Letters
3 Hussein R, Temtamy SA, El-Beshlawy A, et al. Molecular characterization of
â-thalassemia in Egyptians. Hum Mutat 1993;2:48-52.
4 Varawalla NY, Old JM, Sarkar R, et al. The spectrum of â-thalassemia muta-
tions in the Indian sub-continent: the basis for prenatal diagnosis. Br J
Haematol 1991;78:242-7.
5 Quaife R, Al-Gazali L, Abbes S, et al. The spectrum of â-thalassemia muta-
tions in the UAE national population. J Med Genet 1994;31:59-61.
6 Trecartin RF, Liebhaber SA, Chang JC, et al. â°-thalassemia in Sardinia is
caused by a nonsense mutation. J Clin Invest 1981;68:1012-17.
7 Orkin SH, Sexton JP, GoV SC, Kazazian HH, Jr. Inactivation of an acceptor
RNA splice site by a short deletion in â-thalassemia. J Biol Chem 1983;258:
7249-51.
8 Orkin SH, GoV SC. Nonsense and frameshift mutation in â-thalassemia
detected in cloned â-globin genes. J Biol Chem 1981;256:9782-4.
9 Chibani J, Vidaud M, Duquesnoy P, et al. The peculiar spectrum of
â-thalassemia genes in Tunisia. Hum Genet 1988;73:190-2.
10 Kinniburgh AJ, Maquat LE, Schedl T, et al. mRNA-deficient â-thalassemia
results from a single nucleotide deletion. Nucleic Acids Res 1982;10:5421-7.
11 Kazazian HH Jr, Orkin SH, Antonarakis SE, et al. Molecular characteriza-
tion of seven â-thalassemia mutations in Asian Indians. EMBO J
1984;3:593-6.
Rapid screening for the most common
â thalassaemia mutations in south east
Asia by PCR based restriction
fragment length polymorphism analysis
(PCR-RFLP)
EDITOR—The heterogeneity of the molecular lesions which
underlie the failure of erythropoietic cells to synthesise
normal haemoglobin in â thalassaemia1 is a complicating
factor in its molecular diagnosis. However, although more
than 100 diVerent mutations have been identified, mostly
single base substitutions or small deletions and insertions
in the â globin gene, in many populations the bulk of â
thalassaemia is caused by a population specific spectrum of
only a small number of mutations.1 The strategy for the
detection of mutations in patients, therefore, normally
involves screening in the first instance for a small number
of mutations that are the most common for the population
concerned.
Two of the most commonly used screening procedures
are dot blot or reverse dot blot hybridisation2 and the
amplification refractory mutation system (ARMS).3 While
these procedures are satisfactory in the hands of the more
experienced specialised laboratories, the exacting condi-
tions required for the performance of allele specific
hybridisation or PCR amplification steps have made them
less reproducible in less advanced laboratories.4 5 In south
east Asia, where in some regions the frequency of â
thalassaemia can be as high as 10%,6 7 many laboratories in
medium sized provincial hospitals and universities are suit-
ably equipped for routine molecular biology laboratory
Table 1 PCR primers and restriction endonucleases used in the detection procedure
Region Primer sets* Mutation Restriction endonuclease
I TLF62028-TLR62320 IVS-1 nt 5 Cac8I
IVS-1 nt1 BslI
Codon 26 MnlI
Codon 15 SfcI
Codon 17 BfaI
Codon 19 MaeII
Codon 30 Bsp1286I
IVS-1 nt2 Cac8I
II TLF62392-TLR62703 Codon 41/42 TaqI
*The primers used were: TLF62028-5'ACCTCACCCTGTGGAGCCAC3' (common C in Old et al3); TLR62320-5'CTATTGGTCTCCTTAAACCTGTCTT
GTAACCTTGCTA3'; TLF62392-5'TATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTT GGACCCAGAGGTC3'; TLR62703-5' CCCCTTCCTAT
GACATGAACTTAA 3'; modifications in nucleotide sequence are indicated by bold letters.
†Bold numbers indicate fragments of distinguishable sizes.
937
12 Atweh GF, Wong C, Reed R, et al. A new mutation in IVS-1 of the human
â-globin gene causing â-thalassemia due to abnormal splicing. Blood 1987;
70:147-51.
13 Doerk T, El-Harith EA, Stuhrmann M, et al. Evidence for a common ethnic
origin of cystic fibrosis mutation 3120+1G→A in diverse populations. Am
J Hum Genet 1998;63:656-62.
14 Jasim N, Merghoub T, Pascaud O, et al. Molecular basis of â-thalassemia
and G-6-PD deficiency in Bahrain. Proceedings of the symposium on genetic
diseases in Arab population - a wealth of information, King Saud University,
Riyadh, 23-24 November 1997:39.
