et l’état final.
Sinon, la réaction est exothermique. Ainsi, la proposition c. est fausse.

24 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑ e.
184 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• Une réaction élémentaire est une réaction qui repr ésente exactement ce qui se passe à
l’échelle des particules. Il faut donc que les structures des réactifs et des produits soient
relativement proches. Elle peut faire intervenir un, deux, voire trois réactifs (cas rare) et per-
met de produire au maximum trois produits mais généralement un ou deux. On peut donc en
d éduire que les propositions 1. et 5. sont fausses tandis que la proposition 4. est vraie.
• Dans le cas d’un processus él émentaire, l’ordre de la réaction est égal à la molécularité,
c’est-à-dire au nombre de particules intervenant dans la réaction (donc a` la somme des coef-
ficients stœchiométriques des r éactifs). Par contre, une r éaction ayant un ordre global égal à
la somme des coefficients stœchiom étriques n’est pas nécessairement un acte élémentaire. La
proposition 2. est donc correcte alors que la proposition 3. est incorrecte.
Il y a donc 2 propositions exactes : 2. et 4.

25 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
La vitesse d’une réaction (du type α R1 + β R 2 + ... γ P 1 + δ P2 + ...) se faisant
1 d[A i]
à volume constant peut se mettre sous la forme : v =
νi dt
avec Ai un réactif ou un produit et νi le coefficient stœchiom étrique algébrique (positif pour
les produits et négatif pour les réactifs).
Ainsi, l’unité de la vitesse est : mol.L−1 .s−1 (proposition c. ). Par contre, l’unité de la constante
de vitesse k d épend de l’ordre de la réaction.

26 ❑
✘ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
• On pose l’hypothèse que la réaction est d’ordre 1 (première proposition à v érifier). Dans
ce cas-la,` la loi d’évolution de la concentration avec le temps permettant d’obtenir une droite
doit être de la forme : ln[ATP] = ln [ATP] 0 − kt. La proposition a. est donc vraie.
On doit donc établir la régression linéaire de la fonction ln[ATP] = f (t) et vérifier que le
coefficient de corrélation est proche de 1 pour valider cette hypoth èse.
On trouve l’équation : ln[ATP] = −1, 46 × 10−5 t − 3, 92, avec un coefficient de corr élation
r2 = 0, 999 997. L’hypothèse est donc validée.
Par identification, on obtient directement la valeur de la constante de vitesse :
k = 1, 46 × 10 −5 s−1. La proposition f. a est donc juste alors que l’affirmation b. est fausse.
Remarque : on suppose que l’ordre par rapport au solvant H2 O est nul ou que la constante k
est en réalité une constante de vitesse apparente de la forme k = k  [H2O] β .
d ln k Ea
• Pour obtenir la valeur de la constante k a` 40 ◦C, on utilise la loi d’Arrhénius =
dT RT 2
en l’intégrant entre les deux temp ératures notées T1 et T 2.
kT     
2 Ea 1 1 Ea 1 1
On obtient : ln = − soit k T2 = k T1 exp −
kT R T 1 T2 R T 1 T2
1

Après application numérique (en n’oubliant pas de mettre les températures en K et l’énergie
d’activation en J.mol −1 ), on trouve : kT2 = 4, 67 × 10 −4 s−1 .
Remarque : les à 0, 01 × 10−x près signifient simplement que l’on ne garde que trois chiffres
significatifs dans les calculs.
• La constante de vitesse k d’une r éaction donnée ne dépend que de la température donc ne
d épend pas de la concentration initiale en réactif, quel que soit l’ordre de la réaction. Par
contre, le temps de demi-réaction (temps au bout duquel la moitie´ du r éactif limitant a été
consommé) dépend de cette concentration (relation qui dépend de l’ordre de la réaction).

27 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
UE 1 • Corrigés 185

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La première série d’expériences nous permet d’écrire la loi de vitesse sous la forme :

Corrigés
v = k[NO] α [O2 ] 1 .
• La deuxième série d’expériences (où [O 2] = cste) nous permet d’écrire cette loi sous la
forme : v = k app[NO] α soit ln v = ln kapp + α ln[NO] avec kapp = k[O2] 1
La régression linéaire de la fonction ln v = f (ln[NO]) nous donne :
ln v = 2, 01 ln[NO] + 5, 09 avec un coefficient de corr élation r2 = 0, 9999895.
Par identification, on en déduit que l’ordre partiel par rapport au monoxyde d’azote est :
α = 2.
• Ainsi, la loi de vitesse est : v = k[NO]2[O 2] 1. La seule proposition correcte est donc la
proposition c.

28 ❑ a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
En utilisant a` nouveau la r égression lin éaire de la réponse précédente, on obtient par identifi-
cation : ln kapp = 5, 09 soit kapp = 162 L.mol−1 .s −1 (unité trouvée grâce à l’expression
de la vitesse)
En déterminant cette constante de vitesse apparente pour chaque expérience, on trouve :
kapp = 150 L.mol−1 .s −1 pour les quatre premières expériences et kapp = 144 L.mol −1 .s−1
pour la dernière.
Par conséquent, la réponse attendue était l’affirmation d.

29 ❑
✘ a. ❑ b. ❑ c. ❑ d. ❑ e.
• La décomposition de l’antibiotique, que l’on notera A, suit une loi de vitesse d’ordre 1.
Ainsi, la loi d’évolution de [A] en fonction du temps et l’expression du temps de demi-vie
ln 2
(ou demi-réaction) sont : [A]t = [A]0 e−kt et t 1/2 =
k
• La deuxième relation, nous permet de déterminer la valeur de la constante de vitesse :
ln 2
k= = 1, 65 an−1 = 0, 4 mois−1
t1/2
• Pour t = 3 mois, on utilise k = 0, 14 mois−1 et la premiere ` relation. On trouve :
[A] 3 mois = 3, 9.10 mol.L . Pour t = 1 an, on utilise k = 1, 65 an−1 et on trouve :
−3 −1

[A] 1 an = 1, 15.10−3 mol.L−1 . La bonne réponse était donc la proposition a.

30 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
• La définition d’un catalyseur est la suivante : espèce qui augmente la vitesse d’une réaction
thermodynamiquement favorable sans en modifier l’état final prévu par la thermodynamique
et sans apparaı̂tre dans l’équation-bilan de la réaction. Par conséquent, les propositions b. et
e. sont correctes.
• Pour augmenter la vitesse de la réaction, le catalyseur joue sur la valeur de la constante
de vitesse en diminuant la valeur de l’énergie d’activation globale (loi d’Arrhénius : k =
 Ea 
A exp − ), sans changer les énergies des réactifs et produits. La proposition d est donc
RT
juste tandis que l’affirmation c. est fausse.
• Enfin, par définition, un(e) enzyme est un catalyseur biologique donc la proposition a. est
correcte.

31 ❑
✘ a. ❑ b. ❑
✘ c. ❑ d. ❑
✘e.
186 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


d[A]
• La vitesse de formation d’une espèce A s’écrit toujours : v f = donc la proposition a.
dt
est juste.
• Dans le graphique représentant l’évolution de la concentration du diiode en fonction du
temps, la vitesse instantanée de sa formation correspond à la pente de la tangente à la courbe
au point considéré.
Ainsi, cette vitesse est plus importante dans le cas de l’expérience 2 que pour l’expérience
1 (expériences où seules les concentrations sont modifi ées) mais également dans le cas de
l’expérience 4 par rapport à l’expérience 2 (expériences où seule la temp érature est modifiée).
On en déduit que les propositions b. et d. sont incorrectes alors que la proposition c. est cor-
recte.
• Dans les m êmes conditions de concentrations et de température, on constate que l’ajout
d’ions Fe2+ a pour effet d’augmenter la vitesse de la réaction (expériences étudiées : 1 et 5).
Par conséquent, les ions Fe2+ jouent le rôle de catalyseur. L’affirmation e. est donc juste.

32 ❑ a. ❑b.
✘ ❑c.
✘ ❑ d. ❑
✘e.
• La pente de la courbe (4) n’étant pas 100 fois sup érieure à celle de la courbe (1), on en
d éduit que la proposition a. est fausse.
• D’apr ès les conclusions de la question précédente, les conditions optimales sont : concen-
trations élevées, température élevée et présence d’ions Fe2+ . Par conséquent, la proposition
b. est correcte.
• Les molécules sont en mouvement perpétuel. Cette agitation est d’autant plus importante
que la température est grande. On parle d’agitation thermique. L’affirmation c. est donc vraie.
• L’effet de la temperature
´ nous montre que la r éaction est favoris ée lorsqu’elle absorbe de
l’énergie thermique donc qu’elle est endothermique. Par contre, on ne peut pas prédire que
la réaction est également endergonique à partir de l’effet de la température uniquement. La
proposition d. est donc fausse.
• Les courbes représentées nous permettent de déterminer les vitesses initiales de chaque
expérience. Or, cette vitesse initiale a pour expression :
β
v 0 = k [I −]0 [S2 O2− avec [I − ]0 = 2 [S2 O2−
α
8 ]0 8 ]0
  α 2− β 2− q
d’où v0 = k 2[S 2 O2− α
8 ] 0 [S 2O 8 ]0 = k 2 [S2 O 8 ]0 avec q = α + β
 α
Ainsi ln v 0 = ln k 2 + q ln [S2O 2− ] .
 8 0 2− 
La régression linéaire de ln v 0 = f ln [S 2 O8 ] 0 nous permet de trouver q, l’ordre global de
la réaction (celui-ci correspondra au coefficient directeur de l’équation de droite). La propo-
sition e. est donc correcte, bien que la détermination de l’ordre ne soit pas directe.

Thermochimie

33 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
• La proposition a. est fausse. L’expression est ∆rG◦ = ∆r H ◦ − T∆rS ◦.
• La proposition b. est fausse. Comme ∆ rH ◦ < 0, la reaction
´ d égage de la chaleur, elle est
exothermique.
• La proposition c. est fausse. Comme ∆r G < 0, la réaction est exergonique, elle se fait spon-
tanément.
p2(HI)
• Pour l’équilibre considéré, on a : Kp = Kc = ·
p(H2).p(I 2)
UE 1 • Corrigés 187

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


p2 (HI)
Comme p(H2) = p(I 2), on aurait K p = ·

Corrigés
p2 (H2)
D’autre nous avons la relation : ∆rG ◦ = −RT ln K p . Compte tenu des données numériques et

après calcul nous obtenons K p = 3, soit K p = 1, 733 ce qui donne : p(HI) = 1, 73.p(H2 ) =
1, 73.p(I2).

Comme pi = P ◦ = 1 atm la proposition d. est fausse.
i

34 ❑ a. ❑ b. ❑c.
✘ ❑d.
✘ ❑
✘e.
L’expression énergie libre est insuffisante. S’agit-il de l’énergie libre de Gibbs ou de Hel-
moltz ? Nous prendrons l’enthalpie libre ∆r H ◦.
• La proposition a. est fausse. Pour une reaction
´ endothermique ∆ rH ◦ > 0. La réaction chi-
mique absorbe de la chaleur.
• La proposition b. est fausse. Un réactif nucléophile (ami des noyaux) est un donneur
d’électrons. C’est soit un anion X, soit une molécule neutre possédant un doublet libre.
• La proposition c. est vraie. CH3 − CH +2 > CH3+
La stabilit é d’un carbocation est augmentée par tout ce qui lui permet de survivre avec six
électrons et une charge positive, donc favorisé par effet +I ou par effet m ésomère.
• La proposition d. est vraie. Il est électrophile, ami des électrons ; (C3 H 7)4 N + carbocation
quaternaire.
• La proposition e. est vraie : exemple : AlCl3
Un acide de Lewis est un accepteur de doublet, il présente une orbitale vacante.

35 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
L’équation de la réaction de combustion du glucose est :
C 6H6 O6(s) + 6 O 2(g) → 6 CO 2(g) + 6H2 O(l)
• La proposition a. est fausse. Elle produit 6 moles de dioxyde de carbone.
• La proposition b. est fausse. Elle produit 6 moles d’eau.
• La proposition c. est vraie ; voir l’équation de réaction ajustée.
• La proposition d. est fausse. On a ∆H ◦ < 0 ; la réaction est exothermique comme toute
combustion.
• La proposition e. est fausse. Dans le S.I l’unité de mesure de la chaleur est le Joule ( 1
calorie ≈ 4, 18 J).

36 ❑ a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
D(’après la relation de Guldberg et Waage, la constante d’équilibre est :

i [P i,eq ]
νi
Keq =  o ù P désigne les produits et R les r éactifs.
j [R j ]
νj

• La proposition a. est fausse. Ce sont les produits qui prédominent.


• La proposition b. est fausse. Elle est négative car ∆ rG ◦ = −RT ln K eq.
• La proposition c. est fausse. Les acides faibles en solution aqueuse ont des pKa compris
entre 0 et 14 ; où pKa = − log Ka.
n 1n2 ∆E◦
• La proposition d. est vraie d’après la relation suivante : log Kr =
0, 06
γ i Ci
• La proposition e. est fausse. L’activité est : a i = ◦ où γ est le coefficient d’activité, C ◦
C
188 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


la concentration molaire du soluté i (en mol.L−1).
Par conséquent, ai tend vers Ci si γ tend vers 1 ; ce qui est le cas des solutions diluées.

37 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
• La proposition a. est fausse. La fusion est le passage de l’état solide ordonné vers l’état
liquide moins ordonné, il faut fournir de l’énergie ∆Hfusion > 0.
La liquéfaction est le passage de l’état gaz (désordonné) vers l’état liquide (moins désordonné)
donc ∆Hliq < 0. Le système c ède de l’énergie au milieu extérieur.
• La proposition b. est fausse. La sublimation est le passage de l’état solide à l’état gazeux ;
donc ∆Hsub = ∆H fus + ∆Hvap.
• La proposition c. est vraie. H est une fonction d’état extensive du système étudié, décrite à
l’aide des variables d’état (T , P, ni ).
• La proposition d. est fausse. ∆Hion correspond à la r éaction Xgaz → X(+g) + e− , toujours
endothermique.
• La proposition e. est fausse. Elle est toujours plus élevée pour la seconde car il faut arracher
un électron à un cation.

38 ❑a.
✘ ❑ b. ❑ c. ❑d.
✘ ❑ e.
• La proposition a. est vraie. On a : H = U + PV où H est l’enthalpie et U l’énergie interne.
• La proposition b. est fausse. ∆rS renseigne sur l’organisation/d ésorganisation associée à
une réaction. Si ∆ rS > 0 la réaction chimique conduit a` une d ésorganisation du syst`eme, en
augmentant la quantité de matière de gaz.
• La proposition c. est fausse. Comme ∆r H > 0 la réaction est endothermique ; elle absorbe
de la chaleur.
• La proposition d. est vraie La réaction A(s) → B(l) + C(g)
➣conduit à une désorganisation du syst ème, soit : ∆rS > 0 ;
➣ est exothermique, soit : ∆r H < 0
➣ et comme ∆r G = ∆r H − T ∆rS alors ∆ rG < 0, la r éaction est exergonique, elle se fait
spontanément.
• La proposition e. est fausse. W n’est pas une fonction d’ état, il depend
´ de la nature de la
transformation, du chemin suivi pour passer de l’état initial à l’état final.

39 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑ e.
 
aCaCO3(s) . PCO2/P ◦
• La proposition a. est fausse. L’expression de K p est K p = ·
aCaCO3(s)
L’activité des solides purs est = 1, P ◦ la pression de référence donc K p = pCO 2(g) .
• La proposition c. est fausse. CaCO3(s) est insoluble dans l’eau.
• La proposition d. est fausse. CaO(s) est partiellement soluble dans l’eau.
• La proposition e. est fausse. D’après la loi de Le Ch âtelier (principe de modération), à V et
T constantes, une augmentation de pression déplace l’ équilibre dans le sens d’une diminution
du nombre de moles de gaz, donc dans le sens 2.

40 ❑
✘ a. ❑
✘b. ❑
✘ c. ❑ d. ❑
✘ e.
Acide lactique : C 3H 6O3 ; Acide pyruvique : C3 H 4O 3 .
• La proposition a. est vraie. On a : C 3H 6O 3 = C3H4 O 3 + 2H+ + 2e− .
L’acide lactique est le réducteur du couple.
UE 1 • Corrigés 189

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition b. est vraie. Le nombre d’oxydation de Cb dans l’acide lactique est 0, dans
l’acide pyruvique +II, il y a donc oxydation.

Corrigés
• La proposition c. est vraie. La mol écule présente deux doubles liaisons séparées par une
simple liaison.
• La proposition d. est fausse. Comme pour le Cb de la proposition b, le Ca ne change pas de
n.o.
• La proposition e. est vraie. Si l’on compare les E◦ , on constate que E ◦1 > E ◦2. L’acide pyru-
vique est donc l’oxydant le plus fort qui réagit avec le r éducteur le plus fort NADH.

