Vous êtes sur la page 1sur 121

Semestre S5

Biologie Moléculaire

Professeur: Hicham Mansour


Analyses de L’ADN
Figure 1.1 Genomes 3 (© Garland Science 2007)
Figure 1.2 Genomes 3 (© Garland Science 2007)
Caracteristiques de l’ADN
Figure 1.4a Genomes 3 (© Garland Science 2007)
Figure 1.4b Genomes 3 (© Garland Science 2007)
Figure 1.5 Genomes 3 (© Garland Science 2007)
Figure 1.6 Genomes 3 (© Garland Science 2007)
Réalisation du modèle de l’ADN
By Watson et Crick

-Double brin (appariement A-T et GC)

- conformation Helice

Ils se sont basés sur deux découvertes réalisées par d’autres chercheurs: (Franklin
et Chargaff))
1- Franklin:; profile de diffraction des rayons X

Les rayons diffractés produisent la conformation de la molécule (exemple un cristal,


on aura les angles des rayons diffractes suivant les angles et les mailles du cristal)

Ces expériences ont révélé l’aspect de hélice de la molécule de l’ADN


2. Les résultats de Chargaff

A=T

G=C
2- Chagraff
Le ration A/T et G/C de l’ADN

Conclusion de cette parité:


Règle de l’appariement
des nucléotides
(pairing rule)

Figure 1.7 Genomes 3 (© Garland Science 2007)


En résumé
ADN:

-Hélice

- Appariement des bases

- Double brin

- Brins antiparallèle

- Sillons (DNA binding proteins:)

Figure 1.8a Genomes 3 (© Garland Science 2007)


Structure antiparallèle de l’ADN
- Appariement des bases

Figure 1.8b Genomes 3 (© Garland Science 2007)


Stabilité de l’ADN

Due :
- Appariement des bases
(Liaisons H) (plus important)

- interaction hydrophobe des bases


Liaisons hydrogène

2 liaisons hydrogène, -21 kJ

3 liaisons hydrogène, -63 kJ


Dénaturation de l’ADN
1/Quantite de la fluorescence

Température a laquelle la
moitié des paires de bases se
sont séparées et l’autre moitié
reste intact
Dénaturation et
Renaturation
d’un duplex
d’ADN

Hybridisation:
-Augmentation concentration des sels pour neutraliser les charges négatives
dues aux Phosphates, sinon les molecules de phosphates se repossent
-Diminution de la température
• Il est possible de mesurer directement la température de fusion (Tm) d’un DNA double
brin, en mesurant l’augmentation de l’absorbance de la solution en sybergreen en
fonction de la température.
de laof fluorescence

Single-stranded DNA
1

100
260-nm light

Double-stranded DNA

Percentage of G•C pairs


80

0,75 60
Absorption

40

20
1/Quantite

0,5 0
75 80 Tm 85 90 75 70 80 90 100 110
Temperature (°C) Tm (°C)

La température de fusion (Tm)


Calcule de la temperature d’hybridation

• On se contente la plupart du temps d’une estimation à partir de la composition de


l’oligonucléotide pour estimer la température d’hybridation

Si celui-ci a une longueur égale ou inférieure à 20 nt on compte 2°C par


couple A:T et 4°C par couple G:C. A partir de N = 20, on corrige d’un multiplicateur
proportionnel la longueur au delà de ce chiffre : 1 + [(N-20)/20].

Thyb
Nombre de couple AT et le couple GC

Thyb

Sites internet proposent de calculer le Tm


ARN
Figure 1.10 Genomes 3 (© Garland Science 2007)
Figure 1.10a Genomes 3 (© Garland Science 2007)
Figure 1.10b Genomes 3 (© Garland Science 2007)
Figure 1.11 Genomes 3 (© Garland Science 2007)
Figure 1.12 Genomes 3 (© Garland Science 2007)
Figure 1.13 Genomes 3 (© Garland Science 2007)
Les acides aminés
Acide Aminé

Figure 1.14 Genomes 3 (© Garland Science 2007)


Figure 1.15 Genomes 3 (© Garland Science 2007)
Table 1.2 Genomes 3 (© Garland Science 2007)
Le code génétique

Figure 1.20 Genomes 3 (© Garland Science 2007)


TSS

Figure 1.21 Genomes 3 (© Garland Science 2007)


Table 1.3 Genomes 3 (© Garland Science 2007)
Méthodes d’analyse de l’ADN
1- Préparation du matériel biologique
Human

ADN
Tissue
(ensemble de cellule)

- ADN est le même pour une espèce,


- Il existe juste des variations nucléotidiques entre les
individus d’une même espèce, ce qu’on appelle
polymorphisme
- Au sein de l’individu l’ADN est le même dans les
différents tissues
- Mais le produit des gènes (transcrits) vont être
différents d’un tissu à l’autre
Exemple de cetraines cellules
Préparation du matériel biologique
• Tissus ou cellules traités immédiatement.
* L’ajout d’anticoagulant dans le cas du sang.
* Conservation rapide par congélation à -800C.

