Vous êtes sur la page 1sur 8

Revista da Sociedade Brasileira de Medicina Tropical ARTIGO

31(1):19-26, jan-fev, 1998.

Diagnóstico de infecção congênita e perinatal por


citomegalovírus utilizando a reação
em cadeia da polimerase
Diagnosis of congenital and perinatal cytomegalovirus infection
by using the polymerase chain reaction

Aparecida Yulie Yamamoto, Victor Hugo Aquino, Luis Tadeu Moraes


Figueiredo e Marisa Marcia Mussi-Pinhata

Resumo Aplicou-se uma reação em cadeia da polimerase (PCR) no diagnóstico de infecção


congênita e perinatal por citomegalovirus, comparando-a com a técnica de isolamento viral em
cultura celular. Foram processadas 305 amostras de urina de crianças de 0 a 6 meses, por ambas
as técnicas. Utilizou-se na PCR os primers que amplificam parte do gene codificador do principal
antígeno precoce imediato de CMV. Detectou-se virúria em 47 amostras por PCR e comparando os
resultados com aqueles obtidos pelo isolamento viral, observou-se copositividade de 89,6% e
conegatividade de 98,5%. Estas amostras positivas tiveram o resultado confirmado por PCR
utilizando outros primers que amplificam regiões dos genes codificadores das glicoproteínas B e H
de CMV. O diagnóstico de infecção congênita e perinatal por CMV pela PCR mostrou sensibilidade
comparável à do isolamento viral e o uso de vários primers conferiu alta especificidade ao teste.
Palavras-chaves: Citomegalovirus. Diagnóstico da citomegalovirose. Reação em cadeia da
polimerase. Infecção congênita e perinatal.

Abstract The practical application of a polymerase chain reaction (PCR) amplification for the
diagnosis of congenital and perinatal cytomegalovirus (CMV) infections was evaluated. Three
hundred five urine samples were tested by PCR and conventional virus isolation in cell culture. Viruria
was detected in 47 urine samples by PCR using a primer pair which amplifies part of the major
immediate-early (MIE) CMV genome. The PCR compared to virus isolation showed 89,6% sensitivity,
98,5% specificity and 91,5% positive predictive value. PCR with primer pairs amplifying parts of the
glycoprotein B and glycoprotein H genes of CMV were used for confirmation of the positivity of the
47 urine samples. We concluded that this CMV PCR assay in urine has a suitable sensitivity for the
diagnosis of congenital and perinatal infections and its specificity is highly increased by use of more
than one pair of primers among the ones we used.
Key-words: Cytomegalovirus. Cytomegalovirus diagnosis. Polymerase chain reaction. Congenital
and perinatal infection.

Unidade Multidisciplinar de Pesquisa em Virologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP.
Trabalho financiado parcialmente pela FAPESP e CNPq.
Endereço para correspondência: Drª Aparecida Yulie Yamamoto, Unidade Multidisciplinar de Pesquisa em Virologia, FMRP/USP,
Av. Bandeirantes 3900, Campus da USP, Bairro Monte Alegre, 14049-900 Ribeirão Preto, SP. Fax (016) 633-6695.
Recebido para publicação em 03/01/97.

