Vous êtes sur la page 1sur 25

GENE DISCOVERIES IN

COCONUT (Cocos
nucifera L.)

Project Title: GENE DISCOVERY IN COCONUT


Proponent: Institute of Biological Sciences
College of Arts of Sciences (CAS)
University of the Philippines Los Baños

Project Leader: Rita P. Laude, Ph. D.

Study Leaders: Ma. Genaleen Q. Diaz, Ph. D.


Merlyn S. Mendioro, Ph. D.
Researcher: Marni Cueno

Institute of Plant Breeding


College of Agriculture (CA)
University of the Philippines Los Baños

Study Leaders: Olivia P. Damasco, PhD.


Antonio C. Laurena, PhD.
Researcher: Jorge Gil C. Angeles

1
Implementing and Funding
Agency: UPLB-PCARRD-
DOST
Source of Fund: 89-734-23
Total Budget: P1,536,274.96
Duration: Phase 2, 3 years

Objectives
General:
To clone and determine all possible
isoforms of all the major genes
involved in fatty acid metabolism
and to transform the coconut
thioesterase gene in corn

2
Objectives cont…
Specific:
Study 1: To clone isoforms of the acetyl
CoA carboxylase (ACCase),
phosphatidic acid phosphatase (PAP),
βketoacyl (ACP) synthase 3 (KAS 3),
and acyl-ACP thioesterase (TE), acyl
carrier protein (ACP), lysophosphatidic
and glycerol-3-phosphatase
dehydrogenase genes.

Objectives cont…
Study 2: To clone lysophosphatidic acid
acyltransferase (LPAAT) gene from
coconut
Study 3: To over express and transform
the coconut thioesterase gene in corn
Study 4: To perform a coconut promoter
analysis

3
 Coconut (Cocos nucifera
L.) is the major export crop
of the Philippines
 Widely disbributed in
approximately 11.6 ha. in
86 countries

 As of 2004, the Philippines


has produced 11.93 billion
nuts for export

 Of key importance is its


lauric oil content (48-57%)
which commands premium
price in world markets
(Banzon and Velasco, 1982)

Demand for Philippine


coconut greatly
depreciated with the
release of transgenic
canola with high lauric oil
content (68%)

To make Philippine coconut


globally competitive, we
need to ultimately develop
a transgenic coconut with
high lauric content thru
over expression of genes
for FA

1st step is cloning of genes

4
PART I

CLONING OF ISOFORMS OF
ACCase, PAP, KAS 3, TE,
ACP, LPAAT GENES FOR
FATTY ACID METABOLISM

 Coconut Oil
naturally saturated
vegetable oil
has food, industrial
and medical
purposes

5
USES OF COCONUT OIL AND ITS DERIVATIVES
Edible Uses

Refining
Hydrogenation

..Frying Oil
..Cooking Oil
Shortening
..Margarine
Vanasoati Soap Stocks

..Filled Milk
Filled Cheese
..Ice Cream Coating
Meilorines Acid Oil
..Coffee Whitener
Whipped Dessert Topping
..Confectionery
Spray Oil (Cereals, Cookies, Crackes)
Salad Oil
Fatty Acid Soap

Non Edible Uses

Saponification Interesterification Sulfation


Hydrolysis Hydrogenation Amidation
Ethoxylation
Reaction with alkalis, carbonates, amines, oxides

..Laundry Soap14. Lubricant for Textile and Leather


..Toilet Soap15. Viscosity Modifiers for Lube Oil
Fuel Extender16. Plasticizers for Plastic
..Shampoos/Bubble
Surfactants for Synthetic Detergent17. Synthetic Resins
Bath/ Shower Bath18. Paper Processing
..Cosmetics/Toiletries19. Paints, Varnishes and Inks
Surfactants for Enhanced Oil Recovery20. Pharmaceuticals
..Industrial
Foam Boosters21. Anti-sucker Agent
Cleaning Applications22. Toothpaste
..Emulsifier for Agricultural Chemical23. Explosives
Emulsifier in Oil Drilling24. Humectants
.Tin Plating25. Suppositories
Diesel Oil Substitute

Fatty Acid Biosynthesis and


Metabolism
C6H12O6
peroxisome/glyoxysome
-oxidation
ACCase ACP
acetyl- malonyl malonyl- acetyl-CoA
CoA -CoA ACP

KAS III
4:0 - ACP
TE
TAG
C16-C18 - ACP
G-3-P
18:1 - C16-C18-CoA PA
ACP
Galactolipids PAP
Phospholipids
Plastid

Endoplasmic
Reticulum
(Ohlrogge & Jaworski, 1997) DAG

6
METHODOLOGY
mRNA Isolation
4,5 and 6 month old

4 5 6

3’ RACE
(Rapid Amplification of
cDNA ends)