• Séparation et isolation d’un type cellulaire.


* Sépare des lymphocytes des autres cellules sanguines par
centrifugation (gradient de densité).

Avant
centrifugation

• Lavage
• Lyse cellulaire dans un tampon d’extraction:

* Agent dissociant: la membranes plasmique est rompue et


le contenu cellulaire est libéré, lysat.
* température inferieure à 4oC.
* Solution tampon.
* Sels
* EDTA: Chélateur d’ion, inhibition des nucléases.
• Agent réducteur: ex. b mecrcapto-éthanol, dénaturation
des protéines et donc inhibition des nucléases.

• SDS: sodium dodecyl sulfate: coupe les ponts bisulfures


2- Extraction des acides nucléiques
Il existe plusieurs méthodes d’extraction:

1. Extraction par le phénol-chloroforme (dénaturation des


protéines) et précipitation a l’éthanol,

phénol-chloroforme qui dissous les lipides et précipite les


protéines en laissant les acides nucléiques en solution.

Bien mélanger, ADN, ARN, quelques


+ Phénol centrifugation impuretés

ADN, ARN,
protéines,
lipides…
Précipitation des acides nucléiques par l’alcool en présence
de sel. Ils précipitent en un nuage cotonneux blanchâtre.

Redissoudre les
+ Alcool, AN purifiés dans
NaCl Centrifugation Lavage de l’eau

ADN, ARN,
quelques
impuretés
Culot d’ADN
2- Exemple d’utilidation des Colonnes avec une membranes de silice

Un agent chaotropique (comme Ethanol, propanol, phenol, guanidine..) est une molécule qui détruit la structure spatiale (tridimensionnelle)
et dénature des macroécules biologiques. Les agents chaotropiques interfèrent avec les interactions intramoléculaires faibles (non-covalent)
comme les liaisons hydrogène http://www.mn-net.com/tabid/10745/default.aspx
3- Exemple d’utilisation des billes magnétiques (NucloMag) utilise par une compagnie

http://www.mn-net.com/tabid/10753/default.aspx
3- Techniques et méthodes d’analyse
des acides nucléiques
A- Visualisation de l’ADN
Électrophorèse de l’ADN: Migration de l’ADN sur gel
Visualisation de l’ADN par les rayon UV ou la lumière Blue en présence de BET ou sybregreen

Le gel d’agarose après Le gel d’agarose après


l’électrophorèse révélation au BET

• Révélation au bromure d’éthydium (BET):


* Incubation du gel dans une solution de
BET.
* Lavage.
* Le BET se fixe spécifiquement sur l’ADN
quelle que soit la séquence et émet une
fluorescence mauve lorsqu’il est éclairé
avec des rayons ultra-violets.
* On examine le gel sous lumière ultra-
violette à 254 nm pour détecter les
molécules d’ADN.
* Photographier le gel.
* Le seuil de détection est ~ 5 pg d’ADN
(~109 molécules d’un ADN de 3 kb)
Photo du gel de l’ADN

Le gel d’agarose après Le gel d’agarose après


l’électrophorèse révélation au BET Nombre de Kb
(échelle Log)

23 kb

9,5 kb

6,5 kb
Direction
de
4,5 kb migration

Migration mm
2,5 kb
2 kb
Visualisation de l’ADN génomique extrait intact (non coupé ou cassé )

ADN marqueur ADN génomique non


de taille coupé

23 kb ~50 kb
9,5 kb
6,5 kb • Les fragments d’ADN
4,5 kb après extraction ont une
taille moyenne de 50 kb
• Difficile de manipuler de
2,5 kb grands fragments d’ADN
2 kb
B- Techniques de fragmentation de l’ADN
ADN génomique coupé de façon au hasard