19
Revista da Sociedade Brasileira de Medicina Tropical 31:19-26, jan-fev, 1998.

Os citomegalovirus (CMV) representam período de 1993 a 1995. Também, utilizou-se


atualmente os agentes etiológicos mais comuns amostra do protótipo de CMV humano cepa AD
de infecção congênita e perinatal em diversas 169 em fluido da cultura de fibroblastos
partes do mundo. A infecção congênita ocorre humanos.
em 0,2 a 2,2% dos recém-nascidos, com Isolamento viral na urina em cultura de
incidência maior em populações de classe fibroblastos humanos com identificação do
sócio-econômica baixa1 18 23. A infecção perinatal, CMV por imunofluorescência usando anticorpo
como resultado da transmissão durante o parto, monoclonal 10 20. Cem µl de urina fresca tratada
pelo leite materno ou por transfusões de sangue, por 1 hora com amicacina (500µg/ml) eram
é muito freqüente, com incidência de 5 a 38%1 15. inoculados em duplicata nas monocamadas de
Os CMV pertencem ao gênero uma linhagem celular diplóide de fibroblastos
Citomegalovírus, subfamília ß-Herpesvirinae humanos, cultivadas em meio mínimo essencial
da família Herpesviridae. Medem 200nm e com sais de Earle. As células eram mantidas em
possuem envelope, tegumento e capsídio microplacas plásticas de 24 orifícios, a 37oC e
protéico com simetria icosaédrica. Seus genomas em estufa de CO2. As culturas celulares eram
são constituídos por ácido desoxirribonucleico observadas diáriamente em microscópio
de fita dupla contendo cerca de 230000 pares invertido (Zeiss, Alemanha), por período de até
de bases3 14. 30 dias, buscando detectar a infecção por CMV
Na compreensão da história natural da através da visualização de efeito citopático
citomegalovirose grandes avanços tem ocorrido. (ECP) característico. Neste caso, o ECP é
Sabe-se que a infecção congênita por CMV definido pela presença de células grandes e
pode resultar em sequelas importantes como a arredondadas, dispostas em lesões focais ou
surdez e o retardo do desenvolvimento neuro- por toda a monocamada e contendo numerosas
motor. A infecção perinatal pode estar associada granulações intranucleares e citoplamáticas.
a pneumonites de longa evolução e gravidade Fazia-se confirmação posterior do isolamento
variável. Entretanto, por não se procurar o viral nas células infectadas utilizando teste de
diagnóstico rotineiro e precoce de citomegalovirose imunofluorescência com anticorpo monoclonal
nessas crianças, fica prejudicada a intervenção específico para CMV conjugado à fluoresceína
com recursos terapêuticos que poderiam (Baxter, USA).
minimizar a gravidade dos casos e particularmente
Reação de amplificação gênica em cadeia
nas infecções congênitas, possibilitaria diminuir
catalisada pela polimerase (PCR) 5 6. Amostras
a intensidade das seqüelas e também definir
de urina frescas ou armazenadas a -70oC foram
uma população de risco para o desenvolvimento
de anormalidades futuras8 23. testadas por PCR inicialmente utilizando o par
de primers MIE 3 6 (Tabela 1) que permite a
O isolamento viral na urina é o método amplificação de uma região do gene que
clássico utilizado no diagnóstico da codifica o principal antígeno precoce imediato
citomegalovirose congênita e perinatal 20 . dos CMV. As amostras de urina nas quais foi
Porém, atualmente, métodos alternativos vem possível a detecção do ADN viral com os
sendo utilizados para a detecção de virúria por primers MIE, foram testadas novamente por
CMV4 13 21.
PCR para confirmação da presença viral. Nos
Objetivamos com este estudo avaliar a testes confirmatórios, em todas as amostras
aplicação no diagnóstico de infecção congênita préviamente positivas com o primer MIE,
e perinatal por CMV de uma reação em cadeia utilizou-se separadamente outros 2 pares de
da polimerase (PCR) utilizando 3 pares de primers, denominados gB e gH2 3 (Tabela 1),
iniciadores (primers) e comparar esta técnica que amplificam regiões do genoma dos CMV
com o isolamento viral. co d i fi ca d o ra s d a s g l i co p ro te ín a s B e H ,
respectivamente. Em 11 dessas amostras positivas,
MATERIAL E MÉTODOS foi realizado também um PCR multiplex,
Foram testadas 305 amostras da urina de utilizando conjuntamente os 3 pares de primers
204 crianças com idade entre 0 e 6 meses, que em um mesmo teste9. Os primers MIE foram
foram atendidas no Hospital das Clínicas da sintetizados no Laboratório de Hematologia do
Faculdade de Medicina de Ribeirão Preto da H C FMR P-U SP e o s primers gB e gH por
Universidade de São Paulo (HCFMRP-USP), no GIBCO-BRL (USA).

20
Yamamoto AY et al

Tabela 1- Seqüência dos primers utilizados na PCR para CMV.


