Vous êtes sur la page 1sur 235

Université d’Aix-Marseille

Centre de Recherche en Cancérologie de Marseille

École Doctorale Science de la Vie et de la santé (ED62)


Spécialité Pathologie Humaine
Option Oncologie

Présentée et soutenue publiquement par

Mr Brice CHANEZ

Le 18 mai 2018

Pour obtenir le grade universitaire de Docteur en Sciences

Les protéines associées aux microtubules participent à la


régulation de la migration tumorale et de la dégradation de
la matrice par les cellules cancéreuses

Devant le jury composé de


Dr Anne BLANGY Centre de Recherche en Biologie cellulaire de Montpellier Rapporteur
Dr Karine MONIER Centre de Recherche en Cancérologie de Lyon Rapporteur
Dr Olivier TREDAN Centre Léon-Bérard-
Centre de Recherche en cancérologie de Lyon Examinateur
Pr Anthony GONCALVES Institut Paoli-Calmettes
Centre de Recherche en Cancérologie de Marseille Examinateur
Dr Sylvie THUAULT Centre de Recherche en Cancérologie de Marseille Examinatrice
Dr Ali BADACHE Centre de Recherche en Cancérologie de Marseille Directeur de Thèse
Résumé

Décrypter les mécanismes qui régulent la cascade métastatique aboutissant à la formation de métastases,
principale cause d'échec thérapeutique chez les patients atteints de cancer, est primordial et conditionne le
développement de nouvelles approches thérapeutiques. La migration et l’invasion des cellules tumorales
sont requises pour l’étape de dissémination vasculaire. Les microtubules (MT), un constituant important du
cytosquelette contribue à la division cellulaire ce qui en fait une cible thérapeutique de choix en onco-
hématologie. Dans les cellules en interphase, l’extrémité " + " des MT explore le cytoplasme et s'ancre aux
structures cellulaires périphériques. Durant ma thèse, j'ai essayé de comprendre comment les protéines
régulant l’extrémité « + » des MT (+TIP), leur dynamique et l’ancrage à la membrane, contribuent à la
migration cellulaire et à la dégradation de la matrice extracellulaire. Nous avons d'abord évalué l'impact
d'un nouvel agent thérapeutique dépolymérisant les MT, l'éribuline, sur la migration de cellules de cancer
du sein. A doses infracytotoxiques, l’éribuline induisait une diminution de la vitesse de croissance et un
défaut de capture des MT au cortex cellulaire, entrainant la perturbation de la migration en réponse à un
stimulus chimiotactique. Des concentrations croissantes d'éribuline entrainaient la dissociation progressive
des +TIP EB1, CLIP170 et ch-TOG de l'extrémité + des MT et que la dissociation de la tubuline polymérase
ch-TOG précédait la perte des autres +TIP. Nous avons finalement démontré que la déplétion de ch-TOG
affectait la croissance, la capture des MT et la migration cellulaire, de la même manière que l'éribuline.
Nous proposons donc que les effets de l'éribuline sur la dynamique des MT et la migration cellulaire, soient
médiés par son action sur l'extrémité " + " des MT et le déplacement de ch-TOG.
Dans un deuxième temps, nous avons examiné le rôle des +TIP dans la dégradation par les cellules
tumorales de la matrice extracellulaire, une étape précoce de l'invasion médiée par le biais de protrusions
riches en actine et spécialisées dans la dégradation matricielle, les invadopodes. Nous avons identifié par
déplétion systématique des +TIP avec des siARN spécifiques, qu'EB1 et deux de ses partenaires, APC et
ACF7, régulaient négativement l’assemblage et l’action des invadopodes, dans les lignées tumorales
mammaires MDA-MB-231 et MCF10A+TGFβ. L'inactivation d'autres partenaires d'EB1 comme CLASP1
et 2, et CLIP170 ne modifiaient pas les capacités de dégradation des cellules. Ces résultats montrent que
les différents partenaires d'EB1 ont des effets différents dans la formation des invadopodes. Ils laissent
aussi entrevoir l'existence d'un complexe fonctionnel incluant EB1, APC et ACF7, dont le rôle est démontré
dans la capture des MT et la migration dirigée, et qui participerait à la régulation négative des invadopodes.
Il sera important d'en définir le mode d'action. En parallèle, nous avons mis en place une approche
protéomique systématique pour identifier de nouveaux acteurs de la formation des invadopodes. Nous
avons exprimé la protéine TKS5, spécifique et indispensable à l’action des invadopodes, fusionnée à la
biotine ligase BirA dans les cellules de cancer du sein ; puis identifié par biotinylation de proximité in situ,
les voisins proches de TKS5, au sein de l'invadopode. Nous avons validé cette approche et identifié de
nouveaux partenaires, dont une protéine associée aux MT. L'optimisation de cette approche pourra
permettre de valider la présence ou non de protéines candidates, notamment les +TIP, au sein de
l'invadopode, et apporter des précisions sur leur mode d'action.
Au total, les +TIP, par la régulation de la dynamique des MT, interviennent dans différentes étapes de la
cascade métastatique et développer des stratégies ciblées contre ces acteurs pourrait être pertinent dans la
prise en charge du cancer du sein.
Abstract

Identifying new mechanisms involved in metastatic spread, which is the leading cause of patient treatment
failure in oncology, is one of the major challenge for modern cancer science, and a prerequisite for the
development of new treatments. Cell migration and invasion are required for reaching and spread through
vessels. Microtubules (MT), a major element of the cytoskeleton, are well known for their contribution to
cell division and constitute one of the main targets for chemotherapy in onco-hematology. In interphase cells,
MT grow radially from the centrosome, their dynamic + ends exploring the cytoplasm until reaching and
anchoring at peripheral cellular structures.

During my thesis, I have aimed to understand whether MT-associated proteins of the +TIP (+ end tracking
protein) family, which are major regulators of MT dynamics and anchoring, contribute to two essential steps
of metastasis: cell migration and degradation of the extracellular matrix.

We have first investigated the impact of eribulin, a new MT targeting agent, upon the migration of breast
cancer cells. We have observed that infra-cytotoxic doses of eribulin, which do not unpolymerize MTs, led
to reduced MT growth rate and defective MT capture at the cell leading edge, leading to disturbed
chemotaxis. Increasing doses of eribulin led to progressive loss of the EB1 and CLIP170 +TIP proteins from
MT +ends. We have however observed that, at the lowest concentrations used, the loss of the ch-TOG tubulin
polymerase from +ends preceded the loss of other +TIP. We have finally shown that ch-TOG silencing
mimicked the effects of eribulin low dose eribulin treatment on MT growth rate, MT capture and directed
cell motility. Thus, we propose that effects of eribulin on MT dynamics and cell migration are mediated by
its impact on MT + end and ch-TOG displacement.

We have then addressed the role of +TIP in breast tumor cell extracellular matrix degradation, an early step
of invasion mediated by invadopodia, actin-rich cell protrusions specialized in matrix degradation. We have
evaluated the contribution of EB1 and EB1-associated proteins to invadopodia assembly/disassembly cycle,
using specific siRNAs. We found that the knockdown of EB1 and of two of its partners, the APC tumor
suppressor and the ACF7 spectraplakin, was associated with increased matrix degradation and a higher
number of precursor and mature invadopodia, in both MDA-MB-231 breast tumor cells and TGFβ-treated
MCF10A mammary cells. On the contrary, EB1 binding proteins CLASP1 and 2 and CLIP170 had no impact
on matrix degradation. These results show that EB1-associated proteins have distinct roles in invadopodia
regulation. They also suggest that EB1-APC-ACF7 complex, whose function was already shown in MT
capture and directed cell migration, could be involved in regulating invadopodia function. The exact
mechanism by which this complex represses invadopodia remains to be addressed. In parallel, we
implemented an original proteomic approach in order to systematically identify proteins that contribute to
invadopodia. We constructed and expressed a protein fusing TKS5, a protein localized to invadopodia and
required for their assembly, and the biotin ligase BirA in invasive breast carcinoma cells. We then identified,
through in situ proximity biotinylation, close partners of TKS5 within invadopodia. We have identified
known TKS5-associated protein, validating the approach, and novel TKS5 partners, including a MT-
associated protein, which represent novel potential mediators of invadopodia function. When optimized, the
technique might also serve to validate candidate proteins including +TIP in invadopodia, and thus contribute
to deciphering their mode of action.

To conclude, +TIP, through their impact on MT dynamics, contribute to several steps of the metastatic
cascade, and might thus represent relevant therapeutic targets within metastatic breast cancer curative
strategy
Remerciements

Durant toute cette thèse j’ai beaucoup appris. D’abord du savoir scientifique et de la
rigueur dans la recherche mais également beaucoup du monde humain de la science. Je ressors
enrichi de toutes ces expériences qui seront bien évidemment à poursuivre !
Je remercie tout d’abord le Dr Ali Badache pour son accueil, sa confiance et ses
encouragements tout au long de ces presque 5 années dans son équipe (plus long que mon
internat, si si !). Merci Ali pour cet encadrement à la fois libre et rigoureux sur le travail,
pour les discussions faciles et pertinentes et les corrections de mes écrits toujours en
dernière minute.
Je remercie chaleureusement le Dr Pascal Verdier-Pinard pour son encadrement dès le
début de mon aventure scientifique et microtubulesque. J’ai acquis des bases solides pour
la suite.
Un grand merci au Dr Sylvie Thuault pour avoir su tout de suite co-encadrer ce projet
tout en développant le pôle invasion de l’équipe. Merci pour ton efficacité et ton
pragmatisme qui ont bien fait avancer les choses.
Merci au Pr Gonçalves pour ses conseils, sa disponibilité et son soutien tout au long de
ce projet. Et merci d’avoir accepté (encore) de faire partie de mon jury de thèse.
Merci aux Dr Anne Blangy et Karine Monier pour s’être intéressé à ce projet et avoir
accepté de l’évaluer en tant que rapporteurs (et encore désolé du retard du manuscript).
Merci au Dr Olivier Trédan d’avoir accepté de siéger à ce jury et de prendre le temps de
s’intéresser à ce travail pour me donner sa vision médico-scientifique en tant
qu’examinateur.
Merci aux Dr Arnault Sergé et Olivier Destaing pour avoir donné leur avis et critiqué
l’avancement de mes travaux au cours d’un comité de thèse très enrichissant.
Merci au Pr Jean-Paul Borg pour son accueil et son soutien au sein du CRCM et plus
globalement merci à tous ceux que j’ai pu côtoyer, avec qui j’ai pu échanger sur des sujets
scientifiques ou non au sein du centre, comme quoi un médecin peut s’intégrer chez les
scientifiques !
Merci au Pr Viens pour son soutient tout au long de ce projet de thèse.
Merci à Aurélie et Habib, mes deux co-thésards et soutiens de tous les jours, vous
m’avez énormément apporté et appris durant ce bout de chemin fait ensemble, que ça
continue ! Merci à Danièle Salaün pour son aide, sa bonne humeur et l’actu
humoristique/culinaire et d’art contemporain (entre autres) quotidienne.
Merci à Sylvain et Philippe les deux comPEREs de l’hôpital, de l’IPC, des soirées
arrosées ou couche-culotte. Merci pour votre amitié
Merci à Marie et Gabrielle mes deux co-internes de la reprise en clinique, merci de
m’avoir supporté pendant cet écriture, soutenu et permis de m’échapper du service. Sans
cela les nuits auraient été encore plus courtes ! Merci à tous mes collègues pour leur soutien,
les récupérations de gardes et d’astreintes de dernière minute …
Merci à mes amis, mes parents et à ma sœur pour leurs soutien inconditionnel

Merci à la Fondation pour la Recherche Médicale et son soutien financier durant deux
années pour me consacrer à plein temps à mes travaux.

Merci à ma Marion d’être là pour moi, pour ton soutien indéfectible surtout sur la
fin mouvementée, toi et notre petit Théliau vous êtes mes rayons de soleil.
Avant-propos
La médecine en générale et plus particulièrement l’oncologie médicale évoluent de
manière permanente au gré des nouvelles technologies, des courants de pensée mais surtout
sous l’influence des sciences du vivant. Les avancées majeures dans la prise en charge des
cancers de ces 15 dernières années émanent surtout de l’étude et du décryptage des
mécanismes mis en place par les cellules tumorales pour proliférer et se propager. Cibler ces
« hallmarks of cancer » est actuellement la manière de penser la lutte contre le cancer.
L’avènement des molécules pharmaceutiques dites ciblées et plus récemment de
l’immunothérapie en sont de parfaits exemples.

La recherche en biologie doit actuellement faire partie intégrante de la formation


des cancérologues pour trois raisons : la première est l’évident échec thérapeutique auquel
l’oncologue fait face pour nombre de pathologies tumorales et en comprendre les raisons est
fondamental; la seconde est conditionnée par l’omniprésence de la biologie qui envahit la
sphère diagnostique et thérapeutique, que l’oncologue doit comprendre et intégrer de plus en
plus vite dans sa pratique pour proposer des traitements novateurs à la majorité des patients.
Enfin la troisième raison est la nécessité d’acquérir une vision globale de la pathologie
cancéreuse, pour rendre le concept anglo-saxon « from bench to bedside » de plus en plus
présent à l’ère de la médicine de précision.

Les techniques d’étude du cancer ont également largement évolué et la palette des
« -omics » n’est plus seulement applicable à des projets biologiques strictement fondamentaux
mais tendent vers une utilisation en pratique diagnostique ou de suivi, participant à la décision
thérapeutique pour la prise en charge de nombreuses pathologies. L’accès également au grand
public de certaines techniques issues des laboratoires (séquençage de l’exome, recherche de
cellules tumorales circulantes par exemple) et plus largement la diffusion rapide des
informations scientifiques par les médias et réseaux sociaux obligent le praticien à être capable
d’avoir une analyse critique et répondre aux questions/demandes croissantes des patients.

Cette vision globale est la force de la spécialité d’oncologue médical et il faut


pouvoir la revendiquer.

Les essais cliniques sont actuellement l’axe principal de développement des


nouvelles thérapeutiques anticancéreuses et sont réalisés sous la direction des médecins. Pour
permettre un développement stratégique et optimiser au maximum ces essais long et couteux
il convient de poser des questions biologiques pertinentes associées aux questions cliniques
pour pouvoir par exemple déterminer des biomarqueurs ou comprendre précisément la nature
des cibles thérapeutiques. Les essais guidés par la biologie sont également en plein essors
actuellement et y participer nécessite de solides connaissances scientifiques.

Intégrer une thèse de science dans ma formation d’oncologue médicale était donc
assez naturel dans une optique de compréhension et d’échange avec la discipline scientifique,
de mener pleinement un projet basé sur les mécanismes fondamentaux de la dissémination
métastatique et pour permettre par la suite d’avoir une aisance dans l’élaboration de projets
de recherche translationnelle, à l’interface entre les patients et le laboratoire.
Tables des abréviations
+TIP Plus End Binding Proteins
AAA ATPase Associated with number of cellular activities
ACM Agent ciblant les microtubules
AF Adhésions focales
APC Adenomatous Polyposis Coli
aTAT a-Tubulin Acetyl Transferase 1
CD2AP CD2-Associated Protein
ch-TOG Colonic-hepatic Tumor Overexpressed Gene Protein
CLASP Cytoplasmic linker associated protein
CLIP CAP-Gly domain Containing linker protein
EB1 End Binding Protein1
EEY Motif Acide Glutaminique x2 et tyrosine
EGF Epidermal Growth Factor
EGFR Epidermal Growth Factor Receptor
ER Estrogen Receptor
FGD1 Faciogenital Dysplasia 1
GAP GTPase Activating Protein
GDP Guanosine DiPhosphate
GEF Guanosine Exchanging Factor
GTP Guanosine DiPhosphate
HDAC6 Histone deacetylase 6
HER2 Human Epidermal growth factor Receptor 2
HGF Hepatocyte Growth Factor
K40 Lysine 40
MAP-4 Microtubule Associated Protein 4
MT Microtubule
MT1-MMP Membrane Tethered Matrix Metalloproteinase 1
NADPH Nicotinamine Adenin Dinucleotid Phosphate
NogoB Neurite Outgrowth Inhibitor B
PR Progesterone Receptor
ROS Reactive Oxygen Species
TEM Transition Epithélio-Mésenchymateuse
TGFb Transforming Growth Factor béta
TKS4 Tyrosine Kinase Substract with 4 SH3 domains
TKS5 Tyrosine Kinase Substract with 5 SH3 domains
TTL Tubulin Tyrosine Ligase
XMAP215 Xenopus Microtubule Assembly Protein
TABLE DES MATIERES
LE CANCER DU SEIN, UN MODÈLE PERTINENT POUR L'ÉTUDE DES PHÉNOMÈNES
MÉTASTATIQUES ........................................................................................................................................................ 1

EPIDÉMIOLOGIE DU CANCER DU SEIN .................................................................................................................................... 2


STRATÉGIES DE PRÉVENTION DE LA MALADIE MÉTASTATIQUE .......................................................................................... 5
a. Le dépistage ........................................................................................................................................................................5
b. Les traitements adjuvants du cancer du sein.....................................................................................................5
c. La sélection des patientes sur des critères biologiques .......................................................................................6
GÉNÉRALITÉS DANS LE TRAITEMENT DES CANCERS DU SEIN MÉTASTATIQUE ................................................................ 13
a. Chimiothérapie ............................................................................................................................................................... 13
b. Thérapies Anti-HER2 ................................................................................................................................................... 13
c. Inhibiteurs de la voie PI3K-mTOR............................................................................................................................... 14
d. Inhibiteurs des cycline dependant kinase 4 et 6 (Anti CDK4/6) ........................................................... 14
e. Le cas particulier du cancer du sein triple négatif....................................................................................... 14
MODE D’ACTION ET UTILISATION DES AGENTS DE CHIMIOTHÉRAPIE ANTI MICROTUBULE DANS LE CANCER DU SEIN
MÉTASTATIQUE............................................................................................................................................................................ 15

a. Principes généraux et classification des agents ciblant les microtubules ........................................ 15


b. Action sur le fuseau mitotique et arrêt de la division cellulaire ........................................................... 18
c. Action des ACM pendant l’interphase ....................................................................................................................... 19
d. Le développement d’un nouvel ACM : l’éribuline ............................................................................................ 19

PRÉSENTATION ET GRANDS PRINCIPES BIOLOGIQUES DE LA CASCADE MÉTASTATIQUE ......... 21

HISTORIQUE DES THÉORIES DE LA DISSÉMINATION MÉTASTATIQUE............................................................................... 22


LA CASCADE MÉTASTATIQUE .............................................................................................................................................. 23
LA TRANSITION ÉPITHÉLIO-MÉSENCHYMATEUSE ............................................................................................................. 25
LA MIGRATION DES CELLULES TUMORALES ....................................................................................................................... 27
a. La migration individuelle des cellules tumorales ......................................................................................... 27
b. La migration collective des cellules tumorales .............................................................................................. 29

DE LA TUBULINE AUX MICROTUBULES : DESCRIPTION D’UN COMPOSANT MAJEUR DU


CYTOSQUELETTE IMPLIQUÉ DANS LA MIGRATION DES CELLULES TUMORALE ET CIBLE
THÉRAPEUTIQUE DE CHOIX EN ONCOLOGIE .................................................................................................... 31

LES MICROTUBULES ............................................................................................................................................................ 32


a. La tubuline, unité de base du MT, entre conservation et variabilité .................................................. 32
b. Les modifications post-traductionnelles de la tubuline. ........................................................................... 33
c. L’instabilité dynamique des MT : une mécanique hautement régulée ..................................................... 38
d. Régulation de la dynamique des MT ................................................................................................................... 43
e. Mode d’action des ACM et site de fixation sur la tubuline ........................................................................ 57
LE RÔLE DES MICROTUBULES DANS LA MIGRATION DIRIGÉE ............................................................................................ 66
a. L’instabilité dynamique des microtubules permet la régulation de grandes fonctions
cellulaires 66
b. Le rôle des microtubules dans la migration cellulaire dirigée .............................................................. 66
LES INVADOPODES, DES STRUCTURES SPÉCIALISÉES DANS LA DÉGRADATION DE LA MATRICE
EXTRACELLULAIRE .................................................................................................................................................. 76

HISTOIRE ET DÉFINITION DES PROTRUSIONS CELLULAIRES PERMETTANT LE REMODELAGE MATRICIEL ..................... 77


LA MISE EN PLACE DES INVADOSOMES ............................................................................................................................... 79
a. L'induction des invadosomes................................................................................................................................... 79
b. Les constituants majeurs des invadopodes ...................................................................................................... 85
LE CYCLE DE VIE DES INVADOPODES .................................................................................................................................. 91
a. Phase d'initiation et formation d'un invadopode précurseur ................................................................ 91
b. L'invadopode mature .................................................................................................................................................. 92
c. Le désassemblage des invadopodes ........................................................................................................................... 94
FONCTION DES INVADOPODES IN VIVO............................................................................................................................... 96
RÔLES DES +TIP ET DES MT DANS LA RÉGULATION DES INVADOSOMES........................................................................ 97

PREMIERE PARTIE : ETUDE DE L’ACTION DE L’ÉRIBULINE SUR LA MIGRATION DES CELLULES


TUMORALES ............................................................................................................................................................ 114

INTRODUCTION PREMIÈRE PARTIE ................................................................................................................................... 115


ARTICLE : ERIBULIN TARGETS A CH-TOG-DEPENDENT DIRECTED MIGRATION OF CANCER CELLS ............................. 117
DISCUSSION PREMIÈRE PARTIE ....................................................................................................................................... 139

DEUXIEME PARTIE : LES PROTÉINES RÉGULANT LA DYNAMIQUE DES MICROTUBULES


MODIFIENT LA CAPACITÉ DES CELLULES DU CANCER DU SEIN À DÉGRADER LA MATRICE VIA LES
INVADOPODES ........................................................................................................................................................ 142

INTRODUCTION DEUXIÈME PARTIE ................................................................................................................................. 143


RÉSULTATS DEUXIÈME PARTIE ........................................................................................................................................ 146
DISCUSSION DEUXIÈME PARTIE ....................................................................................................................................... 160

TROISIEME PARTIE : ETUDE DES PROTÉINES COMPOSANT LES INVADOPODES PAR UNE
TECHNIQUE DE PROTÉOMIQUE GLOBALE ...................................................................................................... 168

INTRODUCTION TROISIÈME PARTIE ................................................................................................................................ 169


RÉSULTATS TROISIÈME PARTIE ....................................................................................................................................... 170
DISCUSSION TROISIÈME PARTIE ...................................................................................................................................... 178

CONCLUSION GÉNÉRALE ............................................................................................................................. 183

BIBLIOGRAPHIE ............................................................................................................................................ 184


Le cancer du sein, un modèle pertinent pour l'étude
des phénomènes métastatiques

1
Épidémiologie du cancer du sein

Le cancer du sein est actuellement le premier cancer touchant les femmes adultes
dans le monde, avec une incidence de 1,7 million de nouveaux cas par an ce qui représente un
diagnostic toutes les 18 secondes. Cette incidence est soumise à des disparités nationales avec
des taux élevés dans les pays les plus développés (92/100000 aux USA, 94,7/100000 en
France) et des taux moindres dans les pays moins industrialisés (27/100000 en Afrique). Une
augmentation d’incidence avait été observée entre 1980 et 2000 (+2,7% par an) mais celle-ci
semble en recul ces 10 dernières années (-1,5% de 2000 à 2012). Le cancer du sein est
également la première cause de mortalité par cancer dans le monde avec 500000 de décès par
an ce qui correspond à 15% des décès par cancer, tous cancers confondus (Siegel et al., 2014)

En France 54000 nouveau cas sont diagnostiqués chaque année, avec 78% des
cancers du sein décelé chez des femmes de plus de 50 ans et un âge moyen au diagnostic de
63 ans. Cependant 20% des cas touchent des femmes des moins de 50 ans, montrant une
maladie hétérogène et soumise à des facteurs de risques hormonaux, environnementaux et
génétiques.

Il s’agit du cancer le plus fréquent et la première cause de mortalité par cancer chez
la femme en France, avec 12000 décès imputables en 2012, ce qui en fait un problème majeur
de santé publique (2013) (Figure 1).

Depuis 2005 l’incidence et la mortalité annuelle baisse en moyenne de 1,5% par an.

Actuellement la majorité des cancers du sein est décelée avant qu’ils ne forment des
métastases avec en moyenne 15% (2-34%) de patientes présentant une maladie métastatique
d’emblée. Cependant l’on considère qu’un tiers des patientes vont rechuter et développer une
maladie métastatique.

2
Figure 1 : Vue globale de la mortalité par tumeur solide en France en 2015 (estimation) classée
par sexe et évolution de l’incidence et de la mortalité du cancer du sein sur les 30 dernières années

Le cancer du sein reste le cancer le plus meurtrier chez la femme (figure du haut) et son évolution
durant les 30 dernières années a vu son incidence augmenter par les politiques publiques de dépistages avec
cependant une diminution constante du taux de mortalité annuelle (figure du bas).

Issues du rapport InVS : Binder-Foucard F, Belot A, Delafosse P, et al.


Estimation nationale de l'incidence et de la mortalité par cancer en France entre 1980 et 2012 -
Partie 1 -Tumeurs solides.Partenariat Francim/HCL/InVS/INCa. Juillet 2012
Tableaux adaptés de http://www.e-cancer.fr/ressources/cancers_en_france/#page=243

La mortalité consécutive au cancer du sein est fonction du stade auquel il est décelé
: la survie à 5 ans des maladies localisées au sein sans envahissement ganglionnaire avoisine
les 95%, ce taux chutant à 80% lorsqu’un envahissement ganglionnaire régional est présent
(Ma and Jemal, 2013;) (Figure 2). Actuellement les malades atteintes de métastases pour un
cancer du sein peuvent bénéficier d’une survie prolongée mais seulement 20% des patientes
auront une survie supérieure ou égale 5 ans et une guérison au stade métastatique reste
exceptionnelle (Figure 2).

Il est donc primordial de développer des outils pour prévenir cette progression
métastatique et cela passe d’abord par une meilleure compréhension des processus
biologiques relatifs à la cellule tumorale métastatique.

3
Survie depuis le Survie à Intervalle
Stades Cliniques
diagnostic 5 ans (%) de confiance
Au diagnostic 58.1 57,0 -59,1]
Tous stades
confondus Si vivant à 3 ans 73.0 71.6 -74.3]

Au diagnostic 98.4 [98,3-98,5]


Localisé au sein
Si vivant à 3 ans 97.3 [97,2-97,5]
Localement Au diagnostic 84.1 [83,9-84.3]
avancé Si vivant à 3 ans 85.4 [85,1-85,6]
Au diagnostic 24.9 [24,3-25,4]
Métastatique
Si vivant à 3 ans 39.2 [38,0-40,3]

Figure 2 –Survie spécifique à 5 ans pour le cancer du sein selon le stade clinique

Le graphe montre le pourcentage de survie tous stades confondus et associé à chaque stade de la maladie
(localisé au sein, localement avancé avec envahissement ganglionnaire et métastatique). Le
pourcentage est estimé à trois périodes : au diagnostic (bleu ciel), à 1 an du diagnostic (bleu-gris) et à
3 ans du diagnostic (bleu foncé). Les données numériques (tableau) sont exprimées en pourcentage
dans le tableau avec l’intervalle de confiance 95%, pour les périodes diagnostic et à trois ans. Données
issues des registres américains du SEER (Surveillance, Epidemiology, and End Results Program),
données issues de la période 1998-2013.

Adaptée de 5-years SEER Conditional Relative Survival

https://seer.cancer.gov/csr/1975_2014/browse_csr.php?sectionSEL=4&pageSEL=sect_04_zfig.11.html

4
Stratégies de prévention de la maladie métastatique
a. Le dépistage

L’invasion des cellules tumorales vers les organes régionaux ou systémique grève
donc largement le pronostic des cancers du sein (Figure 2). La principale manière de prévenir
la survenue de métastase est la détection la plus précoce possible de tumeurs encore très
localisée et peu (ou pas) invasives. Pour les cancers du sein et du colon il existe un dépistage
national proposé à toute la population sélectionnée sur un critère d'âge à risque, soit entre 50
à 75 ans.

C’est un outil efficace qui permet à terme de diminuer le nombre de décès induit
par la maladie mais également la morbidité des traitements car une maladie très localisée est
beaucoup plus aisée à opérer qu’une maladie localement avancée, voire déjà disséminée. Ce
dépistage de masse instauré dans le cadre d’une politique de santé publique est proposé
gratuitement à toutes les femmes de 50 à 74 ans. Il consiste en la réalisation d’une
mammographie bilatérale et comparative des seins tous les deux ans en absence d’anomalie.
Si une anomalie est détectée, une biopsie guidée par l’imagerie est réalisée, permettant
d’affirmer avec certitude le caractère malin ou bénin de la lésion.

Sont exclues du dépistage les femmes présentant des facteurs de risque élevés et
très élevés de cancer du sein, comme la présence d’une mutation du gène BRCA1 ou BRCA2
ou encore un antécédent personnel de cancer du sein, qui ont une prise en charge
personnalisée.

Ce dépistage systématique a entrainé une augmentation de l’incidence des cancers


du sein, mais également de l’incidence des petites tumeurs permettant une guérison lorsque le
traitement local est optimal (Figure 1).
b. Les traitements adjuvants du cancer du sein

La prévention de la dissémination métastatique du cancer du sein est également au


cœur des stratégies actuelles de traitement des maladies localisées. Une fois la tumeur opérée
et le creux axillaire exploré par ganglion sentinelle avec ou sans curage ganglionnaire, des
traitements complémentaires visant à éradiquer une potentielle maladie micro-métastatique
non décelable, sont effectués en routine. Cela consiste en l’administration de chimiothérapie,
d’une radiothérapie du sein et des aires ganglionnaires homolatérales. A cela s'ajoute, selon le

5
phénotype tumoral, l’adjonction d’une hormonothérapie et/ou d’anticorps monoclonaux anti
ErbB2 (Cardoso et al., 2016).

Ces traitements sont lourds d’effets secondaires pour les patientes et la décision de
les administrer doit reposer sur des données solides quant au bénéfice sur la réduction du
risque de récidive métastatique, synonyme de maladie incurable. En effet des données
maintenant anciennes nous rappelle que traiter des patientes non sélectionnées par
chimiothérapie adjuvante n’augmente que très peu la survie globale (7-11% et 3-7% de
bénéfice en survie globale à 10 ans pour les femmes < 50 ans et de 51 à 69 ans respectivement)
et qu’il est nécessaire de baser ces traitements sur des facteurs prédictifs forts (1998).

Des recommandations internationales permettent d’aider le choix du traitement


adjuvant mais, pour certains sous types de cancer du sein, les bénéfices de ces traitements
restent encore peu connus et la décision finale découle de discussions en réunion de
concertation pluridisciplinaires (Cardoso et al., 2016). Il est donc nécessaire de décrypter
étroitement les différents sous-types de cancer du sein pour identifier des bio-marqueurs
prédictifs de l’invasion métastatique et/ou prédictifs de la réponse clinique aux thérapies
disponibles, et permettre de bien traiter les bonnes patientes.

c. La sélection des patientes sur des critères biologiques


• Critères histo-pronostiques

Parmi les carcinomes invasifs du sein, les plus fréquemment rencontrés sont les
carcinomes sans autre éléments de spécificité infiltrants dans 70% des cas (SAI,
anciennement dénommés carcinomes canalaires infiltrants) et les carcinomes lobulaires
infiltrants. Une mise à jour en 2012 a permis de spécifier leurs caractéristiques histologiques
propres (2012). S’ajoutent des formes mixtes associant les deux types histologiques, mais
également des contingents de carcinomes intra-canalaires qui doivent être décrits dans le
compte rendu anatomopathologique définitif. Il existe des formes histologiques moins
fréquentes comme les carcinomes tubulaires, mucineux, cribiliforme ou médullaire ; les
différenciations neuroendocrine ou sécrétoire sont exceptionnelles.

L’architecture normale du sein comprend des cellules épithéliales en contact avec


la lumière des canaux et des lobules servant à sécréter et à évacuer le lait, des cellules

6
myoépithéliales situées en position basale ou péribasale qui aident à l’évacuation lactée et des
cellules souches ou progénitrices pouvant se différencier vers ces deux types cellulaires. Il
existe des stades de différenciation intermédiaire pour ces cellules qui expriment alors des
marqueurs spécifiques. Les cellules épithéliales expriment les récepteurs hormonaux aux
œstrogènes et à la progestérone, les cytokératines CK8/18 et CK19. Les cellules
myoépithéliales expriment CK5/6, CK14, CK17 et des marqueurs musculaires lisses comme
l’actine musculaire lisse et p63. Les marqueurs phénotypiques des cancers du sein sont donc
en lien avec leur origine histologique initiale.

L’analyse de la tumeur permet de la caractériser au niveau histologique, mais


également de fournir des facteurs utilisés à des fins thérapeutiques et pronostic : l’expression
des récepteurs aux œstrogènes, à la progestérone, la présence d’une amplification du récepteur
HER2/ErbB2. S’ajoutent des éléments relatifs à la prolifération des cellules tumorales :
l’index de prolifération (Ki67), le grade d’Elson et Ellis associant le degré de différenciation
architecturale, le nombre de mitose par champ et l’aspect des noyaux. Ces éléments sont
fondamentaux dans l’appréciation du risque de récidive de la maladie sur le plan local et
métastatique et sur la décision de réaliser ou non des traitements complémentaires. Enfin les
caractéristiques macroscopiques de la tumeur à savoir sa taille, la présence d’emboles
tumoraux périvasculaires ou périnerveux et la présence de cellules isolées, de micro ou de
macrométastases dans les ganglions axillaires sont largement prises en compte pour apprécier
le risque de progression métastatique.

La découverte de ces récepteurs a permis d’étudier et de comprendre le rôle des


voies de signalisation stimulant l’oncogenèse (Gingras et al., 2017) (Figure3). Un exemple
particulièrement important dans l’histoire du cancer du sein a été La découverte de la
surexpression de l’oncogène HER2 dans 20% des cancers du sein et le développement
d’anticorps ciblant cette anomalie promotrice d’une maladie agressive a changé le destin de
ces patientes, permettant actuellement d’obtenir un contrôle de la maladie métastatique durant
de nombreuses années(Swain et al., 2015).

7
Figure 3 : Représentation schématique des voies de signalisation oncogéniques du cancer du
sein et focus sur HER2.

Sous l’effet de facteurs de croissance circulants se liant à leur portion extracellulaire, les récepteurs
de la famille de l’EGFR (EGFR, HER2, HER3) mais aussi IGFR1 et les récepteurs aux œstrogènes (ER) vont
s’activer et entrainer des cascades de signalisation.

ErbB2 ou EGFR2, récepteur épithélial tyrosine kinase de la famille EGFR, ne possède pas de ligand
connu mais peut s’hétéro-dimériser avec EGFR1/HER1 ou EGFR3/HER3 activés par leurs ligands respectifs, ce
qui va entrainer une phosphorylation de sa région C-terminale et activer les voies PI3K/AKT et MAPK/MEK.

En aval de ces signaux s’opère la transcription de gènes impliqués dans la prolifération, la survie,
l’angiogenèse et la dissémination des cellules tumorales. Le récepteur aux œstrogènes est également capable
d’activer la voie PI3K et il existe des possibilités d’activation croisées des voies conduisant au caractère
oncogénique des tumeurs mammaires. La cascade de signalisation PI3K-AKT-mTOR est centrale dans la
régulation de la croissance tumorale mammaire. PTEN joue un rôle de suppresseur de tumeur, inhibant
l’activation d’AKT par PI3K. La protéine p27 est également importante car elle régule négativement le cycle
cellulaire entrainant un arrêt de la prolifération cellulaire. La cycline D1 est souvent surexprimée dans le cancer
du sein et lorsqu’elle lie p27, lève son action inhibitrice, favorisant la prolifération. La voie mTOR joue
également un rôle majeur dans l’angiogenèse et le métabolisme

La voie des MAP kinases, souvent suractivée dans le cancer du sein, est nécessaire à la survie et la
prolifération cellulaire. Il existe de nombreuses redondances et d’interactions entre ces deux voies car elles

8
peuvent être activées par le même récepteur, selon la nature du ligand. Cette caractéristique fait que les nœuds
communs aux deux voies sont des cibles thérapeutiques de choix (inhibiteur de tyrosine kinase, anticorps
monoclonaux, rapalogues) mais explique également l’émergence de résistances, lorsqu’un traitement ciblé
bloque une voie, l’autre peut prendre le relais rétablissant le potentiel tumoral.

D’après Gingras I et al. Nat Rev Clin Oncol. 2017 HER2-positive breast cancer is lost in
translation: time for patient-centered research.

9
• Le portrait moléculaire des tumeurs mammaires

Depuis les années 2000, la classification intrinsèque des tumeurs du sein ou


classification moléculaire a été proposée par Perou et Sorlie et depuis s’impose comme une
classification à la fois plus précise sur le plan des altérations génétiques de la tumeur mais
également sur le plan pronostic.

Cette classification est issue de l’analyse en micro-array des transcrits issus de 8100
gènes humains (Perou et al., 2000). De cette analyse est ressortie quatre groupes de tumeurs
avec des altérations génomiques distinctes, à savoir les tumeurs avec un profil luminal A,
luminal B, de type basal et HER2 amplifié.

Cette classification a été validée sur plusieurs cohortes indépendantes de cancer du


sein retrouvant une différence significative en terme de survie entre ces 4 groupes (Pollack et
al., 2002; Sorlie et al., 2003; Sørlie et al., 2001). Les tumeurs de type luminal A sont
caractérisées comme des tumeurs peu proliférantes, surexprimant les récepteurs hormonaux
mais pas HER2 et possédant le meilleur pronostic. Les tumeurs de type luminal B ont un index
de prolifération élevé, expriment les récepteurs hormonaux et amplifient plus ou moins
HER2 ; leur pronostic est intermédiaire. Les tumeurs de type basal sont hautement
proliférantes, sans expression des récepteurs hormonaux ni d’amplification d’HER2 ; leur
pronostic est le plus sombre. Enfin les tumeurs de type HER2 présentent un pronostic
semblable aux tumeurs de type luminals B (Pollack et al., 2002; Sorlie et al., 2003; Sørlie et
al., 2001). Cette classification est à l’origine du développement de scores pronostiques
moléculaires.

Ø OncotypeDx

Il s’agit d’un test basé sur une signature génomique multigènes (21 gènes
recherchés-16 relatifs au cancer et 5 contrôles) qui est recherchée par RT-PCR sur les ARNm
des tissus cancéreux inclus en paraffine. Un score de récidive est alors calculé selon
l'expression génique et les patientes sont classées en 3 groupes de pronostic différents : score
de 1 à 18, risque de récidive très bas (98% de survie à 3 ans); score de 19 à 29, risque
intermédiaire; score>30, fort risque de récidive (Paik et al., 2004). Ce test, qui a été validé
prospectivement, est actuellement recommandé par les sociétés savantes (Duffy et al., 2017)
et validé par la Food and Drug Administration (FDA) pour déterminer le risque de récidive et

10
le bénéfice prédictible de l'adjonction de chimiothérapie chez des patientes présentant des
tumeurs avec des récepteurs hormonaux exprimés (RH+) sans atteinte ganglionnaire (N-
)(Sparano et al., 2015). Le groupe de très faible risque de récidive ne semble peu ou pas
bénéficier de la chimiothérapie adjuvante alors que celui de haut risque voit son pronostic
nettement amélioré par les cytotoxiques (Paik et al., 2006). Bien qu’il existe des données en
faveur d’un rôle pronostic de Oncotype Dx également pour les cancers de type N+, RH+,
HER2- (Albain et al., 2010), il n’est pas recommandé par toutes les sociétés savantes chez ces
patientes (Duffy et al., 2017). Il a récemment été inclus dans la classification TNM initiale
(Tumor Nodes Metastases) du cancer du sein (Hortobagyi et al., 2017). La conduite à tenir
pour les risques intermédiaires reste floue et nécessite des compléments de réponses qui seront
donnés par des essais actuellement en cours (RxPONDER, NCT 01272037).

Ø MammaPrint

Il s’agit également d’un test fournissant un score génomique de risque basé sur
l'analyse en micro-array des ARNm de 70 gènes impliqué dans des étapes clé de la
cancérogenèse, y compris l'invasion, qui s'opère sur du tissu frais ou inclus en paraffine. Les
résultats classent les patientes en deux groupes pronostic : faible (<10%) et haut risque de
récidive à 10 ans. Ce test, qui a été largement validé dans des essais randomisés prospectifs
(Drukker et al., 2013; Knauer et al., 2010a, 2010b), a montré une efficacité quant à sa capacité
à changer la prise en charge des patientes vis à vis de l'administration de chimiothérapie et
s'avère coût-efficace dans plusieurs systèmes de santé. Il est recommandé par certaines
sociétés (Duffy et al., 2017) pour la décision d'administrer de la chimiothérapie aux femmes
avec un cancer du sein RH+, HER2- et avec ou sans adénopathie positive, mais la société
américaine d'oncologie (ASCO) n'a pas inclus ce test dans ses recommandations et il n'est pas
approuvé par la FDA (Duffy et al., 2017).

Ø Prosigna (PAM 50)

Ce test mesure l’expression de 50 ARNm issus de gènes d’intérêt par la technologie


NanoString. Selon l’expression de ces gènes, un score de récidive de 1 à 100 est attribué aux
patientes. Les patientes N- son classée en bas risque (1-40), intermédiaire (41-60) ou haut
risque (61-100) de récidive et les N+ sont classées à bas (1-40) ou haut risque (41-100).
L’intérêt pronostic du score a été validé prospectivement et sa capacité à discriminer des
femmes à la fois N+ ou N-, nécessitant un traitement par hormonothérapie, a été étudié avec

11
succès prospectivement dans deux études (Dowsett et al., 2013; Gnant et al., 2014). L’intérêt
de la chimiothérapie a été étudié et Prosigna a été jugé digne d’intérêt pour aider à la décision
de traiter ou non par cytotoxiques les femmes N- et N+ (Duffy et al., 2017). De plus, ce test
serait d’un intérêt particulier pour prédire les récidives tardives après hormonothérapies
(Sestak et al., 2015).

Ø uPa/PAI1

Ce score ne repose pas sur une analyse génomique mais sur l’expression d’une
protéines. C'est un biomarqueur pronostic très intéressant car il concerne une sérine protéase
(urokinase plasminogen activator) et son inhibiteur (plasminogen activation inhibitor 1) qui
ont été retrouvé surexprimé dans les phénomènes d'invasion in vitro dans des modèles de
cancer du sein. L'analyse est réalisée selon un test ELISA validé (Femtelle IncTM) sur du tissu
frais ou fraichement congelé issu de biopsies de patientes. La présence d'un taux élevé des 2
protéines dans le tissu est un facteur de mauvais pronostic. Ce biomarqueur a été largement
validé chez les patientes n'ayant pas d'atteinte ganglionnaire, de manière prospective dans un
essai randomisé (Jänicke et al., 2001) et sur une cohorte de plus de 8000 patientes issues de
centres différents (Look et al., 2002). Ce test a également prouvé son efficacité en tant que
décisionnaire pour administrer ou non une chimiothérapie adjuvante (Harbeck et al., 2013).
Malgré cette validation extensive et exhaustive, sa facilité d’utilisation et son faible coût, et
l'attribution par les sociétés savantes d'une validation pour établir la décision de
chimiothérapie chez des patientes RH+, HER2-, N-, ce test est peu utilisé hors d’Allemagne,
probablement à cause de sa forte consommation en tissus frais (Duffy et al., 2014).

Ø La signature invasive humaine (IHS) et Menacalc

Une des critiques faites aux signatures moléculaires de l’ensemble du tissu est qu’elles
ne se focalise que sur des tumeurs RH+/HER2- et les gènes identifiés sont à quelque
exceptions près, impliqués dans les voies de signalisation des récepteurs hormonaux ou de
la prolifération cellulaire. Peu de gènes reflètent le potentiel invasif et métastatique des
tumeurs (MMP11-Cathepsine L2)
L’analyse de l’expression de gènes non plus dans toutes les cellules de la tumeur mais
sur des cellules tumorales recueillies après qu’elles aient envahi/migré dans des systèmes
in vivo murin a permis de développé des signatures dites invasives (IHS). De ces 445 gènes
surexprimés, la majorité touchent les voies relatives à la motilité cellulaire, le

12
développement embryonnaire/du développement, la transition épithélio-mésenchymateuse,
l’échappement à l’apoptose et la résistance au traitement (Patsialou et al., 2012). Le gène
de la protéine MENA (Mammalian-enabled) est particulièrement surexprimé dans l’IHS et
cette protéine est très impliqué dans l’invasion invadopode médiée et la relation avec les
cellules du microenvironnement aidant à l’invasion tumorale (Gertler and Condeelis, 2011;
Karagiannis et al., 2016; Roussos et al., 2011). Un score, Menacalc, a été développé à partir
des variant d’épissage pro invasifs de Mena et associé à la signature IHS (Agarwal et al.,
2012; Forse et al., 2015). Ce score est corrélé au pronostic mais pas encore validé
prospectivement, et exclusivement développé par une seule équipe, mais pourrait être
intéressant car incluant le potentiel invasif des cellules et la relation avec le
microenvironnement tumoral (Pignatelli et al., 2016; Robinson et al., 2009).

Généralités dans le traitement des cancers du sein métastatique

Lorsqu’une maladie métastatique est détectée, le traitement n’est plus basé sur la
résection chirurgicale, mais sur un traitement systémique incluant de l’hormonothérapie et/ou
de la chimiothérapie et/ou des anticorps monoclonaux, mais également des traitements ciblant
la voie mTOR ou les cyclines du cycle cellulaire ( Cardoso et al., 2016).

a. Chimiothérapie

S’il reste impératif de cibler les anomalies moléculaires, expression des récepteurs
hormonaux ou surexpression d’ErbB2, la chimiothérapie cytotoxique de type anthracyclines
(adriamycine, épirubicine, doxorubicine liposomale), les agents ciblant les microtubules (MT)
comme le paclitaxel, vinblastine, eribuline et les antimétabolites (capécitabine) sont les pierres
angulaires du traitement des maladies disséminées.

b. Thérapies bloquant le récepteur HER2

Actuellement, le ciblage du récepteur est indiqué à tous les stades de la maladie. Il


existe deux anticorps monoclonaux (le trastuzumab et le pertuzumab), deux inhibiteurs de
tyrosine kinase (le lapatinib et le neratinib (Martin et al., 2017)) et un anticorps conjugué à
une drogue anti-microtubule (le TDM-1) disponible sur le marché et utilisable en situation

13
métastatique et progressive après un traitement contenant du trastuzumab. Le double blocage
trastuzumab-pertuzumab est actuellement un standard en première ligne métastatique.

c. Inhibiteurs de la voie PI3K-mTOR

La voie de signalisation PI3K-AKT-mTOR (Figure3) a été identifiée comme une


voie d'échappement oncogénique chez des patientes présentant un cancer du sein ER+ mais
avec une résistance primaire ou acquise aux thérapies anti-hormonales. L'association d’une
anti-aromatase, l’exemestane avec l’everolimus, un anti-mTOR, a été approuvée chez ces
patiente présentant une maladie avancée hormono-résistante. Le développement d'autres
inhibiteurs de mTOR et d’inhibiteurs de PI3K (buparlisib, pictilisib) se poursuit mais avec des
limitations en terme de toxicité (Chopra and Turner, 2017; Di Leo et al., 2018).

d. Inhibiteurs des cyclines dependant kinase 4 et 6 (Anti CDK4/6)

Les dérégulations des verrous du cycle cellulaire sont une anomalie bien connue
dans les processus oncogéniques et le cancer du sein RH+ présente jusqu'à 50% de
surexpression de la Cycline D1 entrainant une anomalie de la voie Cycline D1-CDK4/6-
(Cyclin-dependent kinase 4 et 6)-Rétinoblastome (Rb). Cette anomalie inhibe la protéine Rb,
qui en temps normal inhibe la progression du cycle, amenant à une prolifération accrue.

Il existe actuellement un développement clinique avancé de trois inhibiteurs de


CDK4/6 (cycline dependant kinase 4 et 6), le palbociclib, le ribociclib et l'abemaciclib,
molécules similaires avec des affinités pour les cyclines différentes. Tous les trois ont montré
une amélioration de la survie en association avec le letrozole en 1ère ligne thérapeutique chez
des femmes ménopausées atteintes d’un cancer métastatique ou récidivant (Finn et al., 2016;
Goetz et al., 2017; Hortobagyi et al., 2016). Avec l’association palbociclib ou l’abemaciclib
et le fluvestran chez les femmes non ou en péri ménopause, des résultats similaires ont été
observés (Cristofanilli et al., 2016; Sledge et al., 2017). Les essais de phases III randomisée
vont bientôt être rapportés et l'utilisation de ces thérapeutiques devrait probablement
largement s'accroitre.

e. Le cas particulier du cancer du sein triple négatif

Le cancer du sein triple négatif (CSTN) est le « parent pauvre » du cancer du sein
car il s’agit d’une maladie sans récepteur actionnable identifié à ce jour. Le CSTN est
généralement une maladie agressive pouvant présenter une chimiorésistance rapide. L’analyse
14
des anomalies de réparation de l’ADN a permis d’identifier une proportion importante de
patientes présentant une instabilité génomique parmi le CSTN (Gonzalez-Angulo et al., 2011).
Des pistes sont actuellement étudiées pour valider l’utilisation du cisplatine ou des inhibiteurs
de PARP1 (poly adenosin repare protein 1 ), dont l’effet est spectaculaire sur les tumeurs ayant
des anomalies de la réparation de l’ADN, par recombinaison homologue, entre-autre. C’est
aussi le sous type de cancer du sein le plus immunogénique avec un infiltrat lymphocytaire
important (Stanton et al., 2016). Le CSTN pourrait bénéficier de l’apport des inhibiteurs de
« checkpoints » immunitaires (Kwa and Adams, 2018)

Malgré l’addition de ces nombreuses ressources thérapeutiques, le cancer du sein


métastatique présente un pronostic péjoratif. Il est donc nécessaire non seulement d’identifier
de nouveaux « drivers » oncogéniques mis en place par les cellules tumorales métastatiques
en vue de les cibler spécifiquement et d’épargner les tissus sains souvent déjà lourdement
prétraités avec des chimiothérapies, mais également d’ajouter de nouvelles armes à l’arsenal
thérapeutique pour allonger la survie et prévenir les phénomènes de résistance qui finissent
toujours par émerger sous la pression de sélection des thérapeutiques.

Mode d’action et utilisation des agents de chimiothérapie anti


microtubule dans le cancer du sein métastatique
a. Principes généraux et classification des agents ciblant les microtubules

Les agents de chimiothérapie ciblant les microtubules (ACM) ont une part
prépondérante dans le traitement du cancer du sein : les taxanes, agents stabilisateurs des MT,
sont utilisés en situation adjuvante, néoadjuvante et métastatique. Les vinca alcaloïdes, agent
dépolymérisant les MT, sont eux largement utilisés en situation métastatique (Cardoso et al.,
2016; Senkus et al., 2015)

Les ACM sont classés en deux principales familles selon leur mode d’action sur les
MT: les drogues induisant la stabilisation des MT (taxanes, épothilone, discodermolides,
eleuthérobine, laulimalides, péloruside A, sarcodictyins) ; et les drogues induisant la
dépolymérisation des MT ( Amos, 2011) (colchicine, combretastatine A4, vinca alcaloïdes,
estramustine, dolastatine) (Tableau 1).