41 ❑a.
✘ ❑ b. ❑c.
✘ ❑ d. ❑ e.
• La proposition a. est vraie. Considérons la demi-équation :
Pyruvate / Lactate Pyruvate + 2 H+ + 2e − = Lactate.
L’équation de Nernst s’ écrit :
0, 06 [H+ ]2[Pyruvate]
E (pyruvate/lactate) = E1◦ + log
2 [Lactate]
◦ ◦
Le potentiel apparent est E1 = E1 − 0, 06 pH et donc a` pH = 7 les potentiel standards dans
les conditions biologiques sont E◦1  = −0, 19 V et E◦2  = −0, 32 V.
• La proposition c. est vraie.
On utilise la relation ∆G ◦ = −nF ∆E ◦ avec n = 2F (Faraday) = 96 500 C.mol−1 .
On a : ∆E ◦ = E1◦ − E2◦ = 0, 13 V et on obtient : ∆G ◦2 = −25 090 J.
• La proposition d. est fausse. On a : ∆S ◦ = 0. D’autre part la température est un facteur
cinétique et non thermodynamique.
• La proposition e. est fausse. L’expression de la constante de l’equilibre
´ (2) dans le sens
direct 1 s’écrit :
[NAD +[Lactate]
Ke =
[Pyruvate][NADH][H+ ]
Pour pH=10 on a [H +] = 10 −10 mol.L −1. Pour pH=7 on a [H +] = 10−7 mol.L −1.
Donc K e(pH10) > K e(pH7).

42 ❑a.
✘ ❑ b. ❑c.
✘ ❑d.
✘ ❑ e.
• La proposition b. est fausse. Une réaction de combustion d égage de la chaleur.
C’est une réaction exothermique : ∆r H < 0.
• La proposition d. est vraie. Ce sont des fonctions d’état, elles ne dépendent que des seules
variables du système.
• La proposition e. est fausse. La réaction chimique A(g) → A(l) conduit à une organisation
du système donc ∆ rS < 0.

43 ❑ a. ❑b.
✘ ❑ c. ❑d.
✘ ❑ e.
• La proposition a. est fausse. On a :
[HI] 2 n(HI) n(H2) n(H2)
Kc = ; [HI] = ; [I 2 ] = ; [H ] =
[H2 ][I 2] V V V
2
n(HI)
Kc peut donc s’écrire : K c =
n(H2).n (I 2)
Les valeurs numériques du texte conduisent à 54, 76. La valeur donnée est celle de la réaction
190 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


1
inverse Kc = ·
Kc
p2 [HI]
• La proposition b. est vraie. K p s’ écrit Kp =
p[H2 ] p[I2]
Les constituants sont tous à l’état gazeux donc [x] = nX/V = pX /RT et p X = [X ]RT .
En reportant dans l’expression de K p on retrouve l’expression de Kc .
Plus généralement on a la relation K c(T ) = K p (T ).(R.T /V )−ν
o ù ν est la variation des nombres stoéchiométriques : ∆ν = Σνproduits − Σν réactifs.
Dans le cas de la réaction proposée ∆ν = 0.
Les items suivants concernent les lois de Le Châtelier. En r ègle générale toute modification de l’une
des variables d’état intensives définissant un système provoque une évolution du système qui tend à
s’opposer à cette modification.

• La proposition c. est fausse. On ajoute un constituant inactif (qui n’intervient pas dans
l’équation de réaction) à P et T constantes. Ici faites attention ∆ν = 0, donc le système
n’évolue pas.
• La proposition d. est vraie. Par application du principe de modération, l’équilibre sera
d éplacé dans le sens1, avec consommation de H2 .
• La proposition e. est fausse. C’est dans le sens 2.

44 ❑
✘ a. ❑
✘b. ❑
✘ c. ❑ d. ❑
✘ e.
• La proposition a. est vraie. K c (T ) est inchangée, la température est constante.
• La proposition b. est vraie. Toutes les espèces chimiques sont dans la même phase (ga-
zeuse).
• La proposition c. est vraie. Consid érons un nouvel état initial :
2
H 2(g) + I 2(g) 1 2 HI(g)
état initial 0, 100 0, 100 0, 740 + 0, 500 = 1, 240
équilibre 0, 100 + xe 0, 100 + xe 1, 240 − 2xe
La constante d’équilibre s’écrit alors : Kc(T ) = (1, 240 − 2 xe) 2/(0, 100 + xe)2 = 54, 76.
La résolution conduit à xe = 0, 053 mol et donc pour le nouvel equilibre
´ :
n(HI) = 1, 24 − 2 × 0, 053 = 1, 134 mol.
• La proposition d. est vraie. n(I2 ) = n(H2 ) = 0, 153 mol.

45 ❑
✘ a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
• Un système ouvert permet de réaliser des échanges énergétiques et de matière avec le mi-
lieu exterieur.
´ Un syst ème fermé n’ échange que de l’énergie avec le milieu extérieur. Enfin,
un système isolé ne permet aucun échange. La proposition a. est donc correcte.
• Les grandeurs intensives sont celles qui ne sont pas proportionnelles a` la taille du syst ème
et qui ne peuvent s’additionner par réunion de deux syst èmes (exemples : température, pres-
sion). Si on a n mol de A dans un système 1 et m mol de A dans un système 2, on obtiendra
n + m mol de A en réunissant ces deux systèmes. La quantité de matière est donc une grandeur
extensive et la proposition b. est fausse.
• La pression est un paramètre d’état puisqu’il permet de décrire l’état d’un système. Ce
paramètre peut soit être une variable d’etat, ´ soit une fonction d’état, cette dernière étant
d éterminée à partir d’une équation d’état. Ainsi, la proposition c. n’est pas toujours vraie.
• Une fonction d’état (par exemple la variation d’énergie interne ou de l’enthalpie) ne dépend
UE 1 • Corrigés 191

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


pas du chemin suivi entre l’état initial et l’état final puisqu’elle se détermine en faisant la
différence entre la valeur à l’état final et la valeur à l’état initial (quelles que soient les valeurs

Corrigés
intermédiaires). La réponse d. est donc juste.
• Lorsque la variation d’enthalpie d’une réaction (ou plus simplement l’enthalpie de la réaction)
est positive, la r éaction est dite endothermique. Si elle est négative, la réaction est qualifi ée
d’exothermique. L’affirmation e. est donc fausse.

46 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
• Lors d’une réaction exothermique, il y a dégagement d’énergie sous forme de chaleur. Ceci
est dû au fait que l’énergie des produits est plus faible que celle des réactifs. C’est exactement
le contraire dans le cas d’une réaction endothermique. On en déduit que les affirmations a.,
d. et e. sont fausses alors que la proposition c. est juste.
• La variation d’énergie entre l’état final et l’état initial correspond à l’enthalpie de la réaction.
Par conséquent, la proposition b. est incorrecte (l’énergie d’activation correspond à la différence
d’énergie entre l’état de transition et l’état initial).

47 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑
✘e.
• La réaction C2 H4 + Cl2 −→ C2H 4Cl2 correspond à la diff érence entre la première équation
et la deuxième équation donc l’enthalpie de cette réaction est :
∆H = ∆H1 − ∆H2 = 35, 5 kcal (proposition c.)
• Pour déterminer l’enthalpie de formation de C 2 H4, on peut utiliser soit la premi ère réaction,
soit la dernière.
Dans le premier cas, on a : ∆H1 = 2∆ f HCO + 2∆ f H H2O − ∆ f HC 2H
2 4

Dans le deuxième cas, on a : ∆H = ∆f HC H − ∆ f HC H4 − ∆f HCl


2 4 Cl 2 2 2

Dans les deux cas, il nous manque des données pour déterminer ∆ f H C H . La proposition e.
2 4
est donc correcte.

48 ❑
✘ a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
• On suppose que le symbole  prime  s’adresse aux expressions qui ne prennent pas en
compte ni pH, ni [H3O +]. Ici, sauf indication contraire, le pH est égal à 7. On rappelle que les
conditions standard biologiques sont des conditions pour lesquelles la pression est de 1 bar et
le pH est égal à 7.
• L’enthalpie libre standard de la réaction étant reliée à la constante d’équilibre (standard) K ◦
par la relation ∆rG ◦ = −RT ln K ◦, on en déduit que pour une même température, l’enthalpie
libre de réaction augmente lorsque la constante d’équilibre diminue.
Ici, d’après l’équation (1), la constante d’équilibre a pour expression :
[ADP3− ][HPO2−
4 ][H 3O ]
+
K◦1 =   avec C◦ = 1 mol.L −1 la concentration standard.
[ATP 4−] C◦ 2
  [ADP3− ][HPO2− 4 ]
La constante d’équilibre (standard) modifi ée K1◦ s’ écrit : K1◦ =  
[ATP4− ] C ◦ 2

Les valeurs de K◦ dépendent du pH (puisque le pH varie et que la constante d’équilibre K ne
d épend que de la température donc pas du pH). On a alors, lorsque le pH augmente, [H3O +]

diminue donc K  augmente, soit ∆r G ◦ diminue. La proposition a. est alors correcte.
• Les enthalpies libres standard de réaction modifi ée étant négatives pour les réactions (1)
et (2) (le pH ne pouvant modifier le signe), on en déduit qu’elles sont exergoniques (et pas
exothermiques comme proposé à la réponse b.) et qu’elles sont thermodynamiquement favo-
192 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


risées (à la température et au pH considér es).
´ La proposition c. est donc fausse.
∆r G 2 < ∆rG 1 donc la réaction (2) (hydrolyse de P-CREA 2− ) est encore plus favorisée que
◦ ◦

la réaction (1) (hydrolyse de ATP4−) à pH 7. La proposition d. est donc correcte.

49 ❑ a. ❑b.
✘ ❑c.
✘ ❑ d. ❑ e.
• La réaction (3) a pour équation (par soustraction des équations (2) et (1)) :
ADP3− + H3 O+ + P − CREA2−  CREA + ATP4− + H2 O.
L’enthalpie libre standard de la r éaction, modifiée à pH 7 est :
   
∆r G ◦3 = ∆r G◦2 − ∆ rG ◦1 soit ∆r G◦3 = −7, 5 kJ.mol−1 .
 ◦ 
◦  ∆ rG 3 
La constante d’équilibre modifiée associ ée est : K 3 = exp −  = 20, 3. La proposi-
RT
tion b. est donc correcte alors que l’affirmation a. est fausse.
• L’équation (3) faisant intervenir H 3 O + dans les réactifs, la constante d’ équilibre modifi ée
K3 associée dépend nécessairement du pH, ce qui n’est pas le cas de la constante d’équilibre
K3. La valeur du pH permet de déplacer plus ou moins l’équilibre d’une même réaction mais
sans changer la valeur de la constante d’équilibre. La proposition c. est donc correcte.
En supposant l’interprétation du symbole  prime  faite plus haut comme étant celle attendue
par l’auteur, on peut écrire :
K3  [ATP 4−][CREA]
K3 = avec K3 =
[H3 O +] [ADP 3− ][P − CREA2− ]

K3
À pH 7, on a alors : K 3 = −7 ou K 3 = K3 .10−7 (d. est fausse).
10
50 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.

Lorsque le muscle est au repos, la réaction qui a lieu est la réaction (3). On a donc :

K3◦
∆r G 3 = ∆r G3 + RT ln Q3 = −RT ln K 3 + RT ln Q3 = −RT ln −7 + RT ln Q 3
◦ ◦
10  
◦ ◦
⇔ ∆r G 3 = −RT ln K 3 + RT ln 10 + RT ln Q 3 = ∆rG 3 + RT ln 10−7 Q 3
−7

Calculons maintenant la valeur du quotient de réaction Q :


[ATP 4− ] 0 [CREA]0
Q3 =
[ADP3− ] 0 [P − CREA 2−]0 [H3 O+ ]0
5, 0 × 10 −3 × 1, 0 × 10−2
A.N. : Q 3 = = 5, 0 × 10 7
5, 0 × 10−4 × 2, 0 × 10−2 × 10−7
Ainsi, la valeur de l’enthalpie libre de la réaction est : ∆r G3 = −3, 5 kJ.mol −1
La bonne réponse est donc la proposition c.

51 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
• D’après le signe de l’enthalpie de réaction, on en d éduit que le sens 1 est le sens exother-
mique tandis que le sens 2 est le sens endothermique.
• D’après la loi de modération de Le Châtelier ou d’après la loi de Van’t Hoff, une él évation
de température entraı̂ne un déplacement de l’équilibre dans le sens endothermique. La bonne
réponse est donc l’affirmation e. (évolution dans le sens endothermique 2).
UE 1 • Corrigés 193

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


52 ❑ a. ❑b. ❑
✘ c. ❑ d. ❑ e.

Corrigés
L’équation de combustion de l’acétone est :
H3 C − CO − CH3 + 4O2 −→ 3CO2 + 3H2 O.
L’enthalpie de combustion est calculée par diff érence de la somme des énergies de dissocia-
tion de toutes les liaisons rompues et de la somme des énergies de dissociation de toutes les
liaisons formées, soit :
∆comb H = 2 D C−C + DC=O + 6 DC−H + 4 D O=O − 6 D C=O − 6 D O−H
⇔ ∆comb H = 2 DC−C + 6 DC−H + 4 D O=O − 5 DC=O − 6 D O−H
soit ∆comb H = −1268 kJ.mol−1 (proposition c. )

53 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
La variation d’enthalpie libre standard à 298 K est : ∆rG ◦ = ∆r H ◦ − T∆ rS ◦
avec ∆rH ◦ = 2 ∆f H ◦NH − ∆ f HN◦ − 3 ∆ f H ◦H = −92, 2 kJ.mol−1
3 2 2

et ∆rS = 2
◦ ◦
S NH − S ◦N −3 S H◦ = −198, 7 J.K −1.mol−1
3 2 2

donc ∆r G ◦ = −92, 2.103 − 298 × (−198, 7) = −33 kJ.mol −1 (proposition b.)

54 ❑
✘ a. ❑ b. ❑ c. ❑ d. ❑ e.
• D’apr ès la loi de modération de Le Châtelier, lors d’une perturbation d’ équilibre, le système
évolue de façon à réduire cette perturbation. Ainsi, si la pression diminue, l’équilibre va avoir
tendance à se déplacer dans le sens qui permettrait une augmentation de pression (donc de
molécules gazeuses).
Par conséquent, les r éactions favorisant la formation des produits lors d’une diminution
de pression sont celles dont la somme des coefficients stœchiom étriques des produits est
supérieure à celle des coefficients stœchiométriques des réactifs. Attention : on ne prend en
compte que les molécules gazeuses !
• Réaction 1. : 2 mol de produit formé pour 1 mol de reactif ´ gazeux. Cette proposition
convient.
Réaction 2. : 2 mol de produit pour 4 mol de réactif. L’évolution spontanée a donc lieu en
sens inverse (proposition fausse).
Réaction 3. : 1 mol de produit pour 3 mol de réactif. L’évolution spontan ée a lieu en sens
inverse (proposition fausse).
Réaction 4. : il y a autant de molécules gazeuses de r éactifs que de produits. L’équilibre n’est
pas perturbé (proposition fausse).
Réaction 5. : 3 mol de produits pour 1 mol de réactif donc l’ équilibre évolue dans le sens
direct. Cette proposition convient.
Par conséquent, seules les equations
´ 1. et 5. conviennent (proposition a. ).

Solutions aqueuses
55 ❑ a. ❑b.
✘ ❑ c. ❑d.
✘ ❑ e.
• La proposition a. est fausse et b. est vraie. On sait que pKa = − log K a. Pour le couple
HNO2 /NO−2 , on a : K a = 1/K ◦ = 10−3,3 soit pKa = 3, 3.
La réaction entre l’acide HNO 2 et la base H2O a pour équation de r éaction :
HNO 2 + H 2O = NO −2 + H3 O+.
• La proposition c. est fausse. HNO2 est un monoacide faible en solution aqueuse, non tota-
lement associé avec la base H2O et Ka  1.
194 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


56 ❑
✘ a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
• La proposition a. est vraie. La demi-équation r édox du couple HNO2 /NO(g) s’écrit :
HNO 2 + H+ + e− = NO(g) + H2 O.
• La proposition b. est fausse. Pour ce couple la demi-équation s’écrit :
NO −3 + 3H+ + 2e− = HNO 2 + H2O, il faut donc 3H+.
Pour un couple avec l’ion H+, de demi-équation aOx + mH+ + ne− = b Red la formule de Nernst
0, 06
s’écrit : E = E ◦ + log[Ox] a[H + ]m /[Red]b.
n

• La proposition c. est fausse. L’ équation de Nernst s’écrit :


E ◦(HNO2 /N(g) ) + 0, 06log([HNO 2][H +])/p NO(g).
NO est le réducteur du couple.

57 ❑a.
✘ ❑ b. ❑c.
✘ ❑ d. ❑ e.
• La proposition a. est vraie. Comme E◦ (HNO2 /NO(g) ) > E◦ (NO−3 /HNO2 ) l’oxydant HNO2
peut réagir sur le réducteur HNO2 donc réaction de dismutation (règle du gamma).
• La proposition b. est fausse. Pour la molécule HNO2 la somme des n.o est 0. Comme n.o
(H) = +I et n.o (O) = -II on a donc n.o(N) = +III.
• La proposition c. est vraie. cf. demi-équations précédentes.
• La proposition d. est fausse. On a :
HNO2 + H + +e − = NO(g) + 2O (1)
− + −
HNO2 + H2 O = NO3 + 3H + 2e (2)
La combinaison 2(1) +(2) donne : 3HNO2 = NO−3 + 2NO + H 3O +.
L’équation bilan donnée n’est pas ajustée au niveau de N.