Primer Seqüência Tamanho do produto em pares de bases Localização no genoma
MIE 5’ CAGCACCATCCTCCTCTTCCTCTGG 3’ 434 171074 a 171508
MIE 5’ CCAAGCGGCCTCTGATAACCAAGCC 3’
gB 5’ GAAACGCGCGGCAATCGG3’ 293 a 296 81874 a 82176
gB 5’ TGGAACTGGAACGTTTGGC 3'
gH 5’ TGGTGTTTTCACGCAGGAA 3’ 215 109961 a 110174
gH 5’ CCACCTGGATCACGCCGCTG 3’

A PCR era efetuada acrescentando-se a 2µl RESULTADOS


da amostra de urina, 2,5µmol de cada um dos 4
Os resultados observados com os controles
trifosfatos de desoxinucleotídeo, 15 pmol de
positivo (fluido da cultura de fibroblastos
cada primer, 5µl de tampão contendo 5mM de
infectados com CMV cepa AD169) e negativo
Tris (pH 9,0), 750µM de MgCl2, 25mM de KCl e
(água deionizada), foram compatíveis em todos
água destilada e deionizada, completando um
os testes efetuados.
volume de 50µl. A mistura era incubada a 94oC
por 6 minutos (hot start), adicionava-se 1U de Detecção do CMV na urina. Confor me
Taq ADN polimerase (Pharmacia) e a mesma mostrado na Tabela 2, das 305 amostras de
era submetida a 40 ciclos de amplificação, em urina testadas, isolou-se o CMV em 48 (15,7%)
ciclador térmico (Techne, Inglaterra), a 95oC por e a amplificação de ADN do CMV com o par de
60 segundos, 55oC por 90 segundos e 72oC por primers MIE foi possível em 47 (15,4%). Em 5
120 segundos, seguidos ao final por 3 minutos a urinas das quais o CMV foi isolado, não se
72oC. Utilizou-se como controle positivo da PCR conseguiu amplificação do DNA viral e em 4
fluido da cultura de fibroblastos humanos amostras em que a PCR foi positiva, o vírus não
infectados com CMV cepa AD169 e como controle foi isolado. Assim, em 52/305 (17%) das urinas
negativo usou-se água deionizada. foi possível a detecção do vírus, por isolamento
e/ou por PCR e, destas, 43/52 (82,7%) foram
Após eletroforese em gel de agarose a 2%,
positivas por ambas as técnicas.
os produtos da PCR eram corados em solução
de brometo de etídio e visualizados à luz ultra-
violeta. Tabela 2 - Comparação entre resultados do isolamento viral e da
PCR.
Titulação do CMV AD169. Diluições decimais Isolamento Isolamento
e seriadas, até 1:1000, da amostra de CMV cepa viral positivo viral negativo Total
AD169 foram inoculadas, em quadruplicata, PCR positivo 43 4 47
10µl por orifício, numa microplaca de 96 PCR negativo 5 253 258
orifícios contendo monocamadas de fibroblastos Total 48 257 305
χ2 = 233,72 e p < 0,0001
humanos. As colônias foram observadas no 15º
dia pós-inoculação quando determinou-se os
orifícios em que as monocamadas apresentavam As 52 amostras urinárias, nas quais a virúria
ECP característico. Com base nesta leitura do foi detectada por isolamento e/ou PCR, eram de
teste, calculou-se o título viral em dose infectante 9 recém-nascidos com diagnóstico de infecção
para 50% das culturas celulares (TCID 50 ), congênita e de 15 lactentes com infecção perinatal
utilizando a técnica de Reed Muench11. As mesmas por CMV. Foram analisadas pelo menos 2
diluições decimais e seriadas, até 1:1000, da amostras da urina de cada uma destas crianças.
semente do CMV cepa AD169 foram testadas por
Comparação da PCR utilizando primers
PCR, em quadruplicata, utilizando os 3 pares
MIE e o isolamento viral. Com base nos números
de primers.
mostrados na Tabela 2, a copositividade entre
Análise estatística. Os resultados dos testes isolamento viral e PCR foi de 89,6% e a
PCR foram comparados com os obtidos pela conegatividade de 98,5%. O valor preditivo
técnica padrão, o isolamento viral, utilizando positivo da PCR para o isolamento viral foi de
tabelas 2 x 2, com determinação da sensibilidade 91,5% e o valor preditivo negativo de 98%. A
e da especificidade do método. Análise da concordância entre os dois testes foi de 97%.
associação entre PCR e isolamento viral foi feita Observou-se alta associação entre as técnicas
por teste qui-quadrado (p < 0,05). (χ2 = 233,72 e p < 0,0001).