15
Les deux principaux problèmes limitant l'utilisation de ces molécules sont leurs
toxicités neurologiques importantes et prolongées (Wozniak et al., 2018) et la résistance
développée à leur égard par les cellules tumorales (Kavallaris, 2010).

Récemment l'éribuline, un ACM dépolymérisant issu d'une éponge marine, a


obtenu une autorisation de mise sur le marché, en montrant une efficacité sur la survie des
patientes en échec des deux autres classes d'ACM (Cortes et al., 2011; Kaufman et al., 2015).
On peut également noter que l'emtansine (Maytensinoïde), un puissant ACM dépolymérisant,
couplé à l'anticorps monoclonal trastuzumab constituant le TDM-1 (KadcylaÒ-Roche) a été
approuvé dans le cancer du sein HER2+ avancé ( Verma et al., 2012).

Malgré le développement très rapide de multiples thérapies ciblant des anomalies


tumorales de mieux en mieux identifiées dans le cancer du sein, le développement des
nouvelles drogues de chimiothérapie anti-microtubule se poursuit. La meilleure
compréhension du mode d’action de ces molécules, notamment sur les MT de l’interphase,
permet désormais d’envisager leur utilisation dans des situation de résistance aux ACM
« classiques » ou bien à des fins anti-angiogéniques ou immuno-modulatrices (Dumontet and
Jordan, 2010) (Tableau 1).

16
Tableau 1 Présentation des différentes classes d’agents anti-microtubule et leurs
applications en clinique

D’après C Dumontet and MA Jordan, Nat Rev Drug Discov 2010 and JJ Field al Bioorg
Med Chem 2014

17
b. Action sur le fuseau mitotique et arrêt de la division cellulaire

L’action des ACM sur le fuseau mitotique entraîne un allongement de la durée de


la phase M du cycle cellulaire en bloquant ou retardant la transition métaphase-anaphase
(Jordan, 2002) (Figure 4). Cet allongement ne permet pas la survenue normale du point de
contrôle mitotique entrainant un arrêt de la mitose et une mort cellulaire par apoptose
(Denning and Hirose, 2014; Jordan and Wilson, 2004). Ce schéma d’action des ACM a été
longtemps tenu pour seul responsable de l’activité anti-tumorale des ACM. On sait maintenant
que ce mode d’action n’est pas tout à fait exact car l’arrêt de la mitose n’entraînerais pas
toujours une apoptose (Mitchison et al., 2017; Schimming et al., 1999) et le mécanismes de
régression tumoral induit par les ACM est probablement complexe et touche aussi les MT des
cellules en interphases (Komlodi-Pasztor et al., 2011; Mitchison, 2012).

Figure 4 Changements morphologiques des microtubules pendant le cycle cellulaire


Les MT (en vert) vont subir des changements morphologiques marqués pour leur permettre d’assurer leur
fonction au cours du cycle cellulaire. La dynamique des MT varie au cours du cycle cellulaire : plutôt lente en
interphase, la dynamique va s’accélérer lors de la mitose, ce qui rend les MT particulièrement sensibles aux
agents anti-microtubules. La majorité des ACM agissent sur le fuseau, le déstabilisant et entrainant l’arrêt de la
mitose qui aboutit à la mort cellulaire (selon plusieurs modalités). L’ADN +/- compactée est représentée en bleu
Adapté de M.Kavallaris, « Microtubules and resistance to tubulin-binding agents » nature Review Cancer 2010.

18
En effet, la régression rapide et parfois spectaculaire des tumeurs solides ne peut
être complètement due au blocage de la mitose, puisqu’il a été établi que l’index mitotique de
ces tumeurs est de l’ordre de 3 à 10% avec un temps de doublement tumoral de l’ordre de 3
mois (Komlodi-Pasztor et al., 2011; Mitchison, 2012). De plus, l’inhibition de protéines
spécifiques indispensable à la survenue de la mitose comme les kinésines (kinesin-5 ou
CenpE) ou les kinases (Aurora A et B ou la Polo-like kinase 1) n’entrainaient pas de régression
tumorale similaire à celle observée avec les ACM et le développement clinique de ces
molécules a été stoppé pour cause de non efficacité (Komlodi-Pasztor et al., 2012; Marzo and
Naval, 2013; Mitchison et al., 2017). Il est donc de plus en plus admis que l’action anti-
tumorale des ACM passe aussi par la perturbation des MT des cellules tumorales en interphase
(Field et al.)
c. Action des ACM pendant l’interphase

Par leur action, les ACM perturbent les fonctions la dynamique et induisent des
anomalies dans toutes les fonctions cytoplasmiques des MT pendant l’interphase, notamment
sur la migration cellulaire. Il a été établi que les ACM perturbaient la migration des cellules
tumorales mammaires (Kapoor and Panda, 2012) ou des glioblastomes (Pagano et al., 2012)
par les ACM, phénomène qui pourrait jouer un rôle anti-métastatique important. De plus
l’action des ACM a été associée à un défaut de la migration, de la prolifération et de
l’organisation en vaisseaux des cellules endothéliales ce qui se traduirait par un effet anti
angiogénique dans la tumeur ( Kamath et al., 2014; Schwartz, 2009). Tous ces effets étaient
obtenus pour des doses inférieures à la dose cytotoxique (Bijman et al., 2006) et constituent
une partie du rationnel des essais thérapeutiques de chimiothérapie dite métronomique : en
utilisant de faibles doses d’ACM pour obtenir une activité anti-tumorale en ciblant
l’angiogénèse ou en favorisant la réponse immunitaire antitumorale ( Bhatt et al., 2010;
Briasoulis et al., 2009; Pasquier et al., 2010), avec une efficacité clinique modeste chez des
patients souvent à des stades très avancés de leur maladie métastatique.
d. Le développement d’un nouvel ACM : l’éribuline

Outre le problème des effets secondaires toxiques des ACM, l’émergence de


résistances tumorales à ces agents constitue un obstacle à leur efficacité à long terme. La
recherche continuelle de nouveaux ACM, tente, à l’instar de celles d’antibiotiques de nouvelle
génération, de le contourner.

19
L’éribuline (E7389/Halavenâ) a reçu l’autorisation de mise sur le marché en 2011
au vu des résultats de l’essai clinique de phase III EMBRACE (Cortes et al., 2011) qui a
montré une augmentation significative de la survie globale des patientes lourdement
prétraitées pour un cancer du sein. Cette augmentation de la survie globale des patientes,
même faible car évaluée en moyenne à 2,5 mois, reste assez exceptionnel pour une tumeur
épithéliale avancée. Une seconde étude de phase III (Kaufman et al., 2015) n’a pas montré de
supériorité de l’éribuline face à la capécitabine chez des patientes résistantes aux
taxanes/anthracyclines, et actuellement ces drogues cytotoxiques sont toute deux utilisable de
manière équivalente dans le cancer du sein métastatique avancé (Cardoso et al., 2016).

Des analyses en « vie réelle » ont retrouvé l’efficacité de l’éribuline, avec un profil
de toxicité acceptable (Aftimos et al., 2016; de Nonneville et al., 2017) et un bénéfice clinique
malgré une progression clinique sous traitement par taxanes (Inoue et al., 2016) et la réponse
au dernier ACM reçu par les patientes pourrait constituer une marquer predictif de réponse à
l’eribuline.(Sabatier et al., 2017), ce qui suggérant qu’il existe des marqueurs de réponse à la
classe des ACM et qu’il ne semble pas exister chez ces répondeurs de résistances croisées
entre les ACM . Toutes ces données ainsi que la rapidité d’administration (perfusion IV
d’éribuline mésylate : 1.4mg/m2 en 2-5 min à J1-J8 et J21du cycle) en font une drogue
importante au stade métastatique.

Il est à noter que l’éribuline a également récemment reçu une AMM pour traiter les
liposarcomes métastatiques en phase avancée, permettant le doublement de la survie globale
des patients traités (Demetri et al., 2017; Schöffski et al., 2016).

20
Présentation et grands principes biologiques de la
cascade métastatique

21
Historique des théories de la dissémination métastatique

Depuis longtemps les chercheurs ont voulu comprendre par quel moyen les cellules
d’une tumeur initiale deviennent capables de former des métastases. Dans leurs traités de
1829, les français Bayle et Récamier ont émis l’hypothèse précise, à partir d’autopsies, que
les cellules cancéreuses de la tumeur primaire migraient et se greffaient vers les organes
distants. On leur doit le terme métastase, du grec µεθι στ ηµι (je change de place), défini
actuellement par la croissance d’un agent pathogène ou d’une cellule tumorale à distance d’un
site qualifié de primaire. La dissémination par voie vasculaire et lymphatique via des micro-
emboles cellulaires a été décrite par les travaux de Rudolf Virchow (1858) et James Ewing
(1928).

Les travaux de Stephen Paget publié dans le Lancet en 1889 ont apporté la théorie
de « la graine et du sol » (seed and soil) qui par l’étude des sites métastatiques issus de plus
de 700 cas de décès par cancer du sein, a émis l’hypothèse que cette dissémination ne pouvait
pas être dû au hasard, ni ne suivait simplement la distribution vasculaire (hypothèse de
Virchow quelque années auparavant) (Paget, 1889). Il faut donc pour qu’une cellule
métastatique se développe dans un organe secondaire un certain nombre de caractéristiques
favorisant la croissance et la mobilité de cette cellule (les propriétés de la graine), mais
également un environnement « accueillant » permettant sa prolifération (les propriétés du sol).
Cette théorie du milieu du XIXème siècle est la première à poser les bases de l’importance du
microenvironnement.

Les années 70 ont permis l’émergence des concepts de néo-angiogénèse c’est à dire
la capacité des tumeurs à induire une vascularisation à leur contact pour apporter nutriments
et oxygène (Folkman et al., 1971), et la conceptualisation du processus par lequel les cellules
tumorales traversent plusieurs étapes impliquant des interactions entre elles et avec les
microenvironnement aboutissant à une sélection clonale aléatoire (Fidler and Kripke, 1977)).

Enfin l’intégration du processus métastatique parmi les hallmarks of cancer de


Douglas Hanahan et Robert Weinberg en 2000 (Hanahan and Weinberg, 2000) et
2011(Hanahan and Weinberg, 2011) qui mettent la cellule tumorale au centre de multiples
caractéristiques ou processus à la fois propre à la cellules (instabilité génomique, capacité
d’invasion…) mais aussi dépendant de son environnement sur lequel la tumeur agit
(angiogenèse, système immunitaire…).
22
La cascade métastatique

La dissémination métastatique est actuellement théorisée selon la théorie de la


cascade métastatique pour former des métastases à distance (Nieto et al., 2016).Les trois voies
de dissémination sont les voies hématogène, lymphatique et trans-séreuse (au travers des
cavités, souvent les séreuses) (Valastyan and Weinberg, 2011).

La majorité des tumeurs de l’être humain sont d’origine épithéliale et se


développent au sein d’un épithélium non tumoral dont elles sont initialement issues. La
cascade métastatique est un continuum complexe et impliquant de multiples étapes, illustrées
dans la Figure 4, à travers desquelles la cellule va modifier ses propriétés pour :

o Se détacher des autres cellules,


o Acquérir un phénotype mésenchymateux
o Franchir la lame basale de son tissu d'origine ; le cancer devient alors infiltrant.
o Devenir mobile pour traverser des barrières naturelles en dégradant la matrice
extracellulaire et les tissus de soutien environnants ; c’est le phénomène de micro-invasion.
o Migrer vers les vaisseaux sanguins dont elle traverse la paroi (intravasation) et
circule alors via le sang ou la lymphe. Seules certaines cellules seront capables de survivre
dans le flux sanguin sous les pressions de cisaillement du sang et la destruction par le système
immunitaire, de s’arrêter et d’adhérer au niveau de la paroi vasculaire et de la dégrader pour
la franchir (extravasation).
o Les cellules tumorales présentes dans le flux sanguin sont appelées cellules
tumorales circulantes (CTC), qui présentent les caractéristiques de cellules tumorales mais
différents phénotype et organisation entre elles, de la cellule isolée à l’amas cellulaire (ou
cluster).
o Enfin la cellule va initier des foyers secondaires tumoraux après avoir
partiellement ré-acquis des caractéristiques épithéliales ; c’est l’étape de colonisation.

Le phénomène métastatique est hautement inefficace pour les cellules tumorales


qui doivent résister à des contraintes lors de toutes ces étapes, si bien qu’il est estimé que
seulement 1% des cellules tumorales circulantes survit et que parmi celles-ci 1% sera capable
d’initier une métastase (Lambert et al., 2017) .

23
Figure 5 La cascade métastatique : un processus multi-étape complexe
Représentation schématique de la cascade métastatique et précisions sur trois étapes majeures du
processus de dissémination tumorale.
(A) Les cellules ayant subies la transition épithélio-mésenchymateuse plus ou moins complète (E,
E1, E2/3) (1) sont douées de propriétés migratoires sous tendues par l’acquisition d’un phénotype
mésenchymateux et d’une perte des contacts avec les cellules de l’épithélium dont elles sont issues. Les cellules
vont traverser la lame basale (2) de leur tissu d’origine et vont migrer selon divers modes à travers la matrice :
(3) représente une cellule migrant de manière individuelle sur le mode mésenchymateux et nécessitant de
dégrader les fibres de la matrice ; (4) et (5) montre un amas de cellule en migration collective ; (6) est le second
mode de migration individuel basé sur la contraction du corps cellulaire : c’est la migration amiboïde. A cette
étape, les cellules tumorales interagissent fortement avec les cellules du microenvironnement notamment les
fibroblaste et macrophages associés aux tumeurs (TAM et CAF) qui participent à la migration et à l’invasion
tumorale.
(B) Lorsque les cellules ont atteint et pénétré dans les vaisseaux sanguins, elles circulent, seules ou
en amas, au travers des capillaires puis de la circulation générale. Ces cellules sont appelées cellules tumorales

24
circulantes (CTC) qui forment un ensemble hétérogène de cellules ayant des destins différents. Au cours de leur
circulation, elles peuvent interagir avec les éléments figurés du sang leur conférant une certaine protection.
(C) L’outil généralement proposé comme permettant à la cellule tumorale de dégrader et d’envahir
les tissus s’appelle l’invadopode. C’est une protrusion cellulaire capable, grâce à l’action des métalloprotéases,
de dégrader la MEC. Ces invadopodes sont impliqués dans la dégradation de la lame basale, la dégradation de la
MEC lors de la migration et les phénomènes d’intravasation et d’extravasation des CTC.
D’après : image centrale « MA Nieto Cell, 2016 » ; (A) «R.Poincloux et al, J Cell Sci 2009 », (B)
« M. Ignatiadis et al. Clin Cancer Res 2015 »; (C) « Schoumacvher et al, J Cell Biol 2010 ».

La transition épithélio-mésenchymateuse

La transition épithélio-mésenchymateuse (TEM) a été largement étudiée ces


quarante dernières années et permet aux cellules tumorales :

o De se détacher de la tumeur,
o D’acquérir un phénotype pro-migratoire et invasif
o De survivre lors toutes les étapes de la cascade métastatique.

Les cellules vont subir des transformations biochimiques et phénotypique sous


l’influence d’anomalies génétiques et épigénétiques, mais également de facteurs de croissance
provenant de l’environnement péritumoral (Nieto et al., 2016).

Au sein de l’épithélium environnant, les cellules cancéreuses vont perdre leur


caractère épithélial sous l’influence de facteurs de croissance, dont le principal est le TGFb,
sécrété par les fibroblastes, les macrophages et les monocytes du microenvironnement
tumoral. Fixé par son récepteur, il conduit à la phosphorylation des protéines SMAD qui
s’associent en un complexe cytosolique qui est transféré dans le noyau. L’expression de
facteurs de transcription dont les mieux identifiés sont snail, zeb et twist permet de (ré)-activer
des caractéristiques mésenchymateuses. Les cellules tumorales perdent alors l’expression de
molécules d’adhésion, avec notamment la suppression de l’E-cadhérine, mais aussi la perte
des occludine et des claudine des jonctions serrées et des hémidesmosomes, les structures qui
permettent la cohésion cellule-cellule et cellule-membrane basale (Nieto et al., 2016).

Le cytosquelette est aussi complètement remanié avec la perte des fibres


circonférentielle d’actine et une réorientation des MT. Tous ces changements conduisent à la
perte de la polarité apico-basale caractéristiques des cellules organisées au sein d’un

25
épithélium et vont augmenter de manière importante leur motilité. Parallèlement, les cellules
acquièrent, des marqueurs spécifiques de cellules mésenchymateuses comme la vimentine, la
N-cadherine, l’a-actine du muscle lisse, et les intégrines avb6, et la capacité de sécréter de la
fibronectine et des métalloprotéases (Kalluri and Weinberg, 2009). Il va également s’opérer
une reprogrammation épigénétique, par la modification de la méthylation des promoteurs de
gènes, et des modifications post traductionnelles des histones contribue à établir un phénotype
pro migratoire et invasif (Lambert et al., 2017)

Le phénotype mésenchymateux n’est pas uniquement rencontré lors de la


progression tumorale. Il s’agit d’un programme cellulaire primordial lors de l’organogenèse
embryonnaire, les caractéristiques mésenchymateuses des cellules embryonnaires permettant
la juste migration des ébauches des organes, comme par exemple la mise en place de la crête
neurale, future ébauche du système nerveux. Certains fibroblastes sont également capables,
pour réparer des tissus lésés, de ré-acquérir un phénotype mésenchymateux, migrer, se rendre
au sein de la lésion et participer à la cicatrisation. Les cellules cancéreuses quant à elles,
opèrent une reprogrammation en détournant comme souvent une fonction physiologique
(Brabletz et al., 2018).

Il existe encore des zones d’ombre concernant le rôle de la TEM dans la


dissémination métastatique et des observations contradictoires font penser que l’on est face
d’un phénomène non redondant et tissu spécifique avec des facteurs favorisants l’apparition
de métastases dans un type de cancer et pas dans l’autre. Par exemple dans le cancer du sein
le facteur SNAIL favorise l’apparition de métastases (Tran et al., 2014) mais pas dans le
cancer du pancréas (Zheng et al., 2015) dont l’apparition de métastase dépendrait de ZEB1
(Krebs et al., 2017). De même que ZEB 2, facteurs de transcription de la même famille que
ZEB1 réprime la formation de métastases (Caramel et al., 2013; Denecker et al., 2014)

La TEM va favoriser le processus tumoral en conférant une résistance aux thérapies


conventionnelles (chimiothérapie, radiothérapie) participant au phénomène de dormance et de
récidive de cancer non métastatique traités (Brabletz et al., 2018)

Au total, la TEM est un programme complexe qui favorise la survie des cellules
tumorale tout au long de leur parcours métastatique et participe à inhiber les voies anti-
oncogéniques impliquant P53 et RB1. La réversibilité de ce programme est également
importante et la transition mésenchymato-épithéliale permet aux cellules initiatrices des

26
métastases de réacquérir un phénotype partiellement épithélial de s’organiser en tumeur
secondaire au sein des organes colonisés. Par ailleurs, plusieurs études ont révélé que les
cellules tumorales n’opéraient qu’une TEM partielle permettant une plasticité le long d’un
gradient continue de différenciation possible et réversible (Brabletz et al., 2018).

La migration des cellules tumorales

L’une des caractéristiques déjà évoquée des cellules tumorales repose sur leur
capacité à se déplacer dans leur environnement permettant leur dissémination. Comme pour
la TEM, la capacité de migration n’est pas propre aux cellules cancéreuses et il existe de
nombreux exemples physiologiques de migration cellulaire permettant le développement
embryonnaire, l’homéostasie du corps humain avec notamment la cicatrisation et la veille
immunologique.

Pour assurer cette migration accrue les cellules tumorales développent des
interactions à la fois entre elles et avec la matrice environnante. Cette migration est en générale
induite par un gradient de stimuli chimique (cytokines, chimiokine) on parle de
chimiotactisme, par des facteurs présents dans le stroma on parle d’haptotactisme et lorsque
la migration est stimulée par la caractéristique physique d’un élément (exemple la rigidité de
la matrice) on parle de durotactisme (2001).

Les caractéristiques de cette matrice sont très importantes et les cellules tumorales
modifient leur mode de migration en fonction des caractéristiques du stroma notamment la
taille des espaces que permettent les fibres de collagène qui le constitue majoritairement. Il
est habituellement décrit deux grands types de migration tumoral : la migration individuelle
(de type mésenchymateuse ou amiboïde) et la migration collective (Figure 5).
a. La migration individuelle des cellules tumorales

• La migration amiboïde

La migration amiboïde est le phénomène le plus simple de migration d’une cellule


unique. La cellule adopte une morphologie plutôt ronde, mais très déformable, et elle
entretient avec le stroma une adhérence faible et non focalisée, qui va rapidement varier sous
l’effet de la déformation dynamique et contractile de la cellule. Ce mode de migration ne fait
pas ou peu appel à des phénomènes protéolytiques.

27
Par contraction, la cellule va se faufiler entre les espaces ou pores présents entre
l’enchevêtrement de fibres de collagène (1-3µm) (Wolf et al., 2013). Le cytosquelette d’actine
cortical à un rôle majeur dans la migration amiboïde permettant le maintien de la forme, de la
contractilité grâce à l’interaction actine-myosine, l’émission de « blebs » membranaires et de
protrusions au front de migration (pseudopodes, filopodes, lamellipodes) (Figure 5A).

La flexibilité du cytosquelette est orchestrée par les Rho GTPase Rac1, RhoC et
RhoA. La polarisation de la cellule vers le front de migration, mais surtout la rétraction de
l’arrière et des parties latérales de la cellule repose également sur la contraction entre actine
et myosine II sous l’action de la Rho kinase (ROCK) contrôlé par RhoA (Sanz-Moreno and
Marshall, 2010). Cette contraction propulse la cellule vers l’avant, rétracte l’arrière et tracte
le noyau. Ce mode de migration est utilisé par les cellules immunitaires de type lymphocytes,
les cellules tumorales hématologiques (dans les leucémies myéloïdes ou les lymphomes), mais
également les carcinomes à petites cellules. Cependant, il semble que les cellules puissent
sous certaines conditions utiliser une activité protéolytique même lors de la migration
amiboïde, comme montré récemment dans un modèle in vitro de cellules de mélanome
sécrétant de fort taux de MMP13 et MMP9 (Orgaz et al., 2014)

Cela révèle probablement des états intermédiaires entre les modes de migration
individuelle, régulés en fonction des obstacles rencontrés dans le microenvironnement (Paul
et al., 2017)

• La migration mésenchymateuse

C’est le mode de migration utilisé par les cellules tumorales ayant subi une TEM
plus ou moins complète. Généralement, ce sont des cellules peu différenciées exprimant les
facteurs de la TEM snail/slug, twist, la vimentine cytoplasmique ou la protéine nucléaire oct-
4 ce qui permet de les identifier dans l’épithélium. La morphologie cellulaire s’allonge avec
un noyau oblong et sont polarisées dans le sens de migration, augmentant leurs interactions
avec le substrat. Le signal d’activation est reçu par la cellule via des récepteurs tyrosine kinase,
des récepteurs couplés aux protéines G ou l’interaction intégrine-matrice. Ce signal va
favoriser le recrutement de GEF (GTP exchanging factor) qui vont activer des Rho GTPases,
essentiellement RhoA, RAC1 et 2 qui vont favoriser le remodelage et la polymérisation de
l’actine sous corticale (Sanz-Moreno and Marshall, 2010). Le réseau d’actine branché sous
cortical a un rôle prépondérant car sa polymérisation va permettre la formation et l’extension

28
des protrusions au front de migration de la cellule et son organisation en fibres de stress
associé aux adhésion participe à la mécanotransduction de la migration avec le substrat (te
Boekhorst et al., 2016). Ces protrusions (filopodes, pseudopodes, lamellipodes) à l’avant de
la cellule permettant les interactions avec le stroma ( Bravo-Cordero et al., 2012) (Figure 5A)

Ce mode de migration dépend d’interactions fortes avec la matrice par


l’intermédiaire des adhésions focales (AF) qui évoluent sur un mode dynamique, avec une
phase de mise en place impliquant les intégrines, suivi de phases de maturation et de
stabilisation, avant leur désassemblage (voir en détail plus loin).

Ces interactions entraînent une traction mécanique sur la MEC permettant à la


cellule d’avancer tout en contractant les fibres de stress composées d’actomyosine, pour
rétracter sa partie postérieure. La progression au travers du stroma nécessite que la cellule
secrète des métalloprotéases qui permettent de remodeler la matrice en dégradant par exemple
les fibres de collagène, libérant ainsi de nouveaux espaces de migration (te Boekhorst et al.,
2016; Wolf et al., 2007). La migration dirigée des cellules tumorales est également sous le
contrôle d’un autre acteur majeur du cytosquelette : les microtubules qui vont participer à la
régulation des AF, permettant le déplacement directionnel des cellules tumorales (Stehbens
and Wittmann, 2012). De nombreuses protéines régulatrices de l’extrémité « + » des MT
participent à ce phénomène.

b. La migration collective des cellules tumorales

Ce mode de migration est très fréquemment retrouvé dans les tumeurs épithéliales
ou les cellules cancéreuses qui, bien qu’ayant procédé à la TEM, gardent des jonctions
intercellulaires de type jonctions adhérentes cadhérine-dépendantes ou encore des jonctions
gaps pour la communication intercellulaire (Friedl et al., 2012).

Les cellules migrant ensemble, se hiérarchisent et créent une structure


supracellulaire fonctionnant comme une seule « super cellule » (Figure 5A). Les cellules se
déplacent ensemble et sont interdépendantes (Friedl and Mayor, 2017).

La migration collective s’appuie sur les principes mécaniques de la migration


individuelle comme la contraction de l’actine-myosine, mais fait aussi appel à la
communication intercellulaire (Friedl and Mayor, 2017) et à la coordination globale du
29
cytosquelette qui entraine une polarisation de la structure, souvent en forme de digitation. Les
cellules situées au front de migration possèdent des capacités particulières et sont dite cellules
« leaders » ou pionnières. Elles interagissent fortement avec la matrice mais aussi avec les
cellules stromales (fibroblastes et macrophages associés aux tumeurs) qui sécrètent des
chimiokines, stimulant les cellules tumorales et possédant un rôle facilitateur guidant la
migration collective par sécrétion de métalloprotéases dégradant de larges zones matricielles
(Cao et al., 2016). Les cellules tumorales sécrètent aussi des métalloprotéases favorisant la
progression tumorale au travers du stroma (Haeger et al., 2015) (Figure 5).

Au total la migration collective se résume en trois points, expliquant les avantages


de ce mode de déplacement par rapport à la migration individuelle :

1) la démultiplication des capacités migratoires et de survie grâce à la


communication intercellulaire et la sécrétion de facteurs de croissance, de chimiokines et de
protéases

2) le déplacement passif de cellules suiveuses, qui autrement auraient des capacités


migratoires et/ou prolifératives moindres, sous l’action des cellules de tête et du mouvement
de l’ensemble du ruban cellulaire

3) la protection des cellules vis à vis de l’environnement : assauts des cellules


immunitaires, forces de cisaillement et dommages nucléaires rencontrés dans les tissus et la
circulation sanguine, favorisant la survie tumorale aux différentes étapes de la cascade
métastatique.

Comme on vient de le développer, les mécanismes de la migration cellulaire sont


multiples et dépendent largement du cytosquelette d’actine. Les microtubules jouent
également un rôle fondamental dans la directionalité du mouvement, primordial pour une
migration efficace. La tubuline est une cible de choix en oncologie et l’étude des mécanismes
régulant la migration tumorale médiés par les microtubules nécessite toute notre attention.

30
De la tubuline aux microtubules : description d’un
composant majeur du cytosquelette impliqué dans
la migration des cellules tumorale et cible
thérapeutique de choix en oncologie

31
Les microtubules

a. La tubuline, unité de base du MT, entre conservation et variabilité

La tubuline est une protéine très conservée au cours de l’évolution des espèces.
C’est une protéine de 50 kDa, compactes, formées de 2 feuillets b entourés d’hélices a qui
présentent trois domaines fonctionnels :

1) Un site de liaison du GTP


2) Une partie C-terminale libre avec des résidus chargés négativement pouvant
recevoir des modifications post traductionnelles.
3) Un site de liaison entre les deux, impliquée aussi dans la polymérisation des MT

Elle a été découverte par le biais de sa liaison avec la colchicine, une molécule
naturelle ayant une de très forte affinité pour la tubuline (Borisy and Taylor, 1967) par sa
liaison à un domaine situé à l’interface entre la tubuline a, et b, profondément dans la
structure (Dorléans et al., 2009).

Depuis, plusieurs classes de tubulines ont été identifiées et regroupées au sein d’une
super-famille comprenant les tubulines a, b, g, e, d et h (McKean et al., 2001). Seules les
tubulines a, b et g sont retrouvées de manière ubiquitaire dans les cellules eucaryotes et y
jouent un rôle fondamental. Les tubuline a et b s’associent en hétérodimères pour constituer
les polymères de MT. La g-tubuline, est une protéine soluble qui se retrouve au niveau des
centres organisateurs des MT (MTOC) et joue un rôle fondamental dans la nucléation et
l’initiation de la polymérisation des MT. Les autres classes de tubuline ont des rôles encore
peu connus où sont retrouvées dans des structures bien précises comme le flagelle du
spermatozoïde (McKean et al., 2001).

Il existe de nombreux gènes codant pour les tubulines a et b; chez les mammifères
neuf gènes codant pour l’a-tubuline et neuf gènes codant pour la b-tubuline ont été identifiés,
donnant lieux à de nombreuses formes d’hétérodimères a-b ( Gadadhar et al., 2017). En fait,
les propriétés des MT peuvent varier en fonction des isotypes de tubuline a et b, modifiant
l’assemblage, la dynamique ou la fonction mécanique des MT. Ainsi, la séquence des
extrémités libres carboxy-terminales (C-terminales) peut varier d’un isotype à l’autre, avec

32
pour conséquence des modifications post-traductionnelles ou des interactions avec les MAP
différentes. L’existence d’isotypes permet donc de conférer une certaine diversité à une
structure très conservée au cours de l’évolution et des particularités ayant à terme des
conséquences importantes dans la fonction des MT.

Les isotypes de tubulines constituent ainsi avec les modifications post


traductionnelles des tubulines a et b un véritable code de la tubuline (Figure 6) (Gadadhar et
al., 2017)

De manière étonnante, de nombreuses mutations concernant des isotypes de


tubuline largement répandus ont été montrées comme étant responsables de pathologies tissu-
spécifiques, notamment des maladies neurodégénératives (Tischfield et al., 2011). En
oncologie, l’expression de certains isotypes, notamment la b-tubuline de classe III (TUBB3),
a été associée avec des phénomènes de résistance aux ACM (Gan et al., 2011 ; Sève and
Dumontet, 2008) ; et il a été montré in vitro que la présence de TUBB3 au sein des MT
diminue l’impact de l’éribuline sur la dynamique es MT (voir plus loin).

Cela confirme que les isotypes de tubuline participent au rôle global et ubiquitaire
des MT, mais possèdent également des rôles qui semblent très spécifiques sur des fonctions
sensibles des MT dans certains tissus.

b. Les modifications post-traductionnelles de la tubuline.

Comme de nombreuses protéines eucaryotes, la tubuline peut subir de nombreuses


modifications post traductionnelles (MPT) qui consistent en l'ajout/retrait de groupement
moléculaire ou le clivage d’acides aminés par des enzymes. Ces modifications de la tubuline
ont été associées à des états dynamiques particuliers, générant des MT structurellement
différents entre eux, mais aussi des zones différentes au sein du même polymère, régulant
finement leurs fonctions intracellulaires (Figure 6).

La majorité des MPT se situent sur l'extrémité C-terminale libre des tubulines a ou
b, et dans la majorité des cas elles se produisent sur des tubulines incluses dans le polymère,
générant localement des marquages définis du MT.

• La phosphorylation
33
C'est la première MPT observée (Eipper, 1972). Elle peut survenir au niveau de la
région C-terminale de la tubuline a, via la kinase syk impliquée dans l'immunité (Faruki et
al., 2000; Peters et al., 1996), ou sur la serine 172 de la tubuline b, par CDK1. Cette dernière
modifie la capacité de polymérisation de la tubuline b et modifie probablement la liaison GTP-
tubuline via le site E, ce qui entraine une inhibition de la polymérisation de MT avec un impact
sur la mitose (Caudron et al., 2010; Fourest-Lieuvin et al., 2006).

• La tyrosination/détyrosination

Les tubulines se terminent par la séquence EEY (soit deux glutamates et une
tyrosine). La tyrosination, une MPT réversible qui ne survient que sur la tubuline a, est
catalysée par l'enzyme Tubulin Tyrosin Ligase (TTL) (Ersfeld et al., 1993). En fait la majorité
de la tubuline a est tyrosinée par traduction d'ARNm incluant le codon codant pour la tyrosine.
Le cycle de tyrosination/détyrosination est enclenchée lors du premier clivage, médiée par une
carboxy-peptidase, la vasohibine, très récemment identifiée par deux équipes simultanément
et publié dans la revue Science (Aillaud et al., 2017; Nieuwenhuis et al., 2017).

Au niveau fonctionnel, la détyrosination stabilise le MT (durée de vie des MT


tyrosinés : 3-5min versus 2-16h pour les MT détyrosinés) et est un marqueur de l'âge du MT ;
elle confère une protection contre la dépolymérisation médiée par le froid, le nocodazole ou
encore les +TIP MCAK ou Kif2 (Sirajuddin et al., 2014; Vaart et al., 2009). Par exemple, les
MT de l'axone, ou le front de migration sont détyrosinés ; les MT dynamiques des dendrites
sont eux tyrosinés. Il a été montré que les +TIP ayant un domaine CAP-Gly ont une plus
grande affinité pour les MT tyrosinés, et cette liaison renforce la stabilité des microtubules
(Honnappa et al., 2006; Peris et al., 2009).

En cancérologie, l'accumulation de tubuline détyrosinée et la diminution


d'expression de TTL augmentent durant la progression tumorale et sont associées aux tumeurs
de mauvais pronostic dans le cancer du sein (Lafanechère et al., 1998; Mialhe et al., 2001) ou
de la prostate (Soucek et al., 2006).

34
• D2 et D3 tubuline

Après la détyrosination, les deux glutamates du C-terminal de la tubuline peuvent


être également retirés, créant les protéines D2 tubuline (un glutamate en moins) et D3 tubuline
(perte des deux glutamates). C'est une modification irréversible, ce qui permet de fixer le statut
de MT détyrosinés, et constitue donc également une marque des MT stables. Elle est d'ailleurs
retrouvée sur les MT des neurones différenciés, les axonèmes des cils et des flagelles, mais
également dans les MT stabilisés artificiellement avec le taxol (Janke, 2014; Paturle-
Lafanechère et al., 1994).
• L'acétylation

Le site d'acétylation le mieux caractérisé se situe sur la lysine 40 (K40) de la


tubuline-a (Greer et al., 1985; Piperno and Fuller, 1985). L'acétylation est catalysée par une
enzyme spécifique de K40 (Shida et al., 2010): la tubuline acétyl transférase (αTAT1). Les
enzymes HDAC6 et SIRT2 catalysent la déacétylation mais ne sont pas spécifiques.
Contrairement aux autres MPT, l'acétylation sur la K40 a lieu à l'intérieur de la lumière du
MT, nécessitant que les enzymes puissent accéder à la face luminale du MT (Curry and
Coombs, 2016).

L’acétylation du MT est associé à une stabilité accrue de celui-ci (de l'ordre de


l'heure). Les cils, le corps basal du flagelle, les centrioles et le front de migration de cellules
sont enrichis en MT acétylés (Sadoul and Khochbin, 2016).

Le rôle exact de l’acétylation des MT a été longtemps cherché car bien que l’on ait
observé que seuls les MT stables était acétylés, l’acétylation en elle-même survenait un laps
de temps important après la stabilisation des polymères et ne les protégeait pas des
catastrophes (Janke and Montagnac, 2017). Deux études ont récemment montré que le
phénomène d’acétylation des microtubules agissait comme une résistance aux stress
mécanique dont ils font l’objet de manière répétée dans le cytoplasme, l’acétylation
occasionnant une plus grande labilité des interactions entre les protofilaments voisin
permettant au MT d’être plus flexible, d’accumuler moins de « cassures » ou de défaut dans
le polymère et une meilleur résistance au phénomène de vieillissement (microtubule aging)
(Ly et al., 2016; Portran et al., 2017).

aTAT1 est a également été impliquée dans la migration dirigée des cellules du

35
cancer du sein (Montagnac et al., 2013), mais également dans les processus d'invasion associés
aux invadopodes (Castro-Castro et al., 2012) où aTAT1 acétylerais la cortactine, une protéine
liant l’actine primordiale aux invadopodes (voir plus loin).

Enfin dans les tumeurs, il a été mis en évidence qu'un taux important d’a-tubuline
acétylée dans les tumeurs de patientes atteintes de cancer du sein était corrélé avec des types
histologiques plus agressifs, notamment le type basal, et une survie plus courte (Boggs et al.,
2015).

En conclusion « code » de la tubuline confère des propriété particulières, réversible


et donc soumises à des régulations selon les besoins de la cellule, que ce soit au niveau des
isoformes par régulation génétique ou les MPT, plus rapide, par réaction enzymatique. Des
structures très conservées comme les MT deviennent alors de véritables outils dédiés
spécifiquement à certaines tâches et les états favorisant la stabilité accrue des polymères sont
souvent associées aux phénomènes cancéreux et/ou conférant un mauvais pronostic.

36
Figure 6. Les modifications post-traductionnelles sur l’hétérodimère de tubuline et les variabilités des
isotypes de tubuline constituent le code de la tubuline
(A) Représentation schématique d’un microtubule indiquant les extrémités C-terminales de différents isotypes
de tubuline (à gauche) conférant des propriétés intrinsèques spécifiques au microtubule, mais permettant
également des modifications post traductionnelles sur les résidus externes variable selon l’isotype. (B) Zoom sur
les extrémités C-terminales permettant de détailler un aperçu des principales modifications post-traductionnelles
que peut subir le microtubule, sur sa face externe, mais aussi sur sa face luminale (acétylation).
Adapté de (A) S Gadadhar et al, J Cell Sci 2017 (B) CP Garnham et al, Cytoskeleton 2012

37
c. L’instabilité dynamique des MT : une mécanique hautement régulée

Les MT sont formés par la polymérisation d’hétérodimères de tubuline a-b en


protofilaments. La structure tertiaire des tubulines a et b est très proche, malgré des séquences
ayant seulement 40% d’homologie. Les tubulines sont des protéines de 50 kDa,

La polymérisation des MT consiste en l’assemblage polarisé d'hétérodimère a-b,


terminant les protofilaments de l'extrémité "+" par une tubuline b et ceux de l'extrémité "-"
par une tubuline a. Il s’agit d’un phénomène actif nécessitant l'hydrolyse du GTP fixé au site
E (Exchangeable-Site), site actif situé dans la région N-terminale de la tubuline b.
La molécule de GTP fixée sur le site N (Non-échangeable) en N-terminal de
l'a-tubuline est non hydrolysable car bloqué dans la liaison intra-dimère (Figure 7). Lors de
l'association de deux hétérodimères, une nouvelle interface inter-dimère est formée, le GTP
du site E de la b-tubuline est exposé à l'activité catalytique de l'a-tubuline qui joue alors le
rôle d'une GAP (GTPase activating protein)

Figure 7 : Représentation des unités de base et de l’assemblage des microtubules


(A) Hétérodimère d’a/b tubuline en structure quaternaire avec identification des sites fonctionnels. Les deux
molécules de tubuline a et b sont liées de manière tête bèche. En vert, l’extrémité N –terminale, en jaune le
domaine intermédiaire et en bleu l’extrémité C-terminale. Les sites de liaison au GTP sont en rouge. (B) Les
stades de polymérisation d’un microtubule : les hétérodimères vont polymériser en un protofilament linéaire qui,
va s’associer latéralement avec douze autres protofilaments créant un tube creux de 25 nm de diamètre. Les
interactions latérales entre les protofilaments sont majoritairement homotypiques (tubuline b-b ou a-a) sauf au
niveau du sillon, représenté en pointillés rouges, où elles sont hétérotypiques (tubuline a-b).

38
L’assemblage d’hétérodimères entre eux conduit à la formation de protofilaments
qui vont interagir latéralement pour former un feuillet courbé qui va, en se refermant
progressivement, conduire à l’obtention d’un tube creux de 13 protofilaments dans la majorité
des cas (des variations de 11 à 15 ont été observées). Les interactions latérales entre
protofilaments concernent des tubulines du même type (b-b ou a-a), sauf au niveau du sillon
central, zone se refermant en dernier pour clôturer le tube, où les interactions latérales sont
hétérotypique a-b ou b-a. Cette particularité pourrait jouer un rôle dans la régulation de la
dynamique des MT (Akhmanova and Steinmetz, 2015a).

Les deux extrémités du MT présentent une dynamique différente avec une extrémité
« + » alternant rapidement des phases de croissance, de catastrophe puis de sauvetage. La
croissance et la fréquence des catastrophes à l’extrémité «–» est, elle, plus faible (Mitchison
and Kirschner, 1984) (Figure 8).

La cohésion de la structure polymérisée est régulée par la présence d’une coiffe de


GTP à l’extrémité « + » (Figure 8). Lorsque les hétérodimères sont incorporés dans le MT en
cours de polymérisation, l’hydrolyse du GTP fixé sur la tubuline-b en GDP survient avec un
délai. De ce fait, la majorité des dimères du MT sont sous forme GDP sauf les derniers
hétérodimères de l’extrémité « + », pour lesquels l’hydrolyse n’a pas encore eu lieu ou est en
cours. Cette accumulation de tubuline b-GTP (ou de tubuline contenant l’intermédiaire
GDP+Pi) constitue une coiffe et stabilise toute la structure du MT. Lorsque la coiffe-GTP est
présente le MT continue de croitre et lorsqu’elle disparait, le MT est déstabilisé et le
phénomène de dépolymérisation rapide ou « catastrophe » survient.

L’angle de liaison entre les deux tubuline d’un même dimère change au cours du
cycle de polyémrisation ou sous l’action de facteurs régulateurs et il a été démontré que les
dimères de tubuline libres liés au GTP adoptaient une conformation courbée et que lors de la
polymérisation, probablement après hydrolyse du GTP, la conformation du dimère changeait
et devenait droite, ce qui correspond à une conformation moins stable (Ayaz et al., 2012a;
Nawrotek et al., 2011; Pecqueur et al., 2012). La nucléation des MT, c'est à dire l'initiation de
la polymérisation à partir de zones précises, est le plus souvent favorisée par des facteurs
régulateurs situés au niveau des centres organisateur des MT (MTOC). In vitro, la nucléation
peut être initiée en augmentant la concentration de tubuline a-b au-dessus d'un seuil critique,
mais ce phénomène est très rare dans la cellule.

39
Figure 8 Instabilité dynamique des microtubules
1-Les hétérodimères de tubuline sont liés à la GTP ou à la GDP. L’échange de nucléotide GDP en GTP s’opère
sur la tubuline b avant polymérisation.
2-Les hétérodimères liés à la GTP sont ajoutés à l’extrémité « + » en croissance où ils se concentrent. Leur
incorporation crée une coiffe GTP à l’extrémité + conférant une stabilité au MT des caractéristiques particulières
à cette région comme d’interagir avec les protéines +TIP.
3-Les microtubules continuent de croitre, ou s’arrête provisoirement causant une pause. En cas de perte de la
coiffe GTP, le microtubule se courbe jusqu’à former des boucles caractéristiques, puis se dépolymérise
brutalement ; c’est le phénomène de catastrophe. De facteurs de sauvetage ou la présence d’ilots de tubuline
n’ayant pas hydrolysé le GTP permettent d’arrêter la dépolymérisation et de reprendre une phase de croissance
4-S’il n’y a pas de sauvetage (MAP, ilôt de tubuline GTP non hydrolysés) stoppant la catastrophe, le microtubule
se dépolymérise totalement.

D’après Akhmanova et Steimetz, Nat Review Mol Cell Biol 2015

40
Le centre nucléateur principal dans les cellules est le centrosome, un élément
cellulaire unique dans les cellules saines en interphase, situé près du noyau qui initie le réseau
radiaire de MT dans la cellule (Paz and Lüders, 2018)Il est constitué de deux centrioles
disposés perpendiculairement et entourés du matériel péri-centriolaire auquel est associé les
g-tubulines, indispensable à l'initiation de la polymérisation des MT et des protéines associées
constituant le complexe gTuRC (g-tubulin ring complex). Le centrosome n'est pas l'unique
MTOC dans la cellule et en interphase les MT peuvent être nucléés à la membrane plasmique,
au niveau de MT déjà polymérisés, au niveau du Golgi, mais également pendant la mitose au
niveau des kinétochores, du fuseau mitotique ou de la chromatine (Farache et al., 2018). Du
centre cellulaire partent alors les microtubules qui rayonnent de manière dynamique dans le
cytoplasme (Figure 9)

Direction de migration

Figure 9 Réseau de microtubules dans une cellule de cancer du sein en migration


Visualisation du réseau de microtubules par immunofluorescence dans une cellule de
la lignée mammaire SKBr3. La cellule est polarisée dans le sens de la migration et les
pointillés représentent le contour cellulaire. Les microtubules atteignent et se
stabilisent au front de migration

Comme mentionné précédemment, les MT alternent en permanence des phases de


croissance et de phase de dépolymérisation, rapide, soudaine entrainant la disparition plus ou
moins complète du polymère. Les signaux déclenchant cette alternance stochastique entre
catastrophe et sauvetage sont complexes et dépendent de plusieurs facteurs inhérents aux MT,
aux protéines associées et à l’environnement intracellulaire.

41
In vitro, le vieillissement des MT a été rapporté comme un élément favorisant
une fréquence élevée de survenue des catastrophes, et cela pourrait être relatif à une
accumulation de défauts dans la paroi de la structure polymérisée entraînant sa déstabilisation
(Gardner M.KCell. 2011Coombes C.E.Curr. Biol. 2013). On sait désormais que l’acétylation
permet d’augmenter la fléxibilité des MT et diminuer les cassure, laissant le temps à une
éventuelle réparation de ces défaut (Janke and Montagnac, 2017; Ly et al., 2016; Portran et
al., 2017).

L’étude moléculaire du sauvetage et de la reprise de la croissance des MT après


une catastrophe a permis d'identifier plusieurs mécanismes.

Des expériences utilisant un modèle de reconstitution in vitro des MT a permis de


montrer que la survenue de sauvetage n'est pas dépendante de l’augmentation de la
concentration de GTP-tubuline disponible pour les MT en cours de dépolymérisation (Walker
et al., 1988).

Des ilots de tubuline lié au GTP et favorisant le sauvetage et la re-polymérisation


des MT ont été observés in vivo, grâce à des anticorps anti-GTP tubuline révélant ces zones
au sein du polymère et coïncidant avec des sites de sauvetage après catastrophe (Tropini et
al., 2012). La reconstitution in vitro de MT comportant des dimères de tubuline lié à un
analogue non hydrolysable du GTP (mimant les îlots GTP observés in vivo) a confirmé que
ces ilôts GTP se comportaient comme des sites de sauvetage permettant la re-polymérisation
des MT après une catastrophe (Dimitrov et al., 2008). Le modèle proposé repose sur l'arrêt de
la catastrophe lorsque la dépolymérisation atteint le site de sauvetage qui, de manière
semblable à la coiffe GTP, favorise la reprise de la polymérisation du MT (Dimitrov et al.,
2008; de Forges et al., 2013; Tropini et al., 2012). L'origine de ces îlots reste à être identifiée :
il faudrait notamment déterminer s’ils sont incorporés lors de la polymérisation initiale ou
s’ils sont formés par la suite, lors de la réparation des MT vieillissants (Aumeier et al., 2016)

Le treadmilling, qui est avec l’instabilité dynamique la seconde modification


dynamique observée aux microtubules, résulte de la différence de vitesse de polymérisation
et de croissance de l’extrémité « + » par rapport à l’extrémité « - ». Le MT voit son extrémité
« + » croitre plus rapidement et se raccourcir de manière moins importante ce qui donne une

42
résultante en faveur de la croissance du MT. L’extrémité « - » croit moins rapidement et se
dépolymérise plus vite, la résultante est donc en faveur d’un raccourcissement.

Lorsque le MT est observé dans son ensemble cette différence polarisée de


croissance concomitante et à vitesse constante donne un aspect de mouvement du polymère
qui « avance » dans la direction de l’extrémité +, donnant une impression de tapis roulant ou
de treadmilling en anglais (Margolis and Wilson, 1981). Ce phénomène est observé en
interphase permettant le transport des MT du centre de nucléation vers le cortex, mais aussi
lors de la mitose permettant aux MT du fuseau de garder la même taille durant la métaphase
(Waterman-Storer and Salmon, 1997)

d. Régulation de la dynamique des MT

L'étude in vitro de la croissance des MT a montré que de manière isolée les


polymères ont une croissance plutôt lente et que la survenue de catastrophe est peu fréquente.
La dynamique in vivo est bien différente faisant penser qu'il existe des éléments régulateurs
majeurs qui vont catalyser l'incorporation plus rapides des dimères de tubuline et impacter
leur dynamique (Akhmanova and Steinmetz, 2015a; Vaart et al., 2009).

La dynamique des MT peut grossièrement être définie par 4 paramètres : la vitesse


de croissance, la vitesse de raccourcissement, la fréquence des catastrophes et la fréquence
des sauvetages.

Les protéines capables d'interagir avec la tubuline sont nombreuses et appelées


globalement MAP (MT associated proteins) (Desai and Mitchison, 1997). Ce groupe
hétérogène de protéines peut interagir avec la tubuline polymérisée, non polymérisée ou les
deux. Elles sont retrouvées sur toute la longueur du MT ou préférentiellement accumulée à
l'extrémité "+" ou l'extrémité "-". Les MAP jouent un rôle dans la nucléation des MT,
catalysent des modifications post-traductionnelles sur la tubuline ou utilisent les MT comme
des rails pour transporter des vésicules.

Mais les MAP ont surtout une action régulatrice de la dynamique des MT:1/ par
leur fonction stabilisatrice des MT en favorisant le sauvetage, en diminuant la fréquence des
catastrophes ou en accélérant la polymérisation/diminuant la vitesse de dépolymérisation ; 2/
par leur fonction déstabilisatrice, en miroir de la fonction stabilisatrice, en accélérant la
43
dépolymérisation, réduisant la vitesse de polymérisation, favorisant les catastrophes ou en
prévenant les sauvetages en séquestrant la tubuline disponible (Vaart et al., 2009).

Les MAP constituent un réseau complexe et je présenterai essentiellement les


protéines avec une action stabilisatrice et déstabilisatrice associées à l'ensemble du polymère ;
et je me focaliserai sur les protéines associées à l'extrémité + des MT, les +TIP.