58 ❑ a. ❑ b. ❑ c. ❑
✘ d. ❑
✘e.
• La proposition a. est vraie. Dans la cystéine on a l’enchaı̂nement suivant −CH2 − SH alors
que pour la cystine on a −CH2 − S − S − CH2 −, d’où la présence d’un pont disulfure.
La liaison covalente −S − S− (e-équitablement partag és) remplace la liaison −S − H où S
attire à lui les électrons de la liaison étant plus électronégatif que H.
• La proposition b. est fausse. Nous avons : pKa −1 < pH < pKa +1, et pour l’acide :
5, 8 < 7, 4 < 7, 8 ; donc aucune des deux formes prédomine.
• La proposition c. est fausse. Pour le couple cystine/cyst éine noté RSSR/ RSH, la demi-
équation s’écrit :
R−S−S−R + 2 H + + 2e− = 2 RSH
donc E d épend du pH de la solution.
• La proposition d. est vraie. Relisez l’ équation de Nernst dans un QCM qui précède. La
cystéine est le réducteur du couple. Elle se trouve au dénominateur, donc le log augmente.
• La proposition e. est vraie car 0, 06 log vient de (RT /F ) ln.

59 ❑ a. ❑
✘ b. ❑ c. ❑
✘ d. ❑ e.
• La proposition a. est fausse. Pour la molécule de H2 O 2, H − O − O − H, la somme des n.o
est nulle, soit 2 n.o(H) + 2 n.o (O) = 0 avec n.o(H) = +I donc n.o (O) = -I.
• La proposition b. est vraie. En accord avec les demi-équations de réaction qui sont :
UE 1 • Corrigés 195

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


MnO−4 + 8H+ + 5e− = Mn 2+ + 4H2O (1)

Corrigés
H 2O 2 = O2(g) + 2H+ + 2e− (2)
pour avoir l’équation de réaction il faut faire 2 (1) + 5(2) et on obtient :
MnO−4 + 6H+ + 5H2O 2 = 2Mn2+ + 8H 2 O + 5O2(g)
• La proposition d. est fausse. L’ écriture du couple est erronée et de plus il faut être en milieu
acide.
• La proposition e. est fausse. cf. Nernst : E = E◦ + 0, 03 log(PO 2(g) .[H+] 2)/[H2O2 ].

60 ❑ a. ❑ b. ❑
✘ c. ❑
✘ d. ❑
✘e.
• La proposition a. est fausse. Si l’on considère les E ◦ des deux couples Ag+ /Ag(s) et Pb2+ /
Pb(s) , on a E ◦4 > E ◦1 donc Ag + est plus oxydant que Pb2+ .
• La proposition b. est fausse. Si l’on considère le syst ème contenant les esp èces Pb4+ , Pb 2+
et Pb (s) on peutécrire les demi-équations électroniques et les formules de Nernst relatives aux
trois couples :
0, 06 [Pb 4+ ]
Pb4+ + 2e− = Pb2+ E 2 = E◦2 + log
2 [Pb 2+ ]
0, 06
Pb2+ + 2e− = Pb(s) E 1 = E◦1 + log[Pb 2+] car l’activit é aPb(s) = 1
2
0, 06
Pb4+ + 4e− = Pb(s) E 3 = E◦3 + log[Pb 4+]
4
À l’équilibre, il y a unicité des potentiels des couples présents, ce qui impose
E 1 = E 2 = E 3 soit 2E3 = E1 + E 2 et donne :
0, 06 0, 06 0, 06
2E ◦3 + log[Pb4+ ] = E ◦1 + log[Pb2+ ] + E◦2 + log[Pb4+ ]/[Pb2+ ]
4 2 2
◦ ◦ ◦ ◦ 1 ◦
puis : 2E 3 = E 1 + E 2etE 3 = (E 1 + Ev2 ) = 0, 84 V.
2
• La proposition d. est vraie : Pb(s) = Pb 2+ + 2e −.

61 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
• La proposition a. est fausse. HCl est totalement dissocié en solution aqueuse, acide fort.
• La proposition b. est fausse. Compte tenu des valeurs des E ◦(Cu2+/Cu > E ◦(H+ /H2(g) ) la réaction
(s
n’est pas thermodynamiquement possible.
• La proposition c. est fausse. La réaction ne d émarre pas.
• La proposition d. est fausse. Le Cu a un n.o = 0.
• La proposition e. est vraie. Pour la molécule HCl la somme des n.o est nulle. Comme n.o(H)
= +I et n.o(Cl) = -I, Cl est plus électronégatif que H.

62 ❑ a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
• La proposition a. est fausse. Pour un ion la somme des n.o est egale
´ à la charge de l’ion
donc ici n.o(N) + 3 n.o(O) = -I.
Or n.o(O) = -II, ce qui nous donne n.o(N) = -I + VI= +V.
• La proposition b. est fausse. Dans HNO 2 le n.o(N) = +III ; c’est la forme réduite.
• La proposition c. est fausse. Dans une équation de r éaction rédox les électrons n’appa-
raissent pas.
196 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition d. est vraie. Écrivez les demi-équations et les formules de Nernst des trois
couples qui participent au système contenant les espèces NO −3 , HNO2, NO.
L’unicité du potentiel des couples présents dans le syst ème consider
´ é à l’équilibre impose
E1 = E 2 = E 3 ce qui conduit à E3◦ = 3E◦2 − 2E◦1
et à la relation entre les potentiels rédox standards E ◦3 = 3E2◦ − 2E◦1 soit la valeur E ◦3 =
3 × 0, 96 − 2 × 0, 94 = 1, 00 V.
• La proposition e. est fausse. La demi-équation s’écrit :
HNO2 + H+ + e− = NO + H 2 O.
Or NO est le réducteur donc le potentiel d’électrode (relation de Nernst) s’écrit : E = E ◦3 +
0, 06 log([HNO2 ].[H+])/[NO].

63 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑
✘e.
Si B désigne la cocaı̈ne, on a : B + H+ = HB+ ou B + H2 O = HB+ + HO−.
• La proposition a. est fausse. Une solution aqueuse acide à un pH  7, 0 à 25 ◦C, pour une
1 
base faible pH = 7 − pKa - pC ,
2
1 
soit pour la solution : pH = 7 − 8, 7 − 3 = 9, 85.
2
• La proposition b. est fausse. Pour le chlorhydrate de cocaı̈ne HB+ + Cl −, c’est l’acide
conjugué de la base B qui va imposer le pH donc pH  7, 0 à 25◦C.
• La proposition c. est vraie. À 25◦ C, on a pKa + pKb = pK e = 14 donc
pKb = 14 − 8, 7 = 5, 3.
• La proposition d. est fausse. On a Kb = 10 −pKb donc K b = 10 −5,3 .
1
• La proposition e. est vraie. Pour un monoacide faible, la relation donnant le pH est pH =
2
(pKa + pC).

64 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑
✘e.
• La proposition a. est fausse. Tracez un diagramme de pr édominance ( le faire mentale-
ment) :
H2CO 3 HCO−3 CO2−
3
0 pK1 = 6, 4 pK2 = 10, 4 14 → pH
7, 4
À pH 7, 4, HCO−3 est pr édominant.
• La proposition c. est fausse. Voir diagramme, l’ion CO2− 3 prédomine pour pH > pKa2 + 1
soit pH > 11, 4.
1
• La proposition d. est fausse. H2 CO3 est un acide faible. Pour calculer le pH on fait pH =
2
1
(pKa + pC) = (6, 4 + 2) = 4, 2.
2
[base]
• La proposition e. est vraie. pH = pKa + log
[acide conjugu é]
avec ici [base] = [acide conjugué], donc pH = pKa = 6, 4.

65 ❑a.
✘ ❑ b. ❑c.
✘ ❑ d. ❑
✘e.
Il faut avoir un mélange d’un acide HA et de sa base conjuguée notée B dont le pH sera donné
UE 1 • Corrigés 197

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


par la relation pH = pKa(B/HA) + log [B]/[HA] et qui sera dans le domaine de pH souhait é.

Corrigés
• La proposition a. est vraie. On a le couple H2 PO−4 /HPO 2− 4 donc avec les données du texte
0, 02
pH = 7, 2 + log ≈ 7, 0.
0, 03
• La proposition b. est fausse. On considère le même couple mais les quantités de matière
sont inversées. Le pH du mélange vaut donc pH = 7, 2 + 0, 176 ≈ 7, 38 donc hors du domaine
souhaité.
• La proposition c. est vraie. Il se produit la réaction chimique totale suivante :
HPO2−4 + H+ → H2 PO−4
état initial 0, 05 0, 03 ε
état final 0, 02 ε 0, 03
2
La valeur du pH est pH = pK a2 + log ≈ 7, 0, on retrouve le cas a.
3
• La proposition d. est fausse. La réaction chimique totale admet pour équation de r éaction :
HPO2− 4 + HO− → PO 3− 4 + H2 O
état initial 0, 05 0, 03 ε excès
état final 0, 02 ε 0, 03 excès
Le pH est celui du couple HPO2− 3−
4 /PO4 ce qui donne :
 
pH = pKa HPO 2− 3−
4 / PO4 + log[PO3− 2−
4 ][HPO4 ]
soit pH = 12, 4 + 0, 176 ≈ 12, 6 donc hors du domaine.
On peut remarquer que pK a > pH voulu.
• La proposition e. est vraie. On a un m élange d’un acide faible CH3 COOH et d’une base
faible NH3 de concentrations égales.
La réaction prépond érante sera CH3 COOH + NH3 = CH3COO− + NH+4 .
1 
Dans ces conditions le pH est donné par la relation pH = pKa1 + pK a2 soit
2
1
pH = (9, 2 + 4, 8) = 7, 0. C’est donc une bonne solution tampon.
2

66 ❑
✘ a. ❑ b. ❑
✘ c. ❑ d. ❑
✘e.
Une base est un accepteur de proton ou libère directement des ions HO −.
• La proposition a. est vraie.
Ca(OH)2 → Ca 2+ + 2 HO−
• La proposition b. est fausse. Si l’on compare K a de NH +4 = 10−pKa = 6, 3 × 10−10 et Kb de
NO −2 = 2 × 10−11, on remarque que NH +4 est un acide moins faible, alors que NO −2 est une
base plus faible, donc NH+4 impose le pH ; la solution est acide.
• La proposition c. est vraie. Na HS se dissocie pour donner Na+ ( ion indifférent) et HS− qui
est amphotère.
La réaction prépond érante sera : HS− + HS− = H2 S + S 2−.
Si la concentration est considérée comme forte alors
1  1
pH = pK(H2 S /HS − ) + pK(HS − /S 2− ) = (7, 1 + 12, 9) = 10, 5. La solution est basique.
2 2
• La proposition d. est fausse. HF est un monoacide faible.
198 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition e. est vraie. La réaction a pour équation NaClO → Na+ + ClO − suivie de
ClO − + H2 O = HClO +HO− . La solution est basique.

67 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑
✘e.
• La proposition a. est fausse. La concentration de l’amphétamine notée X est donnée par la
n(X ) m(X )
relation [X ] = avec n(X ) =
V M(X )
135×10 −3
135
ce qui nous donne : [X ] = = 10−2 mol.L−1 .
0, 1
• La proposition b. est vraie. Pour une monobase faible le pH est donné par la relation
1 1
pH = 7 − (pK a − pC) soit en valeur pH = 7 − (10 − 2) = 11.
2 2
• La proposition e. est vraie. Le pH de l’estomac est proche de 1 (présence de HCl) donc
l’amphétamine est sous forme de chlorhydrate.

68 ❑ a. ❑b.
✘ ❑c.
✘ ❑d.
✘ ❑e.

• L’ion ammonium a pour formule NH+4 donc la réaction de dissociation de l’ammonium dans
l’eau doit faire intervenir NH +4 et H2 O en tant que réactifs. La proposition a. est donc fausse.
• La proposition b. est correcte. Notons que le terme dissociation n’est pas vraiment adapté
puisqu’il n’y a pas de rupture de liaison au sein de la molécule d’ammoniac. On devrait plutôt
parler de r éaction de protonation.
• L’ammoniac NH+3 joue le r ôle de base dans le couple
ion ammonium/ammoniac NH+4 / NH +3 (pKa = 9, 2)
et le rôle d’acide dans le couple ammoniac/ion amidure NH +3 / NH+2 (pKa ≈ 35). NH+3 est
donc une espèce amphotère (proposition c.).
Il peut donc réaliser une réaction d’autoprotolyse en tant que solvant selon la réaction :
2 NH 3  NH+4 + NH −2
Il y a rupture ou formation de liaison avec échange de protons (et sans formation de radicaux)
donc la réaction est egalement
´ h étérolytique (proposition e.).
Remarque : le terme hétérolytique est plutôt employé pour désigner la nature d’une rupture
de liaison.
• L’élément azote possède 7 électrons lorsqu’il est neutre, 6 électrons s’il possède une charge
positive et 8 électrons s’il a une charge n égative.
Un atome d’hydrogène possède 1 électron. Ainsi, on a 7 + 3 = 10 électrons dans NH+3 ,
8 + 2 = 10 électrons dans NH−2 et 6 + 4 = 10 électrons dans NH+4 . La proposition d. est donc
correcte.

69 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
La réaction qui a lieu est : B + H 2 O  BH+ + HO − (constante d’équilibre K )
On réalise un tableau d’avancement volumique afin de déterminer la valeur du pH :
B + H2O  BH+ + HO − x2
K=
EI : 0, 05 excès 0 0 ( 0, 05 − x) C ◦
EF : 0, 05 − x excès x x
Remarque : C◦ est la concentration standard et vaut 1 mol.L−1 . On ne la notera plus explici-
tement par la suite et pour les réponses suivantes.
UE 1 • Corrigés 199

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


On a x = [HO−] donc le pH se calcule d’apr ès la relation : pH = pKe − pOH soit

Corrigés
pH = pKe + log[HO− ] = pKe + log x
Pour trouver la valeur de x, il suffit de résoudre l’ équation :
x 2 = K (0, 05 − x) ⇐⇒ x2 + Kx − 0, 05K = 0 ⇐⇒ x = 7, 02 × 10−4 mol.L−1
Ainsi, pH = 14 + log 7, 02 × 10 −4 = 10, 8 (proposition c.).

70 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
Le chlorure de sodium NaCl est constitué d’ions sodium Na+, acide indiff érent dans l’eau, et
d’ions chlorure Cl− , base indifférente dans l’eau.
Par conséquent, le chlorure de sodium est une espèce indifférente dans l’eau (ni acide, ni
base) donc le pH n’est pas modifié (on a toujours pH = 10, 8, proposition c.).

71 ❑ a. ❑ b. ❑ c. ❑d.
✘ ❑ e.
À pH 7, le groupe phosphorique est sous sa forme basique (deux charges négatives à droite
car le pH est supérieur aux deux pKa), la fonction carboxylique sous sa forme basique (une
charge négative à gauche) et le groupe guanidyle sous sa forme acide (forme protonée car le
pH est inférieur au pKa). La proposition correspondante à cette description est donc la pro-
position d.

C’est une espèce ampholyte puisque la même espèce non protonéee au niveau du groupe gua-
nidyle est la base conjuguée tandis que l’acide conjugue´ est la m ême esp èce mais avec une
seule charge négative à droite). Le terme zwittérion était aussi correcte puisque dans l’espèce
il y a des charges positives et négatives port ées par des atomes non adjacents (s’ils sont adja-
cents, on parle d’ylures).

72 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
• Le couple rédox [Ag(NH 3 )2 ] + / Ag a un potentiel r édox plus élev é que le couple
Zn2+ / Zn donc la r éaction spontanée fait intervenir l’oxydant [Ag(NH3 )2 ]+ et le réducteur
Zn (attention les couples rédox sont not és dans l’ordre oxydant / réducteur). Ceci nous permet
d éjà d’éliminer les propositions b et d..
• L’équation de la réaction s’obtient en multipliant la première demi-équation par −1 (donc
en l’inversant) et la deuxième par 2. On obtient donc la solution e. :
2[Ag (NH 3 )2 ]+ + Zn −→ Zn2+ + 2 Ag + 4 NH3

73 ❑ a. ❑b.
✘ ❑c.
✘ ❑ d. ❑
✘e.
• Le diiode et l’ion iodate ne peuvent pas appartenir à un même couple acide-base puisqu’au-
cun ne comporte d’élément hydrogène (donc de protons éventuellement échangeables).
• Par contre, les couples rédox IO3 / I2 et SO2−
4 / HSO3 réagissent selon les demi-équations

électroniques :
I 2 + 6 H2 O  2 IO −3 + 12 H + + 10 e− ×(−1)
HSO −3 + H 2O  SO 2−4 +3H +2e
+ −
×5
pour donner l’équation :
200 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


2 IO−3 + 5 HSO−3  I 2 + H 2O + 5 SO2−
4 +3H
+

soit 2 IO−3 + 2 H 2 + 5 HSO−3  I2 + 5 SO2− 4 + 3 H3 O


+

(en ajoutant 3 molécules d’eau à gauche et à droite)


La réaction est donc une réaction d’oxydo-réduction (proposition b. correcte).
Remarque : on aurait également pu le trouver en étudiant les nombres d’oxydation de l’iode
(+V et 0) et du soufre (+IV et +VI) dans la réaction.
• L’addition d’acide (donc d’ions H 3O +) favorise un déplacement de la r éaction vers la
consommation des ions oxonium ajoutés donc un déplacement en sens inverse. La réaction
de formation de diiiode est donc défavoris ée (proposition c. juste).
• L’ajout de base peut permettre de neutraliser le milieu réactionnel en réagissant avec les
ions oxonium formés et donc favoriser la formation de diiode en déplaçant l’équilibre vers la
droite (loi de modération de Le Châtelier). La proposition d. est donc erronée.
• La réaction étudiée étant spontan ée, l’oxydant de la réaction (ici IO−3 ) doit avoir un poten-
tiel rédox supérieur a` celui du r éducteur de la réaction (ici HSO −3). La proposition e. est donc
fausse.