ADN marqueur ADN génomique coupé


de taille

• L’ADN génomique peut être couper


d’avantage s’il est mélanger dans un
mixeur ou incuber avec la DNAse
• Des coupures au hasard sont
produites et génèrent une multitude
de fragments de toute les tailles
provoquant une trainée de
coloration le long de la piste de
migration.
• Impossible d’isoler et d’identifier un
fragment d’ADN particulier sur la
base de sa taille .
1- Enzymes de restriction

• Enzymes de restrictions sont des endonucléases qui coupent au niveau de


séquences spécifiques appelées sites de restriction.
• Les sites de restriction sont souvent de type palindrome. c’est à dire qu’ils sont
identiques sur les deux brins de l’ADN (mais antiparallèles sur l’autre brin).
• Une ER est nomée en fonction de la bactérie et la souche a partir de laquelle a été
isolée. Ex. BamHI, la 1iere enzyme trouvée chez Bacillus amyloliquefaciens, souche H.
Exemples d’enzymes de restriction

Coupures à bout Coupures à bout francs


cohésifs
ADN génomique coupé par une enzyme de restriction

ADN marqueur ADN génomique coupé


de taille

• Des coupures spécifiques sont


produites et génèrent une multitude
de fragments de toute les tailles
provoquant une trainée de
coloration le long de la piste de
migration.
• Tous les fragments d’ADN
contenant une séquence particulière
auront la même taille.
• Possible d’isoler et d’identifier un
fragment d’ADN particulier sur la
base de sa taille ou sa séquence.
Cartes de restriction

• Un fragment d’ADN coupé par une enzyme de restriction produit un


nombre bien précis de fragments plus petits (profile de restriction).
• Le même fragment coupé par une deuxième enzyme génère un profile
différent du premier.
10 kb

7 kb
EcoRI
3 kb

HindIII 8 kb
2 kb

5 kb
EcoRI + HindIII 3 kb
2 kb
EcoRI HindIII

3 kb 5 kb 2 kb
NNN……...GAATTC…NNN.....AAGCTT….NNN
• Le schéma montrant les sites de restriction ainsi que les distances qui les
séparent sur une molécule d’ADN est appelé la carte de restriction.
Cartes de restriction du plasmide pBR322
Cartes de restriction

• Une molecule d’ADN a été coupée par les enzymes de restriction EcoRI et
HindIII. le produit de chaque digestion a été déposé sur un gel
d’électrophorèse. La photo du gel après l’électrophorèse est représentée ci-
dessous. Sans enzyme
EcoRI HindIII EcoRI/HindIII

• Construire la carte de restriction de ce fragment?


1- La taille totale du fragment: c’est la taille sans enzyme de restriction?
2- Le nombre de fragments generes apres coupure par les deux les enzymes
de restriction?
3- Combinaison des deux enzymes de restriction?
EcoRI HindIII HindIII

400? 200?
2- Fragmentation Mecanique de l’ADN:

Differentes methodes

a- Nebulizer

- Add 1–5 μg of purified DNA in a total


volume of 50 μl of TE buffer to the
nebulizer

- Add 700 μl nebulization buffer to the


DNA and mix well

- Use the regulator on the compressed air


source to ensure the air is delivered at
32–35 psi. Nebulize for 6 minutes.
Determination des tailles des fragments d’ADN fragmentes par le Nebulizer

Separation par Electrophorese


(gel d’agarose ou electropherograme du
Bioanalyser)
400-800pb
b- Hydroshear
Principe: utiliser les forces hydrodynamiques pour casser l’ADN (tampon, Eau, ..)
Determination des tailles des fragments d’ADN fragmentes par le Hydroshear
c- Covaris

Principe: utilise la technologie des ultrasongs pour fragmenter l’ADN


Determination des tailles des fragments d’ADN fragmentes par
le Covaris
D’autres techniques de fragmentation existent et l’utilisation depend de l’application
Séance 3 (2h)
Méthode de conversion l’ARN en ADNc
- ARNm ou les microRNA, Synthèse d’un cDNA (ADN complémentaire)
- Les ADN sont robustes peuvent être analyses directement

• La manipulation et l’étude des ARN est difficile à cause de leur grande


sensibilité aux ribonucléases qui les détruisent.