• Les MAP stabilisatrices

Les protéines structurales Tau, MAP2, MAP4 et DCX (doublecortin) décorent toute
la longueur des MT et sont les MAP stabilisatrices les plus étudiées. MAP2, Tau et DCX sont
principalement exprimés dans les neurones, alors que MAP4 est retrouvée dans de nombreux
tissus mais rarement dans les neurones (Dehmelt and Halpain, 2005; Moores et al., 2006)

Elles participent à la stabilisation des MT en liant deux dimères de tubulines


adjacents. La fréquence des catastrophes est par conséquent fortement réduite, la vitesse de
dépolymérisation ralentie et la vitesse de polymérisation. Une autre manière de stabiliser les
MT est d'antagoniser une MAP déstabilisatrice. Par exemple, il a été observé que la protéine
Tau pouvait restaurer l'effet de la protéine déstabilisatrice XKCM1 (Xenopus kinesin
catastrophe modulator-1) (Noetzel et al., 2005) et protéger de l'action de la katanine, une
enzyme pouvant sectionner les MT (Qiang et al., 2006). De la même manière, la présence de
MAP4 sur le MT empêche l'accroche de la protéine dépolymérisante MCAK (Holmfeldt et
al., 2002)

Ces MAP sont elles-mêmes hautement régulées par phosphorylation (Ramkumar et


al., 2018). Cette phosphorylation va entrainer leur détachement de la paroi des MT, abrogeant
leurs effets stabilisateurs et permettant l'accès aux protéines sectionnant les MT et favorisant
les catastrophes.

En pathologie ces MAP ont été identifiées comme impliquée dans des pathologies
neurologiques (Kametani and Hasegawa, 2018) ou psychiatriques (Marchisella et al., 2016)
et de nombreux cancers.

Par exemple, MAP4 est un facteur indépendant de mauvais pronostic lorsqu'elle


est surexprimée dans les cancers oesophagiens, entrainant une survie globale plus courte. Le

44
mécanisme sous-jacent semble être dépendant de la voie de signalisation MAP4-ERK-Jun-
VEGF régulant l'invasion et la migration des cellules tumorales cependant la relation exacte
entre le rôle de MAP4 dans cette voie et les microtubule reste à être identifié (Jiang et al.,
2016).

• Les MAP déstabilisatrices

Les MAP déstabilisatrices favorise la dépolymérisation, les catastrophes et


empêche la polymérisation des MT.

Les MAP dépolymérisantes les plus connues, mais également les plus efficaces,
sont les kinésines non-motrices de la famille kinésine 13. Elles montrent une affinité
particulière pour la conformation courbée de la tubuline, et possèdent une activité ATPasique,
qu’elles utilisent non pas pour se déplacer sur le MT comme les autres kinésines, mais pour
dépolymériser les MT ou séquestrer les dimères libres dans le cytoplasme. La famille des
kinésines 13 comporte les protéines Kif2A, Kif2B and Kif2C/MCAK (Mitotic Centromere-
Associated Kinesin). Elles jouent notamment un rôle important dans le contrôle de la
dynamique des MT durant la mitose (Vaart et al., 2009).

Un autre exemple est l'oncoprotéine 18 (OP18)/stathmine qui séquestre les


dimères libres de tubuline dans le cytoplasme en formant des complexes ternaire de forte
affinité, diminuant le stock de tubuline libre disponible pour la polymérisation des
protofilaments (Steinmetz, 2007). La stathmine a aussi la capacité de se lier aux dimères
terminaux du bout + des MT et de les détacher, ce qui induit la perte de la coiffe GTP et
l’augmentation de la fréquence des catastrophes (Vaart et al., 2009).

Enfin, la déstabilisation des MT peut être consécutive à l'action d'une famille


d'enzyme hydrolysant l'ATP pour sectionner les polymères. Ces enzymes appartiennent à la
superfamille des protéases AAA (ATPases Associated with a number of cellular Activities) et
sont principalement la katanine, la spastine et la fidgetine. Elles lient les MT sous la forme
d'héxamères et désassemblent une tubuline par protofilament provoquant la coupure du
polymère à un site bien précis (Sharp and Ross, 2012) Ainsi, les protéines sectionnant les MT
jouent un rôle important dans le contrôle de la longueur des MT et sont des acteurs importants
dans la génération de MT extra-centrosomaux. Ce système est particulièrement important dans

45
les neurones où il permet d'entretenir la présence de MT le long de l'axone, mais également
dans la régulation du fuseau mitotique et la ségrégation des chromosomes (Akhmanova and
Steinmetz, 2015a; Sharp and Ross, 2012).

• Les +TIP

Parmi les MAP, un sous-groupe de protéines ayant des rôles et des structures
diverses, régulent la dynamique des MT en se localisant par définition spécifiquement à
l'extrémité "+" du polymère en croissance. Pour cette raison elles sont appelées les +TIP
(+End Tracking Proteins). Certaines possèdent également la capacité de lier le bout « + » en
phase de dépolymérisation. Il a été identifié plus d'une vingtaine de +TIP et leur classification
est basée en général sur leurs caractéristiques structurales qui leur permettent d'interagir entre
elles et avec les MT.

Cependant certaines +TIP combinent des caractéristiques relatives à différentes


classes de +TIP. La majorité sont des protéines possédant plusieurs domaines ou sous-unités
d’interaction avec des structures situées dans le cytoplasme ou au niveau de la membrane
plasmique et certaines possèdent des propriétés de moteur des MT (figure 10) (Akhmanova
and Steinmetz, 2010).

L'interaction entre les +TIP au sein d'un réseau protéique complexe est fondamental
pour assurer la régulation de la dynamique des MT. Les +TIP jouent un rôle dans le guidage
des MT vers d'autre éléments du cytosquelette par exemple l’actine ; favorisent l'attachement
de l'extrémité + aux structures cellulaire comme la membrane plasmique, le réticulum
endoplasmique ou les kinétochores durant la mitose ; recrutent et concentrent des protéines à
l'extrémité + pour déclencher une signalisation cellulaire ; participent au trafic vésiculaire et
paradoxalement ont une fonction émergente dans la régulation de l’extrémité moins et la
nucléation des MT (Akhmanova and Steinmetz, 2010, 2015).

Dans la section suivante, je présenterai d’abord les +TIP capable de se fixer


directement aux MT en croissance pour se concentrer à l'extrémité +, ce sont les "+TIP
traceurs autonomes de l'extrémité plus". Dans un second temps, je présenterai les protéines
"suiveuses" ou +TIP indirectes capables de reconnaitre la tubuline mais dont la concentration

46
au bout "+" dépend de leur liaison aux traceurs autonomes (Akhmanova and Steinmetz, 2015)
+TIP traceurs autonomes de l'extrémité plus : EB1

La famille des protéines EB

Les protéines de la famille EB (end-binding) sont sans doute les acteurs les plus
importants dans le réseau des +TIP. Chez les mammifères il existe trois EB: EB1, EB2 et EB3
qui sont les équivalents en structure et en fonction de Bim1 ou Mal3 chez les levures
Saccharomyces cerevisiae et Schizosaccharomyces pombe (Nehlig et al., 2017).

EB1, qui est fortement exprimée dans de nombreux tissus, a été la première
isoforme identifiée en 1995 par l’intermédiaire de son partenaire, la protéine APC
(Adenomatous Polyposis Coli), une protéine possédant entre autre une fonction +TIP et un
rôle suppresseur de tumeur dans le cancer colorectal (Su et al., 1995). EB3 est particulièrement
abondante dans le tissu nerveux et musculo- squelettique et peut s’hétérodimériser avec EB1,
les deux isoformes étant considérées comme équivalentes dans leur capacité à lier au MT en
croissance (Nakagawa et al., 2000). EB2 est moins connue, possède une moindre affinitée
avec les MT et sa fonction +TIP est moins marquée. De plus, elle ne forme pas de dimère avec
EB1 ou EB3 (De Groot et al., 2010; Jiang et al., 2012).

EB1 est considérée comme la +TIP principale au sein du réseau, car elle présente
la capacité de se lier directement à la tubuline, de se concentrer à l'extrémité + du fait de son
affinité pour la tubuline-GTP et d'être une plateforme d'interaction pour de très nombreuses
autres + Tips.

47
Figure 10 Représentation simplifiée du réseau des +TIP avec EB1 comme protéine centrale
La protéine EB1 peut grâce à ses différents domaines d’interaction se lier directement au microtubule (MT) dont
elle régule la dynamique, mais constitue également une plateforme faisant le lien entre les +Tips possédant un
motif SxIP ou CAP-Gly et les MT. Grâce à leur interaction avec EB1, ces protéines seront concentrées à
l’extrémité + de MT, comme illustré sur les images d’immunofluorescence. On voit clairement la localisation de
CLIP170 (en bas à droite), qui lie EB1 par son domaine CAP-Gly, et de ch-TOG (en bas à gauche) qui lie EB1
par l’intermédiaire de SLAIN.

48
Relation structure et fonction des domaines d’EB1

Au niveau structural, EB1 est un (Weisbrich et al., 2007)e protéine de 29 kDa


présentant des régions C-terminale et amino-terminale (N-terminal) relativement conservées,
reliées par une zone de liaison flexible dont la séquence est moins conservée (Figure 11).

La région N-terminale permet l’interaction avec de la tubuline grâce à un


domaine globulaire de type Calponin Homology (CH) chargé positivement (Hayashi and
Ikura, 2003). Le domaine CH est retrouvé dans des protéines liant l'actine et dans d'autres
+TIP. La présence du domaine CH d’EB1 associé au domaine de liaison est indispensable
pour observer son accumulation à l'extrémité "+" des MT, in vitro. Les EB fonctionnent sous
la forme d'homo- ou d'hétéro-dimères ce qui conduit à l'interaction de deux domaines CH avec
la tubuline (De Groot et al., 2010). EB1 a une très grande affinité pour l’extrémité « + » (10
fois plus que pour la partie latérale du MT (Maurer et al., 2011). En microscopie, les EB se
présentent sous la forme typique de comètes oblongues de 0,5 à 2 µm de long à l'extrémité
"+" des MT en croissance au niveau de la coiffe GTP (Bieling et al., 2007; Mimori-Kiyosue,
2011; Seetapun et al., 2012) (Figure 11). Ces comètes ne sont plus visibles lors les MT entrent
en pause ou subissent des catastrophes, indiquant qu’EB1 se dissocie alors du polymère
(Maurer et al., 2011).

Ces comètes sont des lieux d'échanges rapides où les dimères d'EB s'attachent et se
détachent de manière répétée avant que l‘extrémité "+" ne soit mature et intégrée dans la
structure du polymère. L’étude du mécanisme permettant l’accumulation préférentielle à
l’extrémité + a montré que le site de liaison d'EB se situe à quelques dizaines de nanomètres
de la partie distale du MT et préférentiellement au niveau de tubulines sous la forme GTP ou
GDP-Pi (Maurer et al., 2011; Zanic et al., 2009). Les analyses en cryo-microscopie
électronique de l'association EB1/MT (utilisant des MT formés à base de tubuline GTPgS, non
hydrolysable) ont révélé que le domaine CH se liait préférentiellement à l'intersection entre
quatre dimères de tubuline (Maurer et al., 2011; Zhang et al., 2015). Ce positionnement lui
permet de détecter les modifications de conformation (courbure) et de tension des MT induits
par l'hydrolyse du GTP (Alushin et al., 2014; Maurer et al., 2011; Zhang et al., 2015). Ces
observations révèlent que les EB sont capable de jauger l'état d'hydrolyse du nucléotide lié à
la tubuline et expliquent donc la localisation à la fois au bout plus et la forme de la comète :
la concentration d'EB1 diminue avec la raréfaction des dimères de tubuline-GTP qui survient
à mesure que l'on s'éloigne du bout "+".
49
La fonction du domaine de liaison est moins connue, mais il pourrait avoir un
rôle régulateur dans la liaison EB-tubuline, par interaction avec le domaine CH, interaction
régulé possiblement par phosphorylation de résidus sérine sur la zone de liaison 2014 (Buey
et al., 2011; Xia et al., 2014; Zimniak et al., 2009).

Le domaine C-terminal d'EB1 présente un domaine coiled coil qui permet l'homo
ou l'hétérodimérisation parallèle des EB (Figure11). Ce domaine de dimérisation nommé
EBH (EB homology) est composé de quatre hélices-a et d'une partie de la région désordonnée
C-terminale. Lors de la dimérisation, les domaines EBH forment une cavité hydrophobe qui
permet l'interaction entre EB1 et les protéines possédant un motif SxIP (Sérine-n’importe quel
résidu-Isoleucine-Proline » (Kumar and Wittmann, 2012). Ce domaine SxIP est porté par
nombreux partenaires d’EB1 protéines (Figure 10) identifiés par méthode de protéomique
(Jiang et al., 2012).

Récemment, il a été montré que le motif LxxPTPh pourrait permettre également la


localisation de protéines à l’extrémité plus des MT (Kumar et al., 2017), via l’interaction avec
le C-terminal d’EB1, ce qui pourrait conduire à identifier de nouvelles +TIP. Cependant, des
données supplémentaires sont nécessaire pour confirmer cette hypothèse.

La partie extrême C-terminale d’EB1 présente une région désordonnée, incluant des
résidus acides, se terminant par le motif EEY/F, identique à celui retrouvé dans la partie C-
terminale de la tubuline. Ce motif est nécessaire à l’interaction des +TIP possédant un domaine
CAP/Gly (Weisbrich et al., 2007) comme CLIP170 ou la dynactine p150glued avec EB1.
L'extrémité C-terminale flexible jouerait également un rôle dans les phénomènes d'auto-
inhibition d'EB1, en interagissant avec la partie N-terminale et en inhibant l’effet d'EB1 sur la
polymérisation des MT. La liaison d’EB1 avec les protéines ayant un domaine CAP-Gly,
notamment p150glued lève cette inhibition (Hayashi et al., 2007). Certaines MAP vont réguler
la disponibilité d’EB1 à l’extrémité des MT : MAP1B dans les neurones interagit et inhibe
l’action d’EB1 par séquestration dans le cytoplasme (Tortosa et al., 2013) ; Tau/MAP1 peut
aussi réguler négativement EB1 par déplacement d’EB1 de l’extrémité + (Ramirez-Rios et al.,
2016; Sayas et al., 2015) ; et ATIP3 régule négativement EB1 avec qui il interagit dans le
cytosol, par un mécanisme qui n’est pas élucidé. Enfin, la fonction d’EB1 pourrait être régulée
par des modification post-traductionnelles, comme la phosphorylation (Figure11) (Chen et
al., 2014; Nehlig et al., 2017) ou acétylation (Xia et al., 2012).

50
Figure 11 Domaines fonctionnels et structure des protéines EB.
(A1) Représentation linéaire des domaines d’interaction protéine-protéine de la protéine EB1, ainsi que les
résidus sérine et tyrosine susceptibles d’être phosphorylés. (A2) Les isoformes EB1, EB2 et EB3 présentent des
homologies de séquence et de l’organisation en domaines fonctionnels avec leurs homologues retrouvés chez les
levures (Mal3 et Bim1), traduisant une conservation de la protéine entre les espèces. (B) Illustration de la
structure tertiaire d’un dimère d’EB1. On observe clairement les sites de liaison aux microtubules (domaines
CH, en N-terminal), des domaines de liaison, et des domaines EBH permettant l’interaction avec les protéines
contenant un motif SxIP. Le motif EEY/F en C-terminal permet l’interaction avec les protéines ayant un domaine
CAP-Gly. (C) L’analyse par immunofluorescence de cellules de carcinome mammaire illustre la présence de
comètes EB1 (marquées par un anticorps anti-EB1, en vert) s’accumulant à l’extrémité + des microtubules
(marqués avec un anticorps anti-tubuline, en blanc).

§ Modulation de la dynamique de MT par les protéines EB

Les EB ont une action complexe sur la dynamique des MT. In vitro, l’addition d’EB
sur MT reconstitués augmente clairement la vitesse de polymérisation et la fréquence de
catastrophes (Vitre et al., 2008; Zanic et al., 2013). L’augmentation du nombre de catastrophe
est médiée par leur activité GTPase qui accélère l'hydrolyse de la GTP-tubuline réduisant ainsi
la taille de la coiffe (Maurer et al., 2011, 2014), mais également le nombre de site d’interaction
d’EB1.
51
En revanche, in vivo, l’action des EB semble majoritairement favoriser la croissance
des MT suggérant que le rôle pro-catastrophe observé in vitro est inhibé (Komarova et al.,
2009); il a été observé que la présence d'EB rend les MT plus dynamiques, stimulant
principalement l'élongation. Mais cet effet sur la polymérisation varie selon le contexte
cellulaire, car in vivo, l'impact des EB résulte à la fois des leurs propriétés intrinsèques, mais
aussi de la nature des +TIP qu'elles recrutent, qui peut varier d'une lignée cellulaire à l'autre
(Akhmanova and Steinmetz, 2010).

Le rôle favorisant la croissance des MT d’EB1 et le recrutement de facteurs


organisant les MT notamment en faveur de la migration explique peut-être que les études de
l’expression d’EB1 est dans les tumeurs est fréquemment augmentée ce qui lui confèrerait une
possible fonction pro-oncogénique.

§ Données concernant EB1 en cancérologie

EB1 est surexprimée dans de nombreux cancers tels que les carcinomes de la
cavité orale, les cancers œsophagiens, les cancers coliques ou les cancers du sein (Dong et al.,
2010a; Kumar et al., 2016; Wang et al., 2005). Cette surexpression est associée à un mauvais
pronostic pour la survie dans les cancers de la cavité buccale et les cancers du sein (Dong et
al., 2010a; Kumar et al., 2016). Il a également été montré que le gène codant pour EB1
(MAPRE-1) et la protéine EB1 étaient surexprimés dans les lésions pré-tumorales colique ou
le sérum des patients atteints de tumeurs ORL et participeraient aux évènements précoces de
la tumorigenèse des cancers du sein (Kumar et al., 2016; Ladd et al., 2012; Stypula-Cyrus et
al., 2014; Taguchi et al., 2015).

Cependant, et contrairement à APC, aucune mutation somatique d'EB1 n'a été


identifié dans les tissus de cancers du côlon (Jaïs et al., 1998). Finalement, EB1 a été associé
à la sur-activation de la voie de signalisation béta-caténine/TCF dans les cancers oesophagiens,
qui impliquerait l'interaction EB1-APC (Wang et al., 2005), une voie également largement
dérégulée par les mutations d’APC dans le cancer du côlon (Aoki and Taketo, 2007).

+TIP traceurs autonomes de l'extrémité plus : chTOG

La protéine XMAP215 (Xenopus Microtubule Assembly Protein), équivalent de


chTOG chez l'homme (Colonic and Hepatic Tumor Overexpressed Gene Protein), a été

52
initialement identifiée dans les extraits d'oeufs de Xenopus Laevis, lors d’expériences qui ont
révélé qu'elle augmentait d’un facteur 10 la vitesse de croissance des MT in vitro (Gard and
Kirschner, 1987). Les protéines de cette famille sont localisées aux kinétochores, participant
à l'assemblage du fuseau mitotique et à la ségrégation des chromosomes. En cas de perte de
XMAP215, les MT sont plus courts avec une vitesse de croissance plus lente, et le fuseau
mitotique, également plus petit, est assemblé de manière aberrante (Cullen et al., 1999; Wang
and Huffaker, 1997). Ces observations ont été confirmée dans d'autres espèces, telles que la
levure Saccharomyces cerevisiae et la drosophile, où la perturbation de la fonction de
XMAP215/ch-TOG induisait une diminution de la vitesse de croissance des MT (Brittle and
Ohkura, 2005; Severin et al., 2001).

Sur le plan moléculaire, XMAP215/ch-TOG agit comme une tubuline polymérase


qui, grâce à ses cinq domaines TOG, peut interagir avec les dimères libres de tubuline mais
également l'extrémité "+" du polymère (Widlund et al., 2011), permettant de rapprocher et de
catalyser l'incorporation des dimères de tubuline à l'extrémité en croissance (Al-Bassam and
Chang, 2011; Brouhard et al., 2008).

chTOG est localisée au plus près de l'extrémité "+" des MT, sur le lieu d'échange
entre tubuline soluble et tubuline polymérisé. C’est une +TIP qui lie à la fois des MT en
croissance et aussi en raccourcissement. Des études in vitro ont montré que chTOG avait une
affinité particulière pour les dimères d’a-b tubuline courbées c'est à dire liée au GTP ou
GDP+Pi (Ayaz et al., 2012a; Brouhard et al., 2008).

Au sein du réseau des +TIP, la protéine chTOG lie directement les protéines
TACC3, CLASP et SLAIN (Figure 10) par l'intermédiaire de son extrémité C-terminale qui
possède un domaine coiled-coil. Ces interactions modulent son activité (Al-Bassam and
Chang, 2011; Mortuza et al., 2014).

Enfin, chTOG a une relation importante avec EB1, même si les deux protéines ne
sont pas liées directement, mais par l'intermédiaire de SLAIN (Vaart et al., 2011). In vitro, il
existe une coopération fonctionnelle entre EB1 et chTOG qui favorise la polymérisation des
MT et accélère la vitesse de croissance (Zanic et al., 2013). L'étude de l'association EB1-
chTOG en microscopie de super-résolution a montré que les deux protéines étaient distantes
entre elles de d’une centaine de nanomètres, chTOG étant plus proche du bout + des MT. Bien
que ces deux protéines ne se liaient probablement pas sur les mêmes sites de l’extrémité + des

53
MT, leur action est synergique et leur association augmentait la dynamique des MT
(Nakamura et al., 2012). Cependant une étude très récente, utilisant une technique innovante
de photo-inhibition transitoire d'EB1, a rapporté que la localisation de chTOG à l'extrémité +
des MT était indépendante d’EB1, rendant encore plus complexe la compréhension de la
coopération potentielle entre ces deux molécules (van Haren et al., 2018).

La protéine EB1 par sa caractéristique de traceur autonome de l’extrémité « + » va


servir de plate-forme d’interaction pour de nombreuses autres +TIP dites suiveuses,
participant à réguler l’extrémité « + » des MT mais également l’action d’EB1.

• +TIP suiveuses ou « Hitchhikers »

Les +TIP suiveuses possèdent une affinité pour la tubuline, mais s’accumulent de
manière plus efficace à l’extrémité + des MT via leur liaison avec les traceurs autonomes,
fonction illustrée par le terme « hitchhiker » ou auto-stoppeur donné par Akhmanova et
Steinmetz (Akhmanova and Steinmetz, 2015).

On peut classer ces + Tips suivant leur domaine d'interaction avec EB1 (Figure
10):

§ Les protéines +TIP avec un domaine CAP-Gly :

Le domaine CAP-Gly est un module globulaire riche en glycine qui interagit avec
les EB, en reconnaissant le motif EEY/F terminal. Ce motif n'est pas spécifique aux EB, il est
également retrouvé au niveau des tubulines tyrosinées, et sur SLAIN1/2 (Vaart et al., 2011;
Weisbrich et al., 2007). Cette famille de +TIP inclut les protéines CLIP (Cytoplasmic LInker
Proteins) et la grosse sous-unité de la dynactine: p150Glued.

CLIP170 est impliquée dans la stabilisation des MT, agissant comme facteur anti-
catastrophe ou comme facteur de sauvetage dans de nombreuses espèces. De plus, CLIP170
et ses homologues favorisent la capture des MT au niveau de sites corticaux en interagissant
directement avec le complexe dyneine/dynactine (Akhmanova and Hoogenraad, 2005;
Weisbrich et al., 2007).

§ Les protéines +TIP avec un motif SxIP:

C’est un petit motif nécessaire et suffisant à l'interaction avec EB, au niveau du


54
domaine EBH (Honnappa et al., 2009). De nombreuses +TIP portent ce motif, certaines en
possèdent plusieurs copies (Jiang et al., 2012; Kumar and Wittmann, 2012; Tamura et al.,
2015). Il est retrouvé au niveau de régions désordonnées et basiques des protéines, ce qui
contribue à renforcer l'affinité de celles-ci pour la région C-terminale acide des EB et la
surface des MT, chargées négativement (Akhmanova and Steinmetz, 2008). Cette interaction
pourrait être régulée par des kinases, puisque la phosphorylation de sérines situées à proximité
du motif SxIP, perturbent l'interaction +TIP/EB, probablement via répulsion électrostatique
(Kumar and Wittmann, 2012).

Parmi les +TIP contenant un motif SxIP on peut citer APC, MCAK, MACF
(Microtubule Actin Crosslinking Factor) ou les CLASP (CLip Associated Proteins)
(Akhmanova and Steinmetz, 2015).

Parmi les protéines portant un motif SxIP, la protéine Adeno Polyposis Coli va être
présentée plus en détail.

C’est une protéine relativement volumineuse de 310 kDa et 2843 résidus, qui
possèdent de très nombreuses fonctions cellulaires. Sa fonction la mieux connue est la
régulation de la voie de signalisation associée à b-caténine. APC est également considéré
comme une +TIP, modulant la dynamique des MT ce qui conduit à des effets sur la polarité,
la migration, le transport vésiculaire ou la ségrégation des chromosomes pendant la mitose
(Caldwell and Kaplan, 2009; Etienne-Manneville, 2009) mais possède de nombreuses autres
fonction MT indépendantes comme la polymérisation de l'actine et des fonctions dans le
métabolisme cellulaires. Toutes ces fonctions en font un régulateur majeur de l’homéostasie
de l’épithélium notamment colo-rectal et un anti-oncogène important (Hankey et al., 2018;
McCartney and Näthke, 2008; Nelson and Nathke, 2013).

Une grande majorité des cancers du côlon ont des mutations retrouvées dans le
tissu tumoral sur le gène codant pour APC. Ce sont des évènements précoces (Powell et al.,
1992) et fréquents (> 80% des cas) dans l'épithélium colique cancéreux, entrainant dans la
majorité des cas la perte de la région C-terminal (Nelson and Nathke, 2013).
APC s'intègre dans un complexe comprenant l'axine, la caséine kinase ou GSK3b,
qui favorise la dégradation de la b-caténine par le protéasome. APC, lorsqu’elle est mutée, ne
peut donc plus réguler négativement la voie de différenciation et de prolifération
WNT/b-caténine. C’est pour cela qu’APC est considéré comme suppresseur de tumeurs. La

55
mutation constitutionnelle d'APC entraîne une polyadénomatose familiale, générant des
centaines de polypes coliques chez les patients, qui ont un risque cumulé de carcinome
colorectal de 100% au cours de leur vie (Hankey et al., 2018).

APC lie directement les MT et favorise in vitro leur polymérisation et leur


stabilisation dans les cellules, empêchant par exemple leur dépolymérisation induite par le
nocodazole (Munemitsu et al., 1994; Zumbrunn et al., 2001). Le rôle de +TIP d'APC est
surtout associé à sa capacité à lier EB1 car il possède un SxIP à sa partie C-terminale et
s'accumule à l'extrémité "+" de manière EB1 dépendante (Nakamura et al., 2001; Slep et al.,
2005; Su et al., 1995). EB1 et APC agissent de concert pour favoriser la polymérisation et la
stabilisation des MT (Askham et al., 2000; Nakamura et al., 2001).

La localisation d'APC au cortex cellulaire permet, en plus de stabiliser les MT, de


participer au remodelage de l'actine sous corticale (Askham et al., 2000; Kawasaki et al.,
2000). APC peut fixer l'actine directement par son domaine Armadillo mais aussi
indirectement via son interaction avec la protéine d'échafaudage IQGAP1 lui permettant aussi
le lien avec les GTPases Rac1 et CdC42 qui régulent la polymérisation de l'actine (Watanabe
et al., 2004).
APC module la polymérisation de l'actine, favorise l'organisation en faisceaux et
peut lier les fibres de stress (Okada et al., 2010). Il a été montré qu’APC collabore avec la
formine mDia dans la nucléation de l'actine et cette fonction est primordiale pour la migration
dirigée et le turnover des adhésions focales (Yamana et al., 2006).
Sa capacité à lier actine et MT en fait une protéine de couplage entre les différents
éléments du cytosquelette et lui confère un rôle important dans la migration dirigée des
cellules normales et tumorales (Barth et al., 2008; Sansom et al., 2004). La régulation d’APC
par phosphorylation via la protéine GSK3b favorise sa liaison à la b-caténine, mais inhibe la
liaison à la tubuline, rendant ces deux interactions mutuellement exclusives (Harris and
Nelson, 2010; Zumbrunn et al., 2001). La liaison à EB1 est également modulée par la
phosphorylation d'APC sur ses domaines C-terminaux (Askham et al., 2000).
Dans le cancer du sein, le promoteur d’APC a été rapporté comme fréquemment
hyperméthylé (Jin et al., 2001; Van der Auwera et al., 2008; Virmani et al., 2001) et la voie
b-caténine a été rapportée comme suractivé dans une faible proportion de cancer du sein par
mutation du C-terminal d’APC (Jönsson et al., 2000; Odenwald et al., 2013; Schlosshauer et
al., 2000)

56
Pour conclure, APC est une protéine centrale impliquée dans de très nombreux
processus intracellulaires ; la perte de sa partie C-terminale est directement liée aux processus
tumoraux colique, qui pourrait déréguler la dynamique des MT et de la migration cellulaire.

D'autre +TIP importantes favorisent l'interaction de l’extrémité « + » des MT avec


différentes zones et structures cellulaires, favorisant ainsi la capture et la stabilisation des MT.
Les CLASP (il existe deux protéines connues chez les mammifères, CLASP1 et CLASP2)
jouent un rôle dans l'attachement des MT aux kinétochores et dans la ségrégation des
chromosomes, durant la mitose (Maiato et al., 2003). En interphase, elles sont impliquées dans
la capture et la stabilisation des MT au niveau du cortex cellulaire (Mimori-Kiyosue et al.,
2005; Zaoui et al., 2010)

Le dimère d’EB est au centre du réseau de +TIP. Les différentes +TIP se lient au
dimère d’EB, mais ces +TIP peuvent en plus former des interactions entre-elles (CLIP170 et
CLASP), avec d’autres protéines des extrémités + (SLAIN et chTOG) ou directement aux MT
(CLIP170) (Akhmanova and Steinmetz, 2015). Toutes ces interactions contribuent à la
complexité du réseau des +TIP. Les différentes +TIP forment un réseau complexe
d'interactions modulaires centré autour d'EB au bout des MT, dont une version simplifiée est
présentée dans la Figure 10.

Néanmoins, les hiérarchies d'interactions entre les différentes +TIP, la régulation


du réseau et ses conséquences restent encore assez inexplorées. Les agents ciblant les
microtubules peuvent lier directement la tubuline et en changer ses propriétés, ce qui peut être
un bon moyen d’étudier les MT et ses protéines régulatrices.
e. Mode d’action des ACM et site de fixation sur la tubuline

Les ACM proviennent le plus souvent de substances naturelles isolées à partir


de plantes comme l’if (paclitaxel ou Taxol®) ou la pervenche de Madagascar (vinblastine),
ou d’organismes marins comme les éponges (halichondrine B), qui ont été développées par
les organismes vivants à des fins de défense contre la prédation (Dumontet and Jordan, 2010)

Les ACM ciblent et lient spécifiquement la tubuline entrainant une altération


profonde de la dynamique et de la polymérisation des MT. Tous ces agents sont considérés
comme des antimitotiques. Ils inhibent la prolifération cellulaire en se liant aux MT du fuseau
mitotique dont ils inhibent la dynamique, durant la phase particulièrement vulnérable du cycle

57
que constitue la mitose. Leur mode d’action est divisé entre les ACM entrainant la
dépolymérisation et bloquant la croissance des MT et ceux stabilisant et inhibant la
dépolymérisation des MT (Tableau 1).

Des études conformationelles, de photo-marquage et de cristallographie ont


identifié les sites de liaison des principaux ACM.

58
Tableau 1 Présentation des différentes classes d’agents anti-MT et leur
application en clinique

D’après C Dumontet and MA Jordan, Nat Rev Drug Discov 2010 and JJ Field al
Bioorg Med Chem 2014

59
• Agents dépolymérisant les MT (ADM)

La colchicine est historiquement le premier ACM identifié. Son action d’inhibition


de la mitose et de la prolifération tumorale dans des modèles animaux était connue depuis
1934-1936 (Brues and Cohen, 1936), ce qui a permis d’identifier sa cible protéique : la
tubuline.

Le site de liaison de la colchicine se situe à l’interface intra-dimère entre les sous-


unités de tubuline α et β.
Le domaine de liaison des vinca alcaloïdes, plus étendu, se situe à l’interface
entre deux dimères ; proche du site E de la tubuline-b, favorisant une conformation courbée
du dimère et entrainant une cassure dans la liaison inter-dimère. Il existe des sites de liaison
de faible affinité le long de la surface du polymère, mais les sites de plus forte affinité se
situent à l’extrémité +, empêchant l’addition de nouveau dimère. A forte dose, la liaison au
site de vinca alcaloïde entraine une augmentation d’affinité de la tubuline pour elle-même
pouvant aboutir à la formation de structures spiralées appelées paracristaux (Figure 12).

• Agents stabilisant les MT (ASM)

Le paclitaxel (Taxolâ) est le plus ancien ASM identifié et se lie à la sous-unité de


tubuline β lié au GDP incorporée dans le MT, dont il favorise la stabilité. Le site de liaison du
paclitaxel et du docetaxel se situe dans la lumière du tube formé par les protofilaments.
D’autre ASM comme la peloruside ou la laulimalide, lient un site sur la face externe du
polymère (Dumontet and Jordan, 2010) (Figure 12)

Cette liaison, proche du site E de la tubuline, favorise la conformation linéaire du


dimère et stabilise le MT. La polymérisation des MT est également majorée et à fortes doses
la masse polymérisée est augmentée avec une inhibition de la dépolymérisation aux deux
extrémités des MT. Cela favorise aussi les contacts latéraux entre MT créant de véritables
faisceaux intracellulaires (Figure 12).

• Action des faibles doses d’ACM

Il a été établi, in vitro, que les ACM favorisent l’inhibition de la dynamique des MT

60
à une concentration 10 à 100 fois moindre que les doses cytotoxiques, sans changement de la
masse des MT. En fait, ce mécanisme d’action serait commun aux ACM qu’ils soient
stabilisateurs ou déstabilisateurs des MT (Derry et al., 1998). De façon remarquable, cette
inhibition est effective à de faibles doses, infra-stoechiométriques, non anti-mitotiques.
L’inhibition de la dynamique des MT dans ces conditions entrainant un arrêt de la migration
et de l’organisation en vaisseaux des cellules endothéliales, elle est certainement au cœur des
propriétés anti-angiogéniques puissantes des ACM (Field et al., 2014). De même, les ACM à
faible doses entrainent l’arrêt de la migration des cellules tumorales, ce qui pourrait aussi
contribuer à limiter l’apparition de métastases (Cadamuro et al., 2016).

A l’ère des thérapeutiques ciblées et de l’immunothérapie, le développement de


chimiothérapie cytotoxique paraît peut-être moins pertinent. Cependant, nombreuses sont les
nouvelles molécules d’agents cytotoxique qui continue d’être développées dont beaucoup
ciblent la tubuline (Molinski et al., 2009). L’eribuline en fait partie.

• L’Eribuline ; un nouvel agent anti microtubule dans le cancer du

sein

Au point de vue pharmacologique, l’éribuline est une cétone macrocyclique,


analogue synthétique de l’halichondrine B, qui est elle-même un agent dépolymérisant les
MT, et se liant au domaine des vinca alcaloïdes (Bai et al., 2011) (figure 13). In vitro, de
faibles doses d’éribuline diminuent la vitesse de croissance et la longueur des MT (Jordan et
al., 2005) (figure13).

A fortes concentrations, les hétérodimères de tubuline sont séquestrés dans des


agrégats visibles en microscopie électronique et l’éribuline induit un blocage non réversible
de la division cellulaire, augmentant l’apoptose (Towle et al., 2011). La concentration
intracellulaire maximale est obtenue après 4 heures d’exposition et l’efflux est lent par rapport
aux autres analogues de l’halichondrine B (Towle et al., 2011).

Ces caractéristiques pharmacocinétiques pourraient en partie expliquer comment


l’éribuline outrepasse la résistance aux autres ACM. Néanmoins, les effets de l’éribuline sur
les cellules tumorales, notamment à faibles doses, sont encore peu étudiés.

61
Figure 12 Description des principaux agents ciblant les microtubules ACM) et leur interaction
avec la tubuline
(A) Représentation topologique des principaux représentants des agents dépolymérisant les MT se
fixant au domaine vinca alcaloïdes (la vinblastine), ou au site de la colchicine et du paclitaxel. (B) Hétérodimère
de tubuline centré sur la b-tubuline. Le domaine vinca alcaloïde et les sites de la colchicine et du paclitaxel sont
représentés avec les ligands : vinblastine en orange, paclitaxel en jaune et colchicine en rose. Les sites de fixation
du GTP sur les deux tubulines sont représentés en violet. (C) Conformations particulières que prend la tubuline
sous l’effet de fortes d’ACM. Le taxol à 1 M désorganise le réseau de microtubules qui s’agrègent entre eux
sous forme de faisceaux. La vinblastine à 10 M génère des spirales de tubuline qui s’organisent en agrégats
semblables à des cristaux. (D) Permet de visualiser le site d’interaction des ACM sur le microtubule polymérisé.
La colchicine et la vinblastine se lient sur la partie externe de la molécule de tubuline b avec une préférence pour
l’extrémité « + » pour la vinblastine. Le paclitaxel lie aussi la tubuline b mais sur sa face luminale. (B) D’après
R. Bai et al., Journal of Chemical Information and Modeling 2011 (D) D’après C Dumontet and MA Jordan, Nat
Rev Cancer 2010

62
Figure 13 : Représentation de l’interaction entre l’éribuline et la tubuline et illustration de la
perturbation de la dynamique des microtubules qui en découle
(A) Représentation topologique des molécules d’halichondrine B et d’éribuline avec, encadré en rouge, la partie
de l’halichondrine B dont provient l’éribuline. Le site de fixation de l’éribuline est représenté en vert sur la
molécule de tubuline b, non loin du site de fixation des vinca alcaloïdes (en violet) et du site E capable de liée et
d’hydrolyser le GTP.
(B) Exemple de kymographes représentant les phases dynamiques de croissance et de décroissance des
microtubules en fonction du temps, visualisés en vidéomicroscopie, in vitro (1 et 2) et dans des cellules de cancer
du sein (3 et 4). Les microtubules non traités par eribuline (1 et 3) présentent une phase de croissance avant une
phase brutale de raccourcissement (catastrophe), puis une reprise d’une phase de croissance (sauvetage), créant
une large amplitude dynamique. Les microtubules traités par l’éribuline (2 et 4) montrent une amplitude
dynamique faible avec des phases de croissance beaucoup moins rapides.

D’après Jordan et al, Mol Cancer Ther, 2005

63
Les agents dépolymérisant ont une affinité importante pour l’extrémité « + » des
MT et les ACM en général modifient la dynamique des MT. Pour ces deux raisons, plusieurs
études se sont intéressées à l’effet des ACM sur la localisation et l’action des +Tip.

La reconstitution in vitro de polymère de tubuline a montré que l’action des ACM


était potentialisée par la présence d’EB, nécessitant une concentration de drogue moins
importante pour obtenir l’abrogation de la dynamique des MT. La localisation de EB3 au
bout « + » était diminuée par les doses croissantes de dolastatine, un ADM (Mohan et al.,
2013). La présence des EB dans un système in vitro auquel un agent dépolymérisant a été
ajouté semblait accélérer le processus de dépolymérisation probablement par les propriétés
pro catastrophe des EB in vitro.

Sur des lignées cellulaires, les mécanismes d’inhibition de la migration par les
ACM ont aussi été reliés à la présence de EB1 à l’extrémité « + ». La taille des comètes EB1
diminuait avec des faibles concentrations d’ACM et cette perte de localisation était corrélée
avec un défaut de migration dans les cellules endothéliales et tumorales (Berges et al., 2014;
Honoré et al., 2008; Pagano et al., 2012).

Comme préalablement évoqué, la surexpression d’EB1 a été suggéré comme un


facteur de mauvais pronostic dans les tumeurs (Dong et al., 2010), mais aussi facteur associé
à l’efficacité des vinca alkaloïde dans les glioblastomes (Berges et al, oncotarget 2014). Il a
également été proposé qu’il existait une association synergique entre la surexpression d’EB1
ou de CLIP170 et la réponse au paclitaxel dans des tumeurs mammaires (Luo et al., 2014; Sun
et al., 2012). Enfin dans un modèle de cancer du côlon, la perte de fonctionnalité d’APC a été
associée à une meilleure cytotoxicité, médiée par l’apoptose, sous l’effet de la vinorelbine
(Klotz et al., 2012).

Au total, la fonction des +TIP semble être étroitement corrélée à l’activité des
ACM, par une action synergique in vitro, ce qui semble logique dans la mesure où ce sont des
molécules liant la tubuline avec une affinité accrue pour l’extrémité « + » et régulant la
dynamique des MT. In vivo, les données sont beaucoup moins claires et l’étude
complémentaire des mécanismes d’interaction +TIP-ACM doivent être menées

64
• Résistance aux agents anti-microtubule

La résistance aux ACM représente la cause principale d’échec au traitement et


plusieurs mécanismes ont été identifiés. Comme mentionné précédemment la variation
d'isotypes de tubuline a et b composant les MT va influencer la dynamique et les fonctions
des MT. En cancérologie, de nombreuses études ont rapporté une corrélation entre l'agressivité
de la tumeur, la sensibilité aux ACM, la survie des patients, et le sous-type de tubuline b, cible
thérapeutique des agents polymérisant et dépolymérisant.

L’impact de la forte expression de la tubuline-bIII (TUBB3) a été le plus étudiée


et corrèle avec un mauvais pronostic, incluant une survie plus courte et une maladie plus
agressive dans de nombreux cancers comme les cancers du sein, du poumon, de l’ovaire, de
l’estomac et les glioblastomes (Kavallaris, 2010). Par ailleurs, le sous type TUBB3 a été
montré comme plus fréquemment associé aux métastases cérébrales du cancer du sein
(Kanojia et al., 2015). C’est également le sous-type TUBB3 qui ressort comme un facteur
important de résistance au paclitaxel ou aux vinca alcaloïdes dans les cancers de l'ovaire, du
poumon et du sein. De manière intéressante, il a été montré que les mutations des gènes codant
les sous types bI, bII, bIVa ou bV, rare dans le cancer, entrainaient une conformation de la
tubuline et des conséquences cliniques très semblables à celle de TUBB3 renforçant encore
l’implication défavorable de ce dernier sous type (Wang et al., 2017).

D'un point de vue mécanistique, la présence du sous type TUBB3 in vitro


favorise la dynamique des MT et augmente la survenue des catastrophes. Il existe également
une modulation de la dynamique des MT via les +TIP d'une manière isotype dépendante. Ces
caractéristiques pourraient expliquer la résistance aux ACM par leur moindre efficacité pour
inhiber l'instabilité dynamique normale de MT (Kavallaris, 2010). Certains ACM comme la
vincristine, la vinorelbine, le nocodazole (in vitro) et l'éribuline dans des lignées cellulaires
mammaires (Wilson et al., 2015) ont montré une affinité réduite pour l'isotype TUBB3.

Au total la composition même du MT semble moduler de façon majeure la


dynamique des MT, leurs rôles intracellulaires, et par conséquent l'action des agents de
chimiothérapie ciblant la tubuline.

65
Le rôle des microtubules dans la migration dirigée

a. L’instabilité dynamique des microtubules permet la régulation de grandes


fonctions cellulaires

Les MT sont des structures à la fois rigides, mais également labiles, alternant des
phases de polymérisation et de dépolymérisation (Figure 9). Cette instabilité dynamique a été
décrite par Mitchison et Kirschner en observant les MT du fuseau mitotique alternant
croissance/décroissance jusqu'à "pécher" le kinétochore chromosomal ; en absence de
fixation, ils observaient la dépolymérisation rapide du polymère (Mitchison and Kirschner,
1984).

De cette manière, l’extrémité « + » explore sans cesse le cytoplasme pour


finalement s’ancrer à des structures diverses (adhésions focales, membrane plasmique,
kinétochores chromosomiques), phénomène qualifié de capture du MT

Les MT régulent des processus intracellulaires majeurs comme :

1. La séparation des chromosomes durant la mitose par l’action du fuseau mitotique


2. Le transport de vésicules vers ou depuis la membrane plasmique
3. L’établissement et le maintien de la polarité cellulaire
4. La transduction de voies de signalisation,
5. La motilité et la migration cellulaire
6. La formation de la base des cils vibratiles et du flagelle des spermatozoïdes

Nous allons développer les rôles des microtubules impliqués dans la régulation de
la migration dirigée des cellules

b. Le rôle des microtubules dans la migration cellulaire dirigée

• La capture des MT

Tous les éléments du cytosquelette jouent un rôle primordial dans la migration


66
cellulaire. Si la contribution du réseau d'actine est de loin la plus étudiée, car il génère la plus
grande partie des forces nécessaire à la motilité, les MT jouent aussi un rôle prépondérant dans
la migration (Figure 14). Cette implication repose sur trois caractéristiques : les propriétés
intrinsèques des MT, la présence des protéines associées au MT et l'interaction avec les autres
éléments du cytosquelette.

Dans les cellules en migration, les MT croissent à partir du centrosome de manière


radiale et polarisée, et vont explorer le cytoplasme jusqu’à rencontrer des structures où ils vont
pouvoir s’ancrer. Cette capture est nécessaire pour la fonction des MT, que ce soit dans le
trafic vésiculaire, la polarisation de la cellule ou la migration dirigée. Les sites de capture sont
constitués de complexes protéiques, contenant des +TIP mais également des protéines
d'échafaudage liant les MT à d’autres structures tel le réseau sous cortical d'actine, les
adhésions focales ou des complexe protéiques associés à la membrane plasmique.

67
Figure 14: Acteurs majeurs impliqués dans le contrôle de la capture des microtubules dans les cellules en
migration: exemple de la signalisation ErbB2, dans un modèle de cancer du sein
(A) Les microtubules (MT) contribuent à la régulation de la migration des cellules tumorales par le contrôle de la
polarité, le transport polarisé de vésicules et la participation au renouvellement des adhésions focales. La capture et la
stabilisation des MT à l'avant de la cellule impliquent de nombreux acteurs, dont les +TIP.
(B) Dans des cellules de carcinomes mammaires en migration, les MT (marquées par la GFP-tubuline, qui apparait en
noir sur l'image) croissent de manière radiale pour être "capturés" au cortex de la cellule (image de gauche); si la voie de
signalisation ErbB2/Memo/ACF7 est perturbée les MT ne sont plus capturés et restent à distance de la membrane
plasmique.
(C) Représentation schématique de la voie de signalisation contrôlant les MT en aval du récepteur ErbB2. La
dimérisation d’ErbB2 avec un autre récepteur de la famille HER/EGFR entraîne son activation et la phosphorylation des
domaines intracellulaires, ce qui va permettre le recrutement de la protéine Memo (mediator of ErbB2-driven cell motility)
et favoriser la formation d'un complexe Memo/RhoA/mDia1. Ce complexe va inhiber l’activité de GSK3 (qui phosphoryle
et inhibe CLASP2 et APC) et permettre la relocalisation à la membrane plasmique de CLASP2 et APC qui recrute
MACF/ACF7. Son interaction avec EB1, va permettre de stabiliser les MT au front de migration.

68
• La polarisation cellulaire implique la capture des microtubules au

cortex

À la suite d’une stimulation chimique (chimiotaxie), mécanique (durotaxie) ou à la


suite d’une blessure, des voies de signalisation se mettent en place. Les GTPase de la famille
Rho : RhoA, Rac1 et Cdc42 favorisent la polarisation de la cellule. Une fois activées, Rac et
Cdc42 s'accumulent au niveau du front de migration pour permettre l'assemblage d’un réseau
dense de filaments d’actine et la formation de protrusions, filopodes et lamellipodes. Le
recrutement et l’activation des intégrines vont conduire à la mise en place des adhésions
focales (AF), à l’avant de la cellule, dans le lamellipode.

Il existe une polarisation également du réseau de MT et la majorité des MT va se


dirigée vers le front de migration, ces MT présents à l'avant ont une dynamique différente de
ceux dirigés vers l'arrière (Wadsworth, 1999). L'activation de Rac et Cdc42 au front de
migration va modifier les caractéristiques de la dynamique en faveur de la stabilisation : la
portion active de la MAP pro-catastrophe stathmine diminue, générant un gradient d'activité
qui permet la croissance des MT à l’avant de la cellule et leur dépolymérisation à l'arrière
(Niethammer et al., 2004).

Les +TIP pro-polymérisation s'accumulent au front de migration. Dans un


modèle de cicatrisation in vitro, le complexe de +TIP associant EB1, APC et mDia a été
identifié comme associé à la capture et la migration des cellules sous le contrôle de Rho (Wen
et al., 2004). Dans un modèle de migration sous le contrôle du récepteur oncogénique ErbB2,
la voie de signalisation Memo-Rho-mDia contrôle la relocalisation d’APC et d'ACF7 à la
membrane pour réguler la capture des MT et la migration dirigée (Zaoui et al., 2008, 2010)
(Figure 14).

Dans tous ces modèles, l'inactivation locale de la kinase GSK3 favorise


l'accumulation des formes non phosphorylées et actives de CLASP1/2 et d’APC qui vont
stimuler la croissance des MT. La spectraplakine ACF7 pourrait contribuer à guider les MT
le long des fibres d'actine vers le front de migration (Etienne-Manneville, 2013; Kumar et al.,
2009).

L'activation de Rac1 et Cdc42 renforce la liaison d'APC, Clip170 et CLASP avec


IQGAP1 protéine d'échafaudage associée à l'actine corticale permettant la capture et la

69
stabilisation des MT dans la protrusion du front de migration (Brandt and Grosse, 2007).

Les premiers MT capturés son nommé les "MT pionniers" car ils peuvent passer au
travers de l'enchevêtrement d'actine sous-corticale, qui barre la route aux MT. Ils sont ensuite
rejoints par d'autres MT, dont la croissance est stimulée par la présence des premiers,
favorisant l'extension du front de migration (Etienne-Manneville, 2013).

Le réseau de MT se renforce alors avec l'aide de la kinésine 1 qui assure la


réticulation des polymères (Jolly et al., 2010). Ces faisceaux, qui peuvent encore être renforcés
par l'action de certaines MAP stabilisatrices (ou par des modifications post-traductionnelles)
génèrent via leur polymérisation des forces mécaniques qui vont pousser et étendre la
membrane cytoplasmique au niveau du front de migration.

Enfin, les MT stabilisés permettent l'adressage de vésicules au cortex cellulaire


augmentant la surface de membrane lors de la fusion (Miller et al., 2009) et apportant des
protéines de signalisation ou des ARNm (Mili and Macara, 2009; Osmani et al., 2010;
Palamidessi et al., 2008)

• La régulation des adhésions focales par les MT

La migration dirigée nécessite que les cellules coordonnent les voies de


signalisation régulant la polarité d'une part et celles assurant le remodelage du cytosquelette
d'autre part pour générer des forces dans le sens du mouvement. La cellule va alors s'orienter
dans la direction du mouvement et former des protrusions membranaires. Le cytosquelette
d'actine et les MT vont contribuer à propulser la cellule vers l'avant en créant de nouveaux
contacts focaux avec la matrice à l‘avant et en rétractant sa partie arrière, par le désassemblage
des sites d'adhésion.

Les sites d'adhérence de la cellule avec la MEC sont appelés adhésions focales (AF)
et ont été identifiées en 1970 par microcopie à contraste interférentiel (Izzard and Lochner,
1976). Ce sont des complexes multiprotéiques (comprenant environ 180 protéines) situés au
niveau des zones de protrusion membranaire des cellules et permettent une interaction
mécanique entre la matrice et la cellule.

70
Les AF permettent un couplage biomécanique entre le cytosquelette cellulaire et les
composants de la matrice mais aussi la transduction de signaux intracellulaires, via des
récepteurs transmembranaires, les intégrines. Lors de la migration les adhésions focales
doivent permettre l'adhésion de l'avant de la cellule au substrat pour la tracter. Mais pour que
la cellule puisse avancer, ceci doit être coordonné avec le désassemblage des FA présentes
sous le corps cellulaire et à l'arrière, libérant la cellule de ses attaches et permettant le
mouvement vers l'avant (figure 15).