74 ❑a.
✘ ❑ b. ❑c.
✘ ❑ d. ❑ e.
• HCl est un acide fort totalement dissocié dans l’eau en ions oxonium et chlorure tandis que
NaOH est une base forte totalement transformée dans l’eau en ions hydroxyde et sodium.
Br−CH 2COONa est une espèce ionique composée d’ions Br−CH2 COO− et d’ions sodium.
NaCl est un solide ionique totalement dissous dans l’eau en ions chlorure et sodium. Ces ions
étant des espèces indifférentes, on ne les étudiera pas par la suite.
• D’apr ès l’échelle de pKa ci-dessous, on en d éduit que la première réaction qui a lieu est :
1
HO − + H3O + −→ 2 H2 O K  = = 10 14 (réaction quantitative).
Ke

La solution equivalente
´ contient alors 0, 05 mol de H 3 O+ , 0, 10 mol de Br−CH 2COO − et les
ions spectateurs.
La réaction qui a alors lieu spontanément est :
Br−CH2COO − + H3 O+  Br−CH2COOH + H2O
EI : 0, 10 0, 05 0 `
exces
EF : 0, 10 − x 0, 05 − x x exces
`
de constante d’équilibre :
1 x x
K= = 10 2,7 = =
Ka (0, 10 − x ) (0, 05 − x) 5.10 − 0, 15x + x 2
−3

La résolution de l’ équation K x2 − ( 0, 15K + 1 ) x + 5.10 −3 K = 0 nous donne :


x = 4, 81.10 −2 mol.L−1 puis pH = − log[H3O+ ] = − log (0, 05 − x) = 2, 7
UE 1 • Corrigés 201

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


[Br − CH 2 COO− ] 0, 10 − x
Autre possibilité : pH = pKa + log = pKa + log

Corrigés
[Br − CH2COOH] x
Ainsi pH = 2, 7 = pKa, donc les propositions justes sont a. et c.

75 ❑a.
✘ ❑ b. ❑ c. ❑ d. ❑
✘e.
• La somme algébrique des degrés d’oxydation des différents éléments composant une espèce
chimique est égale à la charge de l’espèce etudi
´ ée. Ainsi, le nombre d’oxydation d’un corps
simple (molecule
´ constitu ée d’un unique élément chimique) est nul. Les propositions a. et e.
sont donc correctes.
• Lors d’une oxydation, le reducteur
´ c ède des électrons et est oxydé. Son degré d’oxydation
augmente. L’affirmation d. est donc fausse.
• Dans la classification périodique, les éléments les plus réducteurs sont à gauche (alcalins et
alcalino-terreux) alors que les plus oxydants sont à droite (en particulier les halogènes). Le
fluor (ou plutôt le difluor) est donc un oxydant très puissant. La proposition c. est incorrecte.
• L’électrode standard à hydrogène est une électrode utilisée dans les conditions standard
donc p H = p◦ = 1 bar et [H 3O+] = C ◦ = 1 mol.L −1 . La proposition b. est donc fausse.
2

76 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
On rappelle que dans un édifice polyatomique, le degré d’oxydation d’un élément est compté
n égativement lorsque l’atome considéré est plus electron
´ égatif que l’atome auquel il est lié et
positivement s’il est moins électronégatif. En cas de liaison multiple, ce nombre est multiplié
par le  nombre de liaisons  constituant la liaison multiple. Si l’él ément étudi é possede
` une
charge positive, respectivement une charge négative, il faut ajouter 1, respectivement retiré 1,
au nombre d’oxydation.
Les formules de Lewis de N 2, NO, HNO2 et NO−3 sont respectivement :

donc les nombres d’oxydations de l’azote sont respectivement : 0, +II, +III et +V (proposi-
tion c.).
Autre méthode : additionner les degrés d’oxydation sachant que celui de O est -II, celui de H
est +I et celui de N est not é x. Par exemple, pour NO−3 , on a : 3 × (−2) + x = −1 donc x = 5
et pour HNO2 , on a : 2 × (−2) + 1 + x = 0 donc x = 3.

77 ❑ a. ❑
✘ b. ❑ c. ❑
✘ d. ❑ e.
• Pour savoir si ces réactions sont rédox ou pas, on se propose de déterminer le nombre
d’oxydation des éléments autres que l’hydrogène et l’oxygène (dont les valeurs sont respecti-
vement de +I et -II si les corps ne sont ni simples, ni en présence de fluor ou d’élément moins
électronégatifs que l’hydrogène).
• La réaction a. est une r éaction acido-basique (le fer reste au degré d’oxydation +III durant
la réaction et Fe3+ est un acide).
• Dans la réaction b., l’iode passe du degré d’oxydation -I au degr é d’oxydation +0, il est
oxydé ; en même temps, le fer passe du degré +III au degr é +II, il est réduit. Cette réaction
est donc bien une réaction d’oxydoréduction.
• Dans la réaction c., l’azote conserve son degr é d’oxydation (-III) tandis que le carbone
conserve son nombre d’oxydation nul. Ce n’est donc pas une reaction ´ r édox. Pour informa-
tion, c’est une réaction d’addition nucl éophile.
202 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• Dans la dernière réaction, le chlore est réduit (passage des nombres d’oxydation 0 à -I) tan-
dis que le carbone est oxyde´ (passage de -IV à -II). C’est donc une réaction d’oxydoréduction.

2. Chimie organique

Sructure, nomenclature, isomérie et réactivité


78 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
Pour nommer une molécule, on commence par chercher la chaˆıne carbonée la plus longue
puis on la numérote afin d’avoir les chiffres les plus petits possibles pour les ramifications.
Celles-ci sont nommées par ordre alphabétique (sans tenir compte des préfixes -di, -tri...).

Ici, est le 2, 7-diméthyl-4-propylnonane.


La proposition d. est quasiment juste mais l’ordre alphab étique des substituants n’est pas res-
pecté. Il n’y a donc aucune proposition correcte (proposition e.).

79 ❑ a. ❑b. ❑
✘ c. ❑ d. ❑ e.
La fonction aldéhyde (−CHO) est prioritaire devant les fonctions alcools (−OH) dans la no-
menclature officielle. Cette fonction portera donc le numéro 1 (sous-entendu dans le nom)
tandis que la fonction alcool sera notée en préfixe (-hydroxy).
Ainsi la molécule étudi ée est le 3-chloro-2, 4, 5-trihydroxypentanal.

80 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
La cr éatinine a pour formule de Lewis :

Pour qu’elle soit aromatique, il faut qu’il y ait 4n+ 2 électrons π délocalisés sur le cycle. Ceci
est impossible donc la proposition a. est fausse.
De plus, si le cycle était plan, on aurait des angles de 120◦ (géométrie trigonale plane et penta-
gone irrégulier) alors que la géométrie autour des atomes d’azote et d’un atome de carbone
est tétraédrique ou pyramidale (angles d’environ 109 ◦ d’après la theorie´ VSEPR). Le cycle
est donc repli é (la proposition d. est incorrecte).
On rappelle que pour connaı̂tre le type d’hybridation d’un atome dans un édifice polyato-
mique, il suffit d’additionner les deux nombres donnés dans la formule VSEPR de la structure
étudiée.
Ici, on a : N = 3 + 1 = 4 pour les atomes d’azote du cycle, N = 2 + 1 = 3 pour l’atome d’azote
UE 1 • Corrigés 203

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


externe et N = 3 ou N = 4 pour les atomes de carbone. Pour N = 3, les atomes sont hybrid és

Corrigés
sp 2 et pour N = 4, ils sont hybrid és sp3. La proposition b. est donc fausse.
La forme tautomère faisant intervenir la fonction amide a pour formule :

La proposition c. est donc fausse également.

81 ❑
✘ a. ❑ b. ❑ c. ❑
✘ d. ❑ e.

La spongiacystéine

possède :
➣ 4 atomes de carbone asymétriques (symbolisés par des ast érisques)
➣ 2 fonctions alcool secondaire
➣ 1 fonction amide tertiaire (car l’azote est relié a` 3 atomes de carbone dont celui de l’amide)
➣ 1 fonction thioéther (atome de soufre li é à deux atomes de carbone)
➣1 fonction acide carboxylique
mais pas de fonction cétone (c’est une fonction amide puisque le C=O est lié à un atome
d’azote).

82 ❑
✘ a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
• Le composé 1 poss ède une fonction aldéhyde, et plus précis ément une fonction énal (alc ène
+ aldéhyde).
• 1 et 2 sont deux formes mésomères (pas des tautom ères) : on passe de l’une à l’autre en
d élocalisant lesélectrons (double liaison ou doublet non liant) d’une extrémit é à l’autre. Lors
de cette mésomérie, l’atome de chlore peut donner un doublet non liant pour former une
double liaison avec l’atome de carbone voisin. Il possède donc un effet mésomère donneur
+M.
• Le composé 1 s’appelle le 3-chloro-2-méthylbut-2-énal (la fonction aldéhyde porte le numéro
1).

83 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.

• Le propène possède une seule double liaison et aucun doublet non liant. Il
n’y a donc pas de phénomène de r ésonance (puisqu’il n’y a aucune conjugaison) ni d’effet
m ésomère possible dans cette molécule (propositions b. et e. fausses).
• D’après la théorie VSEPR, les 2 atomes de carbone de la double liaison poss èdent une
g éométrie trigonale plane tandis que l’autre atome de carbone a une géométrie tétraédrique.
Tous les atomes ne peuvent donc pas appartenir au meme ˆ plan (proposition a. incorrecte).
La présence d’une liaison π empêche toute rotation autour de la double liaison (proposition
204 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


d. fausse).
L’effet inductif donneur +I du groupement m éthyle a tendance à fournir une charge partielle
δ − sur l’atome de carbone voisin. Les charges partielles des atomes formant la double liaison
ne sont pas nulles ni identiques donc la double liaison devient alors polarisée (proposition c.
correcte).

84 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.

• Le 6-méthylhepta-2, 4-diène a pour formule :

Il possède deux doubles liaisons conjuguées donc pr ésente un effet mésom ère.
Les deux autres formes limites ont pour formule :

• Sachant qu’un élement´ électronégatif a tendance à attirer les électrons d’une liaison vers
lui, la densité électronique est donc plus forte du côt é de ce dernier (proposition a. fausse).
• Les halogènes sont des éléments électronégatifs donc possèdent un effet inductif attracteur
-I (proposition b. fausse).
• Un carbocation est une espèce pauvre en électron (l’atome de carbone est entouré de 6
électrons, la règle de l’octet n’est pas respectée). Il est donc stabilisé par des effets (inductifs
ou mésomères) donneurs d’électrons (proposition c. correcte).
• Il y a effet mésomère lorsqu’il y a possibilit é de déplacer des doublets non liants ou des
doubles liaisons par délocalisation. Il n’y a pas forcement ´ de mésomérie dans un di ène (il
faut en plus que les doubles liaisons soient conjuguées, c’est-à-dire séparées par une liaison
simple). La proposition d. est donc incorrecte.

85 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
Un conform ère décalé est toujours plus stable qu’un conformère éclipsé.
Entre 4 et 5, les atomes d’halogène (gros atomes par rapport à l’atome d’hydrogène) sont plus
proches les uns des autres dans la forme 4 donc 4 est moins stable que 5.
Entre 3 et 6, les atomes de chlore d’une part et les atomes de brome d’autre part se trouvent
en face dans la structure 3, ce qui la d éstabilise.
Ainsi, 3 est moins stable que 6, lui-même moins stable que 4 puis que 5 (proposition c.).

86 ❑ a. ❑
✘ b. ❑ c. ❑
✘ d. ❑ e.

Le D-ribose ne possède aucun plan de symétrie (la repr ésentation de Fisher ne signifie pas
que tous les atomes sont dans un même plan). Son énantiom ère, le L-ribose est son image par
un miroir plan. La proposition d. est donc correcte.
UE 1 • Corrigés 205

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Corrigés
87 ❑a.
✘ ❑ b. ❑ c. ❑d.
✘ ❑ e.

• Un seul atome de carbone asymétrique sur 3 a la m ême configuration dans le D-ribose et


dans l’isomère 7. Ce sont donc des diast éréoisomères. Nous obtenons la même chose avec
l’isomère 10. Les stéréoisomères regroupant les énantiomères, les diast er
´ éoisomères et les
conformères, les propositions a. et d. sont correctes.
• Le D-ribose et le composé 8 (L-ribose) sont des énantiom ères (voir question précédente).
• La configuration d’un seul atome de carbone asymétrique sur 3 est modifiée entre le D-
ribose et l’isomère 9. Ce sont donc des diast éréoisomeres.
`

88 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
• Une molécule dextrogyre fait tourner le plan de polarisation de la lumi ère vers la droite tan-
dis qu’une molécule l évogyre le fait tourner vers la gauche. Le pouvoir rotatoire spécifique
est positif pour une molécule dextrogyre et négative pour une molécule lévogyre.
Il n’y a aucun lien entre les propriétés optiques des molécules chirales et les configurations
absolues R et S. Par conséquent, les propositions a. et b. sont fausses.
• Un composé ayant 3 atomes de carbone asym étriques possède au maximum 23 = 8 isomères
de configuration (2 possibilités par atome de carbone : R ou S). La proposition c. est donc
incorrecte.
• Une molécule possédant deux atomes de carbone asymétriques peut être achirale si elle
possède un plan de symétrie (proposition d. erronée).
• Deux isomères de position ne diffèrent que par la position des diff érentes fonctions sur le
squelette carboné. La proposition e. est donc correcte (les autres types d’isom érie de consti-
tution étant les isoméries de chaı̂ne et de fonction).

89 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑
✘e.
• a. ne possède aucun atome de carbone asymétrique. La mol écule est donc achirale.
• b. possède 2 atomes de carbone asymétriques et la molécule ne poss ède pas de plan de
symétrie. Elle est donc chirale.

• c. possède également deux atomes de carbone asym étriques mais la molecule


´ poss ède un
plan de symetrie
´ (horizontal sur la repr ésentation de Fisher).La molécule est donc achirale.
• d. ne possède pas d’atome de carbone asym étrique (il y a deux groupements identiques
autour de l’atome central). La molécule est achirale.
206 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• e.

poss ède deux atomes de carbone asymétriques et aucun plan de


symétrie. La molécule est donc chirale.

90 ❑ a. ❑b.
✘ ❑ c. ❑d.
✘ ❑ e.
• Des isomères géométriques ne diffèrent que par la position des atomes dans l’espace (pas
par l’enchaı̂nement des atomes). Les 3 compos és ne sont donc pas des isomères g éométriques.
• La nomenclature cis (du même côté) / trans (a` l’oppos é) fait référence aux positions des
groupements sur un cycle tandis que la nomenclature Z (du même côté) / E ( à l’opposé) est
utilisée pour la position des groupements sur un alcène. Ainsi, 11 est un isom ère cis, 12 un
isomère Z (Cl étant prioritaire devant COOH d’après les num éros atomiques du chlore et du
carbone) et 13 n’est ni de configuration Z, ni de configuration E (deux groupements CH3 à
gauche).
• 11 possède un plan de symétrie et aucune double liaison. La molécule est donc achirale
(malgré la présence de deux atomes de carbone asymetriques).
´

• 13

poss ède un atome de carbone asym´


etrique donc une activit é optique.

91 ❑a.
✘ ❑
✘b. ❑c.
✘ ❑ d. ❑e.

• Le plus rapide est de chercher la configuration de l’atome de carbone central dans chacune
des représentations, sachant que le composé étudié est de configuration S (ordre de priorité
selon les règles de Cahn, Ingold et Prelog ou règles CIP :
S > O > C > H).
Attention, il faut toujours avoir la liaison carbone - groupement minoritaire vers l’arrière (soit
sur le schéma en tournant par exemple 3 groupements autour d’une liaison, soit en imaginant
la molécule dans l’espace).
• Les molécules a., b. et e. sont de configuration R. Ces trois repr esentations
´ correspondent
à l’énantiomère du composé étudié.
• Réécrivons les composés c. et d. en représentation de Cram en regardant de la droite :

(en regardant de la gauche) et


c. est donc de configuration R (énantiomère du compose´ étudié) tandis que d. est de configu-
ration S.