21
Revista da Sociedade Brasileira de Medicina Tropical 31:19-26, jan-fev, 1998.

Resultados obtidos com os diferentes pares de primers simultâneamente. Produtos genômicos


de primers. Em todas as 47 amostras de urina de CMV amplificados com o par de primers MIE
positivas por PCR com os primers MIE, foi estão apresentados na Figura 1 e na Figura 2 os
possível a amplificação do ADN viral com os produtos amplificados em PCR multiplex com os
primers gB e gH, utilizados isoladamente. Em primers MIE, gB e gH.
11 amostras, nas quais foi realizado um PCR Titulação da amostra do CMV AD169 e
multiplex, ocorreu amplificação de 3 fragmentos análise da sensibilidade da PCR. A detecção da
distintos do ADN viral, obtidos com os 3 pares presença viral por PCR utilizando os primers

Figura 1 - Gel de eletroforese corado com brometo de


etídio mostrando na coluna 1 controle negativo (água
deionizada); colunas 2, 4 e 5 amostras de urina
negativas, colunas 3, 6, 7 e 8 amostras de urina
apresentando fragmento amplificado do ADN de CMV
com 430 pares de bases; coluna 9 controle positivo
(CMV AD 169); coluna 10 marcador de peso molecular.

Figura 2 - Gel de eletroforese corado com brometo de


etídio mostrando 3 fragmentos amplificados do
genoma de CMV, com 430, 296 e 215 pares de bases,
obtidos pela PCR com o uso simultâneo dos primers
MIE, gB e gH, respectivamente. Na coluna 8 encontra-
se o controle positivo (CMV AD169) e amostras
positivas de urina nas colunas 1, 2, 3, 4, 5 e 6. A coluna
7 corresponde ao controle negativo (água deionizada)
e a coluna 9 ao marcador de peso molecular.

22
Yamamoto AY et al

MIE e gB, nos testes com as diluições decimais observou-se uma sensibilidade 50 vezes maior
da amostra de CMV AD169, ocorreu até a d a PC R co m o s primers MIE e gB o que
diluição 1:100 e na PCR com o primer gH até a permitiria detectar a presença viral em amostras
diluição 1:10, conforme mostra a Figura 3. c o m t í t u l o v i ra l t ã o b a i x o q u a n t o 1 0 1,8
A amostra do CMV AD169 mostrou título de T C I D 5 0 / m l . Ta m b é m , o b s e r vo u - s e u m a
10 3,5 TCID 50 /ml, com base na detecção do sensibilidade 5 vezes maior da PCR com os
efeito citopático. Comparando este resultado primers gH, suger indo capacidade para
com aqueles obtidos por PCR nas diferentes detectar amostras virais com título de 102,8
diluições da mesma semente viral (Tabela 3) TCID50/ml.

Figura 3 - Gel de agarose mostrando produtos


amplificados a partir das diferentes diluições do CMV
AD169, com os 3 pares de primers pela PCR. Nas
colunas 2 (material puro), 3 (1/10), 4 (1/100) e 5
(1/1000) observa-se os resultados obtidos com os
primers MIE, nas colunas 6 (material puro), 7 (1/10), 8
(1/100) e 9 (1/1000) observa-se os resultados obtidos
com os primers gB e nas colunas 10 (material puro), 11
(1/10), 12 (1/100) e 13 (1/1000) observa-se os
resultados obtidos com os primers gH.