4 5 6

Agarose Gel Electrophoresis TOPO TA Cloning

Primer Design
Primer Sequence Source Molecular %GC
Name Weight
TE-S NQHVNN Jones et 6415.8 42
al,1995
(AAYCARCAYGTNAAYAAY)
ACCase-S EVEVMKM Podkowinski et 6591.8 40
al,1996
(GARGTNGARGTNATGAAR)
LPAAT-S FPEGTRS Knutzon et al, 5501.3 61
1995
(TTYCCNGARGGNACNCGN)
ACP-S DTVEI Suh et al.,1999 5618.4 43.5
(GAYACNGTNGARATHGTN)
PAP-S DDYWH Marcel et 5537.1 41.7
al.,2000
(GAYGAYTAYTAGCAYCAY)
KAS3-S DITAA Tai & 4654.2 62.2
Jaworski,1993
(SWRCANGCNGCNGTD)

7
ONTOGENETIC EXPRESSION & ISOFORM DISCOVERY

Acyl Carrier Protein


(ACP) 4
ACP
5 6
 Done using COLD-START PCR
 Using the ACP-S primer as
forward primer, a 300 bp
band was generated in the 4 mo.
old cDNA only
 No band was generated in the 5
and 6 mo. old

Acyl-ACP thioesterase (TE)


 HOTSTART + 5 4
TOUCHDOWN PCR
initially done with TE
 Using TE-S as forward
primer Isoform 1 (600bp)
 No bands were Isoform 2 (460bp)

produced in the 4 mo.


old cDNA 6
 Two bands were
produced in the 5 mo.
old cDNA
Isoform 2 (460bp)
 Only isoform 2 (460
bp) was observed in
the 6 mo. old cDNA

8
Phosphatidic Acid Phosphatase (PAP)

 Using the PAP-S primer


as forward primer 4 5 6
 Three isoforms (700bp,
500bp and 400bp sizes)
were found in the 6 mo.
old cDNA
 Similar with the works of Isoform 1 (700 bp)
Isoform 2 (500 bp)
Moore et al.(1973), Isoform 3 (400 bp)
Paliyath & Thompson
(1987) and Styme et al.
(1993).

-ketoacyl (ACP) synthase 3 (KAS 3)

 Using the KAS3-S


primer as forward 4 5 6
primer
 Two isoforms (725 bp
and 425 bp sizes)
were found for both 5
and 6 mo. old cDNA Isoform 1 (725 bp)
Isoform 2 (425 bp)
 Similar with the works
of Jaworski et al,1989
& Dehesh et al.,2001

9
Lysophosphatidic Acid Acyl
Transferase (LPAAT)

 Using the LPAAT-S 4 5 6


primer as forward
primer
 Two isoforms (700bp
and 400bp) were
found in the 6 mo. old Isoform 1 (700bp)
Isoform 2 (400bp)
cDNA
 Similar with the works
of Sun et al (1988) and
Davies et al.(1995)

Acetyl CoA carboxylase (ACCase)

4 5 6
 Using the ACCase-S as
forward primer
 Eight isoforms were
found at the 6 mo. old
cDNA
 Two isoforms were
found at the 4 mo. old
cDNA
 No bands were present
in the 5 mo. old coconut
endosperm
 Similar with the works of
Podkowinski et al.
(1996)

10
NOTE!!!
The mRNA transcript or the gene of
interest are found at varying ages
Suggests ONTOGENETIC
EXPRESSION…

Ontogenetic Expression
Genes Age of Coconut Endosperm
4 5 6
ACCase
ACP
KAS 3
TE
LPAAT
PAP

11
suggests enzymatic and gene
regulation occur early in the
endosperm

correlation between fatty acid


composition and development

Isoform Discovery
 Both PAP and KAS 3 genes were found in one
plant species, the coconut
PAP:castor beans, Phaseoulus vulgaris
and safflower seeds
KAS 3: E. coli and Spinach
 The results obtained provides the first evidence
of the presence of the KAS 3 gene in a woody
monocot such as the coconut
 The 8 isoforms of the ACCase gene found in
coconut is unique since only 7 known isoforms of
the ACCase gene has been published.

12
GENE DISCOVERY

Cloning made use of


the Topo TA Cloning
kit (Invitrogen)
Selected genes
were cloned,
namely: ACCase
(from 4 mo.) and TE
(from both 5 and 6
mo.)