92 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
• Atome de carbone C1 : regles
` CIP : O > N > C > H
C1 est de configuration R.
UE 1 • Corrigés 207

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• Atome de carbone C2 : regles
` CIP :

Corrigés
C2 est de configuration R (attention : H est à l’avant dans la représentation).
• Atome de carbone C4 : regles
` CIP :

C4 est de configuration R.

93 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
• Pour obtenir la projection de Fisher de 14, il suffit de regarder de la droite. On trouve :

(l’énantiomère de 15).
• Le composé 14 est de configuration S (r ègles CIP) :

C’est donc la (2S)-leucine ou, en nomenclature officielle, l’acide (2S)-2-amino-4-méthylpen-


tanoı̈que (l’acide carboxylique est prioritaire donc porte le numero
´ 1).
• Le groupement NH 2 est a` droite dans la repr ésentation de Fisher donc 15 est de configura-
tion D.
• On rappelle qu’il n’y a aucun lien entre configuration absolue (R/S ou L/D) et signe du
pouvoir rotatoire spécifique.

94 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
Chaque molecule
´ poss ède deux atomes de carbone asymétriques. Dans ce cas-là, deux molécules
sont des diastéréoisomères si une seule configuration absolue est modifiée entre les deux
structures.
Commençons par écrire le composé 16 en representation
´ de Fisher apr es
` avoir modifié sa
conformation en représentation de Cram (on regarde de dessous, tête du côt é de COOH) :

Ainsi, 16 et 17 sont identiques. Les diastéréoisomères sont 16/18, 17/18, 16/20, 17/20, 18/19
et 19/20. La seule proposition satisfaisante est donc la proposition e.
208 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


95 ❑ a. ❑
✘ b. ❑
✘ c. ❑
✘ d. ❑ e.
Deux molécule isomères ayant deux atomes de carbone asym étriques sont des énantiomères
si les deux configurations absolues changent entre les deux structures. C’est le cas des couples
16/19, 17/19 et 18/20 (propositions b., c. et d.).

96 ❑ a. ❑ b. ❑ c. ❑
✘ d. ❑
✘e.
• Pour savoir si les composes ´ sont des isomères de conformation, des énantiomères ou des
diastér éoisomères, on regarde l’agencement de chaque groupement sur chacun des deux
atomes de carbone asymétriques.
Pour que cela soit plus simple, on redessine le composé 24 en repr ésentation de Cram (en
regardant la projection de Newman de la droite) :

En mettant le groupement méthyle de droite vers le bas (par libre rotation) dans la structure
22, on se rend compte qu’on obtient la structure 23. Ce sont donc des conformères.
21 et 23 diffèrent d’une seule configuration. Ce sont donc des diastéréoisom ères. On a donc
la même relation entre les composés 21 et 22.
Les deux configurations sont modifiées entre les molécules 21 et 24, ce sont donc des énantiomères.
• Cherchons les configurations absolues dans la molécule 21 :
Atome de carbone de gauche (C4) : règles CIP :

L’atome de gauche est donc de configuration R.


Atome de carbone de droite (C3) : règles CIP :

L’atome de droite est donc de configuration R.

97 ❑ a. ❑b.
✘ ❑ ❑ d.
✘ ❑
✘e.
• Le DiMéthylSulfOxyde (DMSO) a pour formule :

C’est donc un solvant polaire aprotique dont la charge partielle δ − est localisée sur l’atome
d’oxygène tandis que la charge partielle δ + sur l’autre groupement d’atomes (bien plus gros).
UE 1 • Corrigés 209

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Cette différence de taille de chaque p ôle du dipôle induit une forte attraction des cations. Il
a donc tendance à solvater pr éférentiellement les cations (ici les ions potassium) et donc à

Corrigés
rendre plus réactifs les anions (ici les ions cyanure).
• Les ions cyanure ainsi libér és vont pouvoir agir sur le composé 21 en tant que nucl éophile.
Ce n’est pas une base forte (pKa (HCN/CN− ) = 9, 3) donc on n’observera qu’une réaction
de substitution nucléophile. On obtiendra alors un composé possédant une fonction nitrile (de
type R − C ≡ N).
• Le composé 21 est un halog énoalcane secondaire. La bonne nucléophilie de l’ion cya-
nure et la présence d’un solvant polaire aprotique favorise un mécanisme S N2. Ce dernier
a lieu en une seule etape
´ avec inversion de Walden (c’est- à-dire que le nucléophile attaque
spécifiquement à l’opposé du groupe nucléofuge, ici le brome sous forme d’ion bromure).

Réactions en chimie organique

98 ❑
✘ a. ❑ b. ❑ c. ❑ d. ❑
✘e.
La réaction d’iodation d’un cycle benzénique est une réaction de substitution électrophile
aromatique (notée SE Ar). Elle se fait en présence d’un agent oxydant (contrairement a` la
chloration et la bromation qui utilisent un catalyseur de type acide de Lewis). Les proposi-
tions correctes sont donc a. et e.

99 ❑a.
✘ ❑
✘b. ❑c.
✘ ❑ d. ❑e.

• Les amines sont des composés organiques contenant un atome d’azote porteur d’un doublet
non liant et relié à 2, 1 ou 0 atomes d’hydrogène. Les diff érentes classes d’amines possibles
sont donc respectivement primaire (une substitution sur l’atome d’azote), secondaire (deux
substitutions) et tertiaire (trois substitutions). La présence d’un doublet non liant indique que
´
les amines sont des espèces nucleophiles.
• Les amides poss édant un atome d’azote dont le doublet non liant est conjugué avec la
double liaisons C ≡ O, ils sont relativement stables (gr âce au phénomène de r ésonance) et ne
peuvent être ionis és (à pH physiologique en particulier). Par contre, ils peuvent être hydro-
lysés (comme tout dérivé d’acide carboxylique) en acide carboxylique et amine.

100 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑e.

• Le réactif est le 1-méthoxyprop-1-ène (chiffres les plus petits possibles).
L’atome d’oxygène est porteur de doublets non liants. Il y a alors conjugaison entre un dou-
blet non liant et la double liaison de ce réactif (ce qui signifie que l’atome d’oxyg ène possède
un effet mésomère donneur). L’autre forme mésomère est :

• La réaction étudi ée est une hydrochloration (ajout de HCl) sur un alcene ` donc une addi-
tion électrophile (puisque la première étape consiste à fixer l’électrophile H+ ). L’alcène étant
asymétrique, il y a deux produits possibles : le produit Markovnikov (majoritaire) et le pro-
duit anti-Markovnikov (minoritaire). On rappelle que le produit Markovnikov est celui issu
du carbocation (formé lors de la première étape) le plus stable. Ici, les deux carbocations
possibles sont :

Ils sont tous les deux substitués deux fois mais l’effet m ésomère donneur de l’atome d’oxy-
g ène stabilise le carbocation de droite.
Le produit majoritaire est donc H 3CO−CHCl−CH2 −CH3 , c’est-à-dire le 1-chloro-1-métho-
xypropane.
210 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


101 ❑
✘a. ❑
✘b. ❑ c. ❑ d. ❑e.

La réaction présentée ici est une hydrobromation. Il s’agit donc d’une réaction d’addition
électrophile.
L’énoncé sous-entend que l’on ne s’intéresse qu’au produit majoritaire. La molécule de départ
ne présente aucun groupement ayant un effet mésomère donc le produit majoritaire est celui
issu du carbocation le plus substitué. C’est donc l’halogénoalcane de classe le plus substitué,
soit le 3-bromo-3-méthylpentane :

Cette molécule ne possède pas d’atome de carbone asym étrique (il y a deux groupements
éthyle).

102 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑ e.
La réaction étudiée est une r éaction de syn-dihydroxylation c’est-à-dire que l’on forme un
diol vicinal (les deux fonctions alcools s’additionnant du même côt é de l’alcène).
Le Z but-2-ène a pour representation
´ :

soit
Le produit obtenu a donc pour représentation (proposition a.) :

103 ❑
✘a. ❑
✘b. ❑ c. ❑
✘d. ❑
✘ e.

• Les informations de l’énoncé nous indiquent qu’il y a deux réactions etudi ´ ées : une substi-
tution nucléophile pour former 29 et une élimination pour former 30, l’ion éthanolate étant à
la fois une base forte et un bon nucléophile.
• Concernant la substitution nucléophile, la formation d’un composé optiquement actif nous
montre que le mécanisme est un mécanisme SN 2 (sinon on obtiendrait un mélange racémique
optiquement inactif). Il se fait donc en une seule étape (sans passage par un carbocation).
• Concernant l’élimination, la base utilis ée étant une base forte, on privil égie un mécanisme
bimoléculaire (E2). D’après la règle de Za¨ıtsev, l’alcène majoritairement formé est le plus
stable donc l’alcène E. En supposant que les composés donnés dans l’énoncé sont les com-
posés majoritaires, la proposition e. est correcte (en réalité, l’alcène Z est également formé).
• Avec du tertiobutylate de potassium, base forte peu nucléophile et espèce plus grosse donc
encombrée, on privilégie la réaction d’élimination. On formera alors uniquement le composé
30.

104 ❑ a. ❑ b. ❑ c. ❑
✘ d. ❑
✘ e.
UE 1 • Corrigés 211

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Le réactif a pour formule :

Corrigés
m
|
o
L’alcool est obtenu par substitution nucléophile. L’halog énoalcane étant tertiaire, le mécanisme

c
t.
o
p
favorisé est S N 1. L’alcool obtenu est donc un mélange racémique (le carbocation formé lors

s
g
lo
de la première étape étant plan, l’attaque est équiprobable de chaque côté du plan).

.b
s
in
Le carbocation susceptible d’être formé lors d’une mécanisme E1 étant tertiaire (donc stable),

c
e
d
e
le mécanisme d’élimination favoris é est donc E1.

m
s
e
rd
o
s
e
105 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑ e.

tr
e
/l
:/
p
tt
h
|
Le mécanisme E1 se déroule en deux étapes : formation d’un carbocation et d’un ion ha-

m
o
.c
logénure puis capture du proton en β par une base. On forme alors un alc ène.

s
s
re
La première étape est identique à celle rencontrée avec le mécanisme SN1. Plus le carbocation

p
rd
o
est stable (donc substitué par des groupements donneurs), plus le m écanisme E1 est favorisé.

.w
s
in
Ce mécanisme est donc plus efficace avec des dérivés halog énés tertiaires.

c
e
d
e
Plus le nucléofuge est bon, plus la réaction d’élimination (E1 ou E2) est rapide.
m
s
e
rd

Enfin, lors d’un mécanisme E1, on forme des alcènes Z ou E, l’alcène E étant majoritaire car
o
s
e

le plus stable (r ègle de Zaı̈tsev).


tr
e
/l

Ainsi, toutes les phrases sont correctes (proposition a.).


:/
p
tt
h
|
s
in

106
c

❑ a. ❑ b. ❑
✘ c. ❑
✘ d. ❑
✘ e.
e
d
e
M
s
e
rD

La réaction 1 est une réaction de substitution nucléophile (l’hydratation n’étant pas possible
o
s
re

sur un cycle benzénique).


T
e
/L
s

L’halogénoalcane 31 étant tertiaire, le m écanisme SN 1 (substitution nucléophile monomo-


p
u
ro

léculaire) est favorisé. La première étape du mecanisme


´ permet de former un carbocation
/g
m

(intermédiaire réactionnel).
o
.c
k
o

Dans cette réaction, l’eau est à la fois un réactif nucléophile (car porteur de doublet non liant)
o
b
e

et un solvant protique (peut former des liaisons hydrogène) polaire.


c
a
.f
w
w

Le réactif est le (2R)-2-chloro-3, 3-diméthyl-2-phénylbutane


w
|

ou le (3R)-3-chloro-2, 2-diméthyl-3-phylbutane (il semblerait que les 2 nomenclatures, com-


s
in
c

portant les mêmes nombres et groupements, soient acceptees). ´ En effet, d’apr ès les règles
e
d
e
M

CIP, le chlore est prepondérant


´ devant le groupement phényle, lui-même prepond ´ érant sur le
s
e
rD

groupement tertiobutyle puis le méthyle. On rappelle qu’il faut prendre la chaine carbonée la
o
s

plus longue comme chaı̂ne principale.


re
T
e
/L

Le produit majoritairement obtenu est un mélange racemique ´ donc la formule non spatiale
m
o

est ci-dessous. C’est le 3, 3-diméthyl-2-phénylbutan-2-ol.


.c
k
o
o
b
e
c
a
.f
w
w
w
|

107 ❑
✘a. ❑
✘b. ❑ c. ❑
✘d. ❑ e.

La réaction 2 possède un mécanisme E2 donc un mécanisme concerté (en une seule étape) et
Retrouvez plus de livres médicaux à télécharger gratuitement et exclusivement sur :
| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins |
| http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |
212 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


bimoléculaire. La loi de vitesse s’écrit alors : v = k[substrat].[réactif]. Une élimination se fait
en présence d’une base forte (plutôt concentrée dans le cas du mécanisme E2) donc la soude
concentrée peut être le r éactif R1 utilisé.
Le produit 33 obtenu a pour formule topologique :

C’est donc un alcène (pas un alcyne).

108 ❑ a. ❑b.
✘ ❑ c. ❑d.
✘ ❑ e.

La réaction 3 est une réaction d’additon radicalaire (présence de peroxyde). Elle fait donc
intervenir des processus homolytiques dans le mécanisme et obéit à une règle que l’on peut
qualifier d’anti-Markovnikov : c’est l’effet Karash.
Le produit obtenu est le 1-bromo-3, 3-diméthyl-2-phénylbutane, de formule topologique :

109 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑ e.
On fait réagir un acide carboxylique avec un alcool : c’est une r éaction d’estérification. Or,
les réactifs sont :

La formule du produit s’obtient en enlevant le groupement OH de la fonction acide et l’atome


d’hydrogène de la fonction alcool et en associant les deux groupements restants :

110 ❑
✘a. ❑ b. ❑c.
✘ ❑ d. ❑e.

Le composé 35 est appelé le bromure d’allyle ou 3-bromopropène. Au niveau de la double


liaison, il y a deux atomes d’hydrogène sur l’atome de carbone de gauche donc pas de
stéréochimie ni Z, ni E.
La première étape permet de former l’organomagnésien :
UE 1 • Corrigés 213

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Les étapes suivantes permettent de synth étiser un ion alcoolate puis un alcool par réaction
avec le benzaldéhyde :

Corrigés
suivie d’une hydrolyse acide. On obtient l’alcool de formule :

111 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
La première réaction est une réaction d’addition électrophile de bromure d’hydrogène sur
un alcène donc une hydrobromation. L’alcene ` étant symétrique, le seul produit possible est
(proposition c.) :

112 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
La deuxième réaction est une réaction de subsitution nucléophile. Sans prendre en compte
le type de mécanisme et la stér éochimie (on n’a pas d’atome de carbone asymétrique), on
obtient le cyclohexanol (proposition b.) :

113 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘ e.
La troisième r éaction permet d’oxyder l’alcool secondaire obtenu en cétone par action du
permanganate de potassium.
On obtient donc la cyclohexanone (proposition e.) :

114 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑ e.
• L’atome d’azote possédant un doublet non liant conjugué avec la double liaison de l’alcène,
l’autre forme mésomère de 40 est :

(l’azote donne son doublet pour former une double liaison adjacente puis la double liaison
d éjà présente se rabat sur l’atome de carbone de droite qui devient un carbanion).
• Dans la formule de 40, on remarque que, concernant la fonction alc ène, l’atome de carbone
de droite est relié à deux groupements méthyle donc 40 ne possede ` ni st éréochimie Z, ni
214 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


stéréochimie E.
• La formule de 40 n’étant pas chargée, les propositions b. et e. sont impossibles. De plus,
40 ne possède pas de forme tautomère (par équilibre entre deux espèces chimiques : énamine
et imine) puisqu’il faudrait que l’atome d’azote soit relié à un atome d’hydrogène qui puisse
être échangé.
• Enfin, la reaction
´ entre une amine primaire et la propanone en milieu acide permettrait de
former une imine (par addition nucléophile). Or la trim éthylamine est une amine tertaire. La
réaction n’aura donc pas lieu.

115 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑
✘ e.
Par action d’un anhydride d’acide sur une amine, on obtient un amide. Dans le cas étudié, le
produit 41 a pour formule :

L’amide 41 est ensuite r éduit en amine par action du tétrahydruroaluminate de lithium (LiAlH 4 )
suivie d’une hydrolyse acide. On obtient alors :

116 ❑
✘a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
• La première étape est une réaction du type acetalisation
´ (nommee ´ thioacétalisation ici du
fait de la présence de soufre). C’est donc une r éaction d’addition nucléophile.
• La deuxième étape est une réaction d’oxydation de l’hémithioacétal (en particulier la fonc-
tion alcool) par le NAD + en thioester (la fonction −OH a été oxydée en ≡ O).
Vérifions à l’aide des demi-équations électroniques :

117 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑ e.
L’action de l’éthanol en milieu acide permet d’ouvrir l’époxyde. Ce dernier étant dissymétrique,
l’attaque se fera préférentiellement sur l’atome de carbone de l’époxyde le moins substitué
(donc celui de gauche). L’ouverture permet de former une fonction alcool et une fonction
étheroxyde en position anti l’une par rapport à l’autre sachant que l’attaque se fait du côté
opposé à la fonction époxyde. Le produit obtenu est donc :
UE 1 • Corrigés 215

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


3. Biochimie

Corrigés
Glucides
118 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑
✘ e.
Le glucose est un aldo-hexose qui, sous forme pyranique, possède un carbone asymétrique
de plus par rapport à la forme linéaire (le carbone anomérique).
Dans la cellulose, les molécules de glucose sont reliées par des liaisons β1-4.