Tabela 3 - Positividade para CMV observada nas diferentes diluições da amostra de CMV AD169 pela inoculação em células (efeito
citopático) e pela PCR, avaliando separadamente os três pares de primers.
Diluições da amostra Efeito PCR com PCR com PCR com
de CMV AD169 citopático Primers MIE Primers gB Primers gH
nº % nº % nº % nº %
Não diluído 4 100 4 100 4 100 4 100
1:10 4 100 4 100 4 100 4 100
1:100 0 0 4 100 4 100 0 0
1:1000 0 0 0 0 0 0 0 0
Volume das diluições da semente viral inoculadas nas células: 10µl;
Volume das diluições da semente viral utilizadas na PCR: 2µl.

DISCUSSÃO
É conhecido que crianças com com infecção adquirida23. A detecção do CMV na
citomegalovirose excretam grandes quantidades urina de recém-nascidos nas 3 primeiras semanas
de vírus na urina e por períodos prolongados. de vida define a infecção congênita1 7 23. Por
As quantidades de vírus excretadas costumam outro lado, a infecção perinatal é diagnosticada
ser bem superiores às observadas em adultos quando crianças em que a virúria era negativa

23
Revista da Sociedade Brasileira de Medicina Tropical 31:19-26, jan-fev, 1998.

ao nascimento, passam a apresentá-la entre a reduz esta interferência com a ligação dos
4ª e 12ª semana de vida1 15 23. Assim, a observação primers e a amplificação do genoma viral.
da presença viral na urina é a técnica mais Assim, a metodologia simplificada da PCR que
comumente utilizada para o diagnóstico dessas utilizamos neste estudo permitiu realizar teste
infecções. sem nenhum tratamento prévio com a
Método clássico para a detecção de virúria, vantagem de evitar os complexos procedimentos
o isolamento viral, tem seu uso rotineiro para extração do DNA viral5 16 17 21. Em nosso
dificultado por necessitar recursos laboratoriais estudo, observamos 5 amostras com isolamento
dispendiosos que permitam a manutenção de positivo e PCR negativa. Acreditamos que,
culturas celulares de fibroblastos humanos e nestes casos, a presença de inibidores urinários
por exigir que as amostras de urina sejam tenha interferido nos resultados, reduzindo a
colhidas com assepsia rigorosa e inoculadas sensibilidade da PCR. Estas urinas pertenciam
logo após a coleta, uma vez que os CMV são a 4 crianças com idade entre 3 a 4 meses e
muito lábeis. Outro inconveniente desta por tanto, com teores ur inár ios de uréia
técnica é a demora na obtenção do resultado d o superiores aos observados nos recém-nascidos.
ex a m e, u m a ve z q u e o s C M V s ã o d e Neste trabalho, observamos uma adequada
replicação lenta, podendo levar semanas para o sensibilidade da PCR utilizando os 3 pares de
aparecimento do ECP20. A aplicação da PCR no primers. Em todos as urinas que tiveram
diagnóstico da infecção por CMV apresenta amplificação viral por MIE o teste mostrou-se
algumas vantagens sobre o isolamento viral. positivo quando utilizou-se gB ou gH. Também, a