Cloning the coconut ACCase gene

GAGGTTGAGGTAATGAAGATGCGCGCTCGCTAT
TTTCTTTTGCCAGTGGTTGGTCTGTGCTTTTTT
GTCTAAATAACATTGTACAAGATGGTTCAATATT
CGACAGCATGATTTGAACTTTTGAAAAAAAAAA
AAAAAAAA

Features of Raw sequence data:


 contains 140 nucleotides
 primer location:1-21(red)
 poly A tail: 124-140
termination signal (green)
possible adenylation signal (underlined)

13
Features of all ACCase Genes
 EVMKM conserved region ( 7-21)
 MKM motif -biotin binding site (13-21)
 Proline (CCA) residue -forms a hinge region for carboxybiotin
movement(43-45)
 Lysine (GAA) residue- highly conserved region (17-19)
Conclusion: NOVEL coconut ACCase gene was cloned from the 4 mo.
old coconut endosperm

Cloning the coconut TE gene

5 4

Isoform 2 from both


5 and 6 mo. old
coconut endosperm Isoform 1 (600bp)
Isoform 2 (460bp)
were cloned
Why:Prolonged 6
expression of this
isoform
Interesting to Isoform 2 (460bp)

compare both

14
Sequence Analysis
TE(2)-5 vs. TE-LIB TE(2)-6 vs. TE-LIB
Homology Homology
1.0 1.0

0 0
1 51 101 151 201 251 301 351 401 451 501 551 601 651 701 751 794 1 51 101 151 201 251 301 351 401 451 501 551 601 651 701 751 794

Homology features: Homology features:


positive and identity score:64.9% positive and identity score:64.8%
Positions 135-609: 100% homology Positions 136-610: 100% homology
results confirm RACE product from results confirm RACE product from
the 5 mo. old coconut endosperm is the the 6 mo. old coconut endosperm is the
coconut TE gene coconut TE gene

Coconut PAP gene


Primer (3’-GAYGAYTAYTACCAY-5’)

Homopolymer
T-chain

Poly-A tail
Representative sequence

15
The three coconut PAP genes were cloned

Proof PAP1 PAP2 PAP3 PAP5


PAP-S + + + +
Primer
ORF 2 2 1 1
BLAST Significantly Significantly Significantly Significantly
similar to similar to similar to similar to
known PAP known PAP known PAP known PAP
Signature + + + +
motifs
Comparativ Similar to Similar to Different Different
e Analysis PAP2 PAP1 from PAP1, from PAP1,
PAP2, PAP5 PAP2, PAP5

Coconut KAS gene

GAC ATC ACT GCA GCG TGC AAG GAG ACC AAG GCC CGC TTC GAG
GAG CGC TTC AAG ACC GGC AAG AAC CGG TGG TTC TTC ACT AAG
CTC CGC TTC TAG ATA AAG GTA TAC AGT TCA TGA GAT TGA TGC CCG
CTG TCT AGG GTT TCT TTC TTA TAT TGT TAT GGA TCG CTT TGC TTA
GTC GTC GTC GTT GCT ATG GTT GGT GTC ATT TGG ATT TGT TAT TGG
ATC TAG TAG ACG TTT TAA TGT AGT TGG CAC TTA ACT GTT TTG ATG
GAG TTA CTT GGT TAT ATG TTT AGG ATG AATGGA TCC GGA TGA GTT
CAA TAA AAA AAA AAA AAA AAA AA

Primer: Red Poly A Signal: Pink Poly A: Blue

16
Conserved region

D I T A A C S G F

Active-site cysteine

ACTIVE-SITE CYSTEINE
1. Suggested to be involved in substrate-binding,
2. Conformational changes during catalysis, and
3. Acid-base catalytic mechanism
---Qui et al., 1999

Coconut LPAAT gene


TTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAG
AGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTC
GTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAAT
CAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTA
AAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAA
TCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCC
CCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCG
CCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCG
GTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCT
GCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG
GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCT
TGAAGTGGNGGCCTNACTCANGCTACACTAGAAGAACAGTA

•Primer region (red)


•Poly A signal (orange)

17
Coconut ACCase gene
GAGGTTGAGGTAATGAAGATGCGCGCTCGCTATTT
TCTTTTGCCAGTGGTTGGTCTGTGCTTTTTTGTCTA
AATAACATTGTACAAGATGGTTCAATATTCGACAGC
ATGATTTGAACTTTTGAAAAAAAAAAAAAAAAAA

Features of Raw sequence data: Analysis:


 contains 140 nucleotides  no significant matches
 primer location:1-21  suggests that it is novel
 poly A tail: 124-140  possibly a novel form of
ACCase

Common features of all ACCase genes:


 EVMKM conserved region ( 7-21)
 MKM motif – biotin binding site (13-21)
 Proline (CCA) residue – forms a hinge region for carboxybiotin
movement(43-45)
Conclusion: NOVEL coconut ACCase gene was cloned from the 4 mo.
old coconut endosperm

18
MOLECULAR-BASED COCONUT (MC)
STANDARD
COCONUT TISSUE CULTURE
for successful coconut
tissue culture to occur,
genes that are responsible
for medium-chain fatty acid
should be present in the
starting material (Lopez-
Villalobos,2001)

using the MC
Standard,detection of the
genes involved in
medium-chain fatty acid
(C12:0 or lauric acid)
synthesis can be readily
made.