Autour des intégrines, qui sont les protéines centrales des AF, s’agrègent des
protéines d’échafaudage et des kinases, le tout orchestré par des Rho GTPases. Les AF suivent
un cycle dynamique : les adhésions naissantes deviennent des complexes focaux, puis des
adhésions focales liant les fibres de stress d'actine (Geiger et al., 2009).

Les phases d’initiation et d’assemblage reposent essentiellement sur l’interaction


des récepteurs transmembranaires hétérodimériques que sont les intégrines, présentes au
niveau des protrusions membranaires (filopodes, lamellipode), avec les constituants de la
matrice tels que le collagène, la fibronectine, la laminine et les protéoglycanes. Les intégrines
possèdent une sous-unité alpha et béta dont il existe respectivement 18 et 8 différents sous-
types, permettant 24 combinaisons d’intégrine liant plus ou moins spécifiquement les
constituants de la MEC (Calderwood et al., 2003). Les intégrines activées vont se concentrer
au niveau de la protrusion (adhésions naissantes) recruter et activer des protéines cytosoliques
et interagir avec le cytosquelette d’actine sous-cortical pour le remodeler et favoriser la
polymérisation en F-actine (Figure 15).

Les adhésions naissantes vont, soit se désassembler, soit maturer et se développer,


ce qui passe par le recrutement de la taline, une protéine de liaison qui peut fixer la queue
cytoplasmique des intégrines et faire le lien avec le cytosquelette d’actine. La taline recrute
également la vinculine qui elle-même lie l'actine et l'a-actinine, contribuant à la stabilisation
des AF (García-Alvarez et al., 2003). La taline peut, directement par voie intracytoplasmique,
activer les intégrines et augmenter leur affinité pour leur substrat matriciel.

La phase de maturation, voit le recrutement d’autres protéines d’échafaudage et de


kinases et un renforcement des liens entre les fibres d’actine par la protéine a-actinine
(Parsons et al., 2010). En réponse à l’activation de RhoA, des moteurs vont s’associer à l'actine
(myosine IIA-IIB) pour générer des forces de traction sur le substrat (Klapholz and Brown,

71
2017). De très nombreuses protéines sont recrutées formant un complexe appelé adhésome et
comportant plus de 180 composants identifiés (Zaidel-Bar et al., 2007). La protéine tyrosine
kinase FAK est importante dans l’adhésome car elle permet la phosphorylation des
composants de l’AF et participe à la stabilité/dynamique du complexe (Sulzmaier et al., 2014).

72
Figure 15- Les adhésions cellule-matrice durant la migration cellulaire
A Dans la cellule polarisée en cours de migration, les adhésions sont étroitement couplées avec les protrusions (filopodes et
lamellipodes) présentes au front de migration. Les adhésions naissantes sont formées initialement dans le lamellipode mais peuvent
aussi être associées aux filopodes. Puis, les adhésions naissantes se désassemblent ou s’allongent, dans la zone de transition entre
lamellipode et lamella. La maturation des adhésions focales implique leur association aux fibres de stress, composées de faisceaux
d’actine polymérisée. Les interactions actine-myosine stabilisent les adhésions focales et permettent la génération de forces, qui
participent à la transduction mécanique des adhésions focales.
B et C Deux modèle d’assemblage des adhésions naissantes, par le contact intégrine-matrice extra cellulaire (MEC) ou directement
par la nucléation de l’actine dès le contact intégrine-MEC. D Représentation schématique du couplage biomécanique entre le
cytosquelette d’actine et la MEC via l’adhésion focale mature, qui sert à l’ancrage et à la transduction de forces générées
essentiellement par l’action de la myosine II sur les filaments d’actine. Des complexes multiprotéiques régulent l’adhésion en jouant
le rôle de module de transduction du signal (exemple : FAK, p130Cas), d’activation (RhoGTPases) ou de nucléation de l’actine
(exemple : zyxine, formines). Chaque module délivre un signal qui agit dans une boucle qui va activer/moduler les forces
développées.
Adapté de: A-B-C J. Thomas Parsons*, Alan Rick Horwitz‡ and Martin A. Schwartz, Nature
Review, Mol Cell Biol 2010 D: Benjamin Geiger*, Joachim P. Spa:tz‡ and Alexander D. Bershadsky,
Nature Review, Mol Cell Biol 2009

73
L’activation de FAK permet le recrutement aux AF d’effecteurs majeurs comme la
kinase Src ou la paxillin (Hu et al., 2014). La phosphorylation de ces protéines, notamment
de la paxilline sur les résidus tyrosine 31 et 118, est impliquée dans le désassemblage des
adhésions. Lorsque FAK est inhibé, (ou non phosphorylable) ou que la paxillin est non
phosphorylable, les adhésions focales persistent, et forment de large complexe empêchant
toute migration (Choi et al., 2011).

Les signaux ordonnant le désassemblage des adhésions focales sont multiples,


cependant il semble que la diminution des forces de tractions aux AF soit d’une importance
première et concentre beaucoup des mécanismes de désassemblage (Stehbens and Wittmann,
2012). Le désassemblage des AF peut fait intervenir des protéases : la calpaïne est capable de
cliver la taline au niveau des sites d'adhésion (Franco et al., 2004), découplant l’intégrine du
réseau d’actine.

Le rôle des MT dans le contrôle du cycle de vie des adhésions focales est étudié
depuis longtemps, mais a été affiné récemment. Les MT sont intimement liés aux adhésions
focales et des études sur les fibroblastes de poisson rouge ont montré que les MT ciblaient les
adhésions focales (Kaverina et al., 1999) et plus particulièrement les AF ventrales de la cellule
(Krylyshkina et al., 2003).

Dans les cellules en migration, les MT ciblaient préférentiellement les AF se


désassemblant et il a été également montré que la dynamique des MT changeait à l'approche
des FA : les MT faisaient plus de pauses, et subissaient des transitions brutales d'une phase de
croissance à une catastrophe cinq fois plus fréquentes aux environs des FA. Ce phénomène
semblait impliquer une protéine des FA, la paxilline (Efimov et al., 2008; Kaverina et al.,
1999).

Le mécanisme permettant aux MT de réguler le désassemblage des AF pourrait


passer par la concentration des GTPases RhoA et Rac1 au niveau des MT. Il a été montré que
lorsque les MT sont dépolymérisés par du nocodazole, la cellule augmente sa contractilité
actine-myosine par l'augmentation de RhoA ce qui favorise la maturation des AF (Ren et al.,
1999).

Au contraire la re-polymérisation des MT après retrait du nocodazole favorise le


désassemblage des FA (Ezratty et al., 2005) et cela pourrait être causé par l'augmentation de

74
Rac1 (Rooney et al., 2010). Ce contrôle spatio-temporel des Rho GTPase par les MT pourrait
s'effectuer par la séquestration ou le relargage des GEF contrôlant le cycle GTP/GDP des
GTPases (Stehbens and Wittmann, 2012).

Certaines +TIP ont été identifiées comme ayant un rôle important dans le ciblage et
le désassemblage des AF par les MT. APC, ACF7 et CLASPs sont des +TIP contenant toutes
un SxIP et donc pouvant interagir avec EB1. Elles possèdent d'autres caractéristiques
communes qui laisseraient à penser qu'elles pourraient jouer un rôle important dans le
désassemblage des AF (Juanes et al., 2017; Stehbens et al., 2014). Ce sont toutes des substrats
pour GSK3 qui les phosphoryle, inhibant leur association aux MT. Par ailleurs APC et ACF7
participent au couplage MT et actine au niveau de la membrane des cellules en migration.
Elles ont également été trouvées toutes les trois dans des zones membranaires très proches des
AF. Enfin leur rôle majeur dans la migration dirigée en fait des sérieux candidats concernant
leur potentielle régulation dans le cycle assemblage/désassemblage des AF (Stehbens and
Wittmann, 2012).

Enfin un mécanisme de désassemblage impliquant la voie de l'autophagie,


dégradation intracellulaire médiée par les lysosomes, émerge depuis plusieurs années (Juanes
et al., 2017; Sharifi et al., 2016). Il a été montré que la migration dirigée était fortement inhibée,
sans modification de la prolifération cellulaire lorsque l'autophagie était dérégulée. La
conséquence, en modèle murin, a été l'abolition de la survenue de métastases pulmonaires et
hépatiques. Le mécanisme sous-jacent a été identifié comme l'inhibition du désassemblage
des AF lorsque la protéine des autophagosomes, également associée aux MT, MAP1LC3B
était inhibée. Cette protéine lierait la paxilline pour entrainer sa dégradation par autophagie
lors du désassemblage des AF et ce mécanisme serait dirigé par la phosphorylation de la
paxilline par Src (Kenific et al., 2016).

Au total, les MT sont soumis à des niveaux de régulations multiples qui permettent
de moduler finement leurs fonctions oncogéniques, notamment la migration dirigée. Il est
donc important de comprendre comment les ACM impactent ces différents de niveau de
régulation mais également comment les MT contribuent à l’efficacité ou aux phénomènes de
résistance à ces drogues.

75
Les invadopodes, des structures spécialisées dans la
dégradation de la matrice extracellulaire

76
Histoire et définition des protrusions cellulaires permettant le
remodelage matriciel

Au début des années 80, T David-Pfeuty et Singer (PNAS 1980) ont observé dans
des fibroblastes d’embryons de poulet transformés en fibrobrascome par le virus du Sarcome
de Rous, oncovirus exprimant l’oncogène v-Src, la relocalisation depuis les adhésions focales
des protéines associées au cytosquelette : vinculine et a-actinine (Figure 16). Ces agrégats
arrondis, localisés au niveau des contacts ventraux des cellules avec le substrat, ont été
initialement nommés "rosette". Dans ces mêmes cellules, les travaux de Tarone et de
Marchisio ont identifié des protrusions membranaires, riches en actine et en protéines
phosphorylées sur des tyrosines, au niveau de la face ventrale des cellules et correspondant à
des sites d'adhérence sur la fibronectine. Ces protrusions, leur faisant penser à des pieds
cellulaires, ont été baptisées podosomes (Tarone et al., 1985). Puis la même année, il a été
montré que ces protrusions localisaient la kinase Src, et surtout qu’elles étaient capables de
dégrader des matrices ; elles furent donc rebaptisées invadopodes (Chen et al., 1985).

Ces cellules transformées ont donc acquis la capacité de réorganiser leur


cytosquelette d’actine en filaments d’actine compactés, de créer des adhésions intégrine b1
dépendantes, de recruter des protéines des AF (a-actinine et vinculine) et d’établir des rosettes
capables de dégrader de nombreuses matrices artificielles (Kelly et al., 1994).

Par la suite des protrusions similaires, capables de dégrader la matrice, grâce à des
métalloprotéases, notamment MT1-MMP, ont été observées dans les cellules tumorales
humaines, notamment issues de carcinomes mammaire. Dans le même temps, il a été montré
que les ostéoclastes en culture avaient la capacité à former des podosomes (Zambonin-Zallone
et al., 1988), observation étendue aux macrophages, cellules dendritiques, cellules
endothéliales et du muscle lisse (Gimona et al., 2008).

Les podosomes sont connues aujourd’hui comme des structures en de nombreux


point similaires aux invadopodes, mis en place lors du remodelage physiologique des MEC.
Même si des confusions demeurent, il est habituellement admis que les protrusions capables
de dégrader le substrat dans des cellules normales sont appelées "podosomes", et
"invadopodes" dans les cellules tumorales.

77
Figure 16 Première observation d’invadosomes sur des fibroblastes transformés par
v-Src
La vinculine (A, B) et l’a-actinine (C, D) marquent respectivement les AF et les filaments d’actine dans les
cellules contrôles (A, B) et sont relocalisées au niveau de structure en rosettes, au niveau de zones d’adhésion
cellule-matrice ventrales, dans des cellules transformées par v-src (C, D).

Extrait de David-Pfeuty and Singer, “Altered distributions of the cytoskeletal proteins vinculin and
a-actinin in cultured fibroblasts transformed by Rous sarcoma virus”, Proc. Nati. Acad. Sci. USA,
(1980), Vol. 77, No. 11, pp. 6687-6691.

Les invadopodes et les podosomes sont actuellement regroupés sous la terminologie


invadosomes (Figure 17), et leur étude parallèle a permis la découverte des fonctions
communes et spécifiques (Tableau 2). Ces structures font également partie de la large famille
des adhésions associées aux intégrines avec la particularité d’être spécialisés dans la
dégradation matricielle (Anna Huttenlocher and Alan Rick Horwitz 2011).

Les invadopodes suscitent un intérêt particulier du fait de leur contribution aux


phénomènes d’invasion métastatique ; ils sont observables dans de nombreuses lignées
cancéreuses incluant des lignées dérivées de cancer du sein, de la prostate, de mélanome,

78
d’ostéosarcome et du pancréas, entre autres. De nombreuses protéines associées aux
invadopodes ont été identifiées comme des facteurs de mauvais pronostic dans le cancer, et
récemment quelques études ont démontré sur des modèles animaux la participation de
protrusions cellulaires dynamiques dans la dissémination métastatique.

La mise en place des invadosomes

Les podosomes et les invadopodes sont caractérisés par la présence des molécules
d'adhésion permettant l’ancrage à la MEC. Ces molécules s’organisent autour de la protrusion
établie, formant un anneau d'adhésion (adhesion ring, en anglais). Cette protrusion comporte
un noyau central dense riche en actine polymérisée et compactée sous l'effet de nucléateur,
de facteur de polymérisation, de protéines croisant les filaments d'actine, le tout orchestré par
des kinases, des Rho GTPase et des protéines d'échafaudage. De nombreux acteurs contribuent
à la formation des invadosomes. On peut citer la cortactine, l’adaptateur TKS5, le complexe
de régulation de l'actine incluant N-WASP, Arp2/3 et la cofiline, la protéine tyrosine kinase
Src qui phosphoryle les protéines des invadosomes notamment TKS5 et les protéases,
véritables marqueurs de la maturation de l’invadosome, dont la principale est MT1-MMP. La
cellule émet des invadopodes sous l’effet de stimuli intracellulaires ou extracellulaires, très
étroitement liés avec le micro-environnement dans lequel elle se trouve (Figure 17).
a. L'induction des invadosomes

On peut rapporter six types de signaux rapportés dans la littérature comme


favorisant la formation d'invadopodes (Figure 18)

1- Les mutations oncogéniques ont été le premier stimulus identifié. Initialement,


c’est l’utilisation de la protéine oncogénique v-src qui a permis l'identification des
invadopodes. Ce rôle de src a été vérifié à de nombreuses reprises par la suite. D'autres
mutations conductrices (ou "driver") connues pour initier ou maintenir l'oncogénèse ont été
associées à la formation des invadopodes. Ainsi, sous l'effet de l'activation de K-ras, les
cellules pancréatiques en culture forment des invadopodes (Neel et al., 2012)

79
Structure Adhésions Focales (AF) Podosomes Invadopodes
Large association de récepteurs
transmembranaires, d'intégrines
Cœur dense d'actine entouré d'un anneau de molécules d'adhérence et associé
Description et de protéines cytosoliques, le
à des protéines régulatrices de l'actine, des kinases et des Rho GTPases
tout lié à la MEC par le
cytosquelette d'actine
Face ventrale de la cellule,
Face ventrale de la cellule, souvent situés
Localisation Front de migration de la cellule souvent regroupés derrière le
sous le noyau
front de migration
Largeur : 0.5–2 µm Largeur : 0.5–2 µm
Dimension de la protrusion Largeur : 2–6 µm
Longueur : 0.5–2 µm Longueur : >2 µm (jusqu'à 15-20 µm)
Filaments parallèles d'actine, en
Filaments d'actine branchés à la surface
Caractéristiques du faisceaux principalement, mais Filaments branchés et non
cellulaire et non branchés à l'extrémité de
réarrangement de l'actine branchement d'actine à branchés d'actine
la protrusion
l'extrémité de la structure
Implication des lipides PtdIns(3,4), P2, PtdIns(3)P
PtdIns(4,5)P2 PtdIns(3,4,5)P3
membranaires et radeaux lipidiques (caveolin-1)
Indispensables à la formation,
Cibles des MT qui s'y accrochent
au positionnement, à la Nécessaires à l'élongation mais pas à la
Implication des microtubules Régulation du cycle des AF en
dynamique et à l'activité formation
favorisant le désassemblage
protéolytique
Importante via les métalloprotéases
Très réduite
Importante via MT1-MMP et (MMP2, MMP9, MT1-MMP) les
Capacité protéolytique Implique MT1-MMP pour le
uPAR séparases, uPAR, ADAM12, ADAM15
désassemblage
et ADAM19

Durée d'existence de la Heures, mais dépend du taux de


Quelques minutes Heures
structure en moyenne migration cellulaire

Tableau 2-Morphologie et caractéristiques moléculaires des structures modelées par l'actine. D’après Murphy and Courtneidge, Nat Rev Mol Cell
Biol 2011, The in and out of podosomes and invadopodia: characteristics, formation and function

80
Figure 17 Les différents types d’invadosomes
Les différents types d’invadosomes retrouvés dans différents types cellulaires sont représentés schématiquement
par des traits/points rouges selon une orientation en z (haut) et x-y (milieu). Les images du bas, obtenues par
marquage de l’actine polymérisée et observation en microscopie confocale (rouge) montrent (A) des
invadosomes en agrégats avec une multitude de points d’actine dans les cellules dérivant des monocytes, (B) des
invadosomes organisés en point isolés comme retrouvés dans les cellules tumorales, (C) des rosettes ou
invadosomes organisée en cercles et (D) des invadosomes linéaires identifiés dans un modèle de culture cellulaire
au sein une matrice de collagène I (en blanc).
Extrait de J Di Martino et al, The microenvironment controls invadosome plasticity, J Cell Sci 2016

81
2- La stimulation de la transition épithélio-mésenchymateuse a été associée à
l'établissement d'invadopodes dans les cellules épithéliales mammaires stimulées par le TGFb
(Pignatelli et al., 2012) Le processus serait régulé par une voie de signalisation impliquant
Twist 1, PDGFRa et Src (Eckert et al., 2011). Cette stimulation ne serait cependant pas
suffisante pour initier in vivo les phénomènes métastatiques et nécessiterait, de concert, des
stimuli provenant du microenvironement (Eddy et al., 2017).
3- Les facteurs de croissance, PDGF, TGFb, EGF, VEGF, HGF et HB-EGF, en
autres, sont capables d'induire des invadopodes à la fois dans les cellules normales et dans les
cancéreuses (Eddy et al., 2017; Mader et al., 2011; Pang et al., 2016; Pignatelli et al., 2012;
Quintavalle et al., 2011; Schoumacher et al., 2010; Varon et al., 2006).

L'EGF est suffisant à l'assemblage d'invadopodes dans certaines lignées cellulaires


cancéreuses même en l'absence de sérum. L'EGF permet également de polariser les
invadopodes qui, dans un gradient d'EGF, vont s'orienter préférentiellement vers les hautes
concentrations (Roussos et al., 2011).

4- L’hypoxie, c’est à dire la baisse d'apport en oxygène à certaines zones de la


tumeur, induit le facteur de transcription HIF-1a et a été impliqué dans la prolifération
tumorale et la dissémination métastatique. Dans les cancers du pancréas, du poumon et de la
tête et du cou, la formation d’invadopodes (HIF1a-dépendant) a été observée en situation
d'hypoxie. Cela impliquerait l'activation de la voie Notch et la stimulation de la protéase
ADAM12, dont l'activité favoriserait le relargage d'HB-EGF potentialisant la formation
d'invadopodes impliquant Tks5 (Diaz et al., 2009; Díaz et al., 2013). Récemment un facteur
induit par l’hypoxie, l’anhydrase carbonique IX (CAIX) a été identifié aux invadopodes,
partenaire de MT1MMP et nécessaire aux étapes d’assemblage, de dégradation et d’invasion
matricielle des cellules de cancer du sein MDA-MB231 (Swayampakula et al., 2017) ce qui
confirme le rôle pro invasif de l’hypoxie tumorale.

Les protéines TKS4 et TKS5, deux éléments importants des invadopodes,


présentent des similitudes structurales avec les protéines du complexe NADPH oxydase et
peuvent lier la p22phox (Saini and Courtneidge, 2018). La formation d'espèces réactives de
l'oxygène (ROS) a été identifiée dans les invadopodes et les podosomes et contribue à leur
formation (Diaz et al., 2009). Les ROS dans les invadopodes favoriseraient le maintien de la

82
phosphorylation des acteurs pro-invadopodes en activant les kinases et inactivant les
phosphatases (Bedard and Krause, 2007)

La protéine tyrosine phosphatase non récepteur de type 12 (PTP-PEST) est un


substrat des ROS qui l'oxyde et l'inactive, permettant à TKS4 et TKS5 de rester sous forme
phosphorylée (Diaz et al., 2009). Enfin la présence de ROS a été directement impliquée dans
l'invasion des cellules de cancer du sein par la régulation d'une voie de signalisation associant
mDia1-Nox4-Akt1, négativement régulée par le suppresseur de tumeur TIS21BTG2/Pc3.
Lorsque TIS21 est inactivé, la voie de signalisation favorise la production de ROS et la
nucléation de l'actine aboutissant à la formation d'invadopodes (Choi and Lim, 2013; Choi et
al., 2016).

5- L'interaction cellule-microenvironnement matriciel est aussi un élément


important pour l’initiation des invadosomes. Le rôle des intégrines est primordial dans
l'établissement de la protrusion notamment capables de lier le
collagène (a2b1, a3b1, a5b1 et a6b1) qui favorisent la formation d'invadopode,
contrairement au sous-type b3 (Artym et al., 2015; Beaty and Condeelis, 2014; Destaing et
al., 2010; Eddy et al., 2017; Zambonin-Zallone et al., 1988).

La nature même du substrat peut changer à la fois le type d'intégrine et la formation


du type d'invadopode. Par exemple la fibronectine, via son récepteur a5b1, favorise la
formation d’invadopodes, mais de manière beaucoup moins importante que le collagène, qui
permet via a2b1 la formation d'un grand nombre d'invadopodes, surtout si la matrice est très
dense (Artym et al., 2015). Des invadopodes linéaire ont été également observé lors de
l'interaction entre le collagène fibrillaire et le récepteur DDR (Juin et al., 2012, 2014) (Figure
17).

L'intégrine b1 a une importance toute particulière dans la maturation des


invadopodes car elle recrute sur sa partie cytoplasmique la kinase Arg, qui va activer par
phosphorylation la cortactine sur deux tyrosines (Y421 et Y466) (Mader et al., 2011; Oser et
al., 2009).

b1 participe aussi à l'acidification de l'espace extracellulaire en recrutant la


moésine et la taline qui vont permettre au transporteur H+/Na+ NHE1 de s'insérer dans la
membrane. La sortie des ions H+ va augmenter le pH dans l'invadopode favorisant la

83
polymérisation de l'actine par la voie de la cofiline, une protéine sectionnant l'actine et
permettant la polymérisation de filaments perpendiculaires à la membrane (Magalhaes et al.,
2011). L'acidification du milieu extracellulaire participe également à l'activité des MMP
(MT1-MMP, MMP2 et MMP9) (Brisson et al., 2012)

6- L'activité des protéases dégradant la matrice va entretenir la formation des


invadopodes par libération de produits de dégradation ou de facteurs de croissance présents
dans la matrice (Murphy and Courtneidge, 2011).

Figure 18 La phase d’initiation des invadopodes


L’adhésion à la matrice environnante par
l’intermédiaire des intégrines fait partie des étapes
initiales dans l’établissement de la protrusion en
permettant la mise en place d’un anneau d’adhésion.
Les récepteurs tyrosine kinase aux facteurs de
croissance (RTK) tels que TGFb, EGF et PDGF
induisent une voie de signalisation qui implique la
kinase Src, et qui va conduire à la phosphorylation de
TKS5 d’une part et des acteurs du complexe de
remodelage de l’actine cortactine-cofiline-Arp2/3-
WASP, d’autre part. Les phospho-inositides, surtout PI
(3,4)P2, sont également très présents et jouent un rôle
important, par recrutement de TKS5 via son domaine
PX, ce qui va permettre de localiser de nombreux
acteurs dans la zone du futur invadopode.
D’après Murphy and Courtneidge, The
‘ins’ and ‘outs’ of podosomesand invadopodia:
characteristics, formation and function, Nat Rev Cell
Biol 2011.

84
b. Les constituants majeurs des invadopodes

• L'actine

Le cytosquelette d'actine est impliqué dans de très nombreux phénomènes


cellulaires comme la division, la polarisation, la morphogénèse cellulaire, la migration et le
trafic vésiculaire. L’actine globulaire monomérique (actine-G), de 42 kDa, polymérise autour
d'un noyau de deux ou trois molécules d'actine G, pour former une double hélice polarisée
d'actine filamentaire (Actine F), qui va ensuite s'organiser en fibres de stress ou un réseau
d'actine avec plus ou moins d'embranchements (Pollard and Borisy, 2003).

La croissance des filaments d'actine est hélicoïdale et polarisée avec une extrémité
+ ( « barbed end » ou barbelée), siège de la croissance du filament d’actine par addition de
monomères d’actine liés à l'ATP, et une extrémité – (« pointed end » ou pointue) à partir de
laquelle les monomères se désassemblent hydrolysant l'ATP en ADP.

La polymérisation spontanée de l'actine est lente et instable et dépend donc d'une


multitude de protéines associées accélérant ou inhibant le processus. Les régulateurs de la
polymérisation comprennent la profiline ou la thymosine b4, qui séquestrent l'actine G dans
le cytoplasme.

Il existe plusieurs classes de nucléateurs de l'actine avec par exemple les formines
favorisant un branchement de l'actine et les protéines du complexe Arp2/3 qui est activé par
les nucleating promoting factors (NPF) type WASP (Wiskott–Aldrich syndrome
protein)/WAVE (WASP-family verprolin-homologous protein WAVE) ou par la cortactine
(Figure 19).

85
Figure 19 Régulation de la polymérisation de l’actine dans la zone corticale
Des signaux extracellulaires activent des récepteurs membranaires (1) qui, par transduction de signaux activent
les GTPases de la famille Rho et la production de phosphoinsositides tel que le PIP2 (2) qui vont à leur tour,
activer les protéines WASp/Scar (3). WASp/Scar recrute le complexe Arp2/3 qui s’associe à un filament d’actine
préexistant afin d’induire la polymérisation d’un nouveau filament d’actine et former une ramification (4).
L’élongation du filament d’actine se fait par l’extrémité + (« barbed end ») (5) et induit une pression sur la
membrane plasmique pour la déformer sur le versant extracellulaire (6). Les protéines de coiffe terminent et
stabilisent le filament à l’extrémité + (7). Les filaments d’actine vieillissent par l’hydrolyse de l’ATP puis par la
dissociation du (8). Des protéines tel que l’ADF/cofiline favorise la dissociation du phosphate, coupe les
filaments d’ADP-actine et favorise la dissociation de l’ADP-actine au niveau des extrémités (9). La profiline
catalyse l’échange ADP-ATP (10), permettant de renouveler le stock d’ATP-actine prêt à allonger les extrémités
« barbed end » (11). La LIM kinase est activée par les Rho-GTPases via PAK et phosphoryle l’ADF/cofiline,
ralentissant le renouvellement des filaments (12).

Extrait de Pollard and Borisy, «Cellular Motility Driven by Assembly and Disassembly of Actin
Filaments », Cell (2003), Vol. 112, 453–465.

86
• La cortactine

La cortactine est une protéine essentielle dans la formation des invadopodes,


essentiellement par son rôle dans la nucléation de l'actine. Elle possède de nombreux sites de
phosphorylation et présente sur la moitié N-terminale des domaines répétés de fixation à
l'actine et sur le versant C-terminal un domaine SH3. Elle se localise aux protrusions
notamment dans le lamellipode et aux zones de contact cellule-MEC. Elle est surexprimée
dans 15-25% des cas dans le cancer du sein et dans de nombreuses autres pathologies
cancéreuses, surexpression associée à un mauvais pronostic et à des maladies plus invasives
(Hill et al., 2006; Hui et al., 1998; Schuuring et al., 1992). La cortactine a été rapidement
identifiée des zones de matrice dégradées par les métalloprotéases (Clark et al., 2007). Des
modèles murins ont confirmé le potentiel oncogénique spécifique à la cortactine (Chuma et
al., 2004; Li et al., 2001)

La cortactine contribue à la polymérisation et au remodelage du réseau d’actine, en


favorisant notamment la formation de filaments branchés, et concourt donc à la dynamique
des invadopodes. C'est également une protéine d'échafaudage qui interagit avec plusieurs
autres partenaires dans la protrusion (Jeannot and Besson, 2017; Kirkbride et al., 2011).

L’activité de la cortactine est régulée essentiellement par phosphorylation de


résidus tyrosine de la région C-terminale proline riche et de résidus serines et thréonines
distribuées essentiellement dans la région N-terminale. Elle est le substrat des kinases Src,
Abl et Arg, suite à l’activation de l’intégrine b1 ou à l’action de facteurs de croissance tels
qu’EGF, HGF, TGFb ou PDGF (Ayala et al., 2008).

• TKS5

Comme nous l’avons souligné plus haut, TKS5 est une protéine majeure
impliquée dans les étapes les plus précoces du cycle des invadopodes.

TKS5 connu aussi sous les noms de SH3PXD2A ne possède pas de propriété
catalytique et son action passe par son rôle de protéine d’échafaudage, via des interactions
protéine-protéine ou protéine-lipides. TKS5 est composée de cinq domaines SH3 (Src
homology domain 3) séparés par quatre domaines riches en proline PxxP, capable de lier les
domaines SH3 (Alexandropoulos et al., 1995) (Figure 20).
87
Ces domaines lui permettent d’interagir avec de nombreuses protéines
impliquées dans la régulation de l’actine, des protéases ou encore des régulateurs de voies de
signalisation intracellulaires. TKS5 présente aussi deux sites de phosphorylations situés sur
des tyrosines, qui sont également importants pour l’interaction avec ses partenaires. Dans la
région N-terminal, on retrouve un domaine PX (Phox Homology) qui permet l’interaction de
TKS5 avec les phospholipides et qui conditionne sa localisation (Abram et al., 2003;
Buschman et al., 2009) Ce domaine a une affinité particulière pour les lipides de type
PI(3,4)P2, particulièrement concentrés dans la membrane des invadopodes, grâce notamment
à la lipide phosphatase Synaptojanine 2 (Ellson et al., 2002; Sato et al., 2001; Sharma et al.,
2013).

Il existe trois isoformes de TKS5 issues de l’usage de promoteurs alternatifs


(Cejudo-Martin et al., 2014; Lock et al., 1998) : TKS5a (ou TKS5 long, 1133 aa) qui est la
seule isoforme capable d’induire des invadopodes et qui est majoritairement exprimée dans
les tissus cancéreux ; TKS5b (1010 aa) et TKS5short (1000 aa) qui ne possèdent pas de
domaine PX et n’ont pas de rôle biologique connu à ce jour (Saini and Courtneidge, 2018b).
Les cellules cancéreuses expriment majoritairement TKS5a, les fibroblastes majoritairement
TKS5b et, pendant le processus tumoral, l’expression de TKSa augmente, alors que celle de
TKS5b et TKS5short diminue (Cejudo-Martin et al., 2014). Plusieurs études ont montré le
caractère pronostic de TKS5 : dans le cancer du poumon, le ratio TKS5a/TKS5short
augmente avec la progression tumorale (Li et al., 2013) ; le niveau d’expression élevé de
TKS5a est associé à un plus mauvais pronostic dans les récidives locales des stades I/II de
cancer du sein (Blouw et al., 2015).

TKS5 est capable d’induire la formation d’invadopodes lorsqu’elle est exprimée


avec une forme active de Src dans des cellules peu invasives (Seals et al., 2005).

TKS5 est indispensable à l’établissement d’invadopodes matures dans de


nombreuses lignées cellulaires (Iizuka et al., 2016; Seals et al., 2005). Plus récemment,
plusieurs études ont montré qu’elle était impliquée dans les processus d’intravasation et
d’extravasation dans des modèles d’invasion en 3D (Gligorijevic et al., 2014; Leong et al.,
2014).

TKS5 est aussi une protéine centrale pour la formation des


podosomes (Crimaldi et al., 2009; Lener et al., 2006) ; et les podosomes d’ostéoclastes sont
fortement dépendants de TKS5 pour dégrader la matrice et il participe au phénomène de fusion

88
cellulaire a aboutissant à des cellules multinucléées (Oikawa et al., 2012). Dans les cellules
tumorales TKS5 aurait aussi des rôles indépendants des invadosomes, puisqu’elle a été
associée à une croissance cellulaire accrue, une diminution de l’apoptose et une meilleure
angiogenèse (Blouw et al., 2008, 2015).

TKS5 possède 36% d’homologie de séquence avec la protéine TKS4, également


impliquée dans la régulation des invadopodes, mais moins étudiée jusqu’à présent (Buschman
et al., 2009; Iizuka et al., 2016). TKS4 possède quatre domaine SH3 et un domaine PX N-
terminal, de nombreuses régions riches proline et plusieurs sites de phosphorylation. TKS4
n’a pas isoforme identifiée (Figure 18).

L’importance de la fonction de TKS5 vient en premier lieu du fait qu’elle


constitue un relais majeur entre protéines et voies de signalisation dans la mise en place de la
protrusion : c’est un substrat de Src qui l’active par phosphorylation des tyrosines Y558 et
Y620 (Buschman et al., 2009; Courtneidge et al., 2005; Lock et al., 1998), ce qui favorise son
interaction avec les protéines impliquées dans la machinerie de polymérisation de l’actine,
comme N-WASP, Grb2 ou encore Nck1/2 (Oikawa et al., 2008; Stylli et al., 2009) La
cortactine co-localise avec TKS5 dans les invadosomes dans de très nombreuses lignées
cellulaires, mais l’interaction directe n’a pas été démontrée (Crimaldi et al., 2009).

Une autre fonction importante de TKS5 serait de permettre la localisation de


protéases dans les invadopodes. En effet, TKS5 est connue pour interagir avec des protéases
de la famille ADAM par son 5ème domaines SH3 (Abram et al., 2003), mais également avec
la Rab GTPase Rab40 impliquée dans le transport vésiculaire des métalloprotéases MMP2 et
MMP9.

Enfin, TKS5 a également un impact sur la sécrétion de ROS aux invadopodes,


qui favorise la mise en place de la protrusion (Diaz et al., 2009; Díaz et al., 2013; Saini and
Courtneidge, 2018).

TKS5 est donc une protéine prototypique des invadopodes, du fait de sa


localisation préférentielle dans cette structure et de sa position centrale dans la biologie des
invadopodes.

89
Figure 20 : Isoformes de TKS5 et interactions connues avec les domaines fonctionnels

(A) Protéine partenaires (direct ou indirect) de TKS5 au sein des invadopodes ; les domaines fonctionnels de
TKS5 impliqués dans l’interaction sont indiqués. (B) Les trois isoformes de TKS5 : les domaines SH3 et PX, les
motifs PxxP et les sites de phosphorylation sont indiqués. (C et D) Protéines ayant des similarités de structure
avec TKS5, (C)= TKS4 et (D)= protéines du complexe NADPH

D’après P.Sahini et S.A Courtneidge, J Cell Science 2018

90
Le cycle de vie des invadopodes

La cortactine joue un rôle central dans les invadopodes. On peut donc suivre toutes
les phases d’assemblage/désassemblage de l'invadopode à travers le cycle
d'activation/inactivation de la cortactine (Figure 21)

a. Phase d'initiation et formation d'un invadopode précurseur

Lorsqu'un signal d'initiation des invadopode est perçu, une cascade d'évènements
bien caractérisés se produit.

Au sein de l'invadopode, la cortactine est recrutée/activée par sa phosphorylation


par Src, mais surtout par Arg, sur les résidus tyrosines Y421 et Y466 et se lie à l'actine. Elle
recrute un complexe comprenant WASP-Arp2/3-Cofilin, mais aussi Vav1 et Nck1. Selon les
études de J.Condeelis et son équipe, cette étape de recrutement est très rapide (de l'ordre de
quelques secondes) et aboutit à la formation d'un invadopode précurseur instable (Eddy et al.,
2017; Sharma et al., 2013) (Figure 20)

La cortactine maintient inactive la cofiline dont le rôle est de sectionner l'actine


polymérisée et de créer des bouts barbelés libres qui vont permettre le redémarrage de la
polymérisation et favoriser ainsi le remodelage du réseau. La stabilisation de l'invadopode
précurseur est la conséquencer de l'interaction de TKS5 par son domaine PX au
phosphoinositide PI(3,4)P2, particulièrement abondant à la membrane de l'invadopode. Une
autre protéine importante, la lamellipodine, se lie a PI(3,4)P2 par son domaine PH, recrute le
complexe MenaINV-Arg-SHIP2, ce qui favorise la formation de nouveau lipides PI(3,4)P2 et
la liaison de TKS5 (Weidmann et al., 2016). TKS5 contribue donc à la maturation de
l'invadopode précurseur, mais ne semble pas impliqué dans la phase d'initiation (Sharma et
al., 2013)

A cette étape, on observe la co-localisation de la cortactine avec TKS5 au niveau


de l'invadopode, ce qui marque l'invadopode précurseur stable, en cours de maturation
(Sharma et al., 2013).

Parallèlement à cela, le réseau d'actine subit un remodelage, puisque suite à


l'augmentation du pH de l'invadopodes (sortie des ions H+ par le canal NHE1), la cortactine
91
phosphorylée libère la cofiline qui va créer des extrémités libres d'actine F. Sous l'action des
nucléateurs WASP et Arp2/3 les filaments d'actine vont polymériser pour former une
protrusion. L'activité de la cofilin est elle-même spatialement régulée par RhoC, qui est
localisée autour de l'invadopode et coordonne le rôle du complexe ROCK/LIMK qui
phosphoryle et inactive la cofiline (sur Ser3). Ceci permet de focaliser l'action de la cofiline
au niveau du cœur d'actine de l'invadopode. Cette étape de
remodelage/nucléation/branchement du réseau d'actine au sein de l'invadopode est
relativement lente et prendrait plusieurs minutes (Bravo-Cordero et al., 2013; Sharma et al.,
2013).

MenaINV est une protéine importante à cette étape là également. Elle régule la
phosphorylation de la cortactine en jouant sur l’activité de la phosphatase PTP1B (Rajadurai
et al., 2016; Weidmann et al., 2016) et favorise le branchement des filaments d'actine,
participant ainsi à la maturation de l'invadopode précurseur.

La protéine Mena est particulièrement intéressante car il s'avère que son variant
d'épissage MenaINV est associé à des cellules assemblant de manière accrue des invadopodes,
et présentant des capacités d'intravasation et de dissémination pas voie hématogène
importantes. Ce variant est associé à un plus mauvais pronostic lorsqu’il est surexprimé dans
les tumeurs mammaire alors qu’un autre isotype, Mena11a, a lui été corrélé à des fonctions
inhibitrices de l'intravasation (Gertler and Condeelis, 2011; Oudin et al., 2016). .

Aussi un test pronostic, basé sur les isotypes de Mena et une signature d'expression
de gènes régulant l'intravasation cellulaire, a été développé dans les tumeurs mammaires sans
atteinte ganglionnaire axillaire donnant un score de risque métastatique (Forse et al., 2015;
Karagiannis et al., 2016)) et été récemment commercialisée (MenaCalc™ Platform -
MetaStat, Inc.).

b. L'invadopode mature

La fonction première des invadosomes est de remodeler/dégrader la matrice


environnante. Le stade mature est donc caractérisé par la présence de metalloprotéases dont il
existe trois grandes familles, que l’on retrouve aux invadopodes : les metalloprotéases
sécrétées ou transmembranaires (MMP) comportant un atome de zinc (MMP2, MMP9, MT1-

92
MMP, ADAM), la cathepsine et les sérines protéases (séparase et urokinase plasminogen
activator surface receptor (uPAR)).

L'utilisation d'inhibiteur pan-métalloprotéase abolit la dégradation de la matrice.


MT1-MMP (ou MMP14) est une métalloprotéase transmembranaire fonctionnant en
homodimère et majoritairement située aux invadopodes. Elle est capable de dégrader de
nombreux composants de la MEC (collagènes 1, 2, 3 et 4, laminine, fibronectine, vitronectine,
aggrecane et fibrine (Overall et Dean, 2006)), et active aussi MMP2 et MMP9 par clivage
(Murphy and Courtneidge, 2011)

La délivrance des protéases vers les invadosomes requiert des protéines associées
aux MT ; les kinésines permettent aux vésicules contenant les MMP d'atteindre le cortex
cellulaire. La délivrance de MT1-MMP à l'invadopode est sous le contrôle d'IQGAP1
(Sakurai-Yageta et al., 2008) qui régule, avec Cdc42 et RhoA, le complexe d'exocytose, une
structure de 8 protéines favorisant l'arrimage des vésicules intracellulaire à la membrane
plasmique. D'autres régulateurs positifs (VAMP-7 ou v-SNARE) ou négatifs (CIP4 et SNX9)
de la sécrétion des MT1-MMP ont été identifiés (Steffen et al., 2008) révèlant une régulation
étroite.

La cortactine joue aussi un rôle dans la maturation des invadopodes par son action
dans la sécrétion des MMP (MMP6, MMP9 et MT1-MMP). Elle interagit directement avec
MT1-MMP lorsqu'il est phosphorylé par LIMK, ce qui permet le transit de MT1-MMP vers
l'invadopode (Lagoutte et al., 2016). MT1-MMP transite dans la cellule via le compartiment
endosomal. Ce transit lui permet d'être positionné et enchâssé dans la membrane plasmique
par exocytose, puis suit un cycle d’endocytose-recyclage ou dégradation (Castro-Castro et al.,
2016).

Ce trafic est régulé par les Rho GTPase Rab, particulièrement Rab7 (Rossé et al.,
2014). Le cytosquelette d'actine régule également le cycle d'endo/exocytose de MT1-MMP,
notamment la protéine WASH qui permet la polymérisation de l'actine à la surface des
endosomes pour permettre les étapes péri-membranaires du cycle et nécessite un complexe
d’exocytose pour les étapes de fusion membranaires (Monteiro et al., 2013). Les MT sont
également impliqués à cette étape (voir plus loin).

93
c. Le désassemblage des invadopodes

C'est certainement la phase du cycle des invadopodes la moins connue. Comme les
autres étapes, le contrôle du désassemblage repose étroitement sur la cortactine et son niveau
de phosphorylation (Figure 21).

Il semble exister deux voies de signalisation aboutissant au désassemblage de la


structure. La première repose sur l'action de la RhoGTPase Rac1 et de Trio, une de ses GEF.
Rac1 activé va à son tour activer PAK1, qui est recruté par p27 au contact de la cortactine.
Ceci permet la phosphorylation de cette dernière sur les sérines S113, S150 et/ou S282 qui
pourrait induire une baisse de l'affinité cortactine - actine F (Jeannot et al., 2017; Moshfegh et
al., 2015). L'inhibition de cette voie augmente la durée de vie et le nombre des invadopodes,
et la dégradation de la matrice, mais paradoxalement, diminue l'invasion des cellules
tumorales in vitro.

Cette observation souligne l'importance de la dynamique des invadopodes pour


assurer l'invasion tumorale.

La seconde voie de désassemblage implique la phosphorylation de la paxilline


médiée par RhoG, une RhoGTPase de la sous famille de Rac, qui induirait la dissolution de
l'invadopode par une voie activant la kinase ERK et la calpaïne (Goicoechea et al., 2017).

Dans les podosomes, la calpaïne clive la taline, Pyk2 et WASP (Calle et al., 2006),
mais cela n'a pas encore été montré dans les invadopodes tout comme le clivage de la
cortactine par la calpaïne (Jeannot and Besson, 2017). Enfin pour augmenter la complexité il
semblerait que ces deux voies de signalisation soient mutuellement exclusives car dans les la
lignée cellulaire SUM159 qui désassemblent les invadopodes par la voie RhoG, la voie Rac1
favorise la formation des invadopodes (Goicoechea et al., 2017). D'un autre côté, Rac1 va
favoriser le désassemblage des invadopodes dans les MTLn3, une lignée de cancer du sein
murine dans laquelle la perte de RhoG ne modifie pas la capacité de dégradation des cellules.
Par ailleurs, les glioblastomes sont connus pour envahir les tissus de manière RhoG
dépendante (Kwiatkowska et al., 2012) alors que les cellules des lignées de mélanomes
(Nakahara et al., 2003) ou les cellules mammaires MCF10A, activées par le TGFb, forment
des invadopodes via l'action de Rac1 (Pignatelli et al., 2012)

94
Figure 21 Le cycle d’assemblage et de désassemblage des invadopodes
Après un signal d’initiation pouvant revêtir une forme chimique ou mécanique, la cortactine sera phosphorylée par diverses kinases (Src, Arg), ce qui va permettre son
recrutement à la membrane, notamment par le biais de TKS5, qui lorsqu’il est lui-même phosphorylé va s’ancrer au niveau des phospholipides membranaires par son
domaine PX. La cortactine recrute alors un complexe de remodelage de l’actine composé de N-WASP-Arp2/3-cofiline qui va fragmenter et remodeler le réseau d’actine
favorisant sa polymérisation perpendiculaire à la membrane. TKS5 et MENA favorisent la stabilisation de la structure naissante et des métalloprotéases, notamment
MT1MMP, vont être recrutés, et permettre la dégradation matricielle. C’est le stade invadopode mature. Enfin l’invadopode va être désassemblé, phase moins bien connue
impliquant, soit une voie de signalisation Rac1-cortactine dépendante, soit la voie paxilline/calpaïne

95
Fonction des invadopodes in vivo

Dans le processus de remodelage matriciel ou d’invasion, les invadosomes sont


présumés être l'organelle spécifique de la dégradation focale des tissus. L'accumulation de
cette dégradation va permettre à la cellule de migrer dans l'enchevêtrement de fibres dans
lesquelles elle va créer des lacunes, qui serviront aussi de chemin aux cellules suiveuses lors
de la migration collective. Longtemps, les invadopodes ont été considérés comme des
formations induites seulement in vitro, lors du contact cellulaire avec des structures planes.

Mais l'association entre la surexpression de marqueurs clés des invadopodes


(cortactine, fascine, Fgd1, MT1-MMP ou TKS5) et le mauvais pronostic de certains cancers
laisse fortement suspecté le rôle de ces structures dans la progression métastatique
(Yamaguchi, 2012). La migration en 3D nécessite la mise en place de protrusions
protéolytiques dépendant de N-WASP, Arp2/3, cortactine, TKS5 et MT1-MMP dans un grand
nombre de types cellulaires (Lizárraga et al., 2009; Magalhaes et al., 2011; Tolde et al., 2010;
Yu and Machesky, 2012); les expériences démontrant la suppression de la dissémination
métastatique dans les modèles de xénogreffe suite à l'extinction de protéines majeures de
invadopodes, comme TKS5 ou Mena (Eckert et al., 2011; Roussos et al., 2011c).

En fait, un nombre croissant d’études a permis de visualiser des protrusions


éphémères comportant des acteurs majeurs des invadosomes, associées au remodelage
matriciel ou à l’invasion tissulaire dans différents systèmes, de plus en plus proches des
conditions physiologiques (Génot and Gligorijevic, 2014; Gligorijevic et al., 2014). Ces
études ont montré l'implication de structures de type invadopode dans l'intravasation
vasculaire : par exemple, chez le poisson zèbre, des cellules de mélanome formaient de
longues protrusions avant de migrer à travers les capillaires (Stoletov et al., 2007); dans un
modèle murin permettant l'observation intravitale du déplacement des cellules, les cellules
MTLn3 produisaient des protrusions N-WASP dépendante avant de pénétrer dans les
capillaires (Gligorijevic et al., 2012). Concernant le rôle des invadopodes dans l'extravasation,
récemment l'équipe canadienne de J D Lewis a observé par microcopie intravitale à haute
résolution en temps réelle, l'extravasation de cellules de carcinome épidermoïde marquées à
la GFP et injectées dans la veine allantoic d'embryons vivants de poulet ex ovo.
L'extravasation des cellules tumorales passait par la formation de protrusions identifiées

96
comme des invadopodes par les auteurs par la présence de cortactine et TKS5, observations
confirmées dans plusieurs lignées cellulaires. La déplétion de la cortactine, TKS4, TKS5 ou
RhoA diminuaient de manière importante le nombre de protrusions et les capacités
d'extravasation cellulaire (Leong et al., 2014).

Rôles des +TIP et des MT dans la régulation des invadosomes


Le cytosquelette d’actine est prépondérant dans toutes les phase d’assemblage et de
désassemblage des invadopodes et hautement régulé par de multiples protéines. Comme pour
les adhésions focales ou les lamellipodes, les MT pourraient jouer un rôle important dans la
régulation de ces structures mais leur implication reste mal comprise avec des données parfois
contradictoires. Dans le paragraphe suivant je résumerais les données majeures connues sur
le rôle des MT dans les invadosomes.

Comme mentionné précédemment, les MT contribuent au transport de la protéase


MT1-MMP. Au niveau des macrophages, il a été montré que les MT jouent un rôle important
dans le transport intracellulaire de la protéase, notamment via les moteurs moléculaires de
type kinésine (Wiesner et al., 2010) Ce mécanisme apparait conservé dans des cellules de
cancer du sein (Marchesin et al., 2015) Des régulateurs de la stabilité du réseau microtubulaire,
tels que les protéines régulant l’acétylation des MT aTAT-1 ou de la tubuline, comme
l’histone déacétylase HDAC6, influencent également le transport et le ciblage de MT1-MMP
à la membrane plasmique (Arsenault et al., 2013; Castro-Castro et al., 2012)

Une voie de signalisation impliquant les MT et EB1 a été identifié comme régulant
la phosphorylation de la cortactine et l'établissement et la stabilité de la ceinture de podosome
dans les ostéoclastes (Biosse-Duplan et al., 2014). Dans cette étude, il a été proposé qu’EB1
interagirait avec la cortactine de manière dynamique, selon l’état de phosphorylation ou
d'acétylation de la cortactine.

Plusieurs études ont également impliqué les MT dans les phases tardives de
formation les invadopodes (phase d’élongation), mais pas dans leur assemblage (Kikuchi and
Takahashi, 2008; Schoumacher et al., 2010) Cette dernière étude dans un système utilisant
une membrane basale de péritoine de rat a montré de manière élégante les différentes étapes
d'initiation, de maturation et d’élongation à travers cette matrice, de cellules de cancer colique
et de cancer du sein invasifs. Les MT étaient observées au sein des invadopodes longs ; les
MT des invadopodes étaient préférentiellement détyrosinés. L'utilisation du nocodazole pour

97
dépolymériser les MT montrait une diminution des invadopodes longs, ce qui amenait les
auteurs à la conclusion de l'utilité des MT pour l'allongement des invadopodes (Schoumacher
et al., 2010). Récemment, une étude suivant le comportement de divers modèles cellulaires
dans une matrice reconstituée a montré que l'invasion matricielle via des protrusions
protéolytiques dépendait de la présence des +TIP SLAIN2 et CLASP1, indiquant que la
stabilisation et la régulation de la dynamique des MT est primordiale pour permettre l’invasion
3D (Bouchet et al, Dev cell 2016).