Para o teste utiliza-se volumes diminutos de adequada sensibilidade da técnica pode ser
material (1 a 2µl) e o seu resultado pode ser observada nos experimentos com o CMV AD 169,
obtido em menos de 24 horas. Também, em que baixos níveis de vírus (101,8TCID50/ml)
as amostras clínicas a serem testadas por PCR mostraram-se detectáveis pelos primers MIE e
podem ser congeladas e armazenadas. gB. Nestes experimentos a sensibilidade de gH
Utilizamos na PCR os primers MIE, gB e gH mostrou-se 10 vezes inferior (Tabela 3 e Figura 3).
com base em estudos prévios mostrando que A confirmação dos resultados obtidos na
estes primers amplificam regiões distintas do PCR para CMV pode ser realizada através de
genoma altamente conservadas nas diversas hibridação com seqüência de nucleotídeos
cepas do vir us e, também, possuem alta específica para a região do genoma amplificada,
especificidade para CMV, não amplificando o marcada com isótopo radioativo ou enzima5 22.
ADN de outros herpesvirus2 5 8 16 17. Entretanto, tal técnica apesar de ser altamente
Analisando os resultados obtidos pela PCR específica, aumenta a complexidade e o custo
em nosso estudo e sua comparação com os do teste. A confirmação da seqüência dos
obtidos pelo isolamento viral, observamos nucleotídeos de CMV obtida por PCR, também
associação altamente significante entre as pode ser feita por técnica denominada nested
técnicas (χ2 = 233,72 e p < 0,0001) e resultados PCR, em que se produz nova amplificação
comparáveis, com sensibilidade (89,6%), genômica com o emprego de primers internos
especificidade (98,5%) e valor preditivo à seqüência inicialmente amplificada19. Em
positivo (91,5%) adequados. Demmler e nosso estudo, foi possível a confirmação da
colaboradores 6 , utilizando os primers MIE, PCR para CMV utilizando mais de um par de
analisaram por PCR urinas de recém-nascidos primers separadamente ou através de um PCR
com infecção congênita e comparando estes multiplex, em que os diferentes pares de
resultados com os obtidos pelo isolamento viral, primers são usados conjuntamente. Assim na
encontraram sensibilidade de 93%, especificidade PCR multiplex, utilizando 3 pares distintos de
de 100% e valor preditivo positivo de 100%, primers, amplificadores de regiões diferentes
valores semelhantes aos observados em nosso do genoma de CMV, conseguimos obter de
estudo. forma rápida, o resultado característico com a
Apesar de alguns trabalhos, como o de presença de fragmentos de tamanhos diferentes
Khan e colaboradores 12, demonstrarem que (Figura 2), relacionados especificamente a cada
existem inibidores na urina para a reação da um dos primers. Nesta situação, cada produto
PCR, como a uréia, sabe-se que os recém- amplificado corresponde a um controle interno
nascidos, habitualmente, possuem baixos teores da especificidade dos outros fragmentos
de uréia, lipídios e proteínas urinárias, o que detectados no mesmo teste, dispensando