COCONUT MOLECULAR BIOLOGY


using the MC standard,
future coconut molecular
biology works would be
guided in choosing the
right starting material for
research works that
would include cloning,
gene detection and
hybridization
knowing the right age of
the starting material
would decrease
erroneous data and
further hasten Philippine
coconut biotechnology
works in coconut

19
VCO STANDARDIZATION

To avoid a similar fate with the


nata de coco industry,
standardization of the VCO
product is now being made

The MC standard would


improve and help standardize
VCO production in the
Philippines by:
(1) avoiding rancidity by
avoiding the genes
responsible
(2) increase lauric acid content
of Philippine-made VCO

PART II

ONTOGENETIC PATTERN OF
DOUBLE-STRANDED FREE
NUCLEIC ACID (DS-FNA) FROM
THE WATER OF COCONUT
(COCOS NUCIFERA L.)

20
Coconut Water (CW)

 Pure and nutritious  CW is thrown away


beverage during copra making
 CW vinegar and wine
 Fiber-rich nata
 Little interest was
 Growth factor
directed to CW when
 Substitute for dextrose
it comes to research
 Curing kidney disorders  Readily available in
– Bukolysis soluble form

Free Nucleic Acids (FNA) in


 To distinguish: CW
 Free nuclei – liquid
endosperm (Cutter,
1952)
 Free nucleic
acid(FNA) – coconut
water (Mondal et al.,
1972)
 Assessment of the DS-
FNA properties of CW
is needed

21
Methodology
Extraction of DS-FNA at
Establishing presence of varying ages
DS-FNA in CW (LR 14-22)
(GFX™ Purification Kit, (DNA Binding Matrix,
Amersham) Eppendorf)

Crude Concentrated

Colorimetric Analysis
(DNA Dipstick, Invitrogen)

Results and Discussion


I. Establishing the presence of DS-FNA
LR 15 A B

 LR 15 (Pre-endosperm
development)
 LR 20 (Late endosperm (+) (+)
development) A B
LR 20

 DS-FNA is present!!!
(+) (-)
 This is interesting!!!
A) Control (Purified CW
compliments of Guzman)
 Does this mean that DS-FNA
B) Purified CW using GFX™
presence depends on its age? Purification Kit (Amersham)

22
II. Extraction of DS-FNA in CW at varying ages

A. Crude CW LR 14,15,16

 LR 14-22 was used LR 17,18,19 0.0 ng/μL

 DNA Binding Matrix


(Eppendorf) 0.0 ng/μL

 Only LR 19 was positive for LR 20,21,22


1.0 ng/μL

DS-FNA
0.0 ng/μL

 Using crude samples, DS-FNA doesn’t seem


to be detectable except for LR 19.

 DS-FNA in CW are not well concentrated


(Mondal et al., 1970). However, at LR 19,
DS-FNA was detected at high concentration.

 This implies that in order to analyze DS-FNA


properly, high concentration of CW must be
used.
 To confirm results, DS-FNA must be purified.

23
B. Concentrated CW LR 14,15,16

 Concentrated every 0.1 0.2 0.3 ng/μL


sample as patterned from LR 17,18,19
Enriquez (2006)
 There’s a gradual
increase of concentration 0.4 0.5 9.0 ng/μL
of DS-FNA from LR 14-19. LR 20,21,22
 LR 19 was estimated to
have the highest
concentration with 9 0.4 0.0 0.0 ng/μL
ng/uL, consistent with the
crude sample.
 At LR 20, sudden
decrease in DS-FNA was
detected.

Results show…
10
Estimated concentration

9
8
7
(ng/uL)

6
5
4
3
2
1
0
14 15 16 17 18 19 20 21 22
Leaf rank

Ontogenetic pattern of DS-FNA in CW EXISTS!!!

24
ACKNOWLEDGMENTS:

Institute of Biological Sciences (IBS)


College of Arts of Sciences (CAS)
University of the Philippines Los Baños

Institute of Plant Breeding (IPB)


College of Agriculture (CA)
University of the Philippines Los Baños

Philippine Council for Agriculture, Forestry


and Natural Resources Research and
Development PCARRD - Department of
Science and Technology (DOST)

THANK YOU!!!

25