119 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
Des énantiomères sont des st éréoisomères pour lesquels la configuration de tous les C asymétriques
est inversée (ils sont images l’un de l’autre dans un miroir).
Pour les oses, il s’agira du même sucre en configuration D ou L.
Dans le cas des sucres (1) et (2), leur configuration différente (cyclique et linéaire) fait qu’ils
ne sont pas images donc non énantiomères.
Deux épimères ne se distinguent que par la configuration d’un carbone asymétrique (hors
carbone anomérique).
Les sucres (3) et (4) sont diastéréoisomères mais pas epim
´ ères.
(3) est le α-D-mannopyranose, absent du lactose (β-D-galactopyranosyl-(1→4)-D-glucopyranose).
(4) est le β L-glucopyranose. Ces deux sucres ne présentent pas la m ême configuration du car-
bone anomérique mais ils ne sont pas anomères pour autant. Il faudrait pour cela que (3) et
(4) soient les mêmes sucres.

120 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑ e.
L’amidon est le polyoside végétal le plus abondant et constitue la source principale de glu-
cides chez l’homme.
Il est composé de 2 polyholosides : l’amylose et l’amylopectine, polymeres` de glucose.
Après hydrolyse parune alpha-amylase, on peut obtenir un mélange de maltose (deux glu-
coses lies
´ en α1-4), maltotriose (trois glucoses li és en α1-4) et d’α-dextrine (deux glucoses
liés en α1-6).

121 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
Glucose et fructose sont des isomères de constitution : ils ont la même formule chimique,
ainsi que le même poids moléculaire.
Le glucose est un aldose tandis que le fructose est un cétose. Ce dernier possède donc un
carbone asymétrique en moins.

122 ❑ a. ❑ b. ❑ c. ❑ d. ❑ e.
Le glucose est un sucre comprenant 5 fonctions alcool et un groupement aldéhydique.
Le saccharose est un disaccharide non réducteur (les 2 C anom ériques sont liés par une liai-
son osidique).
L’isoamylose correspond à la partie ramifiée de l’amidon avec des liaisons oside-ose alpha-1,
4 et alpha-1, 6.

123 ❑
✘a. ❑ b. ❑c.
✘ ❑ d. ❑e.

L’amidon forme des micelles dans l’eau à température ambiante.
216 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Par chauffage, les liaisons faibles comme les liaisons hydrogènes sont rompues.

124 ❑ a. ❑ b. ❑ c. ❑ d. ❑ e.
Le mannose est un aldo-hexose. Si X represente ´ bien le D-mannose ( épimère en C2 du D-
glucose), la molécule Y est une forme anomère β (le OH port é par le carbone anomérique et
le CH2OH pointent dans la même direction) d’u autre sucre.
Le mannose présente un groupement OH porté par le C2 dirigé vers le haut (ce qui est bien le
cas), un C3 vers le haut (il est ici vers le bas), un C4 vers le bas (il est ici vers le haut). C’est
donc un diastér éoisomère du mannose.

125 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑ e.
Le mannose et le galactose sont respectivement les épim ères en C2 et C4 du glucose.

126 ❑ a. ❑ b. ❑ c. ❑ d. ❑ e.
Le saccharose correspond a` un glucose lié à un fructose par une liaison a1-β2.
Le lactose correspond à un galactose lié à un glucose par une liaison β1-4. Le galactose est
un épim ère du glucose.
Le glycogène est un polyholoside de glucose.

127 ❑ a. ❑b.
✘ ❑c.
✘ ❑ d. ❑e.

• La proposition a. est fausse. Une glycoprotéine est une protéine dont le premier motif glu-
cidique est fixé de façon covalente à la chaine polypeptidique.
• La proposition b. est exacte. Les lectines sont des glycoprotéines capables d’interagir
spécifiquement avec des saccharides par liaisons non covalentes.
• La proposition c. est exacte. Les protéines membranaires ne sont que pour partie des gly-
coprotéines.
• La proposition d. est fausse. Dans la majorité des cas, les liaisons se font par leur extrémité
réductrice.
• La proposition e. est exacte. La reconnaissance a lieu par les lectines.

128 ❑
✘b. ❑ c. ❑ d. ❑ e.
La cellulose est une molécule en fibrilles, c’est une structure linéaire, étiree
´ avec des liaisons
hydrogènes intra et inter-chaines.
L’acide hyaluronique est un glycosaminoglycane, donc hydrophile.
La digestion de l’amidon nécessite l’action d’α-amylases (hydrolysent les liaisons α1-4 in-
ternes), de l’α-dextrine (coupe les liaisons a1-6) et de la maltase (hydrolyse du maltose et du
maltotriose).

129 ❑
✘a. ❑ b. ❑
✘ c. ❑ d. ❑
✘ e.
Au sein de l’amidon, les molécules de glucose sont reliées entre elles par des liaisons α1-4
(chaı̂ne principale). C’est cet amidon qui est source principale de glucides alimentaires.

130 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
La molécule (1), le D-mannose, a une conformation 4C1 en chaise qui est la conformation
la plus stable. Le carbone anomerique
´ est en configuration b, comme pour la mol écule (2).
L’énantiomère du L-ribose est le D-ribose.
La molécule (2) ne correspond pas à ce sucre car le groupement OH porté par le carbone 3
UE 1 • Corrigés 217

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


pointe vers le haut alors qu’il devrait pointer vers le bas dans le cas du ribose.

Corrigés
131 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
Le saccharose représent é ici est un disaccharide non réducteur qui peut être hydrolysé au ni-
veau de l’intestin par une α1 glucosidase ou une β2 fructosidase.
La chitine est constituée de résidus de N-acétylglucosamines liés par des liaisons β 1-4.

132 ❑
✘a. ❑ b. ❑ c. ❑d.
✘ ❑ e.
Le sucre représenté est le β-D-galactopyranose.
C’est un épimère du glucose en C4.
La substitution d’une fonction hydroxyle par une amine permet donc d’obtenir une galacto-
samine.
Le glycogène est un polymère de glucose.

133 ❑ a. ❑b.
✘ ❑ c. ❑d.
✘ ❑ e.
• La proposition a. est fausse. Elle serait vraie s’il s’agissait des tissus v égétaux.
• La proposition b. est exacte. Un polymère ramifié diffère de l’amylose.
• La proposition c. est fausse. Les molécules de glucose du glycogene ` sont li ées par des liai-
sons glycososidique α1 → 4.
• La proposition d. est vraie. Nous ne sommes pas des escargots.
• La proposition e. est fausse. Une molécule de glucose ne possède qu’une seule extrémité
réductrice.

134 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
La mutarotation correspond à l’interconversion α/β du carbone anom érique.
La chitine est un polymère de N-acétylglucosamine.
Le tréhalose est un disaccharide non réducteur composé de deux glucoses liés entre eux par
une liaison α1-a1.
Le maltose correspond à 2 glucoses reliés par une liaison α1-4 tandis que dans la cellulose,
les glucoses sont associés par des liaisons α1-4.

135 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑ e.
L’oligosaccharide représenté est un polymère de glucose unis par des liaisons α1-4.
Il possède une extrémité anomérique libre, il est donc réducteur.
La configuration des glucoses est une configuration 4C1 chaise. Ce pourrait être un produit
de dégradation de l’amidon mais non de la cellulose qui contient des glucoses unis par des
liaisons β1-4.

136 ❑ a. ❑ b. ❑
✘ c. ❑
✘ d. ❑ e.
Le raffinose est un oside non réducteur (  -oside  = non r éducteur), toutes les fonctions
réductrices étant engagées dans des liaisons osidiques.
Après hydrolyse par une β-fructosidase, on obtient du α-D-galactopyranosyl-(1-6)-α-D-
glucopyranose (le lactose est le β D-galactopyranosyl (1-4) D-glucopyranose).
Après hydrolyse par une α-galactosidase, on obtient du α-D-glucopyranosyl-(1-2)-β-D-
fructofuranoside (donc du saccharose).
Après perméthylation (m éthylation de tous les carbones d’un ose) puis hydrolyse acide (les
218 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


carbones anomériques ne sont pas méthylés), on obtientra entre autres du 2, 3, 4, 6 tétra-O-
méthyl-D-galactopyranose et du 1, 3, 4, 6 tétra-O-méthyl D- fructofuranose.

137 ❑ a. ❑
✘ b. ❑
✘ c. ❑ d. ❑ e.
Les hétérosides correspondent à l’association d’un ose ( glycone  ) et d’une substance non
glucidique ( aglycone  ou g énine).
La partie aglycone des tanins correspond aux phénols, à l’acide cyanhydrique pour l’amyg-
daline.

Acides aminés
138 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
Les formules développées sont :

139 ❑
✘a. ❑
✘b. ❑ c. ❑ d. ❑
✘ e.
• La proposition c. est fausse. La phénylalanine est hydrophobe.
• La proposition d. est fausse. La sérine est hydrophile.
• La proposition e. est fausse. La lysine est un acide amin é dibasique puisqu’elle contient
deux groupements NH 2.

140 ❑ a. ❑
✘ b. ❑
✘ c. ❑ d. ❑
✘ e.
• La proposition a. est fausse. La phénylalanine possède un noyau benzénique.
• La proposition c. est exacte. L’histidine possede
` un noyau imidazole.
• La proposition d. est fausse. La tyrosine possède un noyau phénol.

141 ❑
✘a. ❑
✘b. ❑
✘ c. ❑
✘d. ❑
✘ e.
Les acides aminés en solution sont incolores.
La leucine est un acide aminé essentiel.
La glycine est un acide aminé dépourvu de carbone asymétrique car sa chaı̂ne latérale est un
UE 1 • Corrigés 219

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


atome d’hydrogène.

Corrigés
Ces deux acides aminés sont des acides amin és aliphatiques, comme le sont également la
valine, l’alanine et l’isoleucine.
La lysine possède bien deux groupement NH2 : le premier porté par le carbone alpha et le
second par la chaine latérale.

142 ❑ a. ❑b.
✘ ❑c.
✘ ❑ d. ❑e.

Une résine échangeuse de cations retiendra les acides aminés chargés positivement. Les
acides aspartiques et glutamiques seront chargés négativement à pH6. L’arginine et la ly-
sine seront chargés positivement donc retenus.
Le cas de l’histidine est particulier. Son pI est égal à 7, 5, à pH 6 l’histidine sera donc charg ée
positivement. Attention car à pH physiologique, cet acide aminé pr ésente une charge nette
nulle.

143 ❑ a. ❑ b. ❑ c. ❑
✘ d. ❑
✘ e.
La glycine est le seul acide aminé de possédant pas de carbone asymétrique par la pr ésence
d’uns simple hydrogène en chaine latérale.
Cela en fait egalement
´ le plus petit acide aminé protéinogène, ou acide alpha aminé.
En tant qu’acide aminé aromatique, le tryptophane absorbe la lumi ère à 280 nm. L’isoleucine
est un acide aminé essentiel.

144 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑ e.
Les chaı̂nes latérales de la valine, de la leucine et de l’isoleucine sont effectivement non ioni-
sables.
Cependant, les groupements carboxyliques et aminés le sont. Ce sont les arginines qui peuvent
être N-glycosylées au moment de l’étape de traduction.
Les s érines peuvent subir des modifications post-traductionnelles telles qu’une phosphoryla-
tion.
Dans les protéines, les acides amin és en surface (boucles) sont des acides aminés plutôt hy-
drophiles (interaction avec le solvant).
Les hydrophobes se trouvent au cœur de la protéine.

145 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑e.

Malgré la présence de soufre, de par sa position dans la chaine latérale, la méthionine est un
acide aminé apolaire et cet acide aminé ne peut pas établir de pont disulfure.
Comme tous les acides aminés (sauf glycine), le carbone α de la m éthionine est asym étrique.

146 ❑
✘a. ❑
✘b. ❑ c. ❑ d. ❑e.

Le carbone alpha est asymetrique,
´ on pourra donc bien distinguer deux isomères L et D.
Les acides aminés sont des mol écules amphotères, capables de se comporter comme un acide
ou comme une base faible en fonction du pH.
Ils comportent tous au moins deux groupements ionisables : carboxylique et aminé.

147 ❑
✘a. ❑
✘b. ❑c.
✘ ❑
✘d. ❑ e.
La formule développée de l’acétylcholine est :
220 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition b. est exacte pour le cœur.
• La proposition c. est exacte. Il résulte de l’estérification entre l’acide acetique
´ et la choline.
• La proposition d. est exacte. Il est produit dans les terminaison nerveuses cholinergiques,
anoxales du cerveau.
• La proposition e. est fausse. Il agit dans le systeme` nerveux parasympathique.

148 ❑ a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
Les plateaux sur ce type de courbe de titration correspondent aux pKa de la molécule.
Dans cet exemple, le pK1 (point 1, autour de 2) est celui du groupement alpha carboxylique,
le pK2 (point 3, autour de 4) est celui la chaine latérale (groupement carboxylique) et le pK3
(point 5, autour de 9) est celui de la fonction amine.
Le pI se lit au niveau du point 2. Ainsi, on peut en déduire que l’acide glutamique est une
acide aminé chargé négativement à pH physiologique (pH7>pI).
Au niveau du point 5, les deux fonctions carboxyliques sont ionisées négativement (soit deux
charges négatives).
Attention, il s’agit ici de charges brutes et non de charges nettes car nous sommes ici au pKa
de la fonction amine. Elle se trouve donc à moitié sous forme NH+3 , à moitié sous forme NH2 .

149 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑e.

La glycine est la seule à être dépourvue de carbone asymétrique.
À partir de deux acides aminés, on peut synth étiser 22 peptides différents (GA, AG, GG et
AA).
À pH = 6, 1, l’alanine est à son point isoélectrique donc sous forme zwiterrion. Le pKa2=9.7
est celui de la fonction amine.
À pH = 11, nous sommes supérieurs au point isoélectrique de la glycine (pI = (9, 7 + 2, 4)/2 =
6). La glycine est donc majoritairement anionique.

150 ❑
✘a. ❑ b. ❑ c. ❑d.
✘ ❑e.

La thréonine est un acide aminé hydroxyle.´
Les hormones thyroı̈diennes, thyroxine (T4) et triiodothyronine (T3), sont des hormones pro-
duites à partir d’iode et de la tyrosine.
La thyroglobuline apporte les tyrosines.
Le glutathion est un tripeptide constitué d’acide glutamique, de cystéine et de glycine.
La phénylcétonurie est une maladie liée à l’absence de phénylalanine hydroxylase.

151 ❑
✘a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
Du fait de l’atome de C ∗2 (porteur des groupements fonctionnels −NH2 et −COOH) sp3
asymétrique, tous les acides aminés (sauf la glycine) possèdent deux stéréoisomères.
À pH acide, les acides aminés sont sous forme de cations. Ce sont des molécules hydrophiles
grâce aux groupements carboxylique et amin é.

152 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
• La proposition a. est fausse. La proline est synthétis ée à partir du glutamate.
UE 1 • Corrigés 221

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition b. est exacte. Par hydrolyse de la tyrosine, on obtient la dihydroxyphénylalanine.

Corrigés
• La proposition c. est fausse. Le PAPS (Phosphoadénosine phosphosulfate) donne du sulfate
à diff érents composés. La metionine
´ donne des chaı̂nes carbonées (acétylation).
• La proposition d. est fausse. La thréonine n’est pas ramifi ée. C’est pourtant un acide aminé
cetogène
´ et glucoformateur.
La valine est ramifiée, mais n’est pas glucoformateur.
• La proposition e. est fausse. La m élatonine est synthétisée à partir du tryptophane.

153 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
La proposition 5 est fausse. Le tryptophane ne repr ésente que 1 % de la constitution des
protéines.

154 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑ e.
• La proposition 2 est fausse. La biosynth èse de la mélanine se fait à partir de la tyrosine.
• La proposition 3 est fausse. Il s’agit de la tyrosine.

155 ❑
✘a. ❑
✘b. ❑
✘ c. ❑
✘d. ❑ e.
• La proposition b. est exacte. Le pKb est égal à 12, 5. L’arginine est le plus basique des
α-acides aminés.
• La proposition d. est exacte. La formule brute commune est : C6H 13 O 2.

156 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑e.

L’acide aminé ici représenté est le L-tryptophane (NH3+ à gauche). Tous les L-acides aminés
(sauf la cysteine)
´ ont une configuration 2S.
Seules la thréonine et l’isoleucine ont deux carbones asymétriques.
Le tryptophane présente un maximum d’absorption à 280 nm conféré par son noyau aroma-
tique.
L’histamine est obtenue par décarboxylation de l’histidine.
Les acides aminés favorables à une structure secondaire en hélice a sont les acides aminés
volumineux, non ou peu polaires : L, F, W.