• Il est nécessaire de recopier la séquence en DNA pour qu’elle soit plus stable
et qu’on puisse l’amplifier en fonction des besoins.
Avec des oligodT

• L’ARNm purifié (chromatographie d’affinité sur une colonne d’oligo-d(T)) est lié
dans un premier temps avec des oligonucléotides poly(T) qui s’attachent à la
queue poly(A),
la réverse transcriptase, synthétise un brin de l’ADN complémentaire du messager de
départ a partir de l’oligodT
Avec des random hexamers
Detection Ciblée de l’ADN (détection des sèquences specifiques)
(Southern blot, Norther blot, PCR, Real Time PCR, microarray)
Southern blot
Southern blot

• Le Southern blot est une technique mise au point par Edward M. Southern
en 1975 pour rechercher des fragments de l’ADN sur une électrophorèse en
les hybridant avec une sonde complémentaire

ADN génomique coupé par


ADN marqueur enzyme de restriction
de taille

• 1-Après avoir digéré l’ADN par une


enzyme de restriction, on obtient un
mélange de très nombreux fragments
de restriction. On soumet ces
fragments à une électrophorèse pour
les faire migrer dans un gel de haut
en bas en fonction inverse de leur
taille.
Southern blot

• 2- On fait un montage pour faire passer les fragments grâce à une


montée de tampon imprégnant le gel puis une membrane de nylon
où le DNA va se fixer par des liaisons stables.

ADN
Southern blot

• 3- La membrane de nylon avec l’ADN fixé est alors mise à incuber


dans un sac contenant une solution d’une sonde radioactive
complémentaire du fragment de DNA qu’on recherche, hybridation
de la sonde avec l’ADN complémentaire.

sonde radioactive denaturee


complémentaire du fragment de DNA

Bag
Nylon membrane
Tampon
Southern blot
Hybridation d’une sonde:
• Pour pouvoir reconnaître spécifiquement une séquence de l’ADN, on utilise
un petit morceau d’ADN synthétisé (sonde) dont la séquence correspond au
moins en partie à celle d’un des brins de l’ADN.
• Parce qu’elle est complémentaire de l’autre brin de l’ADN, la sonde est capable
de se fixer spécifiquement sur l’autre brin à l’endroit où se lit la séquence
complémentaire.
• En marquant cette sonde par un atome radioactif ou par une molécule
fluorescente liés à un des nucléotides de la sonde, on peut détecter la sonde et
le morceau de l’ADN complémentaire qui lui est hybridé.
Southern blot

Visualisation de l’ADN cible


• 4- On lave la membrane des molécules de la sonde qui ne sont pas
fixées à leur ADN complémentaire
• 5- la membrane est mise en présence d’un film radiographique
vierge pour que la sonde radioactive fixée sur les fragments de
l’ADN complémentaires impressionne le film. Après révélation du
film, des taches noires (sur le négatif) correspondent aux
emplacements où ont migré les fragments de l’ADN
complémentaires de la sonde. sain patient

nylon membrane
wash nylon exposed to X-ray film
membrane

probe
Southern blot

ADN génomique coupé par


ADN marqueur enzyme de restriction
de taille

Sain patient

Le film radiographique
avec une sonde radioactive specifique
Gel electrophorese
En résumé

Inconvénient: impossible de détecter plusieurs gènes à la fois


Northern blot
Le même principe que southern-blot sauf c’est pour détecter les ARN

ARN
Inconvénient: impossible de détecter plusieurs gènes à la fois
PCR classique
PCR, (polymerase chain reaction)

• Elle permet d’amplifier spécifiquement une région de l’ADN double brin


de quelques centaines de paires de bases.
Après la PCR, on fait migrer le produit de PCR dans
gel électrophorèse pour vérifier le produit d’amplification

Gel d’agarose 2%

ACGCTCTCCCCCTACATGTACCCCCCCCCCCTTCGTGTGTCATCGTACATGTACT
ACATGTACACGCTCTCCCCCTACATGTACCCCCCCCCCCTTCGTGTGTCATCGTA
CATGTACTACATGTACACGCTCTCCCCCTACATGTACCCCCCCCCCCTTCGTGTG
TCATCGTACATGTACTACATGTACACGCTCTCCCCCTACATGTACCCCCCCCCCC
TTCGTGTGTCATCGTACATGTACTACATGTACACGCTCTCCCCCTACATGTACCC
CCCCCCCCTTCGTGTGTCATCGTACATGTACTACATGTACACGCTCTCCCCCTAC
ATGTACCCCCCCCCCCTTCGTGTGTCATCGTACATGTACTACATGTACACGCTCT
CCCCCTACATGTACCCCCCCCCCCTTCGTGTGTCATCGTACATGTACTACATGTA
CACGCTCTCCCCCTACATGTACCCCCCCCCCCTTCGTGTGTCATCGTACATGTAC
TACATGTACACGCTCTCCCCCTACATGTACCCCCCCCCCCTTCGTGTGTCATCGT
ACATGTACTACATGTAC 500 pb

Marqueur
de taille
PCR en temps réel
Real Time PCR

Real Time PCR also called quantitative polymerase Chain Reaction (qPCR) is the monitoring
of amplification in Real Time, this permits the accurate quantification of the amount of
target sequence within the sample

is one of the most powerful and sensitive gene analysis techniques available.