15 Marwan MM, Felice AE. Molecular analysis of â-thalassemia, sickle cell
anaemia and Hb S-â-thalassemia in patients from Libya. Proceedings of the
symposium on genetic diseases in Arab population - a wealth of information, King
Saud University, Riyadh, 23-24 November 1997:44.
16 Krishnamoorthy R, Darr S, Hussein HM, Merghoub T . Recent molecular
data on the spectrum of â-thalassemia mutations in Oman: a particular
mention about Hb Dhofar. Proceedings of the symposium on genetic diseases in
Arab population - a wealth of information, King Saud University, Riyadh,
23-24 November 1997:58.
J Med Genet 1999;36:937–938
testing, but do not have the skill to comply with the strict
conditions demanded by the above procedures, a situation
which is perhaps shared by many other countries in which
â thalassaemia is common. We have endeavoured,
therefore, to develop a more robust and accurate
alternative method for the detection of â thalassaemia
mutations in south east Asia, based on restriction endonu-
cleases that recognise naturally occurring or PCR gener-
ated restriction sites associated with the â thalassaemia
mutations. The approach is widely used in the detection of
pathological mutations in mitochondrial DNA8 and has
also been applied in the molecular diagnosis of â
thalassaemia.9
A strategy has been devised to allow rapid detection of
nine of the most common mutations in south east Asia
which requires the amplification of two segments only of
the â globin gene. The mutations are at positions IVS-1
nt5, IVS-1 nt1, codon 26, codon 15, codon 17, codon 19,
codon 30, IVS-1 nt2, and codon 41-42 of the â globin gene
(fig 1 (top), table 1), which together account for around
70-90% of â thalassaemia mutations in most populations
of south east Asia.6 7 10 The PCR amplifications use primer
sets TLF62028-TLR62320 and TLF62392-TLR62703.
Primer TLR62320 includes a G at the position equivalent
to nt8 of intron 1 instead of the normal A to create a
GCTAGC site for Cac8I in the presence of the IVS-1 nt5
G>C mutation. A Cac8I site is also created in the presence
of the IVS-1 nt2 T>C mutation which represents less than
1% of the â thalassaemia alleles in Indonesia. The
mutations G to T at IVS-1 nt1, G to A at codon 26, and A
to G at codon 19 abolish the natural occurring sites for
BslI, MnlI, and MaeII, respectively. The mutations G to A
at codon 15, A to T at codon 17, and G to C at codon 30
create sites for SfcI, BfaI, and Bsp1286I, respectively. The
detection of the 4 bp deletion of codon 41-42 is essentially
Restriction fragments (bp)†
Normal Mutant
293 257,36
29,22,22,175,45 29,22,22,220
12,37,106,16,60,62 12,37,106,16,122
293 202,91
24,114,155 24,114,72,83
218,75 293
167,126 167,83,43
293 250,43
312 263,49
938 Letters

IVS1-nt5 of the mutant allele could be distinguished from the 60 and

(Cac 8I) 62 bp fragments of the normal allele among the digestion
Codon 19
(Mae II) fragments of MnlI in the detection of the HbE codon 26
IVS1-nt1
(BsI I) mutation (fig 1B). Definitive electrophoretic patterns were
Codon 17 also obtained in the detection of IVS-1 nt1 (fig 1C), codon
(Bfal) Codon 30 41-42 (fig 1D), codon 15 (fig 1E), codon 19 (fig 1F), and
Codon 15 (Bsp1286l)
(Sfc I) Codon 41–42 IVS-1 nt2 (fig 1G) mutations. Similar results were
Codon 26 (Taql) obtained in the detection of codon 17 and codon 30 muta-
TLF-62028 (Mnl I) TLF-62392 tions (data not shown). In all the above cases, the
EXON I EXON II PCR-RFLP results agreed with those of ARMS and were
confirmed by DNA sequencing.
TLR-62320 TLR-62703
The detection procedure described here does not involve
an allele specific hybridisation or an allele specific PCR
amplification step and is thus less prone to non-specific
I II III reactions which could lead to false positive/negative results.
IVS1 IVS2 We have applied our new procedure to the detection of the
underlying mutations in a number of diYcult samples in
A B which ARMS gave ambiguous results. In all cases the
PCR-RFLP method proved to be more reliable and gave
293 bp 122 bp definitive identification of the underlying mutation, as
106 bp
confirmed by DNA sequencing data (data not shown). The
257 bp nine mutations included here account for 70% of â
b c d
60 bp thalassaemia alleles in Thailand,6 90% in Malaysia,6 53%
a b c d
in India,6 and 68-90% in Indonesia7 10 depending on the
C D
ethnic population. The procedure, therefore, is suitable as
293 bp
the front line screening for the molecular diagnosis of â
312 bp thalassaemia in south east and perhaps also in eastern and
220 bp southern Asia.