98
Matériels et Méthodes
Culture cellulaire

Les différentes lignées cellulaires utilisées ont été achetées auprès de l’ATCC. La
lignée cellulaire de cancer du sein triple négatif MDA-MB-231 a été maintenue dans un milieu
DMEM (Dulbecco’s Modified Eagle Medium, Gibco) supplémenté avec 1% Pyruvate, 1% de
Pénicilline/Streptomycine et 10% de sérum de veau foetal (Eurobio, Courtaboeuf, France). La
lignée mammaire épithéliale MCF10A a été maintenue dans un milieu DMEM/F12
supplémenté avec 5% de sérum de cheval (Life Technologie), 20ng/mL d’EGF, 0.5µg/ml
d’hydrocortisone, 100ng/mL de toxine cholérique (Cholera Toxin from Vibrio cholerae,
Sigma), 10µg/mL d’insuline bovine et 1% de Pénicilline/Streptomycine. Les cellules étaient
incubées à 37°C, sous 5% de CO2 en atmosphère humide. Pour induire la transition épithélio-
mésenchymateuse, les cellules MCF10A étaient traitées pendant 6 jours par 10ng/mL de
TGFb-1 humain recombinant (Recombinant Human TGFb-1, HEK293 derived, Peprotech).
Les cellules ont été testées régulièrement à la recherche d’éventuelle contamination par
mycoplasme.

Agents pharmacologiques

Le GM6001 (InSolution™ GM 6001, Calbiochem) a été dilué dans le milieu de


culture pour obtenir une concentration finale à 10µM pendant les 4 heures du test de
dégradation. A cette concentration, il a été montré une abolition totale de la formation
d’invadopodes actifs (Kikuchi et al, Cancer Sci 2008).

Le Paclitaxel (Sigma©), la Vinblastine, le nocadazole (Sigma©) ont été resuspendus


dans du DMSO 100% à une concentration de 5mM et conservés à -20°C dans une fiole en
verre. La Vinblastine, re-suspendue dans le DMSO 100% et maintenue à -20°C dans une fiole
en verre à la concentration de 5mM ainsi que le nocodazole (Sigma-Aldrich, Lyon, France).
Toutes les dilutions ont été réalisées dans du DMSO 50% puis stockées à -20°C dans des fioles
de verre. Les concentrations obtenues pour traiter les cellules proviennent de dilutions sériées
dans du DMSO 50% pour obtenir la concentration finale dans le milieu de culture avec un
taux de DMSO final à 0,5%, identique au contrôle.

99
Construction plasmidiques

Les séquences nucléotidiques codant pour EB1 humain sauvage et les deux formes
mutantes tronquées (1-265) et (1-248) sans codon stop ont été amplifiées par PCR à partir du
plasmide peGFP-N1-EB1 (JB 131 ; Addgene) avec les oligonucléotides contenant les sites de
recombinaison AttB1 et AttB2 appropriés (cf table) pour générer, par recombinaison avec le
vecteur pDONR-Zéo, les plasmides pDONR-EB1, pDONR-EB1(1-265) et pDONR-EB1(1-
248) respectivement avant leur sous-clonage dans le vecteur de destination pDEST-mCherry-
N1 (Addgene) par la technologie Gateway pour obtenir les différentes formes de EB1
fusionnées en N-terminal de la mCherry. Toutes les constructions ont été vérifiées par
séquençage.

Table: Paires d’amorces utilisées pour les constructions plasmidiques


Nom Séquence
5-
attB1-Nter EB1 ’GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAGAACCATGGCAG
TGAACGTATACTCAACGTCAG -3’
5’-
attB2-Cter EB1 FL GGGGACCACTTTGTACAAGAAAGCTGGGTCATACTCTTCTTGCTCCTCCTGTGGG
C-3’
5’-
attB2-Cter EB1 Q265 GGGGACCACTTTGTACAAGAAAGCTGGGTCTTGCTCCTCCTGTGGGCCCCCTTCA
-3’
5’-
attB2-Cter EB1 A248 GGGGACCACTTTGTACAAGAAAGCTGGGTCGGCATACAGAATGTCTACAATCCT
C-3’
5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGCTCGC
attB1-Nter TKS5
CTACTGCGTGCAGGATG-3’
5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGGC
attB1-delPX TKS5
TCGACCCGAGGATGTC-3’
5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCGTTCTTTTTCTCA
attB2-Cter TKS5
AGGTAGTTGGAAG-3’

Les séquences nucléotidiques codant pour TKS5 sauvage et la forme tronquée DPX-
TKS5 sans codon stop ont été amplifiées par PCR à partir du plasmide peGFP-N1-TKS5

100
(procuré par Courtneidge S.) en utilisant les amorces appropriées (Table 1) puis ont été
utilisées pour générer les vecteurs pDONR-TKS5 et pDONR-DPX-TKS5 par recombinaison
avec le vecteur pDONR-Zéo, respectivement avant leur clonage dans le vecteur pcDNA3.1
MCS-BirA(R118G)-HA (Addgene plasmid # 36047, procuré par K. J. Roux) par la technique
de « Gateway » en vue d’obtenir TKS5 et DPX-TKS5 fusionnées en N-terminal de BirA*-
HA. Toutes les constructions ont été vérifiées par séquençage.

Transfection et établissement des clones stables

Les cellules MDA-MB-231 et MCF10A ont été transfectées par les différents ARNi
avec l’agent de transfection, Lipofectamine RNAimax (Thermofisher, France) en utilisant le
protocole fourni par le fabricant. Les ARNi étaient utilisés à une concentration finale de 20nM.
Les tests fonctionnels étaient effectués après 72h de transfection et l’extinction protéique a été
contrôlée par western blot. Pour les cellules MCF10A transformées par le TGF-b1 les cellules
étaient traitées pendant 3 jours avec du TGF-b1 avant la transfection des différents ARNi et
traitées une seconde fois au TGF-b1 lors de la transfection comme décrit par Pignatelli
(Pignatelli et al., 2012).

Les cibles des différents siRNA sont listés ci-après : le gène de la b-galactosidase
d’E Coli utilisé comme contrôle négatif (siLacZ: séquence du brin sens
GCGGCUGCCGGAAUUUACCTT),

siEB1_1 (séquence du brin sens UUAAAUACUCUUAAGGCAUTT),

siEB1_2 (séquence du brin sens GAAUUGAAUUUUAAGCUAATT),

siAPC_1, (séquence du brin sens UUAUUCUUAAUUCCACAUCTT),

siAPC_2 (séquence du brin sens UUAUGCUCAAUGCUUAGUCTG),

siACF7 (séquence du brin sens UAACCUUCUGAUAAGAUUGTT)

siCLASP1 (séquence du brin sens UAUUGCUGCAUCUCGAACCTG),

siCLASP2 (séquence du brin sens UUCUCGACUAGAAUAAAUCTG),

siIQGAP1 (séquence du brin sens GGUUGUCAUUUAAAAAUAATT),

101
siCLIP170 (séquence du brin sens UUUCUUUGUAUGUCAGAGCTG).

Pour les expériences de sauvetage, les différentes constructions les ARNi étaient
transférés par électroporation en utilisant l’appareil AmaxaTM NucleofactorTM en utilisant le
Kit V (Lonza AG, Cologne, Allemagne) et le programme X-0013 dans les cellules MDA-MB-
231.

Pour l’établissement des clones exprimant stablement les protéines de fusion, les
cellules MDA-MB-231 ont été transfectées par les différents vecteurs d’expression en utilisant
l’agent de transfection, Lipofectamine 2000 (Invitrogen) en suivant les recommandations du
fabricant, puis sélectionnées par l’ajout de 1 mg/ml de généticine (G418, Life Technologies,
France) dans le milieu de culture. Des populations clonales ont été générées par dilution limite.
Des clones exprimant des niveaux modérés des différentes protéines de fusion ont été
sélectionnés pour les expérimentations ultérieures.

Préparation des lamelles couvertes de gélatine fluorescente


Les lamelles de verres recouvertes de gélatine fluorescente ont été préparées selon
les modalités décrite dans la référence suivante (Artym et al., 2009). Préalablement au
recouvrement des lamelles avec de la gélatine, les lamelles de 18mm étaient lavées dans l’HCl
pur pendant une heure, rincées 10 fois à l’eau déionisée, lavées dans l’eau bouillante, plongées
dans de l’éthanol 70%, égouttées et laissées à sécher la nuit et enfin autoclavées. Puis les
lamelles étaient recouvertes d’1 mL de poly-D-lysine (Sigma) à 50µg/ml à 37°C pendant 20
minutes, lavées 2 fois au PBS, incubées 15 min dans 1mL de glutaraldéhyde 0.5% (Sigma)
pour favoriser la réticulation de la poly-D-lysine puis lavées 3 fois dans du PBS. La solution
de gélatine fluorescente 0.2% (Gelatin From Pig Skin, Oregon Green™ 488 Conjugate,
Invitrogen™) était mélangée selon un ratio 1/10 avec de la gélatine incolore (Sigma) 0.2%
dans du PBS et la solution était maintenue à 40°C. Les lamelles étaient ensuite retournées sur
une goutte de 60µL de la solution de gélatine pendant 10 minutes puis plongées 5 min dans
une solution de sodium borohydride à 5mg/mL (Sigma) pour éteindre l’auto-fluorescence
résiduelle induite par le glutaraldéhyde. Les lamelles étaient lavées 4 à 5 fois avec du PBS,
puis déshydratées par un lavage avec de l’éthanol 70% et enfin stockées à 4°C.

Test de dégradation de la gélatine fluorescente et immunomarquage

102
Les lamelles recouvertes de gélatine fluorescente étaient réhydratées dans une boite
12 puits pendant 1 heure à 37°C dans le milieu de culture de la lignée cellulaire utilisée avant
d’y déposer 30000 cellules. La plaque était centrifugée à 1000 rpm pendant 3 minutes pour
synchroniser les conditions et les cellules étaient incubées pendant 4 heures à 37°C, 5% CO2.
Après un lavage au PBS, les cellules étaient fixées avec une solution de Fix Mix (4%
formaldéhyde, 3% sucrose, PBS 1x) à 37°C pendant 15 minutes, lavées 2 fois avec du PBS,
perméabilisées avec une solution de Triton X100 0.4% pendant 2 minutes sous agitation. Pour
observer les +TIP, le protocole de fixation comprenait une première fixation des cellules avec
une solution de méthanol 100% froid contenant de l’EGTA à 1 mM pendant 5 minutes à -
20°C suivie d’une deuxième fixation au formaldéhyde 4% pendant 15 minutes puis 3 rinçages
au PBS avant l’immunomarquage. Après une incubation d’une heure dans une solution de
blocage des sites non spécifiques comprenant de la BSA à 1%, les lamelles étaient ensuite
mises en présence de l’anticorps primaire dilué dans une solution de PBS contenant de la BSA
à 0.5% et du Tween20 à 0.02% et incubées à 37°C pendant 1 heure en boite humide. Après
deux rinçages au PBS-Tween 0.5%, les lamelles étaient incubées avec les solutions
d’anticorps secondaires appropriés couplés à un fluorophore DyLight® 405 dilué au 1/250 ou
AlexaFluor® 594 dilué au 1/500 (Jackson ImmunoResearch) pendant 45 minutes. Après deux
rinçages au PBS-Tween 0.5%, les lamelles étaient rincées à l’eau puis montées sur lames de
verre pour microscope optique avec du liquide de montage Prolong© (Molecular Probes).
L’observation était faite avec un microscope à épifluorescence (Apotome Imager Z) équipée
d’une caméra à fluorescence AxioCam MRm, objectif 63X. Le traitement des images était
réalisé avec le logiciel Axiovision Rel 4.6 et Fiji. Les zones dégradées apparaissaient comme
des trous noirs dans la gélatine et traduisaient la capacité de la cellule à dégrader la matrice.
Les invadopodes matures étaient caractérisés par la colocalisation entre TKS5-Cortactine et
un trou noir.

Quantification de l’aire dégradée et des invadopodes par FIJI

La quantification des données de dégradation a été réalisée par le logiciel Fiji


(Schindelin, J.; Arganda-Nature methods 2012) par le biais d’une macro écrite par nos soins
(annexe 1).

Brièvement, les images prises en fluorescence avec la fonction apotome ont été
traitées par un filtre gaussien pour éliminer les zones d’ombre puis chaque canal de
fluorescence analysée séparément. Après identification manuellement du pourtour de la
103
cellule, les foci de dégradation étaient identifiés par seuillage manuel sur les images du canal
vert correspondant à la gélatine. Puis avec la fonction « analyse particules » de Fiji, l’aire des
foci et leur nombre étaient quantifiés. La procédure était répétée pour identifier et quantifier
les foci de cortactine et de TKS5. Les images des seuillages étaient ensuite superposées pour
quantifier la colocalisation des protéines entre elles et avec les zones de gélatine dégradées.
Les données étaient exportées vers Excel puis analysées et représentées par GraphPad Prism.

Western Blot

Les cellules étaient lysées dans un tampon de lyse contenant 50 mM Tris pH 7.5,
1% NP-40, 120 mM NaCl, 0.5 mM EDTA, 1 mM DTT, 1X Complete Mini Roche® Protease
Inhibitor pendant 30 min sur glace. Les lysats étaient centrifugés à 14000 tr/min à 4°C pendant
30 min. Les surnageants contenant l’extrait de protéines totales étaient collectés et congelés à
- 80°C. Les surnageants étaient alors dosés par la méthode BCA (bicinchonique acid protein
assay Pierce®) et dilués pour obtenir une concentration finale de 0.5-1.5 mg/ml avec du
tampon de dénaturation (Tris 62.5mM pH 6-8, 2% SDS, 10% glycérol, 0.04% Bleu de
Bromophénol) puis dénaturés à 95°C pendant 10 minutes. Les échantillons ont été déposés
dans les puits de gels de polyacrylamide NuPAGE® Bis-Tris 4-12%. La migration a été réalisé
dans du tampon MOPS (50 mM MOPS, 50 mM TrisBase, 0.1% SDS, 1 mM EDTA, pH 7.7)
à 90 V pendant 10 minutes puis à 180V jusqu’à ce que le bleu de bromophénol sorte du gel.
Les protéines séparées sur gel par électrophorèse ont été électro-transférées sur membrane de
nitrocellulose dans un tampon contenant 25mM Tris pH 8.3, 192 mM glycine et 20% Ethanol.
Après blocage des sites de liaison aspécifiques par incubation des membranes dans une
solution de lait à 5%, les membranes étaient incubées avec des anticorps primaires, lavées,
incubées avec des anticorps secondaires couplés à l’HRP (horse raddish péroxydase) et
révèlées par chimioluminescence (Tableau 2).

Analyse en vidéomicroscopie de la durée de vie des invadopodes

Les cellules MDA-MB -231 étaient transfectées par des ARNi spécifiques puis 24h
plus tard les cellules étaient trypsinées et transfectées par le plasmide codant pour le peptide
LifeAct fusionné à la mRFPRuby (3ng). Après 48h, les cellules étaient détachées, comptées
et 10000 cellules étaient ensemencées sur des lamelles recouvertes de gélatine fluorescente.
Après deux heures d’incubation, les lamelles étaient lavées au PBS, transférées dans une boite
permettant l’analyse des invadopodes par vidéomicroscopie (Attofluor™ Cell Chamber,

104
ThermoFisher) en utilisant un microscope confocal équipé d’un spinning disk (Zeiss) en mode
TIRF (Microscope de fluorescence par réflexion totale interne). Lors du transfert des lamelles,
le milieu de culture était remplacé par un milieu DMEMgfp-2TM (Evrogen) sans rouge phénol,
supplémenté avec 10% sérum de veau et 1% de pyruvate, le tout filtré (pores 0.66µm). Les
cellules étaient imagées toutes les 90 secondes pendant deux heures avec un objectif x63 et
deux lasers émettant à 488nm et 561nm (puissance laser 10-20%) permettant de suivre la
dégradation de la gélatine fluorescente et les invadopodes (correspondant aux foci de LifeAct)
respectivement. Les images étaient analysées avec Metamorph et Fiji en repérant et suivant
image par images les foci d’actine apparaissant puis dégradant la gélatine (trou noir dans la
matrice fluorescente verte) puis disparaissant.

Expérience de biotinylation de proximité

Les cellules MDA-MB-231 exprimant stablement les protéines de fusion BirA* ont
été ensemencées à 70% de confluence sur des boites de pétri recouvertes de gélatine 0,2% en
présence de 50µM de biotine pendant 18 heures puis lysées avec un tampon contenant 50 mM
Tris pH 7.4, 500 mM NaCl, 0.4 % SDS, 2 % Triton X-100, 5 mM EDTA ,1 mM DTT et
contenant des anti-protéases et anti-phosphatases. Après clarification des extraits protéiques
par ultracentrifugation, les protéines biotinylées ont été isolées en incubant le lysat cellulaire
avec des billes couplées à l’Avidine (ThermoFisher) pendant 1h à 4°C. Après trois lavages
avec du tampon de lyse et un lavage un tampon contenant 50mM Tris, pH 7.4 et 50mM NaCl,
les protéines précipitées étaient décrochées par l’ajout du tampon de dénaturation supplémenté
de 2 mM de D-biotin (Invitrogen) et chauffage à 95°C pendant 10min préalablement à leur
analyse par SDS-PAGE ou spectrométrie de masse.

Analyse statistique

Toutes les analyses statistiques ont été réalisées sur le logiciel GraphPad Prism
(GraphPad, La Jolla, USA). Le test de Mann Whitney et le t-test avec correction de Welsh ont
été utilisés pour déterminer les différences significatives entre les groupes de données. Les
histogrammes ont aussi été tracés avec Prism pour montrer les moyennes et les erreurs types.

105
Analyse des protéines en spectrométrie de masse

Par la plateforme : Protéomique et Spectrométrie de Masse du CRCM,


France) comme décrit précédemment (Daou et al. 2014, Bouguenina et al 2017) en
utilisant LTQ-Orbitrap-Velos (Thermo Electron, Bremen, Allemagne) couplé à un
nanoLCUltimate 3000 chromatography system (Dionex, Sunnyvale, USA).
L'identification et la quantification des protéines en Label-Free ont été réalisées comme
décrit précédemment (Bouguenina et al., 2017; Daou et al., 2014).

106
Macro écrite pour Fiji selectWindow (nom+"image
(red)");
run("Close All"); run("Duplicate...", " ");
run("Set Measurements...", setTool("freehand");
"area mean standard min display
redirect=None decimal=3"); waitForUser("Tracer le contour
run("Clear Results"); de la cellule");
dir=getDirectory("images à run("Measure");
quantifier");
dir2=getDirectory("dossier de // calcul cortactine
sauvegarde"); selectWindow(nom+"image
(blue)");
print(dir); setAutoThreshold("Default");
v= getFileList (dir); run("Threshold...");
for (i=0;i<v.length;i++) setAutoThreshold("Default
dark");
{ waitForUser("threshold");
nom=v[i]; run("Convert to Mask");
print(nom); run("Fill Holes");
open(dir+nom); run("Duplicate...", " ");
run("Analyze Particles...",
run("Set Scale...", "distance=10 "size=0.1-20.00 circularity=0.06-1.00
known=1 pixel=1 unit=micron global"); show=Outlines display exclude
setTool("freehand"); summarize add");
waitForUser("tracer la zone selectWindow(nom+"image
d'interet"); (blue)");
run("Crop"); saveAs(dir2+nom+"cort"+"Tiff
run("Clear Outside"); ");
rename(nom+"image");
run("Split Channels"); // calcul TKS5
selectWindow(nom+"image
// calcul de l'aire cellulaire (red)");
setAutoThreshold("Default");
run("Threshold...");

107
setAutoThreshold("Default selectWindow(nom+"image
dark"); (green)");
waitForUser("threshold"); saveAs(dir2+nom+"gel"+"Tiff
run("Convert to Mask"); ");
run("Fill Holes");
run("Duplicate...", " "); //create overlay
run("Analyze Particles...", selectWindow(nom+"image
"size=0.1-20.00 circularity=0.06-1.00 (red)");
show=Outlines display exclude rename("c1");
summarize add"); run("Duplicate...", " ");
selectWindow(nom+"image run("Duplicate...", " ");
(red)");
saveAs(dir2+nom+"TKS5"+"T selectWindow(nom+"image
iff"); (green)");
rename("c2");
// calcul spot dégradation run("Duplicate...", " ");
selectWindow(nom+"image run("Duplicate...", " ");
(green)");
run ("Brightness/Contrast..."); selectWindow(nom+"image
(blue)");
waitForUser("contrast?"); rename("c3");
run("Apply LUT"); run("Duplicate...", " ");
run("Duplicate...", " ");
run("Threshold...");
setAutoThreshold("Default run("Merge Channels...",
dark"); "c1=[c1] c2=[c2] c3=[c3]");
waitForUser("threshold"); saveAs(dir2+nom+"merge"+"T
run("Convert to Mask"); IFF");
run("Fill Holes"); run("8-bit");
run("Duplicate...", " "); rename(nom+"MERGED");
run("Analyze Particles...", waitForUser("threshold");
"size=0.1-20.00 circularity=0.06-1.00 run("Analyze Particles...",
show=Outlines display exclude "size=0.03-Infinity show=Outlines
summarize add"); display exclude summarize add");

108
saveAs(dir2+nom+"mergeNB" tab1=dir2+"resultat"+nom+".xl
+"TIFF"); s";
selectWindow("Results");
//creat merge saveAs("Results", tab1);
selectWindow("Summary");
imageCalculator("AND saveAs(dir2+
create", "c3-1","c2-1"); "XLS"+"Summary",tab2);
rename(nom+"GEL et CRT");
run("Analyze Particles...",
"size=0.03-Infinity show=Outlines
display exclude summarize add");
saveAs(dir2+nom+"CRT et
GEL "+"TIFF");

imageCalculator("AND
create", "c1-1","c2-2");
rename(nom+"GEL et TKS5");
run("Analyze Particles...",
"size=0.03-Infinity show=Outlines
display exclude summarize add");
saveAs(dir2+nom+"TKS5 et
GEL "+"TIFF");

imageCalculator("AND
create", "c1-2","c3-2");
rename(nom+"TKS5 et CRT");
run("Analyze Particles...",
"size=0.03-Infinity show=Outlines
display exclude summarize add");
saveAs(dir2+nom+"TKS5 et crt
"+"TIFF");

run("Close All");
}

109
Dénomination Dilutions
Désignation Fournisseur Espèces
de l’anticorps Immunofluorescence Western Blot
4F11-
Anti-Cortactine Millipore Souris 1/100 1/1000
05-180
M-300 Santa Cruz
Anti-TKS5/FISH Lapin 1/200 1/2000
sc-30122 Biotechnology®
Phalloïdine P5282 Thermofisher Conjugué 1/2000 NA
Anti-MMP14 EP1264Y Abcam Lapin 1/200 1/2000

Anti-Cherry ab183628 Abcam Lapin 1/500 1/2000

Anti-EB1 2164 Cell Signaling Souris 1/1000 1/1000


(H70) Santa Cruz
Anti-CLASP1 Lapin NA 1/200
sc-66832 Biotechnology®
(H40) Santa Cruz
Anti-CLASP2 Lapin NA 1/200
sc-98440 Biotechnology®
Santa Cruz
Anti-CLIP170 F3 Souris 1/500 1/1000
Biotechnology®
Anti-IQGAP1 610611 BD Transduction Lab Souris NA 1/500
Anti-a tubuline DM1a Sigma Aldrich, Souris 1/500 1/4000
Anti-a tubuline YOL1/34 Abcam Rat 1/1000 NA
Santa Cruz 1/500
Anti-HA Sc-805 Lapin NA
Biotechnology®
Anti-Nck 610099 BD Transduction Souris NA 1/1000
Santa Cruz
Anti-Grb2 sc-255 Lapin NA 1/1000
Biotechnology®
Anti-Nogo (A/B) ab47085 Abcam Lapin NA 1/10000
Santa Cruz
Anti-MAP4 sc-67152, Lapin NA 1/1000
Biotechnology®
Anti-FGD1 HPA000911 Sigma Aldrich, Lapin NA 1/1000
Anti-NWASP ab56454 Abcam Souris NA 1/1000
Anti IgG de souris Couplé 1/100
Jackson ImmunoResearch Europe, DyLightÒ ou
Anti IgG de lapin NA
Suffolk, UK AlexaFluorÒ 1/250
Anti IgG de rat 488 ou 594
Anti IgG de souris
Couplé à la
Anti IgG de lapin ThermoFisher Péroxydase NA 1/10000
de raifort
Anti IgG de rat
Tableau 3- Anticorps utilisée pour les expériences d’immunofluorescence et de
western blot/immunoprécipitation

110
Objectifs de mon travail de thèse
La cascade métastatique est un phénomène complexe et global dans les processus
cancéreux, mettant en échec le traitement de nombreux cancers. Son étude nécessite une
fragmentation en étapes distinctes pour faciliter l’identification des mécanismes moléculaires
précis conduisant à l’invasion accrue des tissus environnant par les cellules cancéreuses.
L’objectif étant de pouvoir ensuite avoir des marqueurs prédictifs ou actionnables
pharmacologiquement en vue d’endiguer le processus de dissémination des cellules
tumorales.

Les MT sont des cibles thérapeutiques majeures dans le cancer du sein localisé et
métastatique et les chimiothérapies ciblant les MT ont montré un bénéfice clinique en termes
de survie en situation néoadjuvante, adjuvante et métastatique.

Les ACM, utilisés à fortes doses, ont une action cytotoxique en déstabilisant le
fuseau mitotique lors de la phase M du cycle cellulaire, accumulant les cellules en phase G2/M
et menant à la mort cellulaire.

Cependant, les mécanismes moléculaires mis en jeu restent mal connus à ce jour.
La compréhension du mode d'action des ACM utilisés à faibles concentrations est cruciale,
car elle pourrait conduire à une utilisation moins toxique des ACM dont les doses de
traitements actuels entrainent notamment des neuropathies périphériques et des aplasies
médullaires limitant leur utilisation.

Notre équipe étudie depuis plusieurs années les mécanismes régulant la migration
des cellules de cancer du sein, notamment en aval du récepteur à tyrosine kinase ErbB2. Nous
avons caractérisé une voie de signalisation impliquant Memo et mDia1 régulant la fonction
de protéines modulatrices de la dynamique des MT telles qu’APC, ACF7 et EB1 (Benseddik
et al., 2013, Bouguenina et al, 2017; Daou et al., 2014; Zaoui et al., 2010).

Dans ce projet, nous avons poursuivi l’étude du rôle des MT dans les
phénomènes de migration et d'invasion des cellules tumorales, en étudiant d’une part l’action
d’une chimiothérapie anti-microtubules sur les protéines régulant la dynamique des MT et la
migration cellulaire et en caractérisant, d’autre part, la contribution de ces mêmes protéines
régulatrices aux étapes précoces de l’invasion tumorale.

La première partie de mon travail de thèse a eu comme objectif de définir l’impact


de doses non-cytotoxiques d'éribuline, un ACM nouvellement développé et validé en pratique

111
courante et dont l’activité perdure après échec des anti-microtubules conventionnels, sur la
migration des cellules de cancer du sein. J’ai donc étudié l'action de doses sub-nanomolaires
d'éribuline sur la migration des cellules de la lignées tumorale mammaire SKBr3 qui est un
excellent modèle pour l’étude de la contribution des MT au processus migratoire, en réponse
à l’activation d’ErbB2. J’ai démontré l’impact de l’éribuline à faibles doses sur la dynamique
des MT et les conséquences sur la capture des MT au cortex cellulaire. Puis afin de déterminer
les mécanismes moléculaires impliqués, j'ai évalué l'action des faibles doses d'éribuline sur
l’association aux MT des protéines connues pour leur rôle régulateur de la dynamique des
MT : la protéine EB1, protéine au cœur du réseau de +TIP régulant l'extrémité "+" des MT, et
la tubuline polymérase ch-TOG. Ce travail confirme que les ACM, au-delà de leur action anti-
mitotique, ont également un impact très spécifique sur la migration des cellules tumorales qui
pourrait contribuer à l’efficacité de leur action anti-néoplasique.

Dans un deuxième temps je me suis interrogés sur la contribution des protéines


associées aux MT à l’invasion tumorale, et plus précisément, aux phases précoces de
l'invasion qui impliquent la mise en place de protrusions spécialisées dans la protéolyse de la
matrice extracellulaire, les invadopodes. Si la formation des invadopodes dépend clairement
de l’assemblage d’un réseau dense d’actine, la contribution des MT est controversée. Par
ailleurs, si certaines protéines connues pour réguler les MT ont été impliquées dans le
fonctionnement des invadopodes (Lizarraga et al., 2009; Sakurai-Yageta et al., 2008), le rôle
de +TIP telles qu’EB1 restait également à démontrer.

Mon travail de thèse a donc été de définir l’impact de protéines candidates, connues
pour réguler la dynamique des MT, sur la capacité à dégrader la matrice extracellulaire et à
moduler la formation des invadopodes en utilisant comme modèle, la lignées mammaire
MDA-MB-231, dérivées d’un cancer du sein triple négatif invasif.

En parallèle, nous avons mis en place une méthodologie permettant d'identifier de


manière systématique les composants moléculaires des invadopodes, qui pourraient permettre
de faire émerger de nouveaux acteurs de l’assemblage des invadopodes. Une telle approche
nous a semblé nécessaire car malgré des avancées dans les techniques d’étude appliquées à
ces structures, peu d’approches globales ont été décrites. Cette approche repose sur la
biotinylation in situ et l’identification par spectrométrie de masse des protéines directement
voisines de TKS5, une protéine principalement localisée aux invadopodes et contribuant à
leur mise en place. Le développement de cette approche nous a permis d’identifier de
nouvelles protéines des invadopodes, susceptibles d’être impliquées dans leur fonction et donc

112
dans le processus métastatique ; elle permettra aussi de valider la présence de protéines
candidates, +TIP ou protéines régulatrices des MT, aux invadopodes.

113
PREMIERE PARTIE : Etude de l’action de
l’éribuline sur la migration des cellules tumorales

114
Introduction première partie

Les ACM sont des molécules de chimiothérapie largement utilisés en cancérologie,


depuis de nombreuses années.

Les limitations majeures dans l’utilisation des ACM en clinique reposent sur leur toxicité
hématologique et l’induction de neuropathies périphériques, parfois très invalidantes et/ou peu
réversibles (Wozniak et al., 2018). De plus, ces phénomènes de résistance reposent sur des
mécanismes complexes et multiples qui ne sont pas encore tous connus (Kavallaris, 2010).

De façon intéressante, il a été observé que les résistances développées suite au traitement
par un ACM peuvent être surpassées par l’utilisation d’un ACM d’une autre famille
(Dumontet and Jordan, 2010), ce qui serait rendu possible par le fait que chaque famille
d’ACM se fixe de manière différente à la tubuline b, leur principale cible. Cette observation
a conduit à la recherche de nouvelles molécules ciblant les MT afin de tenter de contourner
ces phénomènes de résistance. Ces nouveaux composés tels que l’ixabépilone, la vinflunine
et l’éribuline, ont montré une activité biologique sur des lignées tumorales résistantes aux
autres ACM, notamment au paclitaxel, souvent par un mécanisme d’action légèrement
différent (Kruczynski et al., 1998; Nettles et al., 2004; Smith et al., 2010).

Ces nouveaux ACM ont également montré un bénéfice clinique chez des patients
présentant une récidive/progression de leur maladie, après échec des chimiothérapies à base
d’anthracycline, de sels platine ou de taxanes (Bellmunt et al., 2009; Cortes et al., 2011;
Martin et al., 2018; Sparano et al., 2010). Ces thérapies s’ajoutent à l’arsenal déjà disponible
et pourraient jouer un rôle particulièrement intéressant chez des patientes présentant des
maladies, comme le cancer du sein triple négatif, avec encore peu de ressources thérapeutiques
en phases avancées (Trédan et al., 2015) . Il est donc important de déterminer le mode d’action
de ces nouvelles molécules. C’est pourquoi nous nous sommes intéressés à l’éribuline.

L’éribuline (E7389) est un composé naturel issu de l’halichondrine B, retrouvé


initialement dans une éponge marine présente dans les mers japonaises, l’Halichondria
Hokadai (Hirata and Uemura, 1986). C’est une cétone macrocyclique qui possède une action
dépolymérisante sur les MT (Jordan et al., 2005; Okouneva et al., 2008) en se liant sur le
domaine de fixation des vinca alcaloïdes sur la tubuline b (Bai et al., 1991). In vitro et in vivo,
l’éribuline modulerait la dynamique des MT de façon légèrement distincte des autres ACM

115
(Jordan et al., 2005; Towle et al., 2001): l’éribuline se lierait à la tubuline des MT avec une
affinité plus importante pour l’extrémité + du polymère, inhibant fortement la croissance des
MT (Jordan et al., 2005; Smith et al., 2010). A fortes doses, les agrégats formés par la liaison
de l’éribuline et de la tubuline sont différents des paracristaux habituellement observés avec
les vinca alcaloïdes (Gigant et al., 2005; Jordan et al., 2005).

De façon intéressante, l’éribuline reste cytotoxique sur les lignées tumorales mammaires
résistantes au paclitaxel (Towle et al., 2001). Le développement clinique de l’éribuline a
abouti à une AMM en 2011 en France, dans les cas de cancers du sein avancés (RH+/-, HER2
+/-) en troisième ligne, ou en monothérapie pour les patientes HER2- ayant progressé après
traitement par anthracycline et paclitaxel, en deuxième ligne thérapeutique, en alternative à la
navelbine ou à la capécitabine (Cortes et al., 2011; Kaufman et al., 2015; Twelves et al., 2014).
Récemment, l’éribuline a montré son efficacité dans les liposarcomes métastatiques
(Schöffski et al., 2016).

Considérant l’efficacité de cette nouvelle molécule de chimiothérapie, il est crucial


d’identifier plus précisément son mode d’action ce qui permettrait de mieux appréhender les
résistances émergentes et éventuellement d’identifier des marqueurs prédictifs d’efficacité.
L’éribuline étant une molécule fixant préférentiellement l’extrémité + des MT (Smith et al.,
2010), une structure ayant un rôle central dans la dynamique des MT et un impact sur de
nombreuses fonctions cellulaires dont la migration, il nous a semblé important d’analyser
comment l’éribuline affecte la dynamique des MT interphasiques lors de la migration
cellulaire.

Dans cette étude, nous avons donc montré que l’éribuline, utilisée à des concentrations
non cytotoxiques, modifiait la dynamique des MT et inhibait la capture des MT au cortex,
induisant une perturbation de la migration dirigée. Nos résultats montraient également que, à
ces doses, l’éribuline déplaçait les +TIP de l’extrémité des MT et suggéraient que la tubuline
polymérase ch-TOG pourrait être la cible primaire de l’éribuline menant au défaut de
migration

116
Article : Eribulin targets a ch-TOG-dependent directed migration
of cancer cells
Brice Chanez, Anthony Gonçalves, Ali Badache, and Pascal Verdier-Pinard

117
www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No. 39

Eribulin targets a ch-TOG-dependent directed migration of


cancer cells
Brice Chanez1,2,3,4, Anthony Gonçalves1,2,3,4, Ali Badache1,2,3,4 and Pascal Verdier-
Pinard1,2,3,4
1
Centre de Recherche en Cancérologie de Marseille, Inserm, Marseille, France
2
Institut Paoli-Calmettes, Marseille, France
3
Aix-Marseille Université, Marseille, France
4
CNRS, UMR7258, F-13009, Marseille, France
Correspondence to: Pascal Verdier-Pinard, email: pascal.verdier-pinard@inserm.fr
Correspondence to: Ali Badache, email: ali.badache@inserm.fr
Keywords: eribulin, migration, microtubule, ch-TOG, EB1
Received: June 18, 2015 Accepted: September 30, 2015 Published: October 19, 2015

This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use,
distribution, and reproduction in any medium, provided the original author and source are credited.

ABSTRACT
Non-cytotoxic concentrations of microtubule targeting agents (MTAs) interfere
with the dynamics of interphase microtubules and affect cell migration, which could
impair tumor angiogenesis and metastasis. The underlying mechanisms however are
still ill-defined. We previously established that directed cell migration is dependent
on stabilization of microtubules at the cell leading edge, which is controlled by
microtubule +end interacting proteins (+TIPs). In the present study, we found that
eribulin, a recently approved MTA interacting with a new class of binding site on
β-tubulin, decreased microtubule growth speed, impaired their cortical stabilization
and prevented directed migration of cancer cells. These effects were reminiscent of
those observed when +TIP expression or cortical localization was altered. Actually,
eribulin induced a dose-dependent depletion of EB1, CLIP-170 and the tubulin
polymerase ch-TOG from microtubule +ends. Interestingly, eribulin doses that
disturbed ch-TOG localization without significant effect on EB1 and CLIP-170 comets,
had an impact on microtubule dynamics and directed migration. Moreover, knockdown
of ch-TOG led to a similar inhibition of microtubule growth speed, microtubule capture
and chemotaxis. Our data suggest that eribulin binding to the tip of microtubules and
subsequent loss of ch-TOG is a priming event leading to alterations in microtubule
dynamics and cancer cell migration.

INTRODUCTION processes. Survival of cancer patients treated with


microtubule targeting agents (MTAs) is frequently limited
Natural products such as vinblastine and paclitaxel by tumor resistance to chemotherapies and progression
are important anti-tumoral drugs [1]. Their mode of action towards invasive and metastatic grades. Detailed
involves primarily the destruction of the microtubule characterization of MTA binding to tubulin identified
cytoskeleton forming the mitotic spindle, leading to cell distinct binding pockets, offering alternative opportunities
cycle arrest in mitosis and ultimately to cancer cell death. for treatments against tumor resistant to a site-specific
At usual clinical doses, common side effects of these class of MTAs [2]. Consequently, a continuous effort
chemotherapeutics are decreased neutrophil blood count, in natural product and medicinal chemistry generated
due to the targeting of the fast renewing hematopoietic a wealth of MTAs with a diverse array of chemical
tissues, and peripheral neurotoxicity which is thought structures. Recently, eribulin (Halaven), a synthetic
to occur via the poisoning of microtubule-rich neuronal analog of the sponge metabolite halichondrin B [3,

www.impactjournals.com/oncotarget 41667 Oncotarget


4], has been approved for the treatment of metastatic RESULTS
breast cancer patients previously treated with regimens
including a taxane [5-7]. In phase III clinical trial, eribulin
significantly improved overall survival of women heavily Subnanomolar concentrations of eribulin altered
pretreated for metastatic breast cancer, highlighting a cortical microtubules
clinical benefit of eribulin after failure of other regimens.
Several arguments have been put upfront to
challenge the idea that the antimitotic action is the sole We performed a cytotoxicity assay on three different
mechanism by which MTAs impede tumor progression [8, breast cancer cell lines representative of various molecular
9]. Targeting the few rapidly dividing cells in human solid breast cancer subtypes, and compared the effects of
tumors cannot explain the effectiveness of these drugs, eribulin with those of other MTAs, i.e. paclitaxel and
leading to the hypothesis that MTAs also target interphase vinblastine (Figure S1). The ErbB2-overexpressing SKBr3
cells [10]. This is supported by the observation that non- cells were the most sensitive to eribulin, relative to the
cytotoxic concentrations of MTAs inhibit intracellular
trafficking [11]. Moreover, MTAs abrogate cancer and
endothelial cell migration at doses that affect microtubule
dynamics, without impacting microtubule mass [12].
Nevertheless, the underlying molecular mechanisms are
still unclear, even though studies suggested that MTA
might function by affecting localization of the EB1 +end-
binding protein [13, 14]. The dynamics and stability of the
microtubule cytoskeleton is mainly regulated by proteins
interacting directly with microtubules and belonging to
distinct functional categories [15]: nucleating proteins
(including γ-tubulin), structural proteins (such as Tau and
MAP2), motors (dyneins and kinesins) and +end tracking
proteins or +TIPs (like EB1 or CLIP-170). We investigate
how cues controlling the complex network of microtubule-
associated proteins regulate cancer cell migration. In
particular, we have characterized signaling pathways by
which the ErbB2/HER2 receptor tyrosine kinase regulates
the cortical localization of EB1-binding proteins, allowing
capture and stabilization of EB1-decorated microtubules
at the leading edge of migrating breast cancer cells [16-
19]. We established that interference with +TIP expression
or localization prevents chemotaxis of breast cancer cells
in response to a gradient of heregulin (HRG), an ErbB
receptor ligand.
The activity of eribulin on metastatic breast cancer
may be due in part to an effect on cancer cell migration.
In the present study, we have investigated the effect of
eribulin on tumor cell motility and microtubule dynamics.
We found that subnanomolar concentrations of eribulin
impaired breast cancer cell chemotaxis and prevented Figure 1: Eribulin prevents microtubule capture at
microtubule extension towards the leading edge. The the cortex of SKBr3 cells. SKBr3 cells, transfected with
defect in peripheral microtubules was indistinguishable EGFP-tubulin and a control (Ctrl) or an EB1 siRNA for 48 h,
from the one generated by the disturbance of the were grown in the presence of DMSO 0.5% (NT; not treated
membrane-associated protein complex and the +end with eribulin) or eribulin for 4 h, before addition of HRG to
trigger formation of membrane protrusions. A. Representative
complex that are involved in microtubule capture at the
snap-shots of SKBr3 cells (upper panels) with captured (NT)
cell cortex [18]. Interestingly, eribulin treatment disturbed or non-captured (EB1 siRNA; 1 nM eribulin) microtubules.
the +end localization of EB1 and CLIP170, but also of Zooms on the peripheral regions indicated by the black squares
the tubulin polymerase ch-TOG. Finally, knocking down are presented in the lower panels. Black scale bars represent 10
ch-TOG recapitulated the effects of anti-chemotactic µm. Dashed lines indicate cell limits. B. The percentage of cells
concentration of eribulin suggesting that displacement of with captured microtubules was determined in three independent
ch-TOG from microtubule tip might be a priming event experiments (from a total of 150 cells) and presented as mean
in eribulin-induced disturbance of cancer cell migration. +/- SD; Student t-test with Welch correction: *p < 0.05, **p <
0.01, ***p < 0.001.

www.impactjournals.com/oncotarget 41668 Oncotarget


EGFP-tubulin and estrogen-receptor positive T47D cells 17]. Treatment with subnanomolar concentrations of
and triple-negative MDA-MB-231 cells (Figure S1A; IC50 eribulin for 4 hours was not cytotoxic (Figure S2) and
of 0.3, 1.0, 1.5 nM for SKBr3, T47D and MDA-MB-231 did not affect HRG-induced membrane protrusions, but
cells, respectively) and eribulin was more cytotoxic (IC50 strongly inhibited the extension of microtubules in these
0.3 nM) than vinblastine (IC50 0.9 nM) and paclitaxel (IC50 protrusions (Figure 1A). This was reminiscent of the
2.2 nM) in SKBr3 cells (Figure S1B). Since the SKBr3 phenotype observed when the interaction between the MT-
cells are a model cell line for investigating the role of capture complex at the plasma membrane and the +TIP
microtubules in cell migration, we focused our study on complex was disturbed [18]. Therefore, we evaluated
this cell line. Upon addition of HRG, an ErbB2-activating the number of cells displaying a captured microtubule
ligand, SKBr3 cells form wide protrusions, populated phenotype (i.e. cells with a large number of microtubules
by microtubules that extend to the cell periphery [16, extending within protrusions) vs. the number of cells in

Figure 2: Eribulin inhibits HRG-induced chemotaxis. SKBr3 cells were transfected with a control (Ctrl) or an EB1 siRNA for 48
h before tracking of cells in Dunn chambers for 4 or 8 h, as they migrated in response to a HRG-gradient (highest concentrations at the top
of the figure). A. Upper panel: tracks of individual cells set to the same origin; cells migrated towards high and low HRG concentrations
are represented in black and grey, respectively. Lower panel: rose plots reflecting cell distribution after 4 h of migration; p value < 0.05
indicates unimodal directional cell distribution in the Rayleigh test. NT, not treated with eribulin. B. Cell forward migration index (yFMI),
cell directness (D) and migration speed were calculated after 4 h (black bars) or 8 h (white bars) of migration. Mean and SD from three
independent experiments and at least 150 cells are presented. See Supplemental Material and Methods for definitions and equations for
each parameter.

www.impactjournals.com/oncotarget 41669 Oncotarget


which microtubules remained at a distance from the cell HRG gradient for 4 hours (Figure 2A) and 8 hours (Figure
periphery. The percentage of cells displaying microtubule S4). We determined that exposure to 0.1 nM eribulin was
capture decreased in a dose-dependent manner starting sufficient to strongly limit the efficiency of cell forward
from eribulin doses as low as 0.1 nM (Figure 1B). migration (Figure 2B) and completely disorient migrating
Noticeably, at 0.5 nM, eribulin reduced the percentage cells (Figure 2A), similarly to EB1 down-regulation.
of cells with captured microtubules as efficiently as the Interestingly, eribulin did not affect other parameters of
knockdown of EB1, a master +TIP (Figure 1B). cell motility such as cell migration speed and directness,
even when increasing the concentration of eribulin to 0.5
Eribulin prevented chemotaxis of breast cancer nM and the exposure time to 8 hours (Figure 2B).
cells
Inhibition of chemotaxis by eribulin occurred
in the absence of detectable effects on EB1 and
We previously established that defects in
microtubule capture at the cell cortex led to strongly CLIP-170 comets
disturbed HRG-induced chemotaxis of breast cancer cells.
Thus, we measured the impact of eribulin on chemotaxis, Since exposure to subnanomolar concentrations
by tracking SKBr3 cells as they migrated in response to an of eribulin and EB1 knockdown have similar effects on
cortical microtubules and directed cell migration, we
analyzed whether eribulin treatment affected the function
of EB1 and of the microtubule- and EB1-binding protein
CLIP-170. Eribulin did not alter the expression levels of
EB1 or CLIP-170 (Figure S3B). Localization of EB1 and
CLIP-170 by immunofluorescence revealed an evident
loss of these proteins from microtubule +ends when cells
were treated with 1 nM of eribulin (Figure 3). At 0.1 nM
of eribulin, despite an obvious defect in microtubule
capture at the cortex, microtubules still appeared decorated
with EB1 and CLIP-170 comets. To quantify the impact of
subnanomolar concentrations of eribulin on +TIP comets,
we measured the length (Figure 4A) and the number
(Figure 4B) of EB1 and corresponding CLIP-170 comets.
The density of EB1 comets was strongly decreased
starting from 0.5 nM eribulin; EB1 comet number was
slightly decreased at 0.1 nM of eribulin, but this was
not significant for the corresponding CLIP-170 comets
(Figure 4B). The length of the remaining EB1 and CLIP-
170 comets was also considerably reduced above 0.5 nM
eribulin; but it was not significantly impacted by 0.1 nM
of eribulin (Figure 4A). Collectively, our results show
that the inhibition of microtubule capture and chemotaxis
by 0.1 nM of eribulin is not associated with a detectable
change in the length and density of +TIP comets, and thus
cannot be merely explained by the loss of EB1 or EB1-
associated +TIPs.

Anti-chemotactic eribulin dose reduced


microtubule growth speed

Since 0.1 nM eribulin treatment disturbed


microtubule capture, we examined whether this might be a
Figure 3: Effects of eribulin on EB1 and CLIP-170 consequence of altered microtubule cytoskeleton dynamics
microtubule +end localization. Following treatment with in SKBr3 cells. Because the treatment did not change EB1
eribulin for 4 h, SKBr3 cells were stimulated with HRG for 30 comets, we measured microtubule dynamics by tracking
min and fixed. EB1, CLIP-170 and tubulin localizations were EB1 comets in SKBr3 cells stably expressing EB1-GFP.
visualized by triple immunofluorescence labeling. White scale We have previously verified that the SKBr3.EB1-GFP
bars represent 10 µm; cell limits are delineated with dashed lines.
cell line had the same sensitivity to eribulin than parental

www.impactjournals.com/oncotarget 41670 Oncotarget


SKBr3 cells (Figure S1C, IC50 value of 0.3 nM). Using the 0.1 nM, we observed an increase in the percentage of slow
+TipTracker software, we calculated multiple parameters microtubule tracks (Figure S5) and globally a significant
of microtubule dynamics and in the presence of eribulin at decrease in microtubule growth speed (Figure 4C) and
growth length (data not shown) relative to control, with
no significant change in the growth lifetime (Figure 4C)
or in rescue and catastrophe frequencies (data not shown).