Quantitative: because data is collected during the exponential growth (log) phase of PCR when the quantity of the PCR
product is directly proportional to the amount of template nucleic acid.

Adavantages:
Increased dynamic range of detection
No post-PCR processing
Detection is capable down to a 2-fold change
Collects data in the exponential growth phase of PCR
An increase in reporter fluorescent signal is directly proportional to the number of amplicons generated
The cleaved probe provides a permanent record amplification of an amplicon

Applications:
Quantitation of Gene Expression /Microarray/SAGE Verification/Quality Control and Assay Validation/Pathogen
detection /SNP Genotyping /Copy Number Variation/MicroRNA Analysis Viral Quantitation
Real Time PCR

Three samples with the


same quantity

Figure : Identical Samples Produce Different Quantities of Reaction Product by the Plateau Phase of PCR

Many types of chemistries used to detect PCR products using real-time PCR
instruments have been developed:
- SYBR® Green I dye chemistry
highly specific, double-stranded DNA binding dye
- High Resolution Melting dye chemistry
- TaqMan® chemistry (also known as “fluorogenic 5' nuclease chemistry”)
Uses a fluorogenic probe to enable the detection of a specific PCR product, significantly reducing background and false
positives.
You can label probes with different, distinguishable reporter dyes, which allows you to amplify two distinct sequences in
one reaction tube
- FRET (Fluorescence Resonance Energy Transfer FRET)
Real Time PCR
Real Time PCR,
Taqman assay
Real Time PCR,
Fluorescence Resonance Energy Transfer (FRET)
Real Time PCR

Les longueurs d’ondes d’Excitation et d’Emission des differentes sondes


(Excitation and Emission Wavelengths of different dyes)
Real Time PCR pour cellule unique

Single cell Transcriptome

Figure. Observation of cellular heterogeneity. (a)


mRNA expression of GAPDH from individual
Jurkat cells after siRNA knockdown. The levels fall
into roughly two categories: 50% and 100%
knockdowns (i.e. 50% and 0% expression
remained). Importantly, the average GAPDH
expression obtained from the measurement of 50
cells (~24%) was not representative of any
individual cell. D wang 2010 Trends in
Biotechnology
Real Time PCR
Enable hundreds of individual cells to be tested for the expression of hundreds of genes
Microarray
Many ways to study transcriptome:

1. by microarray on chip analysis

Chemical agent to deshybride DNA


Probes, synthetic oligonucleotides, short DNA molecules (cDNA, PCR
products)
spotted or synthesized in situ on the surface of :

- Glass microscope slide,


- a piece of nylon membrane,
- wafer of glass or silicon

Achieve a high density up to 300 000 oligonucleotides spotted per cm2 and the
position (X, Y) of each oligonucleotides in the slide is known)
- Incubation the Chip or array with labeled target DNA to allow hybridization to
take place

- The quantity of the fluorescence for each transcript is determined by


scanning the surface of the slide and quantifying the signal intensity:

Each position in the microarray or chip contains up 109 copies of the probe
molecules, this is higher than the anticipated copy number for any mRNA in the
small amount of the transcriptome to be studied

- To compare two samples, same quantity of RNA, normalization using


Housekeeping genes
Different samples

Different Genes
- High resolution can be achieved with fluorescent labeling and detection by
laser scanning

- Radioactive labels could be used and signal can be electronically detected by


phospho-imaging, but give low resolution

- Affymetrix, Agilent, Illumina (not only limited to transcriptome profiling)


Méthylation array
GoldenGate Methylation
1505 sondes (807 gènes)
148 E HT
Selected genes fall into various classes, including
tumor suppressor genes
oncogenes
genes involved in DNA repair 28.6% contain one CpG site per gene
cell cycle control 57.3% contain two CpG sites
differentiation 14.1% have three or more sites
apoptosis
X-linked
imprinted genes