263 bp
175 bp
a b c d a c d This work was supported by the RUT grant No IIIo/13/I/-/IPD from the
National Research Council (Indonesia) to Iswari Setianingsih, and grant in aids
from PT Krakatau Steel and PT Inti through the Agency for Strategic Industries
E F (Indonesia).
293 bp PATCHARIN PRAMOONJAGO
293 bp ALIDA HARAHAP
202 bp
RATNA AGUNG TAUFANI
ISWARI SETIANINGSIH
218 bp SANGKOT MARZUKI
91 bp Eijkman Institute for Molecular Biology, Jl Diponegoro 69, Jakarta
a d c a c 10430, Indonesia
ALIDA HARAHAP
Department of Clinical Pathology, University of Indonesia, Salemba 6,
G
Jakarta 10430, Indonesia
293 bp
1 Weatherall DJ. The thalassaemias. In: Stamatoyannopoulos G, Nienhuis
250 bp AW, Majerus PW, Varmus H,eds. The molecular basis of blood diseases. 2nd
ed. Philadelphia: Saunders, 1994:157.
2 Rady MS, BaYco M, Khalifa AS, et al. Identification of Mediterranean
beta-thalassemia mutations by reverse dot-blot in Italians and Egyptians.
a d c
Hemoglobin 1997;21:59-69.
Figure 1 Detection of the common â thalassaemia mutations of south 3 Old JM, Varawalla NY, Weatherall DJ. The rapid detection and prenatal
diagnosis of â-thalassaemia in the Asian Indian and Cypriot populations in
east Asia by PCR-RFLP. (Top) Detection strategy; see table 1 for details. the UK. Lancet 1990;336:834-7.
(Bottom) Results for the detection of (A) IVS-1 nt5, (B) codon 26, (C) 4 Orou A, Fechner B, Utermann G, Menzel HJ. Allele-specific competitive
IVS-1 nt1, (D) codon 41/42, (E) codon 15, (F) codon 19, and (G) blocker PCR: a one-step method with applicability to pool screening. Hum
IVS-1 nt2 mutations; lane a, uncut PCR product; lane b, patient Mutat 1995;6:163-9.
homozygous for the â thalassaemia mutation; lane c, heterozygote for the â 5 Chang JG, Lu JM, Huang JM, Chen JE, Liu HJ, Chang CP. Rapid diagno-
thalassaemia mutation; and lane d, normal subject. sis of â-thalassemia by mutagenically separated polymerase chain reaction
(MS-PCR) and its application to prenatal diagnosis. Br J Haematol
1995;91:602-7.
6 Thein SL, Winichagoon P, Hesketh C, et al. The molecular basis of
as described by Chang et al9; a C has been introduced at the â-thalassemia in Thailand: application to prenatal diagnosis. Am J Hum
second position of codon 41 in the sequence of primer Genet 1990;47:367-75.
7 Setianingsih I, Williamson R, Marzuki S, Harahap A, Tamam M, Forrest S.
TLF62392, which together with the 4 base deletion creates Molecular basis of â-thalassemia in Indonesia: application to prenatal diag-
a TCGA site for TaqI. nosis. Mol Diag 1998;3:11-20.
8 Lertrit P, Noer AS, Jean-Francois MJ, et al. A new disease-related mutation
As shown in fig 1(A-D) the method produces unambigu- for mitochondrial encephalopathy lactic acidosis and strokelike episodes
ous results. Thus, for the detection of the IVS-1 nt5 muta- (MELAS) syndrome aVects the ND4 subunit of the respiratory complex I.
Am J Hum Genet 1992;51:457-68.
tion, the normal allele (indicated by a 293 bp undigested 9 Chang JG, Chen PH, Chiou SS, Lee LS, Perng LI, Liu TC. Rapid diagno-
product) can be distinguished readily from the mutant sis of beta-thalassemia mutations in Chinese by naturally and amplified
created restriction sites. Blood 1992;80:2092-6.
allele (a 257 bp digested fragment). Heterozygosity could 10 Lie Injo LE, Cai SP, Wahidiyat I, et al. â-thalassemia mutations in Indonesia
be easily detected (fig 1A). Similarly, the 122 bp fragment and their linkage to â-haplotypes. Am J Hum Genet 1989;45:971-5.