Recruitment of ch-TOG at microtubule +ends was


altered by the anti-chemotactic dose of eribulin

The effect of 0.1 nM eribulin treatment on


microtubule capture and directed migration did not
correlate with the loss of EB1 or EB1-associated proteins.
Thus, we searched for other possible eribulin effectors that
could mediate its effects on microtubule capture. Among
+TIPs, ch-TOG was a relevant candidate: it is a tubulin
polymerase associating with the very tip of microtubules,
which tracks microtubule +ends independently of EB1
[20-22]. We observed that in SKBr3 cells ch-TOG had a
specific spot-like localization clearly distinct from EB1
comet-like labeling (Figure S6 and 5E). We found that
when ch-TOG expression was down-regulated (Figure
S3A), microtubule capture at the cell cortex was decreased
by 20% (Figure 5A) which was equivalent to the effect of
0.1 nM eribulin-treatment (Figure 1B). Down-regulation
of ch-TOG also prevented HRG-dependent chemotaxis
(Figure 5B), with no effect on cell migration speed
(data not shown). Noticeably, down-regulation of ch-
TOG significantly reduced microtubule growth speed
(Figure 5C). These similarities between the effects of
0.1 nM eribulin treatment and depletion of ch-TOG on
microtubule dynamics and cancer cell migration raised
the possibility that eribulin disturbed ch-TOG localization
or function. Thus, we analyzed the impact of eribulin on
ch-TOG localization at the tip of microtubules (Figure 5D
and 5E). We observed a strong reduction of the number of
ch-TOG positive microtubule +ends, with a 44% decrease
at 0.1 nM of eribulin compared to untreated cells (Figure
5D). We have verified that eribulin treatment was not
Figure 4: Effects of eribulin on the length and density altering the expression of ch-TOG (Figure S3C).
of EB1 and CLIP-170 comets, and on microtubule We further assessed that 0.1 nM-eribulin was
dynamic parameters. The length and density of fluorescent primarily delocalizing ch-TOG rather than EB1 from
EB1 and corresponding CLIP-170 comets were measured on microtubule +ends by determining the number of EB1
immunofluorescence images such as depicted in Figure 3. A. comets harboring a ch-TOG labeling in treated and
For each condition, a total of 90 comets from three independent untreated cells (Figure 5E). We observed that in treated
experiments (10 comets per cell, 3 cells per experiment) were cells, many microtubule +ends had lost ch-TOG labeling,
measured. B. For each condition, a total of 13 cells from five but still harbored EB1 comets: there was 25 % less ch-
independent experiments were analyzed for the number of EB1 TOG labeled EB1 comets in eribulin treated cells relative
or CLIP-170 comets in an area of 300 µm2. C. EB1-GFP comets
to untreated cells. These results indicate that low doses
were tracked in HRG-stimulated SKBr3 cells, pre-treated
or not with 0.1 nM eribulin for 4 h, and resulting tracks were of eribulin disturbed the recruitment of ch-TOG to
analyzed using +TipTracker. Growth speed (including pauses) microtubule +ends and that the loss of ch-TOG induced a
and growth lifetime were calculated. For each condition, a total decrease in microtubule growth speed and in microtubule
of >14,000 tracks, in 15 cells from 3 independent experiments capture, and abrogated directed migration.
were analyzed. Medians and SD are presented, Student t-test
with Welch correction: ns > 0.05, *p < 0.05, **p < 0.01, ***p
< 0.001.

www.impactjournals.com/oncotarget 41671 Oncotarget


DISCUSSION EB1 localization, we explored the impact of eribulin on
EB1. The anti-chemotactic dose of 0.1 nM eribulin had
The present study shows that in non-cytotoxic no significant effect on EB1 and CLIP-170 localization,
conditions, eribulin altered breast cancer cell migration but induced a detectable loss of ch-TOG from the
by specifically inhibiting chemotaxis towards HRG. microtubule +ends. In addition, the down regulation of
This effect was correlated with reduced microtubule ch-TOG also led to inhibition of microtubule growth rate,
growth rate and defective microtubule capture at the microtubule capture and chemotaxis. Collectively, these
cell cortex. As MTAs were previously shown to alter results suggest that eribulin-dependent delocalization of

Figure 5: Eribulin disturbs the microtubule +end localization of ch-TOG, which is involved in MT dynamics and
chemotaxis. A.-C. SKBr3 cells were transfected with a control (Ctrl) or a ch-TOG siRNA before analysis of (A) microtubule capture
at the cell cortex, B. chemotaxis and C. microtubule dynamics as described in Figure 1B, 2A and 4C, respectively. D., E. 0.1 nM eribulin
affects microtubule +end localization of ch-TOG. D. The presence of ch-TOG labeling at the tip of microtubule ends was assessed, in the
presence or absence of eribulin, on a total of 50 microtubules in the periphery of SKBr3 cells displaying double fluorescent labeling for
tubulin and ch-TOG. The percentage of ch-TOG positive microtubules was determined in two independent experiments with ten cells per
condition in each experiment. E. chTOG tip labeling and EB1 comets were identified by dual fluorescent labeling (left panel). Exposure
time was the same for all conditions analyzed for each fluorescence channel. In contrast to control cells (NT; non treated with eribulin), in
cells treated with eribulin, many EB1 comets did not show the typical ch-TOG tip labeling, as observed in zoomed areas (insets). White
scale bar represents 10 µm. The percentage of EB1 comets also displaying ch-TOG labeling was determined in a 900 μm2 area in five cells
per condition (right panel). Student t-test with Welch correction: ns > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.

www.impactjournals.com/oncotarget 41672 Oncotarget


ch-TOG from microtubule +end is sufficient to decrease pharmacological characteristics suggest that eribulin
microtubules growth speed, independently of EB1, which targets more specifically the microtubule +ends.
in turn affects microtubule capture at the cell cortex and We observed that ch-TOG localization at the
specifically prevents steering of cells in the direction of microtubule ends is remarkably sensitive to eribulin
the chemoattractant. treatment, relative to other +TIPs. How does eribulin
The observation that low doses of eribulin affect induce the loss of ch-TOG from microtubule +ends? We
primarily ch-TOG is consistent with recent models speculate that by poisoning microtubule +ends, eribulin
suggesting that ch-TOG and EB1 bind to separate loci on binding to tubulin at substoichiometric concentrations
microtubule ends: ch-TOG associates with the frayed tip [4, 24] disturbs the binding of the tubulin polymerase ch-
of microtubules, whereas EB1 requires complete lateral TOG, thereby impacting tubulin polymerization which
interactions of protofilaments [20, 23]. Yet the two proteins translates in a decrease of microtubule growth speed; this
are linked functionally, as the active incorporation of does not require the delocalization of EB1 which occurs
GTP-tubulin dimers by ch-TOG maintains the generation at higher eribulin concentrations in our cancer cell model.
of new binding sites for EB1. This is probably why we Molecular docking suggests that halichondrin B/eribulin
observed a strong decreased in the number of EB1 comets binds near β-tubulin loops H11-H11’ and H3’-H3 at the
upon ch-TOG knockdown (Figure S6) and upon treatment interdimer interface [26] (Figure S7). Highlighting the
with high doses of eribulin that have a drastic effect on amino-acid residues of β-tubulin that are predicted to be
ch-TOG localization (Figure 5D). in contact with eribulin [26] and the amino-acid residues
Eribulin appears to impact microtubule dynamics of β-tubulin involved in the interaction with TOG1 domain
slightly differently than many antimitotic drugs, such as [27], shows that the presumed binding pocket of eribulin
vinblastine, by not altering catastrophe frequencies [4, 24]. and the β-tubulin-TOG interface are in close vicinity
In addition, eribulin inhibits the binding of vinblastine to (Figure 6). Therefore we speculate that, upon binding to
tubulin non-competitively indicating a different site of β-tubulin, eribulin induces a conformational change that
interaction on β-tubulin [25]. In vitro, eribulin acts by destabilizes the ch-TOG-tubulin complex. Recently, co-
specifically affecting growth phases, in accordance with crystallization of tubulin dimers as parts of a TTL-T2S
our results in cells where it decreased microtubule growth complex with rhizoxin, maytansine or PM060184 revealed
rate (Figure 4C) and length (data not shown). Eribulin a previously undescribed binding site on β-tubulin [28].
does not affect dynamic instability at microtubule minus This site is shaped by loops S3-H3, S5-H5 and H11-H11’
ends. It was also calculated that it binds to microtubule and is located nearby the eribulin/halichondrin B docking
with a maximum of 15 sites per microtubule [24]. These site (Figure S7), suggesting that eribulin belongs to the

Figure 6: The predicted eribulin binding site and the TOG-β-tubulin interface are juxtaposed. The model of the TOG1-
tubulin complex depicted by Ayaz et al [27] (PDB 4FFB) was used to highlight the amino-acid residues (sphere representation) of tubulin
that were predicted to be in contact with eribulin [26] in green, in contact with TOG1 in red or in contact with both in yellow. In the right
panel, the model has been rotated 90° to the right. GTP molecules are shown in stick representation (cyan).

www.impactjournals.com/oncotarget 41673 Oncotarget


same family of MTAs. Binding of MTAs at this site would While EB1 might mediate some of the effects
directly prevent the addition of tubulin dimers at the of eribulin on microtubule capture and chemotaxis, it
+end. Noticeably, T-DM1, a maytansinoid conjugated to is important to observe that at 0.1 nM, eribulin barely
Trastuzumab was approved specifically for the treatment affected EB1 comet density and length, but prevented
of ErbB2/HER2-positive metastatic cancer [29], indicating directed migration, suggesting an alternative mechanism.
the potential benefit of targeting this novel MTA binding Interestingly, this low dose of eribulin induced a decrease
site. Further experimentation will be necessary to in microtubule growth speed, similar to the one observed
investigate how eribulin affects the interaction of ch-TOG upon ch-TOG down regulation. This raised the possibility
with the +end of microtubules and/or with tubulin dimers. that the change in microtubule growth speed was
We previously found that localization at the cell responsible for preventing microtubule capture at the cell
cortex of the EB1-interacting proteins APC (adenomatous cortex. We propose that directed migration rely on a tight
polyposis coli) and the spectraplakin ACF7 is required synchronization of microtubule assembly and leading edge
for both microtubule capture and chemotaxis [18, 19], progression. Thus, slowing down microtubule growth at
underpinning a central role of EB1-mediated microtubule protrusion inception would disconnect microtubules
anchoring at the leading edge for directed migration. How from the fast forward progression of the leading edge,
does the loss of ch-TOG from microtubule +ends lead to a thereby preventing their capture. In vitro, ch-TOG
defect in microtubule capture? Ch-TOG might mediate the strongly synergizes with EB1 for catalyzing the tubulin
interaction of microtubules with proteins localized at the incorporation at microtubule +ends to reach the 10-20
cell cortex and thereby participates to microtubule capture µm.min-1 microtubule growth speeds observed in cells
and stabilization. While we cannot exclude that ch-TOG [22], indicating that it is a key physiological regulator
associates directly with cortical components, microtubule of microtubule growth. A recent study highlighted the
+end cortical interactions are more likely driven by EB1, importance of a tight control of microtubule growth
which is known to bind SxIP motif-containing cortical speed during mitosis [36]. Indeed, colorectal cancer cell
proteins [18, 22, 30-32]. Reconstitution experiments lines presenting chromosome instability showed high
strongly suggest that ch-TOG allosterically enhances microtubule growth speed that was dependent on the
the binding of EB1 to the microtubule +end [22]. This is activity of the TACC3-ch-TOG complex. Interestingly,
consistent with the loss of EB1 from microtubule +ends microtubule growth speed could be brought back to values
upon down regulation of ch-TOG in primary neurons, found in chromosomally stable cell lines by either down-
NIH-3T3 fibroblasts [33, 34] and our own breast cancer regulation of ch-TOG or by subnanomolar concentrations
cell model (Figure S6). Thus, the impact of eribulin of microtubule interacting agents. Therefore, microtubule
on microtubule capture might be the consequence of growth speed may be a key factor for the regulation of
indirectly disturbing EB1 localization, as a result of the microtubule capture at both chromosome kinetochores
loss of ch-TOG. These results also suggest reconsidering during cell division and cell cortex during cancer cell
the mechanism whereby low concentrations of other migration.
MTAs, that decrease EB1 comet length, affect endothelial The present study highlights that impairing
and cancer cell migration [13, 14, 35]. specifically the dynamics of the microtubule +end by
Because SLAIN1 and 2 proteins were shown to act disturbing the associated protein, ch-TOG, inhibits some
as crosslinkers between EB1 and ch-TOG and participate aspects of cancer cell migration. Thus, further discovery
to the recruitment of ch-TOG to microtubule +ends [33], and development of compounds targeting specifically
one cannot exclude their possible contribution to eribulin’s microtubule +end, and the interaction of ch-TOG with
effect. However, it was observed that, in HeLa cells tubulin, may provide treatments of advanced cancers
where endogenous SLAIN proteins are expressed at low therapeutics with improved therapeutic windows.
levels, ch-TOG was not recruited to EB1 comets, but was
distinctively detected ahead of EB1 comets; strikingly, MATERIALS AND METHODS
overexpression of SLAIN led to perfect comet-like co-
localization of ch-TOG and EB1 [20]. The localization
of ch-TOG ahead of EB1-comets in SKBr3 cells suggests Cell culture
that SLAIN proteins do not have a major impact on ch-
TOG recruitment on microtubule +ends. In addition,
downregulation of both SLAIN1 and 2 in neurons did not SKBr3, MDA-MB-231 and T47D breast cancer cell
affect microtubule growth rate; whereas downregulation lines, purchased from ATCC-LGC standards (Molsheim,
of ch-TOG induced a decrease in microtubule growth rate France), were cultured in DMEM media supplemented
in neurons [32] and in many other cellular models [32, with 10% FBS, sodium pyruvate at 37°C and in a
33, 35], including ours. Altogether these data indicate that humidified atmosphere with 5% CO2.
eribulin primarily displaces ch-TOG from microtubule
+ends.

www.impactjournals.com/oncotarget 41674 Oncotarget


Cytotoxicity assay Grenoble, France) and secondary antibodies coupled to
HRP.
Eribulin mesylate (Eisai, Research Triangle Park,
NC), paclitaxel and vinblastine (Sigma-Aldrich, St Louis,
Transfection of siRNA and cDNA
MO) were dissolved in DMSO and stored as a 5 mM
stock in glass vials at -20°C. Serial dilutions of drugs were Transfection of siRNA (30 pmoles) and cDNA
performed in 50% DMSO in glass vials and stored as 100- (3 µg) was performed by nucleofection (kit V) as
fold stock at -20°C. Wells of 96-well plates were coated recommended (Lonza, Cologne, Germany). siRNA against
with 25 µg/ml rat tail collagen I (Roche Diagnostics, EB1 (sense strand: UUAAAUACUCUUAAGGCAUTT),
Mannheim, Germany) in PBS, prior to seeding with 5000 ch-TOG (sense strand: GAAAUACUCUUAAUUCUAATT)
cells per well. Effect of the drugs on cell viability was and LacZ (control siRNA; sense strand
assessed with a sulforhodamine B assay [37] after 72 h of GCGGCUGCCGGAAUUUACCTT) were synthesized
drug exposure. The final concentration of DMSO (0.5%) by Life technologies. Efficiency and specificity of siRNA
was the same for both drug-treated and control cells. are presented in figure S3A. cDNA coding for EGFP-α-
tubulin was obtained from Clontech (Mountain View, CA);
Immunocytochemistry mCherry-α-tubulin was a gift from Gia Voeltz, University
of Colorado, Boulder (Addgene plasmid # 49149).
SKBr3 cells were seeded at 105 cells per well in a
12-well plate containing collagen-coated glass coverslips.
Quantitation of the cell population with captured
After 48 h of culture, cells were treated with drugs (or microtubules by time-lapse video microscopy
DMSO) for 4 h before addition of 1 nM of heregulin β1
(HRG; R&D Systems, Abingdon, United Kingdom) with SKBr3 cells expressing EGFP-α-tubulin were
DMSO or drug for 30 min. Cells were fixed with methanol either transfected with the indicated siRNA for 48 h, or
containing 1 mM EGTA at -20°C for 10 min, followed by pretreated with 0.5% DMSO alone or with eribulin for 4 h,
4% formaldehyde in PBS for 20 min at room temperature. before stimulation by 5 nM HRG and determination of the
In the case of ch-TOG labeling, cells were simply fixed percentage of cells showing captured microtubules over a
with methanol at -80°C for 10 min. Immunolabeling period of observation of 30 min. Detailed procedure has
was performed with antibodies against EB1 (Santa Cruz been described previously [17].
Biotechnology, Dallas, TX), CLIP-170 (Synaptic Systems,
Goettingen, Germany), α-tubulin (Sigma-Aldrich) or ch- Migration in Dunn chambers, cell tracking and
TOG (a generous gift from Dr Lynn Cassimeris, Lehigh quantitation of chemotaxis
University Bethlehem, PA) and secondary antibodies
labeled with DyeLight 405, AlexaFluor 488 or 594
(Jackson ImmunoResearch Europe, Suffolk, UK). SKBr3 cells plated on collagen-coated coverslips
Images were acquired on a structured light ApoTome™ were exposed to a HRG gradient (10 nM HRG in the
microscope (Zeiss, Münich, Germany) equipped with a outside well) in Dunn chambers. SKBr3 cells were
63x 1.4 plan ApoChromat objective and an Axiocam™ tracked for 4 to 8 h in the presence of eribulin. Detailed
MRc5 camera. procedure has been described previously [19]. Tracks
were analyzed using the Chemotaxis and Migration Tool
Western blotting of ImageJ to calculate cell migration speed, directness
and forward migration index along the axis parallel to the
gradient (yFMI). The Rayleigh test for unimodal clustering
Cells were lysed in a NP-40 based lysis buffer (50 of directions was used to test directionality in the HRG
mM Tris pH 7.5, NP-40 1%, 120 mM NaCl, 0.5 mM gradient. Distribution of directions was considered
EDTA, 1 mM DTT) supplemented with protease and uniform (random migration) for p>0.05. Definitions and
phosphatase inhibitors (Roche Diagnostics). Samples equations used to calculate these migration parameters are
were prepared as described previously [19]. Samples were presented in Supplemental Material and Methods.
run on Novex NuPAGE Bis-Tris 4-12% polyacrylamide
gels (Life technologies, Carlsbad, CA) using a MOPS Measure of microtubule dynamic parameters
based running buffer (50 mM MOPS, 50 mM Trisbase,
0.1% SDS, 1 mM EDTA, pH 7.7). Proteins were
transferred onto nitrocellulose membranes and detected by SKBr3 cells stably expressing EB1-GFP (SKBr3.
chemoluminescence using primary antibodies against EB1 EB1-GFP) were grown on collagen-coated glass bottom
(Pharmingen, BD Biosciences, San Diego, CA), α-tubulin dishes (Greiner Bio-One, Frickenhausen, Germany) for
(Sigma-Aldrich), and ch-TOG (Ecrins Therapeutics, 48 h. Medium was changed for DMEMgfp-2 (Evrogen,
Moscow, Russia) supplemented with 5 nM HRG. After

www.impactjournals.com/oncotarget 41675 Oncotarget


10 min, images of EB1-GFP comets were acquired CONFLICTS OF INTEREST
every 60 ms during 1 min, with a confocal spinning-disk
microscope (Zeiss) equipped with a 100x-oil objective and This work was supported in part by a research
a 491 nm laser with power tuned at 30%. For assessing grant from EISAI SAS. EISAI SAS was not involved in
microtubule dynamics, images were analyzed with the collection, analysis and interpretation of data.
MatLab plug-in plusTipTracker [38]. The quality of the
movies was assessed by examining comet detection and FUNDING
track linkage performance. Movies with high rate of false
positive or false negative detection were not used for This work was supported by EISAI SAS and SIRIC
tracking. The same parameters were used for all movies: (grant INCa-DGOS-Inserm 6038).
search radius range: 5 to 12 pixels; minimum track length:
4 frames; maximum gap length: 12 frames; maximum
REFERENCES
forward angle, 50°; maximum backward angle, 10°;
maximum shrinkage factor: 1.5; fluctuation radius, 1.5
1. Mukhtar E, Adhami VM and Mukhtar H. Targeting
pixels. Frame rate: 0.8 s-1 and pixel scale: 133 nanometers.
microtubules by natural agents for cancer therapy. Mol
Cancer Ther. 2014; 13:275-284.
Quantitation of +TIP localization on microtubule
2. Perez EA. Microtubule inhibitors: Differentiating tubulin-
+ends
inhibiting agents based on mechanisms of action, clinical
activity, and resistance. Mol Cancer Ther. 2009; 8:2086-
EB1 and CLIP-170 comet length was measured 2095.
using ImageJ and a line histogram plug-in (George 3. Towle MJ, Salvato KA, Budrow J, Wels BF, Kuznetsov G,
Patterson, Biophotonics Section, NIH). Each comet was Aalfs KK, Welsh S, Zheng W, Seletsky BM, Palme MH,
measured from head to tail using pixels with intensities Habgood GJ, Singer LA, Dipietro LV, Wang Y, Chen JJ,
above 15. EB1 and CLIP-170 comet density in SKBr3 was Quincy DA, et al. In vitro and in vivo anticancer activities
estimated using the spot detector function of freeware ICY of synthetic macrocyclic ketone analogues of halichondrin
(icy.bioimageanalysis.org). Background noise was reduced B. Cancer Res. 2001; 61:1013-1021.
with ImageJ and a Gaussian filter was applied over images 4. Jordan MA, Kamath K, Manna T, Okouneva T, Miller
with ICY. Spot detection was calibrated with size filtering: HP, Davis C, Littlefield BA and Wilson L. The primary
from 3 to 3000 pixels; and scale: 3-7 pixels. The EB1 and antimitotic mechanism of action of the synthetic
CLIP 170 comets detection was done over an identical halichondrin E7389 is suppression of microtubule growth.
300 µm2 region of interest in protrusions. Images were Mol Cancer Ther. 2005; 4:1086-1095.
checked for false positive and false negative detection.
5. Cortes J, O’Shaughnessy J, Loesch D, Blum JL, Vahdat LT,
The presence of ch-TOG labeling at the tip of microtubule
Petrakova K, Chollet P, Manikas A, Dieras V, Delozier T,
+ends at the periphery of SKBr3 cells was manually
Vladimirov V, Cardoso F, Koh H, Bougnoux P, Dutcus CE,
assessed on images displaying double fluorescent
Seegobin S, et al. Eribulin monotherapy versus treatment of
labelling for tubulin and ch-TOG. The percentage of ch-
physician’s choice in patients with metastatic breast cancer
TOG positive microtubules was determined on a total of
(EMBRACE): a phase 3 open-label randomised study.
50 microtubules per cell in ten cells per condition in two
Lancet. 2011; 377:914-923.
independent experiments. In an independent experiment,
the percentage of EB1 comets displaying a ch-TOG 6. Kaufman PA, Awada A, Twelves C, Yelle L, Perez EA,
labeling, irrespective of its fluorescence intensity, was Velikova G, Olivo MS, He Y, Dutcus CE and Cortes J.
determined in a 900 µm2 area in five cells per condition. Phase III open-label randomized study of eribulin mesylate
In individual experiments, exposure time for each versus capecitabine in patients with locally advanced
fluorescence channel was the same for each condition or metastatic breast cancer previously treated with an
analyzed. anthracycline and a taxane. J Clin Oncol. 2015; 33:594-601.
7. Wilks S, Puhalla S, O’Shaughnessy J, Schwartzberg
L, Berrak E, Song J, Cox D and Vahdat L. Phase 2,
ACKNOWLEDGMENTS
multicenter, single-arm study of eribulin mesylate with
trastuzumab as first-line therapy for locally recurrent or
The authors are grateful to Dr Bruce Littlefield for
metastatic HER2-positive breast cancer. Clin Breast Cancer.
insightful discussions, to Habib Bouguenina for his help
2014; 14:405-412.
with the chemotaxis assay, to Arnauld Sergé and Daniel
Isnardon (CRCM Imaging Platform) for their help with 8. Komlodi-Pasztor E, Sackett D, Wilkerson J and Fojo T.
microtubule tip-tracking and to Marie-Laure Thibult Mitosis is not a key target of microtubule agents in patient
(CRCM Flow Cytometry and Cell Sorting Platform) for tumors. Nat Rev Clin Oncol. 2011; 8:244-250.
her help with flow cytometry data acquisition. 9. Mitchison TJ. The proliferation rate paradox in antimitotic

www.impactjournals.com/oncotarget 41676 Oncotarget


chemotherapy. Mol Biol Cell. 2012; 23:1-6. between XMAP215 and EB1 increases microtubule
10. Ogden A, Rida PC, Reid MD and Aneja R. Interphase growth rates to physiological levels. Nat Cell Biol. 2013;
microtubules: chief casualties in the war on cancer? Drug 15(6):688-693.
Discov Today. 2014; 19:824-829. 23. Zhang R, Alushin GM, Brown A and Nogales E.
11. Poruchynsky MS, Komlodi-Pasztor E, Trostel S, Wilkerson Mechanistic Origin of Microtubule Dynamic Instability and
J, Regairaz M, Pommier Y, Zhang X, Kumar Maity T, Its Modulation by EB Proteins. Cell. 2015; 162:849-859.
Robey R, Burotto M, Sackett D, Guha U and Fojo AT. 24. Smith JA, Wilson L, Azarenko O, Zhu X, Lewis
Microtubule-targeting agents augment the toxicity of DNA- BM, Littlefield BA and Jordan MA. Eribulin binds at
damaging agents by disrupting intracellular trafficking of microtubule ends to a single site on tubulin to suppress
DNA repair proteins. Proc Natl Acad Sci U S A. 2015; dynamic instability. Biochemistry. 2010; 49:1331-1337.
112:1571-1576. 25. Dabydeen DA, Burnett JC, Bai R, Verdier-Pinard P,
12. Pourroy B, Honoré S, Pasquier E, Bourgarel-Rey V, Hickford SJ, Pettit GR, Blunt JW, Munro MH, Gussio R
Kruczynski A, Briand C and Braguer D. Antiangiogenic and Hamel E. Comparison of the activities of the truncated
concentrations of vinflunine increase the interphase halichondrin B analog NSC 707389 (E7389) with those
microtubule dynamics and decrease the motility of of the parent compound and a proposed binding site on
endothelial cells. Cancer Res. 2006; 66:3256-3263. tubulin. Mol Pharmacol. 2006; 70:1866-1875.
13. Honoré S, Pagano A, Gauthier G, Bourgarel-Rey V, 26. Bai R, Nguyen TL, Burnett JC, Atasoylu O, Munro
Verdier-Pinard P, Civiletti K, Kruczynski A and Braguer MH, Pettit GR, Smith AB, 3rd, Gussio R and Hamel E.
D. Antiangiogenic vinflunine affects EB1 localization and Interactions of halichondrin B and eribulin with tubulin. J
microtubule targeting to adhesion sites. Mol Cancer Ther. Chem Inf Model. 2011; 51:1393-1404.
2008; 7:2080-2089. 27. Ayaz P, Ye X, Huddleston P, Brautigam CA and Rice
14. Pagano A, Honoré S, Mohan R, Berges R, Akhmanova LM. A TOG:alphabeta-tubulin complex structure reveals
A and Braguer D. Epothilone B inhibits migration of conformation-based mechanisms for a microtubule
glioblastoma cells by inducing microtubule catastrophes polymerase. Science. 2012; 337:857-860.
and affecting EB1 accumulation at microtubule plus ends. 28. Prota AE, Bargsten K, Diaz JF, Marsh M, Cuevas C, Liniger
Biochem Pharmacol. 2012; 84:432-443. M, Neuhaus C, Andreu JM, Altmann KH and Steinmetz
15. Mimori-Kiyosue Y. Shaping microtubules into diverse MO. A new tubulin-binding site and pharmacophore for
patterns: molecular connections for setting up both ends. microtubule-destabilizing anticancer drugs. Proc Natl Acad
Cytoskeleton (Hoboken). 2011; 68:603-618. Sci U S A. 2014; 111:13817-13821.
16. Marone R, Hess D, Dankort D, Muller WJ, Hynes NE and 29. Lambert JM and Chari RV. Ado-trastuzumab Emtansine
Badache A. Memo mediates ErbB2-driven cell motility. Nat (T-DM1): an antibody-drug conjugate (ADC) for HER2-
Cell Biol. 2004; 6:515-522. positive breast cancer. J Med Chem. 2014; 57:6949-6964.
17. Zaoui K, Honoré S, Isnardon D, Braguer D and Badache 30. Watanabe T, Noritake J, Kakeno M, Matsui T, Harada
A. Memo-RhoA-mDia1 signaling controls microtubules, T, Wang S, Itoh N, Sato K, Matsuzawa K, Iwamatsu A,
the actin network, and adhesion site formation in migrating Galjart N and Kaibuchi K. Phosphorylation of CLASP2 by
cells. J Cell Biol. 2008; 183:401-408. GSK-3beta regulates its interaction with IQGAP1, EB1 and
18. Zaoui K, Benseddik K, Daou P, Salaun D and Badache A. microtubules. J Cell Sci. 2009; 122:2969-2979.
ErbB2 receptor controls microtubule capture by recruiting 31. Honnappa S, Gouveia SM, Weisbrich A, Damberger FF,
ACF7 to the plasma membrane of migrating cells. Proc Natl Bhavesh NS, Jawhari H, Grigoriev I, van Rijssel FJ, Buey
Acad Sci U S A. 2010; 107:18517-18522. RM, Lawera A, Jelesarov I, Winkler FK, Wuthrich K,
19. Benseddik K, Sen Nkwe N, Daou P, Verdier-Pinard P Akhmanova A and Steinmetz MO. An EB1-binding motif
and Badache A. ErbB2-dependent chemotaxis requires acts as a microtubule tip localization signal. Cell. 2009;
microtubule capture and stabilization coordinated by 138:366-376.
distinct signaling pathways. PLoS One. 2013; 8:e55211. 32. Wen Y, Eng CH, Schmoranzer J, Cabrera-Poch N, Morris
20. Nakamura S, Grigoriev I, Nogi T, Hamaji T, Cassimeris EJ, Chen M, Wallar BJ, Alberts AS and Gundersen GG.
L and Mimori-Kiyosue Y. Dissecting the nanoscale EB1 and APC bind to mDia to stabilize microtubules
distributions and functions of microtubule-end-binding downstream of Rho and promote cell migration. Nat Cell
proteins EB1 and ch-TOG in interphase HeLa cells. PLoS Biol. 2004; 6:820-830.
One. 2012; 7:e51442. 33. van der Vaart B, Franker MA, Kuijpers M, Hua S, Bouchet
21. Maurer SP, Cade NI, Bohner G, Gustafsson N, Boutant BP, Jiang K, Grigoriev I, Hoogenraad CC and Akhmanova
E and Surrey T. EB1 accelerates two conformational A. Microtubule plus-end tracking proteins SLAIN1/2 and
transitions important for microtubule maturation and ch-TOG promote axonal development. J Neurosci. 2012;
dynamics. Curr Biol. 2014; 24:372-384. 32:14722-14728.
22. Zanic M, Widlund PO, Hyman AA and Howard J. Synergy 34. van der Vaart B, Manatschal C, Grigoriev I, Olieric V,

www.impactjournals.com/oncotarget 41677 Oncotarget


Gouveia SM, Bjelic S, Demmers J, Vorobjev I, Hoogenraad
CC, Steinmetz MO and Akhmanova A. SLAIN2 links
microtubule plus end-tracking proteins and controls
microtubule growth in interphase. J Cell Biol. 2011;
193:1083-1099.
35. Kapoor S and Panda D. Kinetic stabilization of microtubule
dynamics by indanocine perturbs EB1 localization, induces
defects in cell polarity and inhibits migration of MDA-
MB-231 cells. Biochem Pharmacol. 2012; 83:1495-1506.
36. Ertych N, Stolz A, Stenzinger A, Weichert W, Kaulfuss
S, Burfeind P, Aigner A, Wordeman L and Bastians
H. Increased microtubule assembly rates influence
chromosomal instability in colorectal cancer cells. Nat Cell
Biol. 2014; 16:779-791.
37. Vichai V and Kirtikara K. Sulforhodamine B colorimetric
assay for cytotoxicity screening. Nat Protoc. 2006; 1:1112-
1116.
38. Applegate KT, Besson S, Matov A, Bagonis MH, Jaqaman
K and Danuser G. plusTipTracker: Quantitative image
analysis software for the measurement of microtubule
dynamics. J Struct Biol. 2011; 176:168-184.

www.impactjournals.com/oncotarget 41678 Oncotarget


Eribulin Targets a ch-TOG-dependent Directed Migration of Cancer Cells – Chanez et al

Supplemental Materials and Methods

Definition of migration parameters and statistics used in this study

Migration speed: Migration speed is the mean of the sum of all accumulated distances divided by the time
of migration (equation 1). The result is given in micrometers per minutes.

Equation 1

𝑛
1 𝑑𝑖,𝑎𝑐𝑐𝑢𝑚
Migration speed = 𝑛 ∑ t
𝑖=1

Efficiency of forward migration: Potency of each cell to migrate towards the highest concentrations within
the gradient of chemoattractant [1]. Tracks were all normalized in a x,y graph with the y axis parallel to the
heregulin gradient and oriented positively to the highest concentration of heregulin. We used the y forward
migration index (yFMI) which represents the efficiency of the forward migration of cells, in relation to the y-
axis (Equation 2).

The larger the index is on an axis, the stronger the chemotactic effect is on this axis. For simplification, it is
assumed that the y-axis is parallel to the direction of the chemotactic gradient (Scheme 1).

Equation 2

𝑛
1 𝑌𝑖,𝑒𝑛𝑑
𝑌𝐹𝑀𝐼 = 𝑛 ∑
𝑖=1 𝑑𝑖,𝑎𝑐𝑐𝑢𝑚

Directness: Ratio between Euclidean distance and accumulated distance (Scheme 1). It represents a
measurement of the distance ratio of cell trajectories (Equation 3). Directness (D) is not a direct parameter
for assessing chemotaxis but indicates how much cells wander during their migration towards their final
position after a fixed duration.

Equation 3
𝑛
1 𝑑𝑖,𝑒𝑢𝑐𝑙𝑖𝑑
D= ∑
𝑛 𝑑𝑖,𝑎𝑐𝑐𝑢𝑚
𝑖=1
Scheme 1
Rose diagram: Circular diagram in which the events (migrated cells in the present case) are represented in
sectors with a predetermined angle [2, 3]. The area of each sector is proportional to the number of cell
migrating with a final position in this sector.

Rayleigh Test: The Rayleigh test is a statistical test for the uniformity of a circular distribution of points. It
depends on the number of object analyzed and their distribution in space. When p-values is smaller than
p=0.05, the null hypothesis (uniformity) is rejected and the object have a heterogeneous distribution (due to
chemotaxis in the present case) [2, 3].

References
1. Visualization and Data Analysis of Chemotaxis and Chemotaxis and Migration Tool 2.0 in Migration
Processes ( http://ibidi.com/software/chemotaxis_and_migration_tool/ )
2. Statistical Analysis of Circular Data, Fisher NI, Cambridge University Press, 1995, 277 pp
3. Directional Statistics, Mardia KV, Jupp PE, John Wiley & Sons, 2009, 453 pp

Analysis of cell cycle by flow cytometry

SKBr3 cells were grown on collagen for 24h. The medium was replaced by fresh medium containing either
DMSO 0.5% alone or eribulin at 0.1, 0.5 or 1 nM and treatment was performed for an additional 4 h or 72 h.
At the end of treatment time, culture medium and cells were harvested and pelleted at 800 rpm at 4°C. Each
cell pellet was re-suspended in cold 70% ethanol and fixed for 30 min on ice. After centrifugation, fixative
was removed and cell pellets were air dried for 15 minutes and re-suspended in PBS. Cells were pelleted and
re-suspended in a 1:1 solution of 40 µg/mL propidium iodide (Sigma, St Louis, USA) and 40 µg/mL RNase A
(Sigma, St Louis, USA) and incubated 30 min in the dark at 37°C, then kept at 4°C until analysis. The DNA
content in each cell nucleus was determined with a LSRFortessa flow cytometer (Becton–Dickinson, San Jose,
CA, USA), and the cell cycle was analyzed using FlowJo V10 Software.
Figure S1. Effect of eribulin on breast cancer cell growth. SKBr3, MDA-MB-231 or T47D cell lines were grown
for 72 h in absence or presence of serial dilutions of eribulin, paclitaxel or vinblastine, and their survival was
measured using a sulforhodamine B assay. A) Cytotoxicity of eribulin was evaluated in SKBr3 (), T47D (),
or MDA-MB-231 () cell line. B) Cytotoxicity of eribulin (), vinblastine () or paclitaxel () was evaluated in
the SKBr3 cell line. C) Cytotoxicity of eribulin was evaluated in SKBr3.EB1-GFP cells. Percentage of cell
relative to control was determined from quadruplicate data points. The average of three independent
determinations and SD is presented.
Figure S2. Eribulin treatment of SKBr3 cells for 4 h is not cytotoxic. A) Effect of low concentrations of
eribulin after four hours of treatment on SKBr3 cell growth. Cells were treated for 4 h with DMSO only, 0.1,
0.5 or 1.0 nM eribulin and percentage of cell growth determined by a sulforhodamine B assay. The average
of three independent determinations and SD is presented. B) Cells were treated for 4 h or 72 h with DMSO
only, 0.1, 0.5 or 1.0 nM eribulin and the percentage of cells in sub G0/G1 (dashed line), G0/G1 (black), S
(white) and G2/M (grey) phase was determined based on DNA content analyzed by flow cytometry. After 4 h
of treatment, concentrations of eribulin up to 1 nM have no impact on cell growth, cell cycle or cell death of
SKBr3 cells.
Figure S3. Effect of siRNAs and eribulin treatment on +TIP expression. SKBr3 cells were cultured in the
absence or presence of eribulin at 1 nM for 4 h prior to lysis. EB1, CLIP170 and ch-TOG expression was
evaluated by Western blotting of cell lysates (30 μg/lane). Tubulin serves as loading control. A) Efficacy and
specificity of ch-TOG and EB1 siRNAs at 48h. B-C) Eribulin treatment did not alter the expression levels of
EB1, CLIP-170 and ch-TOG.
Figure S4. Eribulin inhibits HRG-induced chemotaxis. SKBr3 cells were transfected with a control (Ctrl) or an
EB1 siRNA for 48h before tracking of cells in Dunn chambers for 8 h, as they migrated in response to a HRG-
gradient (highest concentrations at the top of the figure). Upper panel: tracks of individual cells set to the
same origin; cells migrated towards high and low HRG concentrations are represented in black and grey,
respectively. Lower panel: rose plots reflecting cell distribution after 8 h of migration; p value < 0.05
indicates unimodal directional cell distribution in the Rayleigh test. NT, non-treated with eribulin. Results
from three independent experiments and at least 150 cells are presented.
Figure S5. Effects of eribulin on microtubule dynamic parameters. A) EB1-GFP comets were tracked every
60 ms for 1 min in SKBr3 cells pre-treated or not (NT) with 0.1 nM of eribulin for 4 h and resulting tracks
were analyzed using +TipTracker. Growth speed (including pauses) and growth lifetime were calculated.
17,749 and 14,691 tracks were analyzed in control and eribulin-treated cell, respectively, in 15 cells from 3
independent experiments. Four categories of tracks are created: slow long lived (green), slow short lived
(red), fast long lived (blue) and fast short lived (yellow). Left panels: representative cells with microtubule
tracks are shown. Right panels: tracks growth lifetime was plotted relative to microtubule growth speed. B)
Because growth lifetime is not changed by 0.1 nM-eribulin treatment (see Figure 4C), tracks were grouped
according to growth speed only. Percentage of slow tracks (black) and fast tracks (white) in each cells and in
all 15 cells (average) are presented. The percentage of slow growing microtubules is increased upon 0.1 nM
eribulin treatment.
Figure S6. Effect of ch-TOG siRNA on EB1 localization. SKBr3 cells were transfected with a control (Ctrl) or a
ch-TOG siRNA for 48 h before addition of HRG for 30 min. EB1, ch-TOG and tubulin localizations were
visualized by triple immunofluorescence labeling. White squares show zoomed areas in the cell periphery.
Exposure times for the different fluorescence channels were the same for all conditions analyzed. In the
presence of ch-TOG siRNA, there is a strong decrease in ch-TOG labeling, but also in the number of EB1
comets relative to control cells. White scale bar represents 10 m; cell periphery is delineated with dashed
lines.
Figure S7. Secondary structures of β-tubulin involved in the binding pockets of eribulin and maytansin. The
H11-H11’ and H3’-H3 loops involved in eribulin and maytansin binding pockets are represented in dark blue
and yellow, respectively; the S5-H5 loop involved in the binding pocket of maytansin is represented in cyan.
Note that part of the unresolved S5-H5 loop in PDB 4FFB is materialized by a dashed line with an arbitrary
conformation.
Discussion Première Partie

Nous avons identifié dans notre étude que des doses sub-nanomolaires et infra-
cytotoxiques d’éribuline entrainaient un défaut de stabilisation des MT à la membrane
plasmique et notamment au niveau du front de migration. Ce défaut de capture des MT se
traduisait au niveau fonctionnel par la perte de la migration dirigée des cellules de la lignée
cancéreuse mammaire SKBR3 dans un gradient de chemoattractant, phénomène également
observé lors de la déplétion de la +Tip EB1. Au niveau moléculaire, cette perte de capture des
MT a été expliqué par la délocalisation des +Tip EB1 et CLIP 170 de leur site habituel
d’accumulation à l’extrémité « + » des MT et cela de manière croissante avec la dose
d’éribuline utilisée. Ce déplacement d’EB1 de l’extrémité « + » des MT est rapporté dans la
littérature avec d’autre MTA (Mohan et al., 2013; Pagano et al., 2012).

Nous avons également observé que cette délocalisation des +Tip entrainait une
modification de la dynamique des MT en diminuant leur vitesse de croissance ce qui est un
des modes d’action connu de l’éribuline (Jordan et al., 2005). Nos observations ont montré un
décalage entre la perte de la migration dirigée qui était identifiable dès 0,1nM d’éribuline et
la diminution de taille des comètes EB1 et CLIP170, qui était significativement diminué dès
0,5nM. Pour expliquer ce résultat nous nous sommes intéressés à la +Tip ch-TOG, connue
pour faciliter la polymérisation de MT et qui se localise en avant d’EB1 vers l’extrémité « + »
du MT (Al-Bassam and Chang, 2011; Brouhard et al., 2008).

La déplétion de ch-TOG entrainait un défaut de capture au cortex cellulaire, de


migration dirigée et une diminution de la vitesse de croissance des MT, de plus on observait
la perte de sa localisation à l’extrémité « + » des MT après un traitement par 0,1 nM
d’éribuline, concentration pour laquelle on observait également un découplage avec
l’immunomarquage en comète d’EB1 qui persistait alors que celui de ch-TOG n’était plus
détectable. L’ensemble de ces données nous font donc penser que ch-TOG est plus sensible à
l’action de l’éribuline que EB1, et que dès un traitement à très faible doses, 0,1 nM, la perte
de ch-TOG entraine un défaut de migration dirigée expliqué par un défaut de capture des MT
au cortex cellulaire secondaire à la perturbation de leur dynamique.

Ces observations ainsi que les données de la littérature nous ont fait penser que compte
tenu de la très proche localisation, entre le site de fixation de l’éribuline à l’interface interdimère
de la b-tubuline et celui de ch-TOG (Ayaz et al., 2012; Bai et al., 1991), la fixation de l’éribuline

139
sur son site pourrait modifier la structure de la tubuline, empêchant la fixation de ch-TOG et
entraînant une diminution de la vitesse de polymérisation des MT mais également la
délocalisation des autres +Tip. EB1 ayant un site de fixation différent de ch-TOG est
secondairement affecté, notamment par la perte d’adjonction de nouveau dimère de tubuline-
GTP, habituellement apportés par ch-TOG et qui constituent de nouveaux sites d’accroche pour
EB1

Une récente étude, utilisant une molécule d’éribuline marqué à la GFP (green
fluorescente protein, Eribulin A488) dans un modèle in vitro de MT reconstitués, a confirmé
la localisation préférentielle de l’éribuline à l’extrémité « + » des MT en croissance avec une
fixation avant d’EB3, avec en moyenne une molécule par protofilament. L’éribuline utilisée
seule dans le système in vitro diminuait la vitesse de croissance du MT mais n’affectait pas
les catastrophes, cependant quand EB3 était introduit dans le système, il fallait une
concentration 5 à 10 fois moindre de drogues pour obtenir la même réduction de la vitesse de
croissance des MTs (-20%) et les catastrophes étaient largement augmentées (x2,5) (Doodhi
et al., 2016).

Dans notre étude nous n’avons pas trouvé de modification de la fréquence des
catastrophes sous l’effet de l’éribuline ce qui est probablement dû à un faible nombre de
catastrophe dans nos cellules ou qu’il existe un facteur empêchant les catastrophes qui est peu
ou pas touché par l’éribuline contrairement aux autre ACM dépolymérisant, qui eux
augmentent in vivo la fréquence de survenue des catastrophes (Pagano et al., 2012).

D’autre propriétés de l’éribuline pourraient expliquer son efficacité anti


tumorale notamment par sa capacité à inverser la TEM par inhibition de la voie du TGFb et
déphosphorylation de Smad4, observé à la fois dans les lignées de cancer du sein et dans un
modèle de xénogreffe (Yoshida et al., 2014). Des effets sur la vascularisation tumorale ont été
également observé avec une meilleure oxygénation des tumeurs traitées à l’éribuline, par
remodelage vasculaire ce qui a terme diminue l’hypoxie et rend le microenvironnement moins
favorable la dissémination métastatique et à la résistance aux traitement (Dezső et al., 2014;
Funahashi et al., 2014).

L’éribuline pourrait aussi agir effacement sur les cellules souches cancéreuses,
généralement peu accessible aux traitement et foyer de récidive tardive de la maladie
(Kurebayashi et al., 2016).

140
Enfin deux études récentes ont proposé de combiner des inhibiteur de kinase
indispensable à la survenue de la mitose, Aurora A et B, avec l’éribuline ce qui a montré un
renforcement de l’action cytotoxique et la prévention de l’apparition de métastases dans un
modèle de xénogreffe (Kozyreva et al., 2016), faisant penser que renforcer l’action anti
mitotique de l’éribuline tout en bénéficiant de ses propriétés sur les cellules en interphase
renforce la toxicité induite par l’éribuline (Tsuda et al., 2017).

Il serait intéressant également d’étudier l’action de faible doses d’éribuline sur la


migration et l’invasion de lignées cellulaire résistantes au paclitaxel et à la vinblastine et l’effet
sur la localisation des +Tip en général et ch-TOG en particulier. Ces résultats pourraient
donner des pistes concernant les mécanismes de résistance aux ACM et d’explorer si l’action
de déplacement de ch-TOG de l’extrémité « + » est propre à l’éribuline et si cette action
participe au fait que l’éribuline garde une efficacité même en cas de résistance aux autres
ACM.

Il semble intéressant aussi d’évaluer in vivo (lignées résistance aux ACM en modèle
murin, xénogreffes issues de patient ayant progressé sous ACM) la capacité de l’éribuline à
prévenir à faibles doses l’apparition de métastases dans un modèle résistant aux ACM.

A terme ces résultats pourraient conduire à des essais de chimiothérapie métronomique


en phase métastatique ou laisser une place à l’éribuline plus précocement dans la prise en
charge de patientes ayant des facteurs mauvais pronostic avec un risque métastatique accru.

141
DEUXIEME PARTIE : Les protéines régulant la
dynamique des microtubules modifient la capacité
des cellules du cancer du sein à dégrader la matrice
via les invadopodes

142
Introduction Deuxième Partie

Les invadopodes sont des protrusions membranaires riches en actine, généralement


situées à la face ventrale des cellules tumorales et dotées d’une activité protéolytique. Ces
structures sont actuellement perçues comme un outil cellulaire dédié à la dégradation focalisée
de la matrice et sont observables dans de nombreuses lignées tumorales humaines et murines
mais également lors de l’expression de l’oncogène v-Src dans des fibroblastes (Chen et al.,
1985).
Les invadopodes présentent de nombreuses similitudes avec les podosomes,
structures apparentées dans leur constitution et leur mode de régulation, présents dans les
cellules dérivées des monocytes et spécialisées dans le remodelage matriciel (Murphy and
Courtneidge, 2011).

L’intérêt pour les invadopodes est croissant depuis quelques années car, alors que
leur étude a longtemps été limitée à des modèles in vitro, assez loin de la réalité physiologique,
ils ont récemment été visualisés par microcopie intravitale lors des processus d’intravasation
et d’extravasation des cellules tumorales, étapes clés de la cascade métastatique (Gligorijevic
et al., 2014; Leong et al., 2014).

En réponse à des stimuli d’origine variée, plusieurs étapes vont se succéder pour la
mise en place des invadopodes, incluant l’adhésion à la matrice par le biais d’intégrines, le
remodelage de l’actine sous-corticale et sa polymérisation perpendiculaire à la membrane
plasmique au niveau des zones sous nucléaires généralement car ce sont des zones de faible
tension. La maturation des invadopodes, étape clé marquée par le recrutement de
métalloprotéases dont la plus abondante est MT1-MMP, va permettre la dégradation du
substrat entourant la cellule (lame basale, matrice extracellulaire, paroi vasculaire) (Castro-
Castro et al., 2016).

La régulation de ces étapes implique à la fois des protéines remodelant l’actine dont
la principale est la cortactine, des protéines d’échafaudage comme TKS5, des kinases comme
Src ou Arg, des Rho GTPases comme Rac1, RhoC, Cdc42 et des molécules de signalisation
comme Mena (Eddy et al., 2017).

Ces étapes engagent de très nombreuses protéines impliquées dans le remodelage


du réseau d’actine dont les interactions réciproques sont connues. Le rôle potentiel des MT et

143
des protéines associées aux MT reste mal connu et les données sont parfois contradictoires.
(Kikuchi and Takahashi, 2008; Morimura and Takahashi, 2011; Quintavalle et al., 2011;
Schoumacher et al., 2010)

Un certain nombre d’études rapportent l’implication de +TIP, mais essentiellement


dans les podosomes. Ainsi EB1 serait nécessaire à la mise en place de la ceinture podosomale
dans les ostéoclastes (Duplan et al., 2014). EB1 est localisée en périphérie des podosomes dès
le stade de regroupement des podosomes, avant l’établissement de la ceinture podosomale.
Cette étude suggère que l’interaction entre EB1 et la cortactine, régulée par sa phosphorylation
via les kinases Src et son acétylation contrôlée par le système aTAT1/HDAC6, serait
indispensable à l’adressage des MT dans les podosomes (Duplan et al., 2014).

La colocalisation d’EB1 avec la cortactine au niveau des podosomes a également


été rapportée dans les cellules endothéliales lors de l’activation d’une voie de signalisation
impliquant RhoA-IQGAP1-EB1-cortactine. Cette signalisation permettrait la régulation de la
perméabilité vasculaire par modulation de la dynamique des MT et de l’interaction MT-actine
(Tian et al., 2014).

La cortactine ne possédant pas de motif SxIP, l’interaction avec EB1 est


probablement indirecte et pourrait impliquer d’autres +TIP telles que TIP150 ou P140CAP,
qui sont des partenaires connus de la cortactine dans les neurones (Adams et al., 2016;
Jaworski et al., 2009), ou CBP90 (Jiang et al., 2012) . Pourtant EB1 et la cortactine n’ont
jamais été rapportés comme collocalisés dans les invadopodes.
D’autres +TIP ont été décrites comme des éléments régulateurs des podosomes,
notamment les kinésines. Il a été montré que l’extrémité + des MT entrait directement en
contact avec les podosomes (Bhuwania et al., 2014; Kopp et al., 2006). De nombreuses
kinésines ont été impliquées dans la mise en place et la régulation de la dynamique des
podosomes (Bhuwania et al., 2014; Cornfine et al., 2011; Kopp et al., 2006; Wiesner et al.,
2010). Les MT enrichis en KIF1C à leur extrémité entreraient en contact direct avec les
podosomes favorisant leur stabilisation par une possible liaison avec l’actine (Kopp et al.,
2006). Par ailleurs, dans les cellules musculaires lisses associées aux vaisseaux, KIF1C
fonctionne de pair avec CLASP1 dans la formation des podosomes, mais également leur
remodelage et leur localisation membranaire (Efimova et al., 2014).
Enfin, il a été montré que la régulation du trafic de vésicules transportant MT1-
MMP le long des MT et son expression à la surface cellulaire étaient dépendantes des

144
kinésines KIF5B et KIF3A/KIF3B. En absence de ces kinésines, les macrophages perdent
leurs capacités à dégrader les matrices artificielles (Wiesner et al., 2010).
Ces données posent les bases d’un rationnel fort pour étudier le rôle des +TIP dans
la régulation de l’assemblage et de la maturation des invadopodes.

145
Résultats Deuxième Partie
Contribution des régulateurs de la dynamique des MT à la dégradation de la
matrice extracellulaire par des cellules de carcinome mammaire.

Nous avons étudié la contribution de protéines, connues pour être impliquées dans
la régulation de la dynamique des MT, lors du processus d’invasion de la matrice, médié par
les invadopodes. Pour cela, nous avons mis à profit les propriétés invasives de la lignée MDA-
MB-231, dérivée d’une tumeur du sein triple-négative. Ces cellules, lorsqu’elles sont déposées
sur une matrice de gélatine, forment des invadopodes situés sur leur partie ventrale et
produisant des protéases capables de dégrader cette matrice artificielle.

Nous avons ciblé avec des ARN interférents (ARNi) spécifiques l'expression de la
protéine EB1, véritable noyau central dans le réseau d’interaction des +TIP, et de certains de
ses partenaires, qui avaient précédemment été impliqués dans la migration cellulaire : APC,
ACF7, CLASP1, CLASP2 et la protéine IQGAP1. Les trois dernières ayant déjà impliqués
dans la formation des invadosomes (Bouchet et al., 2016; Efimova et al., 2014; Zhu et al.,
2016).

Après transfection avec l’ARNi d’intérêt, les cellules MDA-MB-231 ont été
déposées sur une lamelle recouverte de gélatine fluorescente pendant 4 heures, puis les
cellules ont été fixées et immunomarquées pour être observées en microscopie à fluorescence
(Figure 24A). Nous avons pu ainsi quantifier le pourcentage de cellules associées à des zones
de dégradation, repérées par la présence de trous noirs dans la gélatine fluorescente, et l’aire
totale dégradée par cellule.