Infinium Methylation (15.000 euro HT: 48 samples) 312 EURO/SAMPLE


High resolution: single CpG site resolution for 27,578 CpG sites spanning more than 14,000 genes
High throughput: multi-sample format allows for interrogation of 12 samples on a single BeadChip
Established assay: streamlined PCR-free Infinium Assay protocol
Low sample input: as low as 500 ng (pre-bisulfite conversion)
High-quality data: reproducibility >0.98 between technical replicates
Integrated data analysis: methylation data analysis is fully supported within BeadStudio and allows for integration with
gene expression data
Low-cost: as low as $225 per sample

Puces à façon (33,000 euro HT: 384 CpG, 96 samples) 343 EURO/SAMPLE
Principe
ADN méthylé ADN non méthylé
CH3
CCTAGCGCCCTAGAA CCTAGCGCCCTAGAA
GGATCGCGGGATCTT GGATCGCGGGATCTT

CH3 Bisulfate de sodium

CH3
UUTAGCGUUUTAGAA UUTAGUGUUUTAGAA
GGATUGCGGGATUTT GGATUGUGGGATUTT
CH3
Hybridation & quantification
CH3
UUTAGCGUUUTAGAA UUTAGUGUUUTAGAA
G A
Fluorescence de la sonde méthylé
Valeur de la methylation = valeur β =
Fluor de la sonde méthylé + Fluor sonde non méthylé

Exemple 1 Exemple 2

CH3 CH3
CG CG
CH3
CG CG
CH3
CG CG

CG CG

CG
CG
0 Valeur de la méthylation= 1/5=0,2 Valeur de la méthylation= 3/5=0,6 1
ADN méthylé (+) : 1
ADN non méthylé (-) : 0
ADN non modifié: bruit de fond
Reproductibilité

Bibikova M, Lin Z, Zhou L, Chudin E, Garcia EW, Wu B, Doucet D, Thomas NJ, Wang Y, Vollmer E, Goldmann T, Seifart C, Jiang W, Barker DL, Chee MS, Floros J, Fan JB.
High-throughput DNA methylation profiling using universal bead arrays.
Genome Res. 2006 Mar;16(3):383-93. Epub 2006 Jan 31.
Clonage
Clonage
Insertion d’un ADN dans un vecteur, plasmide recombinant
Clonage
La ligation (Ligature)

• Les ADN ligases sont des


enzymes qui sont capables de
reconstituer la liaison
phosphoester entre le carbone
3’-OH et le phosphate-5’ de
deux nucléotides voisins sur
un brin d’ADN.
• Application dans la génie
génétique et le clonage de
molécule d’ADN.
Clonage
Transformation des bactéries par plasmide recombinant, clonage d’ADN
Séquençage
Séquençage, SANGER Method

Sequencing Reaction
with only one primer Forward or Reverse
Lack Hydroxyl Group:
Elongation is blocked

Amplification/
Purification
Target gene

X
1, Amplification of region of interest for sequencing

Up to 1000bp

2, amplified product purification


3, Sequencing reaction
• L’ En utilisant des amorces spécifiques (Fw ou Rv pas les deux en même temps), on
fait synthétiser un brin complémentaire de l’ADN à lire, en présence d’une faible
proportion de didésoxyribonucléotides
• L’ADN polymérase lorsqu’elle a incorporé un tel didésoxyribonucléotide ne peut plus
continuer la synthèse faute d’extrémité 3’OH libre. Il se forme donc une multitude de
brin complémentaires inachevés, chacun terminé par un didésoxyribonucléotide
caractéristique de la base de ce dernier nucléotide.

• En séparant par électrophorèse ces fragments complémentaires on sépare dans le gel


chacun des fragments, du plus petit au plus grand
• Les didésoxyribonucléotides sont marqués d’un radical fluorescent différent pour
chaque base.
• En séparant par électrophorèse ces fragments complémentaires on sépare dans le gel
chacun des fragments, du plus petit au plus grand et on les détecte au passage par un
faisceau laser qui excite la fluorescence et une cellule photoélectrique qui lit la lumière
émise à chacune des longueurs d’onde des fluorescences caractéristiques des quatre
bases.
• L’ordinateur reçoit donc une série de mesure d’intensité lumineuses en forme de pics
correspondant au passage de chacun des fragments : en interprétant la couleur de la
fluorescence de chaque pic l’ordinateur écrit la séquence du DNA.

Electrophorèse
Gel plat / capillaire

AGCTA T
Analyse automatique
AGCT A
A G C T A T
AGC T dépot détection

AG C
A G

A
Electropherogram

Vous aimerez peut-être aussi