24
Yamamoto AY et al

procedimentos posteriores para a confirmação 10. Gleaves CA, Smith TF, Shuster EA, Pearson GR.
destes produtos9. Rapid detection of cytomegalovirus in MRC5 cells
Portanto, a PCR tem uma grande aplicabilidade, inoculated with urine specimens by use of low speed
comparável ao isolamento viral no diagnóstico centrifugation and monoclonal antibody to an early
da citomegalovirose, particularmente na infecção antigen. Journal of Clinical Microbiology 19:917-19,
congênita e perinatal e o uso simultâneo de 1984.
mais de um par de primers na PCR pode 11. Hawkes RA. General principles underlying laboratory
aumentar a especificidade do teste, sua diagnosis of viral infections. In: Lennette EH, Schmidt
rapidez, praticidade e economia. NJ (eds) Viral, Rickettsial and Chlamydial Infections,
5th edition, American Public Health Association, New
REFERÊNCIAS BIBLIOGRÁFICAS
York, p.3-48, 1979.
1. Alford CA, Stagno S, Pass RF. Congenital and 12. Khan G. Inibitory effects of urine on the polymerase
perinatal cytomegalovirus infections. Reviews of chain reaction for cytomegalovirus DNA. Journal of
Infectious Diseases 12:745-752, 1990.
Clinical Pathology 44:360-365, 1991.
2. Barber L, Egan JJ, Lomax J, Yonan N, Deiraniya AK,
13. Landini MP. New approaches and perspectives in
Turner AJ, Woodcock AA, Fox AJ. Comparative study
cytomegalovirus diagnosis. Progress in Medical
of three PCR Assays with antigenaemia and serology
Virology 40:157-177, 1993.
for the diagnosis of HCMV infection in thoracic
transplant recipients. Journal of Medical Virology 14. Mocarski Jr ES. Cytomegaloviruses and their
49:137-144, 1996. replication. In: Fields BN, Knipe PM (eds) Fields
3. Chee MS, Bankier AT, Beck S, Bohni R, Brown CM, Virology, 3th edition, Raven Press, New York, p. 2447-
Cerny R, Horsnell T, Hutchison CA, Kouzarides T, 2492, 1996.
Martignetti JA, Preddie E, Satchwell SC, Tomlinson P, 15. Machado CM, Fink MCDS, Vilas Boas LS, Sumita
Weston KM, Barrel BG. Analysis of the protein-coding LM, Weinberg A, Shiguematsu K, Souza IC,
content of the sequence of human cytomegalovirus Casanova LD, Pannuti CS. Infecção perinatal pelo
strain AD169. Current Topics Microbiology and citomegalovirus em hospital público do
Immunology 154:125-169, 1990. município de São Paulo: estudo prospectivo. Revista
4. C h o u S. N ew e r m e t h o d s fo r d i a g n o s i s o f Instituto de Medicina Tropical de São Paulo 33:159-
cytomegalovirus infection. Reviews of Infectious 166, 1991.
Diseases 12:727-736, 1990. 16. Olive DM, Mulfi SA, Simsek M, Fayez H, Nakib WA.
5. Costa SCB. Citomegalovirus em transplantados Direct detection of human cytomegalovirus in urine
renais: Diagnóstico pela reação em cadeia da specimens from renal transplant patients following
polimerase (PCR) e impacto clínico. Tese de polymerase chain reaction amplification. Journal of
doutorado. Universidade Estadual de Campinas, Medical Virology 29:232-237, 1989.
Campinas, SP, 1993.
17. Olive DM, Simsek M, Al-Mufti S. Polymerase
6. D e m m l e r G J. S u m m a r y o f a w o r k s h o p o n
Chain Reaction Assay for detection of human
sur veillance for congenital cytomegalovirus
cytomegalovirus. Journal of Clinical Microbiology
diseases. Reviews of Infectious Diseases 13:315-
27:1238-1242, 1989.
329, 1991.
18. Pannuti CS, Vilas-Boas LS, Angelo MJO, Carvalho
7. Demmler GJ. Congenital cytomegalovirus infections.
RPS, Segre CM. Congenital cytomegalovirus
Seminars in Pediatric Infectious Diseases 5:52-55,
1994. infection. Occurrence in two socioeconomically
distinct populations of a developing country. Revista
8. Demmler GJ, Buffone GJ, Schimbor CM, May RA.
Instituto Medicina Tropical São Paulo 27:105-107,
Detection of cytomegalovirus in urine from newborns
1985.
by u s i n g Po l y m e r a s e C h a i n R e a c t i o n D N A
amplification. Jour nal of Infectious Diseases 19. Porter-Jordan K, Rosenberg EI, Keiser JF, Gross JD,
158:1177-1184, 1988. Ross AM, Nasim S, Garrett CT. Nested Polymerase
9. Edwards MC, Gibbs RA. Multiplex PCR. In: Chain Reaction Assay for the detection of
Dieffenbach CW, Dveksler GS (eds) PCR Primer a cytomegalovirus overcomes false positives
Laboratory Manual. Cold Spring Harbor caused by contamination with fragmented DNA.
Laboratory, New York p. 157-171, 1995. Journal of Medical Virology 30:85-91, 1990.

25
Revista da Sociedade Brasileira de Medicina Tropical 31:19-26, jan-fev, 1998.

20. Reynolds DW, Stagno S, Alford CA. Laboratory 22. Spector S, Rua JA, Spector DH, McMillan R.
diagnosis of cytomegalovirus infections. In: Lennette Detection of human cytomegalovirus in clinical
EH, Schmidt NJ (eds) Viral, Rickettsial and specimens by DNA-DNA hybridization. Journal of
Chlamydial Infections, 5o edition, American Public Infectious Diseases 150: 121-126, 1984.
Health Association, New York, p.3-48, 1979. 23. Stagno S, Pass RF. Congenital and perinatal
21. S m i t h K L , D u n s t a n R A . P C R d e t e c t i o n o f cytomegalovirus infections. Seminars in Perinatology
cytomegalovirus: a review. British Journal of 7:31-42, 1983.
Haematology 84:187-190, 1993.

26