Nous avons observé que 25% des cellules contrôles (siLacZ) dégradaient la matrice,
ce qui correspond aux données rapportées précédemment pour ce type cellulaire (Rajadurai et
al., 2016) (Figure 24B). Les zones de dégradation apparaissaient dans la gélatine comme des
lacunes ponctiformes sous le corps cellulaire, majoritairement sous le noyau.

La perte d’IQGAP1 était associée à une diminution de la surface de gélatine


dégradée par les cellules, par rapport aux cellules contrôle mais également à une diminution
significative du nombre de cellules ayant la capacité de dégrader la matrice (Figure 24A-C).
Ces résultats confirment les données de précédentes études impliquant IQGAP1 comme un
acteur important dans la capacité de dégradation matricielle des cellules cancéreuses en
régulant l’accumulation membranaire de MT1-MMP (Sakurai-Yageta et al., 2008). De façon
surprenante, l’extinction des protéines EB1, APC ou ACF7 entrainait une nette augmentation

146
de l’aire dégradée par cellule (Figure 24C), sans pour autant modifier le pourcentage de
cellules ayant la capacité de dégrader la matrice, qui restait de l’ordre de 20-25% (Figure
24B). L’effet le plus important était obtenu avec la déplétion d’EB1 et d'APC qui entrainait
une augmentation de 2 à 2,6 fois de la surface totale dégradée par cellule (Figure 24A et C).
La spécificité de l’effet observé a été confirmée grâce à l’utilisation d’un second ARN
interférent ciblant EB1 et APC (Figure24 B-C).

En revanche, l’extinction des protéines CLIP170, CLASP1 et CLASP2 n’avait


aucun effet sur l’aire dégradée par les cellules tumorales, ni sur le pourcentage de cellules
dégradant la matrice bien que les ARN interférents ciblant ces protéines étaient efficaces
(Figure 24 D).

Lors de l’extinction d’EB1, APC ou ACF7, les zones de dégradation étaient situées
sous le corps cellulaire, sous le noyau mais également en périphérie de la cellule, avec parfois
des zones dégradées en dehors de la cellule suggérant un déplacement de la cellule. La
déplétion d’EB1 entrainait particulièrement la dispersion périphérique des zones dégradées
(Figure 24A, 25B).

Ces résultats montrent que les +TIP EB1, APC et ACF7 ont une action répressive
sur la capacité de dégradation des cellules de cancer du sein, au contraire des protéines
impliquée dans la jonction entre les MT et l’actine corticale: IQGAP1 et mDia favorisent
quant à elles la dégradation de la matrice (Lizarraga et al., 2009; Sakurai-Yageta et al., 2008)

Le fait que les protéines EB1, APC et ACF7 répriment l’activité protéolytique des
cellules cancéreuses mammaires permet d’imaginer une signalisation impliquant ces trois
acteurs, de manière similaire à celle qui a été démontrée dans le contexte de la migration des
cellules de cancer du sein.

147
Figure 24: Impact des +TIP sur la capacité des cellules de cancer du sein à dégrader la matrice
extracellulaire.

(A) L'expression de EB1, APC, ACF7, CLASP1, CLASP2, CLIP170 et IQGAP1 dans des cellules MDA-MB-
231 a été inhibée grâce à des ARN interférents spécifiques ; les cellules ont été placées sur gélatine couplée au
fluorochrome Alexa-488 pendant 4h, puis fixées et immunomarquées par la cortactine (bleu-DyLight 405)
comme marqueur des invadopodes. (B) Le pourcentage de cellules associées à une zone de dégradation est
représenté par la médiane ± SEM, provenant de 3 expériences indépendantes, 200 cellules choisies aléatoirement
par expérience par condition ont été analysées (statistiques : t-test non apparié avec correction de Welch). (C)

148
La surface totale de gélatine dégradée par cellule (en µm2) est représentée par la médiane ± SEM, provenant de
3 expériences indépendantes. Pour chaque expérience, 25 cellules ont été quantifiées par condition (statistiques
: test de Mann-Whitney). (D) L’efficacité des ARN interférents spécifiques de chacune des protéines d'intérêt a
été contrôlé par Western blot en utilisant des anticorps spécifiques. *p<0,05, **p<0,001, ***p<0,0001, ns: non
significatif. Barre d’échelle = 10µm

EB1, APC et ACF7 répriment la formation des invadopodes dans les lignées
invasives mammaires.

Nous avons observé qu’EB1, APC et ACF7 réprimaient la dégradation de la


matrice par les cellules MDA-MB-231. Cette dégradation était médiée par l’activation de
métalloprotéases comme le montre la suppression de toute dégradation lors du traitement des
cellules avec l’inhibiteur de métalloprotéases, GM6001 (Figure2A)

Le mécanisme sous-jacent pourrait concerner soit la limitation de la capacité


protéolytique des invadopodes (par exemple une diminution de l’activité des
métalloprotéases), soit la régulation de la formation des invadopodes. Il est admis que
l’assemblage des invadopodes se fait selon un processus dynamique (Beaty and Condeelis,
2014).

La co-localisation entre la cortactine et TKS5 est un événement précoce survenant


pendant la phase d’assemblage des précurseurs des invadopodes ; la co-localisation entre la
cortactine, TKS5 et une zone de gélatine dégradée signe la présence d’un invadopode mature
capable de dégrader la matrice grâce au recrutement de métalloprotéases. Afin d’analyser
l’impact de la déplétion de EB1, APC et ACF7 sur la formation des invadopodes, nous avons
réalisé un marquage de la cortactine et de la protéine d’échafaudage TKS5 par
immunofluorescence, sur des cellules déplétées pour chacune des trois +TIP (Figure25 B).

Nous avons ensuite quantifié le nombre d’invadopodes précurseurs et


d’invadopodes matures et le nombre total de foci de dégradation par cellule en fonction de la
présence ou non des protéines EB1, APC et ACF7 (Figure25C-F). Les cellules n’exprimant
plus EB1 présentaient une augmentation, d’environ deux fois du nombre d’invadopodes
mature et du nombre d’invadopodes précurseur (Figure25 E-F).

Cette augmentation du nombre d’invadopodes était corrélée à une augmentation du


nombre total de foci de dégradation (Figure25 C). Il est à noter que l’aire moyenne de chacun
des foci de dégradation n’était pas affectée (Figure25 D). De façon similaire aux résultats
obtenus pour EB1, les cellules MDA-MB-231 n'exprimant plus ACF7 ou APC présentaient 2

149
fois plus d’invadopodes précurseurs et 1,5 fois plus d’invadopodes matures que les cellules
contrôles, confirmant également que l’augmentation de dégradation observée était secondaire
à une augmentation de la densité d’invadopodes par cellule (Figure25 C, E et F).

L’augmentation de l’activité de dégradation des cellules peut être la conséquence


d’un nombre plus important d’invadopodes assemblés à un temps donné, mais peut être
également due à un cycle de vie des invadopodes accéléré ou encore à un défaut de
désassemblage, sans altération de l’assemblage des invadopodes (Goicoechea et al., 2017;
Moshfegh et al., 2015). Nous avons donc analysé l’impact d’EB1 et d’APC sur la durée de
vie des invadopodes. Pour cela nous avons exprimé le peptide LifeAct, marqueur de l’actine
filamenteuse, fusionné à la protéine fluorescente mRFPruby, dans les cellules MDA-MB-231.
Nous avons déposé ces cellules sur de la gélatine fluorescente et suivi en temps réel
l’apparition et la durée de vie de foci d’actine au niveau de zones de dégradation de la gélatine,
correspondant aux invadopodes. Nos observations indiquent que la durée de vie moyenne des
invadopodes est diminuée dans les cellules n’exprimant pas EB1 ou APC, par rapport aux
cellules contrôles (Figure25 F). L’augmentation de l’activité de dégradation des cellules
associées à l’extinction de ces protéines n’est donc pas dûe à une durée de vie plus longue des
invadopodes mais plutôt à un nombre plus important d’invadopodes formés et à un cycle
assemblage-désassemblage plus rapide.

Nous pouvons donc conclure qu’EB1, APC et ACF7 contrôlent le nombre


d’invadopodes assemblés dans les cellules tumorales mammaires limitant leur formation et
activité.

150
Figure 25 : Les cellules MDA-MB-231 déplétées de EB1, APC ou ACF7 (par des ARNi
éteignant spécifiquement l’expression de ces protéines) présentent une forte augmentation du nombre
d’invadopodes matures
(A)Les cellules MDA-MB-231 transfectées par un ARN interférent contrôle (siLacZ) ou des ARN
interférents dirigés contre EB1 (siEB1_1 et siEB1_2) ont été traitées avec un inhibiteur des métalloprotéases, le
GM6001, pendant les 4 heures du test de dégradation et leur capacité à dégrader la gélatine fluorescente a été
analysée par immunofluorescence. Le marquage cortactine (bleu) permet ici de visualiser la forme des cellules.
(B) Les même cellules transfectées par un ARN interférent contrôle ou spécifiques de EB1, APC (siAPC_1 et
APC_2) ou ACF7 (siACF7) ont été ensemencées sur des lamelles recouvertes de gélatine fluorescente. Après 4
heures, les cellules ont été fixées puis marquées pour les marqueurs des invadopodes: cortactine et TKS5. Le
nombre total de foci de dégradation dans la zone péricellulaire (C), l’aire moyenne des foci de dégradation (D),
le nombre d’invadopodes précurseurs, identifiés par la co-localisation de la cortactine et de TKS5 sans
dégradation sous-jacente (E) et d’invadopodes matures, identifiés par une co-localisation de la cortactine et de
TKS5 avec un focus de dégradation (F) ont été quantifiés et sont représentés sous forme de graphes

151
correspondant à la médiane ± SEM. Pour chaque condition 25 cellules ont été analysées par expérience dans 3
expériences indépendantes. (G) Impact d’EB1 et APC sur la dynamique des invadopodes. Des cellules MDA-
MB-231 exprimant le marqueur d’actine polymérisée LifeAct-RFPruby ont été déplétées d’EB1 ou APC par des
ARN interférents spécifiques. La formation des invadopodes (points de LifeAct au contact d’une zone de
dégradation) a été suivie par vidéomicroscopie (mode TIRF, film de 2heures, 1 image/90secondes). La durée de
vie moyenne d’un invadopode est représentée par la médiane ± SEM. 9 cellules ont été analysées dans chaque
condition, >50 invadopodes/condition. * p<0,05, **p<0,001, ***p<0,0001, ns : non significatif. Barre d’échelle
= 10µm (barre échelle zoom = 5µm)

Pour conforter nos observations, nous avons testé la contribution d’EB1 dans la
capacité de dégradation d’une autre lignée cellulaire mammaire, la lignée MCF10A. Les
MCF10A sont des cellules non transformées, non invasives et qui ne dégradent donc pas ou
très peu la gélatine lorsqu’elles y sont déposées (Figure 26A). Pour favoriser leur capacité
invasive, nous avons induit la TEM par traitement au TGF-b pendant 6 jours, comme
précédemment décrit (Pignatelli et al., 2012). Les cellules MCF10A ayant subi le processus
de TEM ont la capacité de former des invadopodes et de dégrader la matrice (Figure 26A).
La déplétion d’EB1 dans les cellules MCF10A ayant subi le processus de TEM
récapitulait les résultats obtenus dans les cellules MDA-MB-231 (Figure 26B-C). En effet,
nous avons observé une augmentation significative de l’aire totale dégradée par cellule et du
nombre d’invadopodes matures (Figure 26C). Ces observations démontrent que
l’augmentation de l’activité de dégradation des cellules déplétées d'EB1 est la conséquence
d’un nombre plus important d’invadopodes assemblés.

Les ACM ne modifient pas la capacité des cellules de cancer du sein à former
des invadopodes matures et à dégrader la matrice.

EB1, APC ou ACF7 ayant été précédemment impliqués dans l’instabilité


dynamique des MT, nous avons analysé l’effet d’ACM sur la formation des invadopodes. En
effet, l’interaction directe des ACM avec la tubuline leur permet d’altérer profondément la
fonction des MT et, suivant les concentrations utilisées, de perturber globalement leur
organisation ou plus spécifiquement leur dynamique sans modifier l’aspect global du réseau
(Figure 27A).

Dans un premier temps, nous avons traité nos cellules MDA-MB-231 avec de fortes
doses d’ACM nous avons quantifié les paramètres de dégradation de la gélatine en présence
de MT incapables d’assurer leurs rôles intracellulaires. Nous avons utilisé le paclitaxel un
ACM stabilisant les MT et induisant la formation de faisceaux de MT et le nocodazole, un

152
ACM dépolymérisant les MT (Figure 27A). Après 4 heures de traitement des cellules avec
du paclitaxel à 1µM ou du nocodazole à 10 µM, nous n’avons observé aucune modification
significative que ce soit de la surface totale de gélatine dégradée ou du nombre de foci de
dégradation par cellule (Figure 27C-E). Les invadopodes des cellules traitées par ACM
apparaissaient morphologiquement semblables à ceux des cellules contrôles, traitées par du
DMSO. En effet, la cortactine et TKS5 co-localisaient aux foci de dégradation (Figure 27C),
de plus l’aire d’un foci de dégradation était similaire à celle retrouvé dans les cellules non
traitées (données non présentées)

153
Figure 26 : Les cellules MCF10A transformées au TGF-b et déplétées de EB1 présentent des capacités de
dégradation de la matrice accrues.
(A) Les cellules MCF10A traitées ou non avec du TGF-b pendant 6 jours ont été ensemencées sur des lamelles recouvertes
de gélatine fluorescente pendant 4heures, puis fixées et marquées par immunofluorescence pour la cortactine (bleu) et TKS5
(rouge). (B) Les cellules MCF10A ont été transfectées avec un ARNi contrôle (siLacZ) ou dirigé contre EB1 (siEB1_1)
puis traitées avec du TGF-b pendant 6 jours. La capacité de ces cellules à dégrader la gélatine et à former des invadopodes
a ensuite été analysée par immunofluorescence comme décrit dans (A). (C) Le pourcentage de cellules dégradant, la surface
totale dégradée, le nombre de foci de dégradation et d’invadopodes matures par cellule ont été quantifiés comme décrit en
Figure 1. (D) Les niveaux d’expression de EB1 ont été analysés par Western blot. La b-tubuline sert de contrôle de charge.
Barre d’échelle = 10µm, (barre échelle zoom = 5µm

154
Le fait que la physiologie globale de ces cellules soit probablement très perturbée par les fortes
doses d'ACM rendait difficile l’interprétation de ces résultats.

Comme je l’ai démontré dans la première partie de cette thèse, les agents ciblant les
MT utilisés à faibles doses ne détruisent pas le réseau de MT (Figure 27A), mais perturbent
spécifiquement leurs propriétés dynamiques, déplaçant notamment les +TIP des MT (Chanez
et al., 2015; Mohan et al., 2013; Pagano et al., 2012).

Nous avons donc cherché à déterminer l’impact de faibles doses de paclitaxel ou de


vinblastine, un agent dépolymérisant les MT, sur la capacité des cellules à former des
invadopodes. De manière similaire à ce que nous avions fait lors de notre étude utilisant
l’éribuline, nous avons choisi d’utiliser une dose de 1 nM, qui se situe au niveau ou en deçà
de la concentration cytotoxique à 72h de traitement (Figure 27B). Le traitement par 1nM de
paclitaxel ou de vinblastine pendant 4 heures n’altérait pas le réseau de MT des cellules MDA-
MB-231 (Figure 27A). Nous avons observé que la surface totale dégradée par cellule n’était
pas différente entre les deux types de traitement, relativement au contrôle traité au DMSO
(Figure 27F). Le nombre de foci de dégradation par cellule n’était pas modifié non plus
(Figure 27F).

En résumé, la perturbation du réseau dans son ensemble ou plus finement de la


dynamique des MT ne permet pas de mettre en évidence les mêmes effets promoteurs de
l’assemblage des invadopodes que ceux observés par extinction d’EB1, APC ou ACF7.

155
Figure 27 : Les agents ciblant les MT ne modifient pas la capacité des cellules de cancer du sein à former
des invadopodes et à dégrader la matrice.
(A) Images représentatives de cellules MDA-MB-231 ensemencées sur de la gélatine fluorescente (verte) et
traitées par des fortes doses de paclitaxel (1µM) ou de nocodazole (10µM) ou des faibles doses de paclitaxel (1nM)
ou de vinblastine (1nM) pendant 4 heures. Le réseau de MT a été marqué grâce à un anticorps dirigé contre la
tubuline (bleu) puis observé au microscope à fluorescence. (B) représente la courbe dose-réponse qui indique un
IC50 (index de cytotoxicité pour 50% des cellules) de 1,16 nM pour le paclitaxel [IC 95% : 1-1,35] et de 2,06 nM
pour la vinblastine [IC95%:1,8-3,7], après 72h de traitement des cellules MDA-MB-231. Les cellules MDA-MB-
231 traitées par de fortes (C) ou de faibles (B) doses des ACM décrits en (A) ont été déposées sur gélatine pour
un test de dégradation de 4 heures puis immunomarquées pour la cortactine ou la tubuline (bleu) et TKS5 (rouge).
(E-F) L’aire totale dégradée et le nombre de foci de dégradation par cellule ont été quantifiés et sont représentés
sous forme de graphes indiquant la médiane ± SEM de 25 cellules par expérience dans trois expériences
indépendantes. ns : non significatif.

156
Le domaine CAP-Gly et l’extrémité C-terminale flexible d’EB1 ne sont pas nécessaires
à EB1 pour inhiber la formation des invadopodes

La protéine EB1 présente un rôle central dans le réseau des protéines interagissant
avec l’extrémité « + » des MT. EB1 est une petite protéine dimérique de 268 résidus qui
possède dans sa région N-terminale un domaine CH (calponin homology) d’interaction avec
la tubuline alors que sa région C-terminale présente un domaine coiled coil suivi d’une
organisation en superhélice de 4 hélices-a, nécessaire à sa dimérisation et présentant un
domaine EBH (EB homology). La dimérisation d’EB1 permet aux deux domaines EBH de
former une véritable plateforme d’interaction avec les +TIP possédant un motif SxIP. La
protéine se termine par une extrémité C-terminale flexible composée de résidus acides,
importante pour des phénomènes d’auto-inhibition, mais comprenant également un motif
EEY qui permet l’interaction d’EB1 avec les +TIP possédant un motif CAP-Gly.

Pour identifier les domaines d’interaction de EB1 requis pour l’inhibition de la


formation des invadopodes, nous avons établi par insertion de codons stop deux protéines EB1
tronquées, l’une du motif EEY (EB1(1-265)) ; et l’autre d’une portion plus importante du C-
terminal mais épargnant le domaine de dimérisation (EB1(1-248)) (Figure 28A) ; des données
indiquent que cette délétion abroge l’interaction avec les protéines à motif SxIP, notamment
APC (Honnappa, 2009).

Ces protéines tronquées ainsi que EB1 sauvage étaient exprimées sous la forme de
protéines de fusion avec la protéine fluorescente mCherry. Nous avons exprimé ces différentes
formes d'EB1 dans les cellules MDA-MB-231 contrôles (siLacZ) ou déplétées d’EB1
endogène par l’ARN interférent siEB1_2 (qui cible une région non-codante de l’ARNm
codant pour EB1, et donc pas EB1 exprimée de manière ectopique). Puis nous avons réalisé
des tests de dégradation de la gélatine. Nous avons vérifié que la localisation d’EB1 sauvage
fusionnée à la mCherry était similaire à celle d’EB1 endogène, soit une colocalisation le long
du marquage des MT, avec une accumulation à l’extrémité « + » des MT sous sa forme
typique de comètes (Figure 28B).

La surexpression d’EB1 dans les MDA-MB-231 ne modifiait pas les paramètres de


dégradation de la gélatine (Figure 28B-C). La ré-expression d’EB1 sauvage à des niveaux
comparables à son expression endogène dans des cellules déplétées d'EB1 permettait de
revenir à une aire dégradée et un nombre de foci de dégradation similaire à ceux observés dans
les cellules contrôles (Figure 28B-C et F).

157
L’expression des protéines tronquées EB1(1-265) et EB1(1-248) dans les MDA-
MB-231 déplétées d’EB1 donnait un résultat similaire à l’expression de la protéine EB1
sauvage (Figure 28D-E). L’expression de EB1(1-265) ou EB1(1-248) induisait un
rétablissement du nombre de foci et de l’aire dégradée identiques à celui quantifié pour des
cellules contrôles. Nous avons vérifié que les protéines tronquées étaient localisées le long
des MT de manière similaire à EB1 sauvage (Figure5D). Ces observations suggèrent que
l’action d’EB1 sur les invadopodes n’implique pas les interactions par le motif EEY, ni par la
région la plus C-terminale du domaine EBH.

Figure 28 : Le motif EEY et la partie C-terminale du domaine EBH de EB1 ne sont pas nécessaires à EB1
pour inhiber la formation des invadopodes

(A) Représentation schématique de l’organisation en domaines de EB1 et des protéines EB1


tronquées du motif EEY (EB1(1-265)) et la partie C-terminale de l’EBH (EB1(1-248)). (A-D) Les plasmides
codant pour la mCherry ou EB1-mCherry sauvage (B, C) ou mutées (D, E) ont été transfectés dans les cellules
MDA-MB-231 contrôles (siLacZ) ou déplétées de EB1 endogène par un ARN interférent spécifique (siEB1_2).
Les cellules ont été ensemencées sur de la gélatine fluorescente pendant 4h, fixées et immunomarquées pour la
cortactine (bleu) et la mCherry (rouge). Des images représentatives sont montrées (B, D). L’aire totale dégradée
et le nombre de foci par cellule ont été quantifiés (C, E). (F) Les niveaux d’expression des protéines de fusion et
de EB1 endogène ont été détectés sur des lysats cellulaires totaux par Western blot en utilisant un anticorps dirigé
contre EB1. La détection de l’a-tubuline sert de contrôle de charge. Toutes les expériences sont représentées par
la médiane des valeurs ± SEM, sur 25 cellules par expérience dans 3 expériences indépendantes. ***p<0,0001.
Barre d’échelle = 10µm

158
159
Discussion Deuxième Partie

Pour étudier le rôle des MT dans l’établissement et le fonctionnement des


invadopodes, nous avons choisi une approche moléculaire, plutôt que d’utiliser des drogues
non dénuées d’effets non spécifiques. Nous avons évalué l’impact de l’inactivation, via des
ARNi spécifiques, d’EB1 et de certains de ses partenaires : APC, ACF7, CLASP1, CLASP2
et IQGAP1. Ces protéines ont été impliquées précédemment dans la régulation des MT, de
leur capture au cortex cellulaire et de la migration cellulaire (Zaoui et al., 2010a).

Nous avons ainsi pu mettre en évidence plusieurs groupes fonctionnels : les


protéines favorisant l’activité protéolytique, les protéines neutres et les protéines réprimant
l’activité protéolytique des cellules invasives mammaires.

L’inhibition d’EB1 amplifiait considérablement la surface de matrice dégradée à


la fois dans les cellules MDA-MB-231 et dans les cellules MCF10A ayant subi une TEM sous
l’effet du TGF-b. Cette augmentation est la conséquence de l’augmentation du nombre
d’invadopodes précurseurs et du nombre d’invadopodes matures. La déplétion d’APC ou
d’ACF7 donne des résultats similaires. Ces +TIP agiraient donc comme des régulateurs
négatifs de la formation des invadopodes.

A noter que nous n’avons pas observé d’augmentation du pourcentage de cellules


capables de dégrader la matrice, suggérant que la perte de ces +TIP amplifierait le phénomène
de dégradation matricielle en cours mais ne serait pas en soit capable seul de l’initier.

En revanche, la déplétion des protéines CLASP1, CLASP2 et CLIP 170 n’avait pas
d’impact sur la capacité des cellules à dégrader la matrice extracellulaire, ni sur le pourcentage
de cellules capable de dégrader la matrice, dans notre système.

La protéine IQGAP1 a un rôle important dans la coordination entre le cytosquelette


d’actine et les MT dans la migration cellulaire et les phénomènes d’exocytose (Noordstra and
Akhmanova, 2017). De plus, c’est un partenaire d’EB1 (Cao et al., 2015). Nos observations
ont confirmé les résultats précédents qui rapportaient la déplétion d’IQGAP1 inhibait
clairement la capacité des cellules à dégrader la matrice (Branch et al., 2012; Petropoulos et
al., 2016; Sakurai-Yageta et al., 2008) en entrainant une diminution importante à la fois du
nombre d’invadopodes et du pourcentage de cellule capable de former des invadopodes.

160
EB1 est surexprimé dans divers types de cancers, dont le cancer du sein, et semble
posséder un rôle pro-tumoral (Dong et al., 2010; Stypula-Cyrus et al., 2014). La
caractérisation d’EB1 comme un régulateur négatif des invadopodes peut paraître surprenant.
Cependant le mécanisme potentiel pro-oncogénique d’EB1 dans l’invasion des cellules
tumorales n’est pas clairement établit.

Une étude a rapporté que l’inhibition d’EB1 dans les cellules MDA-MB-231, le
même modèle cellulaire que celui que nous avons utilisé, ne modifiait pas le nombre de
cellules capable d’envahir la matrice reconstituée (en chambre de Boyden), en réponse à
l’IGF-1 (Morimura and Takahashi, 2011). Nos résultats préliminaires (non montrés)
semblaient confirmer ces observations.

Le rôle d’EB1 a été également étudié dans les cellules MDCK (Madin Darby
Canine Kidney cells) organisées en cystes et polarisées lorsqu’elles étaient incluses dans une
matrice de collagène I reposant sur une couche de matrigel. Sous l’effet d’une stimulation à
l’HGF (hépatocyte growth factor), les cystes se désorganisent et les cellules émettent de
longues protrusions invasives : les pseudopodes. Dans cette étude la déplétion d’EB1
conduisait à des pseudopodes plus courts et plus ramifiés avec des cycles de protrusion-
rétraction et des changements de direction plus fréquents, donc semblant moins stables. Les
auteurs impliquaient EB1, et les MT plus généralement, dans le contrôle des propriétés
mécano-transductrices des AF via la phosphorylation de la myosine-II et le trafic vésiculaire.
Cependant, il n’a pas étudié si, dans ce modèle, la dégradation de la matrice extracellulaire
était un préalable nécessaire à l’extension des protrusions et si ces protrusions exprimaient des
marqueurs d’invadopodes. Nous ne savons donc pas si ces pseudopodes peuvent être assimilés
à des invadopodes ou non (Gierke and Wittmann, 2012).

Une seconde étude a rapporté un rôle similaire pour les +TIP SLAIN2, chTOG et
CLASP1 (des partenaires directs ou indirects d’EB1), mais pas CLASP2, dans l’élongation
de pseudopodes émis par des cellules invasives de diverses origines (cellules tumorales
mammaires, fibrosarcomes, cellules transformées par TEM). L’inhibition de SLAIN2 ne
semblant pas avoir d’effet sur la protéolyse du collagène, les auteurs proposaient que les MT
favorisaient la formation des protrusions en exerçant une force de pression sur la membrane
plasmique. Il est à noter que le rôle d’EB1 n’a pas été directement étudié dans ce système
(Bouchet et al., 2016).

161
Nous avons observé que la déplétion d’EB1 pouvait avoir un impact négatif sur la
migration cellulaire, paramètre qui a lui seul pourrait entrainer un retentissement indirect sur
l’invasion dans le cas d’un modèle 3D où les phénomènes d’invasion et de migration sont
largement entremêlés (données non présentées et Chanez et al., 2015).

EB1 est une protéine centrale dans le réseau de +TIP, qui interagit avec de
nombreux partenaires. Nous avons montré que ses partenaires pouvaient avoir des effets
antagonistes sur la capacité de dégradation matricielle et l’impact final d’EB1 sur les
invadopodes dépendra donc de l’équilibre entre ces différents régulateurs positifs et négatifs,
dans chaque modèle cellulaire.

En tenant compte des actions similaires et synergiques observées pour les protéines
EB1, APC, ACF7, CLASP1 et 2 dans le processus de migration dirigée des cellules tumorales
mammaires (Wen et al., 2004; Zaoui et al., 2010), il est intéressant de noter que dans les
invadopodes seuls EB1, ACP et ACF7 semblent impliqués dans les phénomènes de
dégradation de la matrice médiés par les invadopodes dans nos cellules. Les protéines APC et
ACF7 ont un rôle majeur dans la capture des MT à la fois au niveau des AF, mais aussi au
cortex cellulaire lors de la migration dirigée des cellules tumorales mammaires (Stehbens and
Wittmann, 2012; Zaoui et al., 2008).

Nous avons observé que, lors de l’inhibition d’APC ou d’ACF7, le nombre


d’invadopodes précurseurs et matures, et l’aire totale dégradée étaient significativement
augmentés, comme lors de l’inhibition EB1. Ces résultats concordants sont particulièrement
intéressants car ils suggèrent la possibilité qu’APC, ACF7 et EB1 forment un complexe
régulant négativement la formation des invadopodes. Cependant cette régulation pourrait
survenir de manière indirecte, puisque nous n’avons pas réussi jusqu’à présent à visualiser
EB1 au niveau des invadopodes par immunofluorescence (données non présentées).

Les comètes d’EB1 étant une structure particulièrement dynamique et les


invadopodes une structure de taille limitée, la présence d’EB1 serait de toute façon un
évènement rare, difficile à visualiser. Alternativement, il serait intéressant d’étudier une
possible localisation d’APC et d’ACF7 dans les invadopodes, par immunofluorescence ou
expression des protéines de fusion fluorescentes.

A notre connaissance, aucune étude n’avait encore montré l’implication des +TIP EB1,
APC et ACF7 dans la régulation du cycle de vie des invadopodes dans des cellules tumorales.

162
Il serait intéressant de reproduire nos résultats dans d’autres lignées tumorales invasives,
comme nous l’avons déjà fait pour EB1 dans la lignée MCF10A, en présence de TGFb. Notre
modèle expérimental « en 2D » peut être assimilé aux premières étapes du processus invasif,
lorsque la cellule tumorale doit traverser la membrane basale. Il serait donc d’un grand intérêt
d’étudier le rôle du complexe EB1-APC-ACF7 dans la formation des protrusions
protéolytiques mises en place par les cellules invasives de cancer du sein dans un modèle « en
3D », plus proche de la migration interstitielle. Ce modèle donnerait également accès à
d’autres paramètres dynamiques, notamment le nombre de protrusions et l’élongation des
protrusions (dans le système 2D l’épaisseur de la matrice extracellulaire est restreinte à 1-2
µm (Artym et al., 2009). Cette analyse serait importante puisque plusieurs études suggèrent
que les MT seraient principalement impliquées dans les phases d’élongation, pour des
invadopodes de plusieurs microns de long (Kikuchi and Takahashi, 2008; Schoumacher et al.,
2010).

En effet, Kikuchi et Takahaschi ont montré que le paclitaxel inhibait la mise en


place de longues protrusions protéolytiques contenant des MT dans les cellules MDA-MB-
231 (Kikuchi and Takahashi, 2008). Plus récemment, Schoumacher et coll. ont confirmé que
l’inhibition des MT par traitement des cellules avec du nocodazole ne modifiait pas la
proportion de cellules capables de dégrader la matrice, ni à former des courtes protrusions
mais diminuait spécifiquement la formation des longues protrusions, contenant des MT
majoritairement détyrosinés, donc stables (Schoumacher et al., 2010).

De manière similaire aux deux études précédemment citées, nous n’avons pas
identifié de différences significatives dans la capacité des cellules à dégrader une matrice
plane qu’elles aient été traitées par des ACM stabilisant comme le paclitaxel ou
dépolymérisant comme le nocodazole ou la vinblastine, à des doses micro-molaires,
désassemblant le réseau de MT ou nano-molaires, affectant seulement la dynamique des MT.
Ceci est en accord avec l’hypothèse que les MT ne semblent impliqués que dans la phase
d’élongation des invadopodes, qui n’apparait pas dans le modèle utilisé dans notre étude.
Certaines études ont cependant rapporté une augmentation du nombre d’invadopodes et de la
dégradation matricielle dans un large panel de lignées tumorales invasives, suite à un
traitement avec du paclitaxel Quintavalle et al., 2011; Ren et al., 2015; Volk-Draper et al.,
2014; Wang et al., 2009). Il est à noter que dans ces études, contrairement aux précédentes
études citées et à notre étude, les temps de traitement étaient longs permettant la mise en place

163
de programmes génétiques spécifiques, fort probablement indépendant de l’effet direct des
ACM sur les MT (Quintavalle et al., 2011; Ren et al., 2015; Volk-Draper et al., 2014; Wang
et al., 2009).

S’il n’est pas complétement clair pourquoi les ACM ont des effets différents par
rapport à l’inactivation des +TIP, on peut supposer que les ACM, même à faibles doses,
impactent assez largement de multiples processus cellulaires empêchant d’observer des effets
subtils obtenus avec une extinction très ciblée par ARNi. L’utilisation de l’eribuline, très
spécifique de l’extrémité + et à des doses sub-nanomolaires pourrait permettre d’observer un
phénotype de dégradation/assemblage des invadopodes différent.

D’autres protéines régulant négativement la formation des invadopodes ont été


décrites telles que RhoG, la laminine 332, l’ezrin et FAK au cours des dix dernières années,
agissant selon deux modes différents : la régulation de la phase de désassemblage d’une part
et le contrôle du recrutement de Src depuis les AF vers les invadopodes d’autre part (Chan et
al., 2009; Goicoechea et al., 2017; Hoskin et al., 2015; Liu et al., 2010). Il est intéressant de
noter que même si l’extinction de ces protéines conduit à une augmentation de la capacité des
cellules à dégrader la matrice, ceci n’est généralement pas corrélé à une augmentation des
propriétés invasives des cellules, suggérant qu’un excès de dégradation n’est pas
nécessairement favorable à une invasion efficace (Chan et al., 2009; Goicoechea et al., 2017;
Hoskin et al., 2015; Liu et al., 2010).

RhoG est nécessaire au désassemblage des invadopodes (induits par le phorbol


ester) dans plusieurs types cellulaires, via le contrôle de la phosphorylation de la paxilline qui
est nécessaire au désassemblage de la protrusion, et impliquerait également la calpaïne
(Badowski et al., 2008) Il faut cependant noter que RhoG peut au contraire avoir une fonction
pro-invadopodes dans les cellules de glioblastome (Kwiatkowska et al., 2012). De façon
similaire Rac1 favorise le désassemblage des invadopodes dans les cellules cancéreuses
mammaires murines MTLn3 (Moshfegh et al., 2014), mais a été également décrit, par
Goicoechea et coll., comme nécessaire à la formation des invadopodes dans la lignée de cancer
mammaire humain SUM149 (Goicoechea et al., 2017) (figure 21).
Nos résultats d’analyse de la durée de vie des invadopodes observés en temps réel
indiquent que, en l’absence d’EB1 ou APC, les invadopodes ont une durée de vie plus courte,
en contradiction avec un rôle de ces protéines dans la phase de désassemblage. Il faudrait
néanmoins compléter ces données en explorant le rôle d’ACF7 dans la dynamique des

164
invadopodes et confirmer ces données dans une autre lignée avec éventuellement un marqueur
plus spécifique des invadopodes comme la cortactine qui permettrait d’analyser plus
précisément la cinétique du cycle assemblage/déassemblage.

La kinase FAK, quant à elle, restreindrait la formation des invadopodes par un


mécanisme différent, en séquestrant une large fraction de la population de Src au niveau des
AF. En l’absence de FAK, cette population de Src serait relocalisée aux invadopodes,
conduisant à un niveau de phosphorylation (et donc d’activation) renforcé des acteurs
impliqués dans la formation des invadopodes (Chan et al., 2009). Ces données pourraient
permettre d’expliquer nos résultats. En effet, le complexe APC-ACF7, mais également le
complexe CLASP2 et EB1, participent à la stabilisation des MT au niveau des AF, favorisant
leur turnover nécessaire à la migration cellulaire (Gierke and Wittmann, 2012; Juanes et al.,
2017; Matsumoto et al., 2010; Wu et al., 2008) Il est donc envisageable que l’augmentation
de dégradation aux invadopodes, obtenue suite à la déplétion des protéines EB1, APC et
ACF7, soit une conséquence de la dérégulation des AF.

Notre hypothèse est que l’absence d’EB1, APC ou ACF7 entrainerait un défaut de
la dynamique des AF, ce qui inhiberait la rétention de Src par FAK au niveau des AF,
permettant la relocalisation et l’activation de Src aux invadopodes, favorisant leur
développement et leur maturation.

Nos résultats préliminaires indiquent que, dans des cellules déplétées d’EB1 ou
d’APC, les niveaux de phosphorylation de FAK sur la tyrosine 397, synonyme de son
activation, étaient fortement diminués (données non présentée). Il sera important de confirmer
cette observation, analyser précisément l’impact de l’inactivation d’EB1, APC ou ACF7 sur
la dynamique des AF, l’activation de FAK et la distribution de Src au niveau des AF et des
invadopodes. Il faudra aussi observer les adhésions focales en utilisant des marqueurs typiques
tels que la vinculine ou la taline et en quantifier la taille, le nombre et la localisation. Les
données de Gierke and Wittmann rapportaient qu’en système 3D, la déplétion d’EB1
impactait largement la taille des adhésions focales.

Cette hypothèse propose donc que EB1, APC et ACF7 affecteraient la formation
des invadopodes indirectement, par leur rôle dans le contrôle des AF. Un bémol à ce modèle
est que, bien que CLASP2 ait été impliqué dans la régulation des AF, il ne régule pas la
formation des invadopodes. Il sera donc nécessaire de vérifier l’impact de CLASP2 sur la

165
dynamique des AF dans notre modèle, et aussi d’analyser les possibles redondances de
fonction entre CLASP1 et CLASP2.

Les invadopodes sont matures lorsqu’ils sont capables de dégrader la matrice de


manière MT1-MMP dépendante. Le recrutement et l’activation de MT1-MMP sont en grande
partie assurés par le transport endosomal lui-même régulé par l’actine, ses protéines associées
(WASH, IQGAP1), les complexes d’exocytose mais également impliquant les MT et les
protéines motrices (kinésines et dynéines) associées (Castro-Castro et al., 2016; Marchesin et
al., 2015; Monteiro et al., 2013; Rossé et al., 2014). Cependant le cycle de MT1-MMP semble
débuter par une phase d’endocytose de la protéase déjà à la membrane puis d’exocytose et de
regroupement aux invadopodes (Hoshino et al., 2012).

L’acétylation des MT semble aussi contrôler la dégradation matricielle dépendante


de MT1-MMP. L’hyperacétylation des MT par surexpression d’aTAT1 ou inhibition de
HDAC6 inhibait la dégradation matricielle cellulaire (Rey et al., 2011) quand la déplétion
d’aTAT1 était associée à un pourcentage de cellule dégradant et une aire de matrice dégradée
très augmentée. Le mécanisme moléculaire sous-jacent impliquait un contrôle de la dispersion
de vésicules contenant MT1-MMP. Cette dernière étude n’a pas identifié si le nombre
d’invadopodes précurseurs et matures étaient augmentés (Castro-Castro et al., 2012).
Dans nos données, les zones dégradées lors de la déplétion des +TIP semblaient
plus étendues sur l’ensemble de la cellule (données non quantifiées). Nos données
préliminaires indiquent aussi que la déplétion d’EB1 entraîne une diminution de la tubuline
acétylée dans les cellules MDA-MB-231 et MCF10A+TGF-b ce qui suggère que EB1
inhiberait l’ancrage de MT1-MMP aux invadopodes via l’inhibition de l’acétylation des MT.
Cette dernière hypothèse n’expliquant néanmoins pas l’augmentation du nombre
d’invadopode précurseurs mais on pourrait supposer que les protéines EB1, APC et ACF7
seraient requises pour réguler la délivrance des endosomes contenant MT1-MMP de manière
focalisée à l’invadopode.

En résumé, nos travaux ont permis d’identifier de nouveaux régulateurs négatifs


des invadopodes : EB1, APC et ACF7. Il sera important d’en déchiffrer le mode d’action
moléculaire, en déterminant notamment si l’effet est direct ou s’il dépend de leur rôle dans la
régulation des AF, mais aussi d’en mesurer l’impact dans des modèles d’invasion tumorale.

166
Figure 29- Possible rôle d’EB1, APC
et ACF7 dans la régulation des
invadopodes et de la dégradation
matricielle : un modèle
(A) Les cellules invasives déposées au
contact d’une matrice forment deux
types de structures adhésives : des
adhésions focales (AF) et des
invadopodes, qui utilisent des
molécules de signalisation communes,
telle que Src. Les +TIP EB1, APC et
ACF7 favorisent le ciblage des MT
vers les AF qui contribue au turnover
de ces dernières. Elles pourraient
également contribuer à l’acétylation
(médiée par aTAT1) des MT et à
l’adressage des vésicules de MT1-
MMP aux invadopodes. (B) Lorsque
l’expression d’EB1, APC ou ACF7 est
inhibée, la perte du complexe de
ciblage des MT entrainerait une baisse
de la dynamique des AF et une
diminution de phospho-FAK (par un
mécanisme non identifié), ce qui
permettrait la redistribution de Src
depuis les AF vers les invadopodes,
entrainant une majoration du nombre
d’invadopodes. Par ailleurs, la perte du
complexe de ciblage pourrait également entrainer une dérégulation de l’adressage et la dispersion des vésicules
transportant MT1-MMP, favorisant la maturation d’invadopodes supplémentaires.

La présence de protéines +TIP au niveau des invadopode semble nécessaire à la


régulation de leur assemblage et de leurs fonctions protéolytiques. L’immense majorité des
protéines connues des invadopodes appartiennent à la signalisation cellulaire comme les Rho
GTPase ou à la régulation du remodelage de l’actine, composant majoritaire des protrusions.
Identifier de nouveaux acteurs au sein de invadopodes régulant potentiellement des systèmes
peu ou pas connus aux invadopodes est nécessaire pour augmenter notre connaissance de ces
structures favorisant les métastases.

167
TROISIEME PARTIE : Etude des protéines
composant les invadopodes par une technique de
protéomique globale

168
Introduction Troisième Partie

Les invadopodes constituent une machinerie spécialisée requise pour le


déplacement des cellules tumorales invasives à travers les membranes basales et la matrice
interstitielle, et représentent donc une structure essentielle du processus métastatique. Malgré
de grandes avancées dans les techniques d’étude appliquées à ces structures, leur composition
moléculaire globale est peu décrite, l’isolation des invadopodes restant un réel défi.
Nous avons donc décidé de développer une approche innovante basée sur la
biotinylation de proximité qui permet d’identifier les partenaires d’une protéine d’intérêt in
situ, avant lyse de la cellule pour étudier la composition moléculaire globale des invadopodes.
Plus spécifiquement, nous avons utilisé la technique BioID (Roux et al., 2012) Cette technique
repose sur l’établissement de lignées cellulaires exprimant la protéine d’intérêt fusionnée à
une forme mutée de la biotine ligase BirA (BirA*).
BirA, est une enzyme bactérienne, capable de fixer de manière covalente une
molécule de biotine sur les lysines des chaines aliphatiques des protéines. La protéine BirA
mutée (BirA*) a été développée pour permettre la biotinylation uniquement des protéines se
trouvant dans un environnement proche de l’enzyme, dans un rayon de l’ordre d’une dizaine
de nanomètres et non de manière diffuse (Roux et al., 2012). En présence de biotine, BirA*
fusionnée à la protéine d’intérêt induit la biotinylation in situ des protéines qui se trouvent
dans son environnement proche. Les protéines biotinylées sont ensuite précipitées grâce à
l’utilisation de billes couplées à l’avidine ou à la streptavidine et identifiées par spectrométrie
de masse.
Pour développer cette approche dans le but de déterminer la composition
moléculaire globale des invadopodes, nous avons considéré que la protéine TKS5 serait un
bon outil.
En effet, TKS5 est spécifiquement retrouvée au niveau des invadopodes/podosomes
et est absente des autres types de protrusions, comme les lamellipodes ou les filopodes, mais
aussi des sites d’adhésions focales, contrairement à l’actine ou la cortactine qui, bien que
jouant un rôle fondamental dans l’établissement des invadopodes, ont également un rôle très
important dans les autres types de protrusions. De plus, TKS5 est indispensable à la mise en
place des invadopodes (Sharma et al., 2013).

169
Résultats Troisième Partie
La protéine de fusion TKS5-BirA* est fonctionnelle et localise au niveau des
invadopodes.

Afin de mettre en place le modèle cellulaire nécessaire à la biotinylation de


proximité, nous avons construit des plasmides permettant l’expression de TKS5a (=TKS5)
ou TKS5a délétée de son domaine PX (=DPX-TKS5) fusionnées à la biotine ligase BirA*. La
forme DPX-TKS5, correspond d’un point de vue séquence à l’isoforme TKS5b/short
incapable de lier les lipides membranaires et ne localisant pas aux invadopodes, et nous servira
de contrôle (Figure 30A). Ces deux constructions plasmidiques ainsi que le plasmide codant
pour BirA* seule ont été exprimés de manière stable dans les cellules MDA-MB-231. Toutes
ces protéines contiennent également l’étiquette HA en C-Terminal de l’enzyme BirA*
permettant de détecter spécifiquement les constructions avec un anticorps anti-HA. Le niveau
d’expression des différentes protéines de fusion analysé par Western blot avec l’anticorps anti-
HA était similaire dans les différentes lignées cellulaires (Figure 30C).

Afin de valider nos modèles cellulaires, nous avons réalisé des tests de dégradation
avec les cellules exprimant les protéines d’intérêt fusionnées à BirA*. La protéine BirA* seule
avait une localisation cytoplasmique diffuse et ne se localisait pas aux invadopodes matures ;
de plus l’expression de BirA* ne modifiait pas les caractéristiques de dégradation des cellules
(Figure30 B et D-E).

En revanche, les expériences d’immunofluorescence montraient que TKS5-BirA*


était fortement concentrée aux foci de dégradation et co-localisait avec la cortactine aux
invadopodes (Figure 30B). La détection de DPX-TKS5-BirA* indiquait une localisation
cytoplasmique de la protéine de fusion : DPX-TKS5-BirA* ne se retrouvait pas aux foci de
dégradation, ni ne co-localisait avec les spots de cortactine aux invadopodes matures (Figure
30B). Par ailleurs, nous avons observé dans le cas des cellules exprimant TKS5-BirA* une
augmentation très importante du pourcentage de cellules capables de dégrader la gélatine,
ainsi qu’une augmentation d’un facteur 2,5 de la surface dégradée par cellule (Figure 30D-
E). Ce résultat est en accord avec les études montrant que la surexpression de TKS5 est un
facteur favorisant la formation d’invadopodes (Seals 2005). Au contraire, l’expression de la
protéine délétée du domaine PX n’avait pas d’effet sur l’aire de dégradation par cellule,
maisentrainait une diminution du pourcentage de cellules associées à de la dégradation
(Figure 30D-E).

170
Figure 30 La protéine de fusion TKS5-BirA* est localisée et fonctionnelle aux invadopodes.
(A) Représentation schématique des protéines de fusion de TKS5 avec la biotine ligase BirA* ; les domaines
fonctionnels de TKS5 : PX, SH3 et PxxP sont indiqués. Toutes les protéines de fusion possèdent l’étiquette HA
au niveau C-terminal. (B) Les cellules de la lignée MDA-MB-231 exprimant de manière stable les protéines de
fusion TKS5-BirA*, DPX-TKS5-BirA*ou BirA* ont été déposées sur de la gélatine fluorescente pour un test de
dégradation de 4 heures, fixées et marquées par un anticorps anti-HA et anti-cortactine comme marqueur des
invadopodes. (C) L’expression des protéines TKS5-BirA*, ΔPX-TKS5-BirA* ou BirA* dans les cellules MDA-
MB-231 a été analysée par western blot en utilisant l’anticorps anti-HA ; l’a-tubuline servait de contrôle de
charge. Le pourcentage de cellules associées à des zones de dégradation (D) et l’aire de gélatine dégradée par

171
cellule (E) ont été quantifiées et sont représentés par la médiane ± SEM. 50 cellules ont été analysées dans deux
expériences indépendantes. *** = p≤0.0001

La biotinylation sélective de protéines des invadopodes est détectable dans les


cellules exprimant TKS5-BirA*.

Nous avons réalisé un test de dégradation avec les cellules exprimant de manière
stable TKS5-BirA* ou DPX-TKS5-BirA*, en les laissant sur la gélatine pendant 16h dans un
milieu contenant de la biotine dans le but d’analyser la localisation des protéines biotinylées
par les différentes protéines de fusion. Après 16h, les cellules ont été fixées et marquées avec
un anticorps dirigé contre la cortactine, comme marqueur des invadopodes, et avec la
streptavidine (protéine ayant une affinité forte pour la biotine) couplée au fluorophore Alexa
Fluor® 594 pour localiser les protéines biotinylées (Figure 31A). Nous avons observé que les
protéines biotinylées s’accumulaient aux invadopodes matures (répérés par la co-localisation
de la cortactine et des points noirs de dégradation) seulement dans les cellules exprimant
TKS5-BirA*. Pour les cellules exprimant BirA* (résultats non montrés) ou DPX-TKS5-
BirA*, les protéines biotinylées avaient une localisation cytoplasmique. Ces observations
montraient que TKS5-BirA* biotinylait plus spécifiquement les protéines associées aux
invadopodes.

Nous avons ensuite voulu vérifier si TKS5-BirA* était capable de biotinyler des
protéines connues comme partenaires de TKS5 ; ces protéines sont aussi connues comme
ayant une implication majeure dans la formation des invadosomes. Pour ceci les cellules
exprimant TKS5-BirA*, DPX-TKS5-BirA* et BirA* ensemencées sur gélatine ont été traitées
avec la biotine pendant 16h, pour permettre la biotinylation des proches voisins par BirA*.
Les cellules ont ensuite été lysées et les protéines biotinylées isolées par la technique de
purification d’affinité grâce à des billes couplées à l’avidine (pulldown). Nous avons ensuite
vérifié que les protéines candidates faisaient partie des protéines biotinylées par Western blot
en utilisant des anticorps spécifiques.

Comme contrôles, nous avons analysé la biotinylation des protéines par BirA*
seule, qui représente « le bruit de fond », c’est à dire la biotinylation non spécifique par BirA*
libre, et la biotinylation par DPX-TKS5-BirA*, c’est à dire les protéines proches de TKS5
dans le cytoplasme. Et nous avons également vérifié que les niveaux d’expression des
protéines candidates étaient bien équivalents dans les trois lignées cellulaires (lysats
cellulaires totaux).

172
Nos résultats montraient que la cortactine était biotinylée en quantité similaire par
TKS5-BirA* et DPX-TKS5-BirA*, alors qu’elle n’était pas biotinylée par BirA* seule ; ceci
indique que la cortactine est proche de TKS5 à la fois au niveau des invadopodes et dans le
cytoplasme et que la proximité de TKS5 et de la cortactine n'est pas dépendante de la présence
du domaine PX (Figure 31B). NCK et N-WASP, toutes deux des protéines de la machinerie
de polymérisation de l’actine, connues comme interagissant avec TKS5 et impliquées dans la
formation des invadopodes (Oikawa T, JCB, 2008, Stylli SS, JCS 2009), étaient biotinylées
seulement par TKS5-BirA* (Figure 31B). Quant à la protéine Grb2, partenaire de TKS5 et
composant spécifiquedes rosettes des cellules transformées par Src mais pas des invadopodes
de cellules cancéreuses (Oikawa T, JCB, 2008, Oser M, Eur J Cell Biol 2011), cette protéine
n’était biotinylée ni par DPX-TKS5-BirA*, ni pas TKS5-BirA*

Ces résultats montrent que notre modèle permet d’identifier les proches voisins de
TKS5 avec une spécificité de localisation. En effet la variation de biotinylation des protéines
par TKS5-BirA* et DPX-TKS5-BirA* montre que les protéines spécifiquement biotinylées
par TKS5 se situe au cœur de l’invadopode, lorsque TKS5 est fixé dans la membrane par son
domaine PX.