157 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑ e.
Pour répondre à ce type de question, la méthodologie consiste à numéroter les acides aminés
de la séquence proposée et de reporter leur(s) pKa(s) :
acide aminé V D Y K H G
Ordre 1 2 3 4 5 6
pKa 9 (pKa2 4 11 11 6 2
de NH +3 ) (pKr) (pKr) (pKr) (pKr) (pKa 1 de COOH)
On barre ensuite les acides amines
´ cit és dans l’énoncé : ici 1, 3, 4 et 5 :
acide aminé V D Y K H G
Ordre 1 2 3 4 5 6
pKa 9 (pKa2 4 11 11 6 2
de NH+3 ) (pKr) (pKr) (pKr) (pKr) (pKa1 de COOH)
222 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


La zone de pH attendue correspond à l’intervalle entre le plus petit pKa barré (9, 11 ou 6 = il
s’agit de 6) et le plus grand pKa non barré (2 ou 4 ? on conserve 4).
Dans notre exemple, l’intervalle recherch é est donc l’intervalle compris entre 4 et 6. Cette
proposition n’est pas proposée, on retiendra 5 et 6 qui est un intervalle plus restreint.
Attention, l’inverse n’est pas vrai : l’intervalle 3 à 7 par exemple ne conviendrait pas.

Lipides
158 ❑ a. ❑
✘ b. ❑
✘ c. ❑
✘d. ❑
✘ e.
• La proposition a. est fausse. Les HDL transportent le cholestérol des tissus vers le foie
(transport rétrograde).
• La proposition b. est exacte. La densité des chylomicrons est inférieure à 0, 99 ; celle des
LDL est comprise entre 1, 019 et 1, 063.
• La proposition d. est exacte. Dans le sang humain, le cholestérol se répartit : 1/3 sous forme
libre, 2/3 sous forme estérifiee.
´
• La proposition e. est exacte. Le bon cholest érol est celui qui est oxydé (estérifié).

159 ❑
✘a. ❑ b. ❑
✘ c. ❑
✘d. ❑
✘ e.
• La proposition a. est exacte. L’accumulation de sphingolipides dans le système nerveux est
lié à un d éficit enzymatique.
• La proposition d. est exacte. On utilise une analyse de la β-glucosidose dans les leucocytes,
ou en cultures fibroblastes.
• La proposition e. est exacte. La maladie de Gaucher (1854-1918) est une maladie de sur-
charge lysosomale. Elle est caractérisée par une accumulation excessive des cérébrosides, qui
sont des glycosphingolipides.

160 ❑ a. ❑ b. ❑c.
✘ ❑d.
✘ ❑e.

• La proposition a. est fausse. Le cœur hydrophobe est forme´ par les lipides entourés de
protéines.
• La proposition b. est fausse. Une lipoprotéine contient une surface amphipathique (phos-
pholipides, cholestérol libre . . .).
• Les propositions c. et e. sont exactes. Une lipoprotéine contient du cholest érol non estérifi é
et des phospholipides dans la monocouche périphérique.
• La proposition d. est exacte. On trouve du cholest érol estérifié dans le cœur hydrophobe.

161 ❑ a. ❑ b. ❑c.
✘ ❑d.
✘ ❑e.

• La proposition a. est fausse. La sphingomyéline est un constituant majeur de la gaine de
myéline des nerfs, de la cornée, du cerveau.
• La proposition b. est fausse. La sphingomyéline est un phospholipide membranaire.
• La proposition c. est exacte. à partir d’un céramide et d’une phosphatidylcholine, on obtient
de la sphingomyéline et des DAG.
• La proposition e. est exacte. Par catabolisme, la sphingomyélinase dégrade la sphingomyé-
line en céramides, phosphotylcholine.

162 ❑
✘a. ❑
✘b. ❑
✘ c. ❑ d. ❑ e.
• La proposition a. est exacte. delta 5 crée une insaturation en (n-15) sur les acides gras en
20 atomes de carbone.
• La proposition b. est exacte. delta 6 crée une insaturation en (n-12) sur les acides gras en
18 atomes de carbone.
UE 1 • Corrigés 223

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition c. est exacte. delta 9 assure la conversion de l’acide palmitique en acide
palmitoléı̈que et l’acide stéorique en acide oléı̈que.

Corrigés
• Les propositions d. et e. sont fausses. delta 12 et delta 15 sont pr ésents chez les végétaux.
delta 12 assure la conversion de l’acide oléı̈que en acide linéléı̈que et delta 15 de l’acide
linéléı̈que en acide dilin élé ı̈que.

163 ❑
✘a. ❑
✘b. ❑ c. ❑ d. ❑e.
✘  
La formule de l’acide eicosano¨ıque est : CH3 − (CH2 18-COOH.
La formule de l’acide arachidique est : C20 H40 O2.
La formule de l’acide oléı̈que est : C 18 H34 O 2.
La formule de l’acide linoléı̈que est : C18 H32O 2.
La formule de l’acide arachidonique est : C20 H32 O 2.

164 ❑ a. ❑
✘ b. ❑
✘ c. ❑
✘d. ❑
✘ e.
Les leucotriènes appartiennent à la famille des eicosanoı̈des.
• La proposition a. est fausse. La chaı̂ne carbonée est linéaire.
• La proposition b. est exacte. Il existe trois doubles liaisons conjuguées C6,8,10 .
• La proposition c. est exacte. Ils sont formés sous l’action de la 5-lipoxygénase sur l’acide
arachidonique.
• La proposition d. est exacte. Ils recrutent d’autres cellules pro-inflammatoires.
• La proposition e. est exacte. Ils sont biosynth étisés à partir de l’acide arachidonique dans
les mastocytes.

165 ❑
✘a. ❑
✘b. ❑
✘ c. ❑
✘d. ❑ e.
• La proposition a. est exacte. Les chylomicrons et les VLDL comportent 88 % de tri-
glycérides.
• La proposition c. est exacte.

• La proposition d. est exacte. Les triglycérides sont hydrolyses´ par la lipase hormonosen-
sible, enzyme des tissus adipeux, qui hydrolyse les triglycérides de r éserve.
• La proposition e. est fausse. Les triglycérides sont neutres.

166 ❑
✘a. ❑
✘b. ❑ c. ❑
✘d. ❑ e.
• La proposition a. est exacte. Le cholest érol est une molécule amphipathique, c’est-à-dire
qu’elle possede
` à la fois un groupe hydrophile et un groupe hydrophobe.
• La proposition c. est fausse. Les acides biliaires sont libéres
´ dans le tube digestif.
• La proposition d. est exacte. Le cholestérol limite le mouvement des phospholipides.
• La proposition e. est fausse. La formule de la testostérone est C19 H28 O 2 .

167 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘ e.
Le cholestérol est un stérol à 27 C.
Il possède en C3 une fonction alcool pouvant être est érifié.
Il est pr ésent dans la membrane cellulaire eucaryote sous forme non estérifié où il diminue la
224 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


fluidité des membranes.

168 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘ e.
L’oxydation de l’acide arachidonique C20 : 4∆ 5,8,11,14 conduit à la synthèse des eicosanoı̈des
(leucotriènes et prostaglandines).

169 ❑ a. ❑
✘ b. ❑ c. ❑
✘ d. ❑
✘ e.
• La proposition a. est exacte. La formule du cholest érol est C27 H 46 O. Le groupement hy-
droxyle est en position 3.

• La proposition b. est exacte. C’est la vitamine D3 qui intervient dans la calcification des os.
• La proposition c. est fausse. L’oestradiol est un dérivé naturel du métabolisme du cho-
lestérol. Le groupement −CH3 est sur le C 13 .
• La proposition d. est exacte. L’acide cholique possède 3 groupements −OH sur les C3,8,12 .
sa formule est C24 H 40O 5.

170 ❑ a. ❑
✘ b. ❑
✘ c. ❑ d. ❑ e.
• La proposition a. est fausse. C’est un acide gras polyinsatur é a` cha ı̂ne linéaire.
• La proposition b. est exacte. Il a une double liaison sur le C6 à partir du CH3 terminal.
• La proposition c. est exacte. Il a des doubles liaisons s éparées par deux simples liaisons.

• La proposition d. est fausse. Son rôle n’est pas essentiel chez l’adulte. Mais il devient in-
dispensable chez les personnes âgées.
• La proposition e. est fausse. C’est le précurseur du groupe des oméga-6.

171 ❑
✘a. ❑ b. ❑ c. ❑d.
✘ ❑e.

• La proposition a. est exacte. Les chylomicrons contiennent de 85 à 95 % de triglycérides.
• La proposition b. est fausse. Ils acquièrent l’apo C provenant des HDL circulants.
• La proposition c. est fausse. Ils contiennent 1 % de cholestérol estérifi é.
• La proposition d. peut être considér ée comme exacte. Ils contiennent 8 % de phospholi-
pides.
• La proposition e. est exacte. L’apolipoprot éine B48 est située à la surface des chylomicrons.

172 ❑
✘a. ❑
✘b. ❑c.
✘ ❑
✘d. ❑ e.
• La proposition a. est exacte. Ce sont des glycosphingolipides contenant au moins deux
UE 1 • Corrigés 225

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


résidu osidiques.

Corrigés
• La proposition e. est fausse. Ils sont synthétisés à partir des c éramides :
céramide + glucose + galactose −→ globoside.

173 ❑
✘a. ❑
✘b. ❑c.
✘ ❑
✘d. ❑e.

• La proposition a. est exacte. L’hypertriglycéridémie favorise la survenue des maladies
cardio-vasculaires.
• La proposition b. est exacte. L’oxydation d’un gramme de glycogène fournit 4, 2 kcal, soit
la moitié de ce que fournit un gramme de triglyc´
eride.
• La proposition c. est exacte. Les molécules sont hydrophobes car elles sont apolaires.

174 ❑
✘a. ❑
✘b. ❑ c. ❑
✘d. ❑ e.
• La proposition a. est exacte. Ce sont des domaines particuliers de la membrane plasmique
correspondant à l’assemblage de glycosphingolipides et de cholestérol.
• La proposition b. est exacte. Ces microdomaines jouent un rôle important dans le fonction-
nement des cellules, surtout au niveau de la transduction des signaux par récepteur interposé.
• La proposition c. est fausse.

175 ❑ a. ❑b.
✘ ❑c.
✘ ❑ d. ❑e.

Le cholestérol fait partie de la famille des stérols.
• La proposition a. est fausse. Le cholest érol est un composant majeur des membranes cellu-
laires animales.
• La proposition b. est exacte. Le cholest érol a quatre cycles carbonés (noyau cyclo-pentano-
phénanthrénique).
• La proposition c. est exacte. Il est présent sous forme de stérides (cholestérol estérifié).
• La proposition d. est fausse. Il provient des cellules du foie et de l’intestin principalement.
• La proposition e. est exacte. Les LDL, lipoprotéines à basse densité, transportent le cho-
lestérol des lieux de sécrétion vers les cellules de l’organisme.

176 ❑ a. ❑ b. ❑ c. ❑d.
✘ ❑ e.
L’acide linoléique, ou acide octadécadiénoı̈que ou C18 : 2∆9,12 , appartient à la famille des
ω-6.
Le point de fusion diminuant avec le nombre d’insaturation, le sien est bien inférieur à celui
de l’acide stearique
´ (C18 :0).
L’acide palmitique possède moins de carbone (C16 :0), l’acide linoléique n’est donc pas son
précurseur.

177 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
L’acide palmitique est bien appelé acide hexad écano¨ıque mais ne comporte que 16 carbones
(comme son nom chimique l’indique).

178 ❑
✘a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
Les sphingomyélines sont constituées d’un céramide (association d’une sphingosine et d’un
acide gras), d’un phosphate et de choline.
Les phosphatidylcholines, appartenant aux glycérophospholipides, sont constituées de glycérol,
estérifi é par deux acides gras à longue chaine et d’une choline liée au glycérol par un acide
phosphorique.
Les céramides issus des sphingomyélines peuvent servir de médiateurs chimiques, de m ême
226 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


que l’acide arachidonique souvent en position 2 du glycérol des glycérophospholipides.

179 ❑
✘a. ❑
✘b. ❑ c. ❑ d. ❑
✘ e.
Comme tout acide gras, l’acide arachidonique, C20 : 4∆ 5,8,11,14 est une mol écule amphiphile.
Il appartient à la famille des ω-6 et peut être produit par action de la phospholipase A2.
Les prostaglandines sont synthétisées suite à l’action de la cyclooxygénase sur l’acide ara-
chidonique.

180 ❑ a. ❑ b. ❑
✘ c. ❑
✘ d. ❑
✘ e.
L’acide palmitique est un acide gras en C16, celui qui se trouve sur la ligne 1 en possède 18
(acide stéarique).
L’acide linoléique possède deux insaturations, il s’agit sur la ligne 2 de l’acide oléique (ω-9).
Le résidu polaire lié au glycérol par un acide phosphorique en 3 est la choline.

181 ❑
✘a. ❑ b. ❑ c. ❑d.
✘ ❑e.

L’acide  c -linolénique ou acide tout-cis-∆ 6,9,12 octadécatriénoı̈que (C18 :3) est un acide gras
insaturé ω-6 à ne pas confondre avec l’acide α-linolénique, qui est un ω-3.
Il est précurseur de l’acide dihomo- ?-linolénique, qui mène à son tour à l’acide arachido-
nique.

182 ❑
✘a. ❑
✘b. ❑ c. ❑ d. ❑
✘ e.
• La proposition a. est exacte. La phospholipase C intervient sur la fonction ester liant le
glycérol et le phosphate.
• La proposition b. est exacte. C’est la structure de base des glycérophospholipides.
• La proposition c. est fausse. Les cérébrosides sont des glycolipides neutres. Ils comportent
une fonction acide pA-H 3PO 4 et une fonction basique pA-1’AA alcool.
• La proposition d. est fausse. Les céramides sont composés d’une base à longue chaı̂ne
(sphingosine . . . ) et d’un acide gras lié par une liaison amide à l’azote de base.

183 ❑ a. ❑ b. ❑c.
✘ ❑ d. ❑ e.
Les mol écules des lécithines et des sphingomy élines ont pour partie commune :

qui est la molécule de phosphorylcholine.

184 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑
✘ e.
• La proposition a. est fausse. La lipoprotéine lipase est synth étisée par les cellules muscu-
laires et adipeuses.
• La proposition b. est fausse. Elle se fixe sur les cellules endothéliales des capillaires.
• La proposition c. est exacte. Elle possède le même triade catalytique que les protéases à
sérine, soit sérine-histidine-un acide carboxylique.
• La proposition d. est fausse. L’hydrolyse des triglycérides par la lipoprotéine lipase donne
2 acides gras libres et un monoglycéride, le monoacylglycérol.
UE 1 • Corrigés 227

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition e. est exacte. Elle permet l’hydrolyse des triglyc érides des lipoprotéines
plasmatiques, ce qui donne des chylomicrons et du VLDL.

Corrigés
185 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑ e.
L’éthanolamine se retrouve préférentiellement au sein des phospholipides pr ésents sur le
feuillet interne des membranes cellulaires au même titre que l’inositol ou la sérine.
Les phosphatidyl-cholines libèrent de la choline sous l’action de la phospholipase D au ni-
veau cérébral (la phospholipase C libérerait de la phosphocholine).
L’inositol 1, 4, 5-triphosphate est un médiateur d’activation cellulaire.
Un céramide correspond à l’association entre une sphingosine et un acide gras lié par une
liaison amide.

186 ❑ a. ❑b.
✘ ❑ c. ❑d.
✘ ❑e.

Si la synthèse des acides biliaires est bien initee
´ au niveau h épatique, elle se poursuit au ni-
veau du tube digestif, en particulier grâce à l’action de la flore bactérienne commensale.
Le cholestérol est le précurseur des hormones steroı̈diennes
´ (progest érone, androgènes, oes-
trogènes) produites par différents organes et aussi de la vitamine D3 au rôle essentiel dans le
métabolisme phosphocalcique.
La quantité de cholestérol nécessaire pour la synthèse des hormones stéroı̈diennes est presque
n égligeable devant celle nécessaire pour la production des sels biliaires. Ces derniers per-
mettent une assimilation plus rapide des triglycérides alimentaires.

187 ❑
✘a. ❑ b. ❑ c. ❑ d. ❑e.

Les triglycérides ou triacylglycérols correspondent à une molécule de L-glycérol estérifiée
par 3 acides gras.
Ils ont une fonction de stockage énergétique au niveau des adipocytes.
Ils peuvent être aussi synthétisés au niveau des entérocytes pour incorporation dans les chy-
lomicrons après dégradation par des lipases et absorption intestinale.
Par leur nature hautement hydrophobe, ils sont totalement absents des membranes cellulaires
mais sont solubles dans les solvants organiques.
Peptides et protéines
188 ❑
✘a. ❑ b. ❑c.
✘ ❑
✘d. ❑e.

• La proposition a. est exacte. Quatre grands types d’interaction interviennent dans le replie-
ment de la chaı̂ne d’acides amines ´ : effet hydrophobe, liaisons ioniques, liaisons hydrog ène,
ponts disulfure.
• La proposition b. est fausse. On a bien une structure figée pour les protéines globulaires.
Une protéine fibreuse s’étire en longueur.
• La proposition d. est exacte. Dans le cas des protéines globulaires, les r ésidus polaires sont
en contact du solvant, les r ésidus hydrophobes sont tournés vers l’int érieur.
Pour les protéines solubles, le cœur hydrophobe est au centre de la structure tertiaire, les
groupes polaires restent en surface.
• La proposition e. est exacte. Elle est hydrophobe et insoluble. Cette protéine fibreuse est
ins érée dans les lipides. Des r ésidus polaires peuvent se trouver à la surface en contact avec
les milieux hydrophobes.

189 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
L’hélice alpha est une structure secondaire assez courante, comprenant 3, 6 acides aminés par
tour.
228 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


La myoglobine, protéine globulaire, est riche en hélices alpha.
Les chaı̂nes latérales des acides aminés constituant l’hélice sont rejetées vers l’extérieur.
L’hélice est stabilisee
´ par des liaisons H intracat énaires.
Au contraire, la proline (et la valine, l’isoleucine, la thréonine ou les acides aminés de charge
identique contigus) sont défavorables à l’établissement de cette structure.

190 ❑ a. ❑ b. ❑ c. ❑
✘ d. ❑
✘ e.
• La proposition a. est fausse. Le glutathion est un tripeptide, formé par la condensation
d’acide glutamique, de cystéine et de glycine.
• La proposition b. est fausse. La liaison entre l’acide glutamique et la cystéine est pseudo-
peptidique.
• La proposition c. est fausse. La liaison entre les deux derniers acides amines
´ est peptidique.

191 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
• La proposition a. est fausse. la ghréline est un peptide orexigène. Elle stimule l’appétit.
• La proposition b. est exacte. Elle joue un rôle majeur dans le contr ôle tensionnel.
• La proposition c. est fausse. Le glucagon a un très faible effet sur le tissu adipeux.
• La proposition e. est fausse. L’insuline est secr étée par le pancréas endocrine.

192 ❑
✘a. ❑
✘b. ❑ c. ❑
✘d. ❑ e.
• La proposition a. est exacte. Ce sont des glycoprotéines à majorité membranaire.
• La proposition b. est exacte. Elles possèdent deux chaı̂nes lourdes H et deux chaı̂nes lég ères
L (ponts disulfures).
• La proposition c. est fausse. La présence de ponts disulfures témoigne de la pr ésence de
cystéine.
• La proposition e. est fausse. Il faudrait enlever IgH de la liste.

193 ❑
✘a. ❑ b. ❑ c. ❑
✘ d. ❑ e.
• La proposition b. est fausse. Il s’agit de liaisons hydrogènes.
• La proposition c. est fausse. Les acides aminés stabilisant l’hélice α sont : la leucine, la
phénylalanine et le tryptophane grâce à leurs interactions hydrophobes.
• La proposition e. est fausse. Les coudes γ résultent de la pr ésence d’une liaison hydrogène
entre le groupe −CO d’un résidu i et le groupement −NH d’un r ésidu i + 2.

194 ❑ a. ❑
✘ b. ❑ c. ❑
✘ d. ❑ e.
• La proposition a. est fausse. L’hélice α caract érise la structure secondaire des protéines.
• La proposition b. est exacte. La proline est un  briseur de chaˆıne .
• La proposition c. est fausse. C’est le cas des protéines intrinsèquement non structurées.
• La proposition d. est exacte. Ils relient deux structures secondaires cons écutives.
• La proposition e. est fausse. On a en général :
feuillet β - h élice α - feuillet β.

195 ❑
✘a. ❑
✘b. ❑ c. ❑
✘d. ❑ e.
• La proposition a. est exacte. Il existe des ponts disulfures entre les r ésidus de cystéine de
deux sous-unités.
• La proposition b. est exacte. C’est une liaison covalente, donc la plus forte.
• La proposition c. est fausse. Ce sont des résidus soufrés.
UE 1 • Corrigés 229

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


• La proposition d. est exacte. Les ponts disulfures sont oxydés par l’acide performique.

Corrigés
• La proposition e. est fausse. Les protéases enzymes hydrolisent la liaison peptidique.

196 ❑
✘a. ❑
✘b. ❑ c. ❑
✘d. ❑e.

• La proposition b. est exacte. Au niveau des adipocytes, l’insuline stimule la lipoprotéine
lipase.
• La proposition e. est exacte. L’insuline est nécessaire pour la lipogénèse.

197 ❑ a. ❑
✘ b. ❑
✘ c. ❑
✘d. ❑
✘ e.
• La proposition a. est fausse. Il ne comporte que des sous-unités α et β.
• La proposition d. est exacte. Il y a autophosphorylation.

198 ❑ a. ❑b.
✘ ❑ c. ❑d.
✘ ❑ e.
• La proposition a. est fausse. Elle a une structure globulaire.
• La proposition b. est exacte. Il s’agit de la globine.
• La proposition d. est exacte. On a : Hb + 4 O2 −→ Hb(O2 )4 .
• La proposition e. est fausse. La myoglobine transporte de l’oxygène dans le muscle.

199 ❑ a. ❑ b. ❑c.
✘ ❑d.
✘ ❑ e.
• La proposition a. est fausse. L’hématine est un hème oxydé. Elle r ésulte du passage de Fe2+
à Fe 3+ .
• La proposition b. est fausse. Fe( Fe 2+ ) est au centre du noyau porphirinique, composé
tétrapyrrolique.
• La proposition c. est exacte. Le fer est hexacoordinant. Il est lié par 4 liaisons entre les N
des cycle pyrol et 2 liaisons de coordinance libres.

200 ❑ a. ❑ b. ❑ c. ❑ d. ❑
✘ e.
Les protéines prions normale et infectieuse diffèrent par leur structure tertiaire, la forme in-
fectieuse contenant beaucoup plus de feuillets bêta.
Les structures primaires sont quant à elles identiques. Le changement de conformation de la
forme normale vers l’infectieuse est favorisée par cette dernière, on désigne ce phénomène
sous le terme de  conversion auto-propageable  .
Les protéines prions ne sont pas pour autant allostériques (terme se référant aux propriet´ és
cinétiques de certaines enzymes).

201 ❑ a. ❑b.
✘ ❑c.
✘ ❑ d. ❑e.

• La proposition b. est exacte. Il s’agit de l’unité de masse des atomes (u.m.a.).
• La proposition d. est fausse. Il y a désorganisation de la structure spatiale sans ruptures des
liaisons.
• La proposition e. est exacte. Un agent réducteur permet d’ouvrir les ponts disulfures.

202 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑
✘ e.
• La proposition a. est fausse. L’électrophor èse sur gel de polyacrylamide fait intervenir la
charge et le poids moléculaire.
• La proposition b. est exacte. Il existe une spécificité de liaison entre un ligand et une
protéine.
• La proposition c. est fausse. Dans la chromatographie sur r ésine échangeuse d’ions, la force
230 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


de rétention est de nature ionique.
• La proposition d. est fausse. Les protéines sont séparées selon leur taille et leur forme.
• La proposition e. est exacte. Le SDS (Sodium dodecyl sulfate) est un detergent. ´ Dans la
partie séparative du gel, les grosses molécules sont plus frein ées et plus arrêt ées que les pe-
tites.

203 ❑ a. ❑ b. ❑ c. ❑
✘ d. ❑
✘ e.
• La proposition a. est fausse. La solubilité de la proteine
´ (b) est minimale à pH = 4 car on a
alors pH = PI, la charge nette de la protéine est nulle.
• La proposition b. est fausse. On est dans la situation où pH < pI pour la protéine (c) sa
charge nette est positive.
• La proposition c. est fausse. En chromatographie d’exclusion st érique, les grosses molécules
ne rentrent pas dans les billes et donc elles sortent en premier.
Les petites sont piégées, ralenties, elles sortent en dernier. L’ordre est le suivant en 1 la (c)
puis simultanément (a) et (b).
• La proposition d. est vraie. La protéine (c) a une charge nette positive à pH = 8, elle se
fixera à un échangeur de cation (forme anionique).
• La proposition e. est vraie. Le SDS entraˆıne la rupture des liaisons non covalentes, alors
que le β-mercatoéthanol agent réducteur a pour propri eté´ de réduire les ponts disulfure des
protéinesla non cass és par SDS.
SDS dénature les protéines et se fixe dessus avec une densité % à la masse moléculaire. (b)
et (c) ont la même masse 30 kDa : une seule bande donc au total deux bandes.

204 ❑ a. ❑b.
✘ ❑c.
✘ ❑
✘d. ❑ e.
• La proposition a. est fausse. Les VLDL (Very Low Density Lipoprotéine) ont une densité
inférieure à celle des LDL (Low Density Lipoprotéine).
• La proposition b. est vraie. Les VLDL sont synthétis és par le foie. Ils contiennent des tri-
glycérides, du cholestérol et une apoprot eine
´ B100. Leur d égradation donne de IDL . 50%
des IDL perdent leur protéine E et leurs triglycérides pour donner les LDL.
• La proposition c. est vraie. Les LDL sont chargés d’amener le cholest érol vers le stockage.
S’ils sont trop nombreux, le cholestérol va alors se déposer sur les parois des vaisseaux san-
guin, avec risque d’arthérosclérose et d’infarctus. On dit que les LDL transportent le mauvais
cholestérol.
• La proposition d. est vraie. apo B00 est l’apolipoprotéine majoritaire dans les LDL.

205 ❑ a. ❑ b. ❑
✘ c. ❑
✘ d. ❑ e.
• La proposition a. est fausse. L’élution d épend du pHi des protéines. La charge nette de la
protéine est liée à son pHi et au pH de l’éluant.
• La proposition b. est fausse. En ultrafiltration les tamis moléculaires utilisés ont des pores
très petit et ne permettent pas aux grosses protéines de passer. C’est donc uniquement les
petites protéines qui peuvent passer et les grosses sont ralenties.
• La proposition c. est vraie. exclusion = filtration sur gel : les petites mol écules pénètrent
dans les interstices du gel, elles subissent des frottements qui les retardent. Les grosses
molécules migreront plus vite vers le bas de la colonne.
• La proposition d. est vraie. Avec SDS (gel d énaturant) la migration se fait uniquement en
fonction de la masse (plus c’est gros et moins ça migre vite).

• La proposition b. est fausse. En ultrafiltration les tamis moléculaires utilisés ont des pores
très petit et ne permettent pas aux grosses protéines de passer. C’est donc uniquement les
petites protéines qui peuvent passer et les grosses sont ralenties.
UE 1 • Corrigés 231

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


Enzymologie

Corrigés
206 ❑
✘a. ❑ b. ❑ c. ❑
✘ d. ❑
✘ e.
• La proposition a. est exacte. Le catalyseur apparaı̂t dans les produits de réaction. Il n’est
pas consommé.
• La proposition b. est fausse. L’intervention des enzymes conduit a` diminuer l’énergie d’ac-
tivation et à augmenter la vitesse de r éaction.
• La proposition c. est fausse. La r éaction doit etre
ˆ possible sur le plan thermodynamique soit
∆G < 0.

207 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
La constante de Michaelis KM de l’enzyme est égale à la moitié de la vitesse maximale, soit
14, 7
ici = 7, 35 µmole.min−1 = 7, 35 µmole.L−1.
2
208 ❑
✘a. ❑ b. ❑
✘ c. ❑
✘d. ❑
✘ e.
• La proposition b. est fausse. Cette carence conduit à une anémie hypochrome.
• La proposition c. est exacte. la vitamine B2 (riboflavine) est un précurseur du FAD +, en-
zyme de la classe des oxydo-réducteur.
• La proposition d. est exacte. Elle est apportée par la viande, le poisson, le lait, les œufs.

209 ❑
✘a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
• La proposition b. est fausse. Le processus est irréversible.
• La proposition c. est exacte. La chymotrypsine peut accomplir la protéolyse.

210 ❑
✘a. ❑ b. ❑c.
✘ ❑
✘d. ❑ e.
• La proposition b. est fausse. Le modèle a éte´ proposé par Monod, Wyman, Changeux (en
1965).
• La proposition e. est fausse. La proposition correspond à la cinétique enzymatique de Mi-
chaelis.

211 ❑ a. ❑b.
✘ ❑c.
✘ ❑ d. ❑e.

On sait que 1 UI = 1 µmol.min et 1 cat = 1 mol.s−1 , d’où 1 ncat = 0, 06 UI.
−1

• L’activité de A est égale à : 334 ncat = 20 UI. La proposition a. est fausse et b. est exacte.
• La proposition c. est exacte. L’activit é spécifique de l’enzyme A est :
334
= 2, 227 ncat/mg de protéines.
150
• La proposition d. est fausse. L’activité specifique
´ de l’enzyme B est de :
40
= 0, 133 UI/mg de protéines.
300
• La proposition e. est exacte. Ce sont deux molécules diff érentes qui catalysent la même
réaction.

212 ❑ a. ❑ b. ❑
✘ c. ❑ d. ❑ e.
• La proposition 1. est fausse. Jusqu’à la température d’inactivation spécifique, mais avant la
température optimale, elle suit la loi d’Arrhénius.
• La proposition 5. est fausse. Par contre, un inhibiteur réversible non compétitif entraı̂ne une
232 Corrigés • UE 1

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


diminution de Vmax ; l’affinit é et KM ne sont pas modifiés.

213 ❑ a. ❑ b. ❑
✘ c. ❑
✘ d. ❑
✘ e.
• La proposition a. est fausse. Le mot ribozyme est formé à partir de  acide ribonucléique 
et  enzyme  . Les ribozymes sont des ARN (et non des protéines) qui ont une activité cata-
lytique.
• La proposition b. est fausse Une enzyme ne change pas avec la réaction.
• La proposition e. est vraie. Le site actif d’une enzyme est la partie de la protéine qui va être
impliqué intimement dans la réaction catalysée. Il peut être formé de deux sites : le site de
fixation du substrat et le site catalytique qui va agir sur le substrat et lui faire subir la réaction
chimique.

214 ❑
✘a. ❑
✘b. ❑ c. ❑
✘d. ❑e.

• La proposition a. est vraie. v = f ([S ]) est une sigmo¨ıde, c’est-à-dire une courbe en forme
de S.
• La proposition b. est vraie. Un activeur allostérique déplace l’enzyme vers la forme R
(relâchée).
• La proposition c. est fausse. En présence d’effecteurs pour des enzymes allost ériques du
système K, on a : Vmax qui est constante et K1/2 qui varie.
• La proposition d. est vraie. L’activeur favorise sa propre fixation sur la forme R de l’en-
zyme.
• La proposition e. est vraie. L’inhibiteur favorise sa propre fixation sur la forme T de l’en-
zyme.

215 ❑ a. ❑ b. ❑c.
✘ ❑d.
✘ ❑e.

• La proposition a. est fausse. Une enzyme abaisse l’energie´ d’activation d’une r éaction chi-
mique.
• La proposition b. est fausse. Une enzyme n’affecte pas l’équilibre d’une réaction r éversible.
• La proposition c. est vraie. Il y a spécificité de la catalyse enzymatique.
• La proposition d. est vraie. La FAD est tr ès utilisée pour les déshydrogénases.
• La proposition e. est vraie. Elle forme une nouvelle double liaison par soustraction de
groupe.

216 ❑ a. ❑ b. ❑ c. ❑d.
✘ ❑ e.
• La proposition 1. est fausse. La classe 1 regroupe les oxydo-réductases (peroxydases...)
• La proposition 2. est vraie. Les transférases sont des enzymes qui permettent le transfert
d’un radical à une autre molecule.
´
• La proposition 3. est vraie. Les synthétases appartiennent à la classe des ligases.
• La proposition 4. est fausse. Les aminotransférases sont des transférases.
• La proposition 5. est vraie. Les peptidases font partie des hydrolases, qui sont dans la classe
+3 des enzymes.

217 ❑ a. ❑
✘ b. ❑ c. ❑ d. ❑ e.
• La proposition a. est fausse. Le site actif contient de la sérine 195, de l’histidine 57, et de
l’acide aspartique 102. C’est la sérine qui est active.
• La proposition b. est vraie. Le processus se fait par étapes :
➣ acylation, formation du premier intermédiaire tétraédrique ;
➣ formation de l’acyl-enzyme ;
UE 1 • Corrigés 233

| www.facebook.com/LeTresorDesMedecins | www.facebook.com/groups/LeTresorDesMedecins | http://letresordesmedecins.wordpress.com | http://letresordesmedecins.blogspot.com |


➣ désacylation, formation du deuxième intermédiaire t étraédrique.

Corrigés
• La proposition c. est fausse. L’oxygène carbonyle n égatif établit une liaison hydrogène avec
un groupement N−H du squelette carboné de l’enzyme dans une région appelée  trou oxy-
anion  .
• La proposition d. est fausse. Elle intervient dans la 4e etape.
´
• La proposition e. est fausse. Cette enzyme hydrolyse la liaison peptidique qui suit un
phénylalanine.

218 ❑ a. ❑b.
✘ ❑ c. ❑ d. ❑ e.
• La proposition a. est fausse. Il n’y a pas de modification de Km .
• La proposition b. est vraie. Les inhibiteurs non-comp étitifs diminuent Vm. Dans la représentation
K
de Lineweaver-Burk, la pente égale à m est donc augmentée.
Vm
−1
• La proposition c. est fausse. Dans ce diagramme, la pente est alors que Km est constante.<