173
Figure 31: TKS5-BirA* biotinyle sélectivement les protéines des invadopodes.

Les cellules MDA-MB-231 exprimant stablement TKS5-BirA*, ΔPX-TKS5-BirA* ou BirA* ont été placées
sur de la gélatine fluorescente en présence de biotine pendant 16 heures. (A) Les cellules ont été fixées et
marquées avec un anticorps dirigé contre la cortactine comme marqueur des invadopodes et avec la streptavidine
couplée au fluorochrome Alexa Fluor® 594 pour révéler les protéines biotinylées. (B) Après lyse cellulaire, les
protéines biotinylées ont été isolées en utilisant des billes couplées à l’avidine. La présence de partenaires connus
de TKS5 et de protéines majeures des invadopodes dans le pulldown a été analysée par western blot. LCT : lysat
cellulaire total.

Identification des protéines voisines de TKS5 dans les invadopodes

Nous avons montré que notre modèle cellulaire permettait d’identifier des protéines
précédemment associées à TKS5. Nous avons ensuite mis en place une recherche
systématique des protéines associées à TKS5 dans les invadopodes, par identification des
protéines biotinylées par TKS5-BirA*, mais également DPX-TKS5-BirA* et BirA*, par
analyse en spectrométrie de masse.

Tout d’abord, nous avons analysé la biotinylation globale induite par les différentes
protéines de fusion. Nous avons détecté les protéines biotinylées, par Western blot en utilisant

174
la streptavidine couplée à la HRP, dans les lysats protéiques totaux et dans des pulldowns
réalisés avec les billes couplées à l’avidine. Tks5-BirA* et DPX-TKS5-BirA* induisaient la
biotinylation de nombreuses protéines, alors que peu de protéines biotinylées étaient
observées dans les cellules non-transfectées ou exprimant seulement BirA* (Figure 32A).

Cependant, la révélation de l’ensemble des protéines précipitées, par une coloration


au nitrate d’argent, montrait la présence d’un nombre important de protéines dans tous les
échantillons, y compris les échantillons issus des cellules contrôles, non transfectées ou
n’exprimant que BirA* (Figure 32B). Ceci indique qu’une quantité non négligeable de
protéines se fixent de façon aspécifique aux billes couplées à l’avidine.

Nos résultats d’analyse par spectrométrie de masse des protéines précipitées


confirment cette observation. Nous avons réalisé deux expériences de biotinylation de
proximité à grande échelle qui ont été analysées par spectrométrie de masse. Près de 500
protéines ont été identifiées dans les échantillons issus de la précipitation d’extraits issus de
cellules exprimant TKS5-BirA* et DPX-TKS5-BirA*, comme de celles exprimant BirA* seul,
indiquant que l’immense majorité représentait des protéiques associées aux billes d’avidine
non spécifiquement (Figure 32C).

Nous avons recherché les protéines présentes uniquement dans les échantillons
issus des cellules exprimant TKS5-BirA* et DPX-TKS5-BirA* (Figure 32C). Nous avons
identifié dix protéines biotinylées à la fois par TKS5-BirA* et par DPX-TKS5-BirA*; nous
avons également identifié huit protéines biotinylées spécifiquement par TKS5-BirA* et quatre
protéines biotinylées seulement par DPX-TKS5-BirA* (Figure 32C et 32D).

Parmi les protéines identifiées, nous avons retrouvé un partenaire connu de TKS5,
la Cortactine. Aucune des autres protéines identifiées n’était connue précédemment pour
interagir avec TKS5. Mais certaines d’entre elles ont été montrées comme étant présentes ou
impliquées dans la formation des invadosomes ; c'est le cas de de FGD1, de DNMBP (connu
aussi sous le nom de Tuba), de la Paxilline et de la Synaptojanin-2 (Genot E, JCell Sci 2015 ;
Juin et al, JCB 2015, Petropoulos JCB 2016, Ben Chetrit Sci Signal 2015) (Figure32D). Nous
avons ensuite cherché à confirmer l’identification de ces nouveaux partenaires potentiels de
TKS5 par analyse par Western blot utilisant des anticorps spécifiques, après précipitation des
protéines biotinylées. Nous avons ainsi confirmé que FGD1 était spécifiquement biotinylée
par TKS5-BirA* (Figure 32E).

175
En revanche DNMBP/Tuba est biotinylée à bas niveau et est également biotinylée
dans les cellules contrôles n’exprimant que BirA*. DNMBP/Tuba semble donc être un faux-
positif (Figure32 E). Enfin parmi les protéines biotinylées seulement par TKS5-BirA* et qui
n'avaient jamais été impliquées dans le fonctionnement des invadopodes, nous avons pu
confirmer que RTN4/Nogo-B, CD2AP et MAP4 (Figure 32D) étaient spécifiquement
biotinylées par Tks5-BirA*, confirmant que ces protéines sont associées à TKS5 lorsque celle-
ci est localisée aux invadopodes (Figure 32E).

Toutes ces protéines possèdent des domaines riches en Proline et/ou des domaines
SH3. La présence de ces domaines protéiques pourrait permettre des interactions protéines-
protéines au sein de l’invadopode avec les domaines SH3 de TKS5.

176
Figure 32: Identification systématique des protéines biotinylées par TKS5 dans les invadopodes.
Les cellules MDA-MB-231 non transfectées (NT) ou exprimant de manière stable les protéines de fusion BirA*,
TKS5-BirA* ou ΔPX-TKS5-BirA* ont été déposées sur gélatine en présence de biotine pendant 16 heures. (A)
La présence de protéines biotinylées a été analysée sur les lysats cellulaires totaux (LCT) ou après précipitation
d'affinité (pulldown) par Western blot en utilisant la streptavidine-HRP. # correspond à des protéines biotinylées
spontanément, même en absence de BirA*. (B) Analyse de l’ensemble des protéines précipitées par coloration
au nitrate d’argent du PAGE. (C) Les protéines isolées par précipitation grâce aux billes d’avidine ont été
analysées par spectrométrie de masse. Le tableau indique le nombre moyen de protéines identifiées, le nombre
de protéines spécifiquement biotinylées par TKS5-BirA* ou par ΔPX-TKS5-BirA* ou les deux. Deux
expériences de pulldown indépendantes ont été réalisées et seules les protéines biotinylées dans les deux
expériences ont été retenues. (D) Liste des protéines biotinylées par TKS5-BirA* et/ou ΔPX-TKS5-BirA*. Les
protéines qui ont été précédemment impliquées dans la formation des invadopodes sont notées en rouge. (E)
Validation par Western blot à l’aide des anticorps spécifiques indiquées de certaines protéines identifiées par
spectrométrie de masse.

177
Discussion Troisième Partie

Notre objectif, dans cette troisième partie, était de développer une approche
permettant de caractériser de manière systématique les composants protéiques des
invadopodes. Pour cela, nous avons développé une approche globale de protéomique basée
sur la technique de biotinylation de proximité BioID (Roux et al., 2012).

TKS5 étant un composant spécifique et constant des invadopodes et nécessaire à


leur formation, nous avons développé des lignées cellulaires MDA-MB-231 exprimant TKS5
ou une forme mutante de TKS5 ne localisant pas aux invadopodes (DPX-TKS5) fusionnées à
BirA*. L’utilisation de ces modèles cellulaires nous a permis d’identifier, par une approche
globale (non candidate), des acteurs connus pour être impliqués dans la formation des
invadopodes, tels que FGD1, la cortactine, démontrant la pertinence de l’approche utilisée,
mais également de potentiels nouveaux composants ou régulateurs des invadopodes tels que
RTN4, MAP4 ou CD2AP.

Nous avons choisi TKS5 comme appât pour tenter d’identifier la composition
moléculaire des invadopodes du fait de sa localisation spécifique aux invadopodes et son
absence des autres protrusions ou systèmes associés aux intégrines. De plus, TKS5 est un
constituant permanent des invadopodes. En effet, il est requis pour l’initiation des
invadopodes précurseurs et réside aux invadopodes jusqu’à leur désassemblage nous
permettant de pouvoir adresser la composition globale des invadopodes de la phase
d’initiation à la phase de désassemblage dans sa globalité (Beaty and Condeelis, 2014).
Cependant, la technique BioID ne nous permet pas d’explorer la composition des invadopodes
à chacune des phases de leur cycle de vie (initiation, maturation, désassemblage), comme
discuté plus loin.

L’utilisation de TKS5 délété de son domaine PX, correspondant au variant


d’épissage TKS5β, incapable de se lier aux lipides membranaires, nous a permis de distinguer
les partenaires de TKS5 lorsque celle-ci est aux invadopodes (protéines spécifiquement
isolées par affinité avec TKS5-BirA*), des partenaires de TKS5 ne nécessitant pas sa
localisation aux invadopodes (protéines isolées par affinité avec TKS5-BirA* et DPX-TKS5-
BirA*).

Il faut noter que le domaine PX étant également un domaine d’interaction protéique,


la délétion de ce domaine induira non seulement une délocalisation des invadopodes, mais un

178
défaut d’interaction avec des protéines dont l’association avec TKS5 requière le domaine PX.
Pour distinguer entre les deux, nous pourrions utiliser un mutant ponctuel du domaine PX de
TKS5 qui inhibe spécifiquement son interaction avec les phospholipides membranaires,
comme le mutant TKS5 R42A R93A (Oikawa et al., 2008).

Notre stratégie nous a permis d’identifier des protéines connues pour être
impliquées dans la formation des invadopodes, tel que la cortactine, la paxilline et FGD1, ce
qui démontre que notre approche est pertinente. De plus, ces résultats suggèrent que FGD1
pourrait être un interacteur direct de TKS5, ce qui jusqu’à ce jour n’a pas été montré et
mériterait d’être approfondi. La cortactine et la paxilline sont biotinylées par TKS5 et ΔPX-
TKS5 suggérant que leur interaction avec TKS5 serait préalable à leur recrutement aux
invadopodes (Petropoulos et al., 2016). La cortactine et TKS5 sont des acteurs précoces du
cycle des invadopodes (Sharma et al., 2013), leur co-localisation définit l’invadopode
précoce. Leur interaction directe est fortement suspectée mais n’a à ce jour pas été clairement
validée (Crimaldi et al., 2009; Stylli et al., 2009).

Il est à noter que des interacteurs connus de TKS5 impliqués dans la formation des
invadopodes, tels que N-WASP et Nck, n’ont pas été identifiés par l’approche globale
d’identification des protéines biotinylées par spectrométrie de masse. Cependant, ces deux
protéines ont bien été identifiées parmi les protéines biotinylées par TKS5-BirA* par Western
blot.

Une explication possible est que lors de leur interaction avec TKS5, leur
orientation n’est pas favorable à leur biotinylation par BirA* et/ou qu’une population infime
de ces protéines interagit avec TKS5 et donc qu’elle soit présente au-dessous de la limite de
détection lors de l’analyse par spectrométrie de masse. Les limites de détection par l’analyse
en spectrométrie de masse sont, à notre avis, principalement associé au fait qu’une quantité
non négligeable de protéines se fixe aux billes d’avidine de façon aspécifique, générant un
rapport signal sur bruit défavorable. Une étape d’élution par de la biotine des protéines
biotinylées fixées sur les billes d’avidine pourrait minimiser ce problème.

Il est à noter que Grb2, un interacteur connu de TKS5 (Oikawa et al., 2008), n’a
pas été identifée parmi les protéines biotinylées par TKS5-BirA*, ni par spectrométrie de
masse, ni par Western blot. Le fait que Grb2 ne soit pas retrouvé dans le proche environnement
de TKS5 aux invadopodes est en accord avec de précédentes études indiquant que Grb2
permettrait de distinguer les podosomes des invadopodes (Oikawa et al., 2008; Oser et al.,
2011; Yamaguchi et al., 2006), les cellules MDA-MB-231 ne formant que des invadopodes.

179
Bien que des améliorations de notre approche pourraient permettre une
identification plus robuste de la composition globale des invadopodes, dans sa configuration
actuelle, notre approche nous a déjà permis d’identifier plusieurs nouveaux composants
potentiels des invadopodes, tels que CD2AP, MAP4 et RTN4B qui, en association avec TKS5,
pourrait jouer un rôle régulateur des invadopodes.

La protéine CD2AP (CD2 Associated Protein) par son interaction avec la


protéine CP (capping protein) et la cortactine est impliquée dans la formation de lamellipodes
et la migration cellulaire (Bruck et al., 2006; Hutchings et al., 2003; Lynch et al., 2003; Zhao
et al., 2012). Elle pourrait donc réguler la polymérisation et le maintien du cœur d’actine dense
au niveau des invadopodes, en interagissant avec la cortactine et CP (Zhao et al., 2012). Elle
pourrait directement interagir avec TKS5 par ses domaines SH3 ou ses régions riches en
proline (Dustin et al., 1998), ou indirectement via la cortactine.

MAP4 (Microtubule Associated Protein 4) est une protéine stabilisant et


favorisant la croissance des microtubules (Holmfeldt et al., 2002). Elle a été impliquée dans
les phénomènes de migration et d’invasion (Jiang et al., 2016). Les MTs ont été impliqués
plus spécifiquement dans la phase d’élongation des invadopodes. Notre modèle ne permettant
pas le développement de cette phase plus tardive, il nous faudra donc déterminer si MAP4
intervient à d’autres étapes du cycle de vie des invadopodes.

RTN4B, ou Nogo-B, comme les protéines de la famille Réticulon (RTN) en


général, est une protéine transmembranaire généralement retrouvée au niveau du réticulum
endoplasmique (GrandPré et al., 2000). Sa biotinylation par TKS5 est inattendue cependant,
elle pourrait être retrouvée au niveau de la membrane plasmique (Cantalupo et al., 2015) et
pourrait donc être en relation avec les lipides membranaire de l’invadopode.

Une des fonctions de RTN4 est de contrôler les flux de calcium intracellulaire, à la
suite de la mise en place de contacts entre le réticulum endoplasmique et la membrane
plasmique via les protéines STIM1 et Orai1 (Jozsef et al., 2014). Les flux de calcium étant
importants pour la formation et l’activité des invadopodes (Sun et al., 2014), RTN4, si sa
localisation dans l’invadopode est confirmée, pourrait réguler la formation/maturation des
invadopodes via son contrôle des flux calciques.

CD2AP, MAP4 et RTN4 possèdent tous des domaines riches en proline et/ou
des domaines SH3 qui pourraient permettre leur interaction directe avec TKS5. Pour vérifier
le mode d’interaction de ces protéines avec TKS5, il faudrait produire des mutants ponctuels

180
des différents domaines et réaliser des expériences de biotinylation de proximité ou de co-
immunoprécipitation, pour identifier les domaines requis pour l’interaction. La localisation
des différentes protéines candidates devra également être étudiée pour déterminer si elles sont
bien localisées dans l’invadopodes et à quelle étape du cycle.

Enfin il sera important de vérifier si ces protéines jouent un rôle dans la


formation de l’invadopode. Pour cela il faudra étudier l’impact de la déplétion de chacune de
ces protéines par des ARNi spécifiques sur la formation d’invadopode et la capacité à dégrader
la matrice. Des résultats préliminaires utilisant des ARNi ciblant RTN4B indiquent que
RTN4B serait un régulateur négatif de la capacité des cellules à dégrader une matrice
extracellulaire. En effet, sa déplétion par deux ARNi différents induit une augmentation du
pourcentage de cellule dégradant la matrice et du nombre de foci de dégradation par cellule
(données non montrées). Les mutants de ces trois protéines dans leur domaine d’interaction
avec TKS5 pourront également être utilisés pour vérifier leurs implications dans la régulation
les invadopodes. A moyen terme, il sera important de déterminer si c’est protéine, via leur
interaction avec TKS5, contribue au processus invasif et à la dissémination cellulaire dans des
modèles d’invasion in vitro et des modèles murins de formation de métastases.

En conclusion, notre approche, bien que nécessitant quelques améliorations d’ordre


technique, pourra être utilisée pour identifier la composition globale d’autres types
d’invadopodes tel que les invadopodes linéaires ou les rosettes induites par Src par exemple.
Pour obtenir une vision plus globale de la composition moléculaire des invadopodes, au-delà
des proches partenaires de TKS5, il pourrait être intéressant d’utiliser une protéine de fusion
TKS5-BirA ayant un linker plus long et donc un rayon d’action plus grand (Kim et al., 2014),
ou d’utiliser d’autres protéines spécifiques des invadopodes comme appât comme FGD1ou
TKS4. Cependant, comme mentionné précédemment, une des limites de la technique BioID
est qu’elle ne nous permet pas d’étudier l’évolution de la composition moléculaire des
invadopodes au cours de leur cycle de vie ; en effet, BirA* nécessite d’être en contact avec
son substrat, la biotine, au moins 16h pour obtenir une biotinylation efficace, alors que la
durée de vie d’un invadopode est de l’ordre de 30 à 60 minutes. L’utilisation de nouvelles
générations de biotinylation de proximité, basées sur la peroxydase APEX2 (Lam et al.,
2015)ou la biotine ligase de B. Subtilis BASU (Ramanathan et al., 2018), permettraient de
capturer un instantané du réseau d’interactions protéiques dans une échelle de temps de l’ordre

181
de la minute, et ainsi d’avoir accès à des information précises sur chacun des stades de la vie
des invadopodes, c’est-à-dire assemblage, maturation ou désassemblage.

182
Conclusion générale

Les processus biologiques régulant la dissémination métastatique restent complexes et


encore mal compris mais les phénomènes de migration et d’invasion, notamment dans le
cancer du sein, sont largement dépendants de l’actine et des microtubules. Les mécanismes
moléculaires qui orchestrent la mise en place de structures comme les lamellipodes, les
adhésions focales ou encore les invadopodes présentent des homologies et des redondances
dans les interactions entre leurs acteurs protéiques impliqués comme par exemple la
machinerie de remodelage de l’actine ou la régulation par les Rho GTPases. Ces redondances
font penser que la cellule peut utiliser la même machinerie moléculaire à des fins différentes
et que la migration et l’invasion sont des phénomènes interconnectés. Les microtubules
régulent à la fois la migration dirigée des cellules et l’invasion, mais des subtilités notamment
dans l’implication de certaines +TIP révèlent des particularités propres à chaque système.
L’intérêt de ce travail de thèse a été d’étudier par des approches très différentes et
complémentaires, les étapes de la migration cellulaire par le biais de l’action de l’éribuline. A
faibles doses, cet agent dépolymérisant les microtubules s’est avéré cibler spécifiquement
l’extrémité + des microtubules, cela se traduisant par la perte de la migration dirigée. La mise
en évidence d’une action anti migratoire à des doses aussi faibles soulève évidemment la
question de la transposition d’un tel effet dans un système in vivo et éventuellement en
thérapeutique clinique.
L’étude des invadopodes par le prisme des +TIP est une approche novatrice car elle
aborde les invadopodes sous un angle différent de celui de la machinerie de l’actine et le rôle
des microtubules reste assez obscure dans les invadopodes. Nos résultats sont encourageants
pour continuer à décrypter l’impact du réseau des +TIP au sein de l’invadopode.
Enfin l’approche protéomique permet d’identifier de nouveau intéractants au niveau de
la structure invadopode pour mieux en comprendre le fonctionnement. Plus généralement,
cela permet aussi de définir les protéines spécifiques de ces structures mais également les
protéines déjà connues dans d’autres systèmes comme les adhésions focales ou les
lamellipodes, ce qui permet d’avoir une vue globale du fonctionnement cellulaire dans sa
compléxité et d’envisager, en thérapeutique, les cibles les plus pertinentes pour endiguer la
dissémination métastatique.

183
Bibliographie

Abram, C.L., Seals, D.F., Pass, I., Salinsky, D., Maurer, L., Roth, T.M., and Courtneidge, S.A.
(2003). The Adaptor Protein Fish Associates with Members of the ADAMs Family
and Localizes to Podosomes of Src-transformed Cells. J. Biol. Chem. 278, 16844–
16851.
Aftimos, P., Polastro, L., Ameye, L., Jungels, C., Vakili, J., Paesmans, M., van den Eerenbeemt,
J., Buttice, A., Gombos, A., de Valeriola, D., et al. (2016). Results of the Belgian
expanded access program of eribulin in the treatment of metastatic breast cancer
closely mirror those of the pivotal phase III trial. Eur. J. Cancer Oxf. Engl. 1990 60,
117–124.
Agarwal, S., Gertler, F.B., Balsamo, M., Condeelis, J.S., Camp, R.L., Xue, X., Lin, J., Rohan,
T.E., and Rimm, D.L. (2012). Quantitative assessment of invasive mena isoforms
(Menacalc) as an independent prognostic marker in breast cancer. Breast Cancer Res.
14, R124.
Aillaud, C., Bosc, C., Peris, L., Bosson, A., Heemeryck, P., Van Dijk, J., Le Friec, J., Boulan,
B., Vossier, F., Sanman, L.E., et al. (2017). Vasohibins/SVBP are tubulin
carboxypeptidases (TCPs) that regulate neuron differentiation. Science 358, 1448–
1453.
Akhmanova, A., and Hoogenraad, C.C. (2005). Microtubule plus-end-tracking proteins:
mechanisms and functions. Curr. Opin. Cell Biol. 17, 47–54.
Akhmanova, A., and Steinmetz, M.O. (2008). Tracking the ends: a dynamic protein network
controls the fate of microtubule tips. Nat. Rev. Mol. Cell Biol. 9, 309–322.
Akhmanova, A., and Steinmetz, M.O. (2010). Microtubule +TIPs at a glance. J. Cell Sci. 123,
3415–3419.
Akhmanova, A., and Steinmetz, M.O. (2015). Control of microtubule organization and
dynamics: two ends in the limelight. Nat. Rev. Mol. Cell Biol. 16, 711–726.
Albain, K.S., Barlow, W.E., Shak, S., Hortobagyi, G.N., Livingston, R.B., Yeh, I.-T., Ravdin,
P., Bugarini, R., Baehner, F.L., Davidson, N.E., et al. (2010). Prognostic and predictive
value of the 21-gene recurrence score assay in postmenopausal women with node-
positive, oestrogen-receptor-positive breast cancer on chemotherapy: a retrospective
analysis of a randomised trial. Lancet Oncol. 11, 55–65.
Al-Bassam, J., and Chang, F. (2011). Regulation of Microtubule Dynamics by TOG-domain

184
proteins XMAP215/Dis1 and CLASP. Trends Cell Biol. 21, 604–614.
Alexandropoulos, K., Cheng, G., and Baltimore, D. (1995). Proline-rich sequences that bind to
Src homology 3 domains with individual specificities. Proc. Natl. Acad. Sci. U. S. A.
92, 3110–3114.
Alushin, G.M., Lander, G.C., Kellogg, E.H., Zhang, R., Baker, D., and Nogales, E. (2014).
High-resolution microtubule structures reveal the structural transitions in αβ-tubulin
upon GTP hydrolysis. Cell 157, 1117–1129.
Amos, L.A. (2011). What tubulin drugs tell us about microtubule structure and dynamics.
Semin. Cell Dev. Biol. 22, 916–926.
Aoki, K., and Taketo, M.M. (2007). Adenomatous polyposis coli (APC): a multi-functional
tumor suppressor gene. J. Cell Sci. 120, 3327–3335.
Arsenault, D., Brochu-Gaudreau, K., Charbonneau, M., and Dubois, C.M. (2013). HDAC6
Deacetylase Activity Is Required for Hypoxia-Induced Invadopodia Formation and
Cell Invasion. PLOS ONE 8, e55529.
Artym, V.V., Swatkoski, S., Matsumoto, K., Campbell, C.B., Petrie, R.J., Dimitriadis, E.K., Li,
X., Mueller, S.C., Bugge, T.H., Gucek, M., et al. (2015). Dense fibrillar collagen is a
potent inducer of invadopodia via a specific signaling network. J. Cell Biol. 208, 331–
350.
Askham, J.M., Moncur, P., Markham, A.F., and Morrison, E.E. (2000). Regulation and function
of the interaction between the APC tumour suppressor protein and EB1. Oncogene 19,
1950–1958.
Aumeier, C., Schaedel, L., Gaillard, J., John, K., Blanchoin, L., and Théry, M. (2016). Self-
repair promotes microtubule rescue. Nat. Cell Biol. 18, 1054–1064.
Ayala, I., Baldassarre, M., Giacchetti, G., Caldieri, G., Tetè, S., Luini, A., and Buccione, R.
(2008). Multiple regulatory inputs converge on cortactin to control invadopodia
biogenesis and extracellular matrix degradation. J. Cell Sci. 121, 369–378.
Ayaz, P., Ye, X., Huddleston, P., Brautigam, C.A., and Rice, L.M. (2012). A TOG:αβ-tubulin
complex structure reveals conformation-based mechanisms for a microtubule
polymerase. Science 337, 857–860.
Bai, R., Nguyen, T.L., Burnett, J.C., Atasoylu, O., Munro, M.H.G., Pettit, G.R., Smith, A.B.,
Gussio, R., and Hamel, E. (2011). Interactions of Halichondrin B and Eribulin with
Tubulin. J. Chem. Inf. Model. 51, 1393–1404.
Barth, A.I.M., Caro-Gonzalez, H.Y., and Nelson, W.J. (2008). Role of adenomatous polyposis
coli (APC) and microtubules in directional cell migration and neuronal polarization.

185
Semin. Cell Dev. Biol. 19, 245–251.
Beaty, B.T., and Condeelis, J. (2014). Digging a little deeper: The stages of invadopodium
formation and maturation. Eur. J. Cell Biol. 93, 438–444.
Benseddik, K., Sen Nkwe, N., Daou, P., Verdier-Pinard, P., and Badache, A. (2013). ErbB2-
dependent chemotaxis requires microtubule capture and stabilization coordinated by
distinct signaling pathways. PloS One 8, e55211.
Berges, R., Baeza-Kallee, N., Tabouret, E., Chinot, O., Petit, M., Kruczynski, A., Figarella-
Branger, D., Honore, S., and Braguer, D. (2014). End-binding 1 protein overexpression
correlates with glioblastoma progression and sensitizes to Vinca-alkaloids in vitro and
in vivo. Oncotarget 5, 12769–12787.
Bhatt, R.S., Merchan, J., Parker, R., Wu, H.-K., Zhang, L., Seery, V., Heymach, J.V., Atkins,
M.B., McDermott, D., and Sukhatme, V.P. (2010). A phase 2 pilot trial of low-dose,
continuous infusion, or “metronomic” paclitaxel and oral celecoxib in patients with
metastatic melanoma. Cancer 116, 1751–1756.
Bieling, P., Laan, L., Schek, H., Munteanu, E.L., Sandblad, L., Dogterom, M., Brunner, D., and
Surrey, T. (2007). Reconstitution of a microtubule plus-end tracking system in vitro.
Nature 450, 1100–1105.
Bijman, M.N.A., van Nieuw Amerongen, G.P., Laurens, N., van Hinsbergh, V.W.M., and
Boven, E. (2006). Microtubule-targeting agents inhibit angiogenesis at subtoxic
concentrations, a process associated with inhibition of Rac1 and Cdc42 activity and
changes in the endothelial cytoskeleton. Mol. Cancer Ther. 5, 2348–2357.
Bouguenina, H., Salaun, D., Mangon, A., Muller, L., Baudelet, E., Camoin, L., Tachibana, T.,
Cianférani, S., Audebert, S., Verdier-Pinard, P., et al. (2017). EB1-binding-myomegalin
protein complex promotes centrosomal microtubules functions. Proc. Natl. Acad. Sci. U. S.
A. 114, E10687–E10696.
Blouw, B., Seals, D.F., Pass, I., Diaz, B., and Courtneidge, S.A. (2008). A role for the
podosome/invadopodia scaffold protein Tks5 in tumor growth in vivo. Eur. J. Cell
Biol. 87, 555–567.
Blouw, B., Patel, M., Iizuka, S., Abdullah, C., You, W.K., Huang, X., Li, J.-L., Diaz, B.,
Stallcup, W.B., and Courtneidge, S.A. (2015). The Invadopodia Scaffold Protein Tks5
Is Required for the Growth of Human Breast Cancer Cells In Vitro and In Vivo. PLOS
ONE 10, e0121003.
te Boekhorst, V., Preziosi, L., and Friedl, P. (2016). Plasticity of Cell Migration In Vivo and In
Silico. Annu. Rev. Cell Dev. Biol. 32, 491–526.

186
Boggs, A.E., Vitolo, M.I., Whipple, R.A., Charpentier, M.S., Goloubeva, O.G., Ioffe, O.B.,
Tuttle, K.C., Slovic, J., Lu, Y., Mills, G.B., et al. (2015). α-Tubulin acetylation
elevated in metastatic and basal-like breast cancer cells promotes microtentacle
formation, adhesion, and invasive migration. Cancer Res. 75, 203–215.
Borisy, G.G., and Taylor, E.W. (1967). The mechanism of action of colchicine. Binding of
colchincine-3H to cellular protein. J. Cell Biol. 34, 525–533.
Brabletz, T., Kalluri, R., Nieto, M.A., and Weinberg, R.A. (2018). EMT in cancer. Nat. Rev.
Cancer 18, 128–134.
Brandt, D.T., and Grosse, R. (2007). Get to grips: steering local actin dynamics with IQGAPs.
EMBO Rep. 8, 1019–1023.
Bravo-Cordero, J.J., Hodgson, L., and Condeelis, J. (2012). Directed cell invasion and
migration during metastasis. Curr. Opin. Cell Biol. 24, 277–283.
Bravo-Cordero, J.J., Magalhaes, M.A.O., Eddy, R.J., Hodgson, L., and Condeelis, J. (2013).
Functions of cofilin in cell locomotion and invasion. Nat. Rev. Mol. Cell Biol. 14.
Briasoulis, E., Pappas, P., Puozzo, C., Tolis, C., Fountzilas, G., Dafni, U., Marselos, M., and
Pavlidis, N. (2009). Dose-ranging study of metronomic oral vinorelbine in patients
with advanced refractory cancer. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 15,
6454–6461.
Brisson, L., Reshkin, S.J., Goré, J., and Roger, S. (2012). pH regulators in invadosomal
functioning: proton delivery for matrix tasting. Eur. J. Cell Biol. 91, 847–860.
Brittle, A.L., and Ohkura, H. (2005). Mini spindles, the XMAP215 homologue, suppresses
pausing of interphase microtubules in Drosophila. EMBO J. 24, 1387–1396.
Brouhard, G.J., Stear, J.H., Noetzel, T.L., Al-Bassam, J., Kinoshita, K., Harrison, S.C., Howard,
J., and Hyman, A.A. (2008). XMAP215 Is a Processive Microtubule Polymerase. Cell
132, 79–88.
Brues, A.M., and Cohen, A. (1936). Effects of colchicine and related substances on cell
division. Biochem. J. 30, 1363-1368.1.
Buey, R.M., Mohan, R., Leslie, K., Walzthoeni, T., Missimer, J.H., Menzel, A., Bjelic, S.,
Bargsten, K., Grigoriev, I., Smal, I., et al. (2011). Insights into EB1 structure and the
role of its C-terminal domain for discriminating microtubule tips from the lattice. Mol.
Biol. Cell 22, 2912–2923.
Burger, K.L., Davis, A.L., Isom, S., Mishra, N., and Seals, D.F. (2011). The podosome marker
protein Tks5 regulates macrophage invasive behavior. Cytoskelet. Hoboken NJ 68,
694–711.

187
Buschman, M.D., Bromann, P.A., Cejudo-Martin, P., Wen, F., Pass, I., Courtneidge, S.A., and
Brugge, J. (2009). The Novel Adaptor Protein Tks4 (SH3PXD2B) Is Required for
Functional Podosome Formation. Mol. Biol. Cell 20, 1302–1311.
Cadamuro, M., Spagnuolo, G., Sambado, L., Indraccolo, S., Nardo, G., Rosato, A., Brivio, S.,
Caslini, C., Stecca, T., Massani, M., et al. (2016). Low-Dose Paclitaxel Reduces
S100A4 Nuclear Import to Inhibit Invasion and Hematogenous Metastasis of
Cholangiocarcinoma. Cancer Res. 76, 4775–4784.
Calderwood, D.A., Fujioka, Y., de Pereda, J.M., García-Alvarez, B., Nakamoto, T., Margolis,
B., McGlade, C.J., Liddington, R.C., and Ginsberg, M.H. (2003). Integrin beta
cytoplasmic domain interactions with phosphotyrosine-binding domains: a structural
prototype for diversity in integrin signaling. Proc. Natl. Acad. Sci. U. S. A. 100, 2272–
2277.
Caldwell, C.M., and Kaplan, K.B. (2009). The Role of APC in Mitosis and in Chromosome
Instability. In APC Proteins, (Springer, New York, NY), pp. 51–64.
Calle, Y., Carragher, N.O., Thrasher, A.J., and Jones, G.E. (2006). Inhibition of calpain
stabilises podosomes and impairs dendritic cell motility. J. Cell Sci. 119, 2375–2385.
Cao, D., Su, Z., Wang, W., Wu, H., Liu, X., Akram, S., Qin, B., Zhou, J., Zhuang, X., Adams,
G., et al. (2015). Signaling Scaffold Protein IQGAP1 Interacts with Microtubule Plus-end
Tracking Protein SKAP and Links Dynamic Microtubule Plus-end to Steer Cell Migration.
J. Biol. Chem. 290, 23766–23780.
Cao, H., Eppinga, R.D., Razidlo, G.L., Krueger, E.W., Chen, J., Qiang, L., and McNiven, M.A.
(2016). Stromal fibroblasts facilitate cancer cell invasion by a novel invadopodia-
independent matrix degradation process. Oncogene 35, 1099–1110.
Caramel, J., Papadogeorgakis, E., Hill, L., Browne, G.J., Richard, G., Wierinckx, A., Saldanha,
G., Osborne, J., Hutchinson, P., Tse, G., et al. (2013). A switch in the expression of
embryonic EMT-inducers drives the development of malignant melanoma. Cancer
Cell 24, 466–480.
Cardoso, F., Costa, A., Senkus, E., Aapro, M., André, F., Barrios, C.H., Bergh, J.,
Bhattacharyya, G., Biganzoli, L., Cardoso, M.J., et al. (2016). 3rd ESO–ESMO
International Consensus Guidelines for Advanced Breast Cancer (ABC 3). Ann.
Oncol. mdw544.
Castro-Castro, A., Janke, C., Montagnac, G., Paul-Gilloteaux, P., and Chavrier, P. (2012).
ATAT1/MEC-17 acetyltransferase and HDAC6 deacetylase control a balance of
acetylation of alpha-tubulin and cortactin and regulate MT1-MMP trafficking and

188
breast tumor cell invasion. Eur. J. Cell Biol. 91, 950–960.
Castro-Castro, A., Marchesin, V., Monteiro, P., Lodillinsky, C., Rossé, C., and Chavrier, P.
(2016). Cellular and Molecular Mechanisms of MT1-MMP-Dependent Cancer Cell
Invasion. Annu. Rev. Cell Dev. Biol. 32, 555–576.
Cejudo-Martin, P., Yuen, A., Vlahovich, N., Lock, P., Courtneidge, S.A., and Díaz, B. (2014).
Genetic Disruption of the Sh3pxd2a Gene Reveals an Essential Role in Mouse
Development and the Existence of a Novel Isoform of Tks5. PLOS ONE 9, e107674.
Chen, J., Luo, Y., Li, L., Ran, J., Wang, X., Gao, S., Liu, M., Li, D., Shui, W., and Zhou, J.
(2014). Phosphoregulation of the dimerization and functions of end-binding protein 1.
Protein Cell 5, 795–799.
Chen, W.T., Chen, J.M., Parsons, S.J., and Parsons, J.T. (1985). Local degradation of
fibronectin at sites of expression of the transforming gene product pp60src. Nature
316, 156–158.
Choi, J.-A., and Lim, I.K. (2013). TIS21/BTG2 inhibits invadopodia formation by
downregulating reactive oxygen species level in MDA-MB-231 cells. J. Cancer Res.
Clin. Oncol. 139, 1657–1665.
Choi, C.K., Zareno, J., Digman, M.A., Gratton, E., and Horwitz, A.R. (2011). Cross-correlated
fluctuation analysis reveals phosphorylation-regulated paxillin-FAK complexes in
nascent adhesions. Biophys. J. 100, 583–592.
Choi, J.-A., Jung, Y.S., Kim, J.Y., Kim, H.M., and Lim, I.K. (2016). Inhibition of breast cancer
invasion by TIS21/BTG2/Pc3-Akt1-Sp1-Nox4 pathway targeting actin nucleators,
mDia genes. Oncogene 35, 83–93.
Chopra, N., and Turner, N.C. (2017). Targeting PIK3CA-mutant advanced breast cancer in the
clinical setting. Lancet Oncol. 18, 842–843.
Chuma, M., Sakamoto, M., Yasuda, J., Fujii, G., Nakanishi, K., Tsuchiya, A., Ohta, T., Asaka,
M., and Hirohashi, S. (2004). Overexpression of cortactin is involved in motility and
metastasis of hepatocellular carcinoma. J. Hepatol. 41, 629–636.
Clark, E.S., Whigham, A.S., Yarbrough, W.G., and Weaver, A.M. (2007). Cortactin is an
essential regulator of matrix metalloproteinase secretion and extracellular matrix
degradation in invadopodia. Cancer Res. 67, 4227–4235.
Cortes, J., O’Shaughnessy, J., Loesch, D., Blum, J.L., Vahdat, L.T., Petrakova, K., Chollet, P.,
Manikas, A., Diéras, V., Delozier, T., et al. (2011). Eribulin monotherapy versus
treatment of physician’s choice in patients with metastatic breast cancer (EMBRACE):
a phase 3 open-label randomised study. Lancet 377, 914–923.

189
Crimaldi, L., Courtneidge, S.A., and Gimona, M. (2009). Tks5 recruits AFAP-110,
p190RhoGAP, and cortactin for podosome formation. Exp. Cell Res. 315, 2581–2592.
Cristofanilli, M., Turner, N.C., Bondarenko, I., Ro, J., Im, S.-A., Masuda, N., Colleoni, M.,
DeMichele, A., Loi, S., Verma, S., et al. (2016). Fulvestrant plus palbociclib versus
fulvestrant plus placebo for treatment of hormone-receptor-positive, HER2-negative
metastatic breast cancer that progressed on previous endocrine therapy (PALOMA-3):
final analysis of the multicentre, double-blind, phase 3 randomised controlled trial.
Lancet Oncol. 17, 425–439.
Cullen, C.F., Deák, P., Glover, D.M., and Ohkura, H. (1999). mini spindles: A gene encoding
a conserved microtubule-associated protein required for the integrity of the mitotic
spindle in Drosophila. J. Cell Biol. 146, 1005–1018.
Curry, S.H., and Coombs, S.E. (2016). Benzoic acid is not the only important product of
accelerated metabolism of cocaine. Proc. Natl. Acad. Sci. U. S. A. 113, E2101.
Daou, P., Hasan, S., Breitsprecher, D., Baudelet, E., Camoin, L., Audebert, S., Goode, B.L.,
and Badache, A. (2014). Essential and nonredundant roles for Diaphanous formins in
cortical microtubule capture and directed cell migration. Mol. Biol. Cell 25, 658–668.
De Groot, C.O., Jelesarov, I., Damberger, F.F., Bjelić, S., Schärer, M.A., Bhavesh, N.S.,
Grigoriev, I., Buey, R.M., Wüthrich, K., Capitani, G., et al. (2010). Molecular insights
into mammalian end-binding protein heterodimerization. J. Biol. Chem. 285, 5802–
5814.
Dehmelt, L., and Halpain, S. (2005). The MAP2/Tau family of microtubule-associated proteins.
Genome Biol. 6, 204.
Demetri, G.D., Schöffski, P., Grignani, G., Blay, J.-Y., Maki, R.G., Van Tine, B.A., Alcindor,
T., Jones, R.L., D’Adamo, D.R., Guo, M., et al. (2017). Activity of Eribulin in Patients
With Advanced Liposarcoma Demonstrated in a Subgroup Analysis From a
Randomized Phase III Study of Eribulin Versus Dacarbazine. J. Clin. Oncol. Off. J.
Am. Soc. Clin. Oncol. 35, 3433–3439.
Denecker, G., Vandamme, N., Akay, O., Koludrovic, D., Taminau, J., Lemeire, K., Gheldof,
A., De Craene, B., Van Gele, M., Brochez, L., et al. (2014). Identification of a ZEB2-
MITF-ZEB1 transcriptional network that controls melanogenesis and melanoma
progression. Cell Death Differ. 21, 1250–1261.
Denning, D.P., and Hirose, T. (2014). Anti-tubulins DEPendably induce apoptosis. Nat. Cell
Biol. 16, 741–743.
Derry, W.B., Wilson, L., and Jordan, M.A. (1998). Low potency of taxol at microtubule minus

190
ends: implications for its antimitotic and therapeutic mechanism. Cancer Res. 58,
1177–1184.
Desai, A., and Mitchison, T.J. (1997). Microtubule polymerization dynamics. Annu. Rev. Cell
Dev. Biol. 13, 83–117.
Destaing, O., Planus, E., Bouvard, D., Oddou, C., Badowski, C., Bossy, V., Raducanu, A.,
Fourcade, B., Albiges-Rizo, C., and Block, M.R. (2010). β1A Integrin Is a Master
Regulator of Invadosome Organization and Function. Mol. Biol. Cell 21, 4108–4119.
Di Leo, A., Johnston, S., Lee, K.S., Ciruelos, E., Lønning, P.E., Janni, W., O’Regan, R.,
Mouret-Reynier, M.-A., Kalev, D., Egle, D., et al. (2018). Buparlisib plus fulvestrant
in postmenopausal women with hormone-receptor-positive, HER2-negative, advanced
breast cancer progressing on or after mTOR inhibition (BELLE-3): a randomised,
double-blind, placebo-controlled, phase 3 trial. Lancet Oncol. 19, 87–100.
Diaz, B., Shani, G., Pass, I., Anderson, D., Quintavalle, M., and Courtneidge, S.A. (2009).
Tks5-dependent, nox-mediated generation of reactive oxygen species is necessary for
invadopodia formation. Sci. Signal. 2, ra53.
Díaz, B., Yuen, A., Iizuka, S., Higashiyama, S., and Courtneidge, S.A. (2013). Notch increases
the shedding of HB-EGF by ADAM12 to potentiate invadopodia formation in hypoxia.
J. Cell Biol. 201, 279–292.
Dimitrov, A., Quesnoit, M., Moutel, S., Cantaloube, I., Poüs, C., and Perez, F. (2008). Detection
of GTP-tubulin conformation in vivo reveals a role for GTP remnants in microtubule
rescues. Science 322, 1353–1356.
Dong, X., Liu, F., Sun, L., Liu, M., Li, D., Su, D., Zhu, Z., Dong, J.-T., Fu, L., and Zhou, J.
(2010). Oncogenic function of microtubule end-binding protein 1 in breast cancer. J.
Pathol. 220, 361–369.
Dorléans, A., Gigant, B., Ravelli, R.B.G., Mailliet, P., Mikol, V., and Knossow, M. (2009).
Variations in the colchicine-binding domain provide insight into the structural switch
of tubulin. Proc. Natl. Acad. Sci. U. S. A. 106, 13775–13779.
Dowsett, M., Sestak, I., Lopez-Knowles, E., Sidhu, K., Dunbier, A.K., Cowens, J.W., Ferree,
S., Storhoff, J., Schaper, C., and Cuzick, J. (2013). Comparison of PAM50 Risk of
Recurrence Score With Oncotype DX and IHC4 for Predicting Risk of Distant
Recurrence After Endocrine Therapy. J. Clin. Oncol. 31, 2783–2790.
Drukker, C.A., Bueno-de-Mesquita, J.M., Retèl, V.P., van Harten, W.H., van Tinteren, H.,
Wesseling, J., Roumen, R.M.H., Knauer, M., van ’t Veer, L.J., Sonke, G.S., et al.
(2013). A prospective evaluation of a breast cancer prognosis signature in the

191
observational RASTER study. Int. J. Cancer 133, 929–936.
Duffy, M.J., McGowan, P.M., Harbeck, N., Thomssen, C., and Schmitt, M. (2014). uPA and
PAI-1 as biomarkers in breast cancer: validated for clinical use in level-of-evidence-1
studies. Breast Cancer Res. BCR 16, 428.
Duffy, M.J., Harbeck, N., Nap, M., Molina, R., Nicolini, A., Senkus, E., and Cardoso, F. (2017).
Clinical use of biomarkers in breast cancer: Updated guidelines from the European
Group on Tumor Markers (EGTM). Eur. J. Cancer 75, 284–298.
Dumontet, C., and Jordan, M.A. (2010). Microtubule-binding agents: a dynamic field of cancer
therapeutics. Nat. Rev. Drug Discov. 9, 790–803.
Duplan, M.B., Zalli, D., Stephens, S., Zenger, S., Neff, L., Oelkers, J.M., Lai, F.P.L., Horne,
W., Rottner, K., and Baron, R. (2014). Microtubule Dynamic Instability Controls
Podosome Patterning in Osteoclasts through EB1, Cortactin, and Src. Mol. Cell. Biol.
34, 16–29.
Eckert, M.A., Lwin, T.M., Chang, A.T., Kim, J., Danis, E., Ohno-Machado, L., and Yang, J.
(2011). Twist1-Induced Invadopodia Formation Promotes Tumor Metastasis. Cancer
Cell 19, 372–386.
Eddy, R.J., Weidmann, M.D., Sharma, V.P., and Condeelis, J.S. (2017). Tumor Cell
Invadopodia: Invasive Protrusions that Orchestrate Metastasis. Trends Cell Biol. 27,
595–607.
Efimov, A., Schiefermeier, N., Grigoriev, I., Ohi, R., Brown, M.C., Turner, C.E., Small, J.V.,
and Kaverina, I. (2008). Paxillin-dependent stimulation of microtubule catastrophes at
focal adhesion sites. J. Cell Sci. 121, 196–204.
Eipper, B.A. (1972). Rat brain microtubule protein: purification and determination of
covalently bound phosphate and carbohydrate. Proc. Natl. Acad. Sci. U. S. A. 69,
2283–2287.
Ellson, C.D., Andrews, S., Stephens, L.R., and Hawkins, P.T. (2002). The PX domain: a new
phosphoinositide-binding module. J. Cell Sci. 115, 1099–1105.
Ersfeld, K., Wehland, J., Plessmann, U., Dodemont, H., Gerke, V., and Weber, K. (1993).
Characterization of the tubulin-tyrosine ligase. J. Cell Biol. 120, 725–732.
Etienne-Manneville, S. (2009). APC in cell migration. Adv. Exp. Med. Biol. 656, 30–40.
Etienne-Manneville, S. (2013). Microtubules in cell migration. Annu. Rev. Cell Dev. Biol. 29,
471–499.
Ezratty, E.J., Partridge, M.A., and Gundersen, G.G. (2005). Microtubule-induced focal
adhesion disassembly is mediated by dynamin and focal adhesion kinase. Nat. Cell

192
Biol. 7, 581–590.
Farache, D., Emorine, L., Haren, L., and Merdes, A. (2018). Assembly and regulation of γ-
tubulin complexes. Open Biol. 8.
Faruki, S., Geahlen, R.L., and Asai, D.J. (2000). Syk-dependent phosphorylation of
microtubules in activated B-lymphocytes. J. Cell Sci. 113 ( Pt 14), 2557–2565.
Fidler, I.J., and Kripke, M.L. (1977). Metastasis results from preexisting variant cells within a
malignant tumor. Science 197, 893–895.
Field, J.J., Kanakkanthara, A., and Miller, J.H. (2014). Microtubule-targeting agents are
clinically successful due to both mitotic and interphase impairment of microtubule
function. Bioorg. Med. Chem. 22, 5050–5059.
Field, J.J., Kanakkanthara, A., and Miller, J.H. Microtubule-targeting agents are clinically
successful due to both mitotic and interphase impairment of microtubule function.
Bioorg. Med. Chem.
Finn, R.S., Martin, M., Rugo, H.S., Jones, S., Im, S.-A., Gelmon, K., Harbeck, N., Lipatov,
O.N., Walshe, J.M., Moulder, S., et al. (2016). Palbociclib and Letrozole in Advanced
Breast Cancer. N. Engl. J. Med. 375, 1925–1936.
Folkman, J., Merler, E., Abernathy, C., and Williams, G. (1971). Isolation of a tumor factor
responsible for angiogenesis. J. Exp. Med. 133, 275–288.
de Forges, H., Pilon, A., Poüs, C., and Perez, F. (2013). Imaging GTP-bound tubulin: from
cellular to in vitro assembled microtubules. Methods Cell Biol. 115, 139–153.
Forse, C.L., Agarwal, S., Pinnaduwage, D., Gertler, F., Condeelis, J.S., Lin, J., Xue, X., Johung,
K., Mulligan, A.M., Rohan, T.E., et al. (2015). Menacalc, a quantitative method of
metastasis assessment, as a prognostic marker for axillary node-negative breast cancer.
BMC Cancer 15, 483.
Franco, S.J., Rodgers, M.A., Perrin, B.J., Han, J., Bennin, D.A., Critchley, D.R., and
Huttenlocher, A. (2004). Calpain-mediated proteolysis of talin regulates adhesion
dynamics. Nat. Cell Biol. 6, 977–983.
Friedl, P., and Mayor, R. (2017). Tuning Collective Cell Migration by Cell-Cell Junction
Regulation. Cold Spring Harb. Perspect. Biol. 9.
Friedl, P., Locker, J., Sahai, E., and Segall, J.E. (2012). Classifying collective cancer cell
invasion. Nat. Cell Biol. 14, 777–783.
Gadadhar, S., Bodakuntla, S., Natarajan, K., and Janke, C. (2017). The tubulin code at a glance.
J. Cell Sci. 130, 1347–1353.
Gan, P.P., McCarroll, J.A., Byrne, F.L., Garner, J., and Kavallaris, M. (2011). Specific β-

193
tubulin isotypes can functionally enhance or diminish epothilone B sensitivity in non-
small cell lung cancer cells. PloS One 6, e21717.
García-Alvarez, B., de Pereda, J.M., Calderwood, D.A., Ulmer, T.S., Critchley, D., Campbell,
I.D., Ginsberg, M.H., and Liddington, R.C. (2003). Structural determinants of integrin
recognition by talin. Mol. Cell 11, 49–58.
Gard, D.L., and Kirschner, M.W. (1987). Microtubule assembly in cytoplasmic extracts of
Xenopus oocytes and eggs. J. Cell Biol. 105, 2191–2201.
Geiger, B., Spatz, J.P., and Bershadsky, A.D. (2009). Environmental sensing through focal
adhesions. Nat. Rev. Mol. Cell Biol. 10, 21–33.
Génot, E., and Gligorijevic, B. (2014). Invadosomes in their natural habitat. Eur. J. Cell Biol.
93, 367–379.
Gertler, F., and Condeelis, J. (2011). Metastasis: tumor cells becoming MENAcing. Trends Cell
Biol. 21, 81–90.
Gimona, M., Buccione, R., Courtneidge, S.A., and Linder, S. (2008). Assembly and biological
role of podosomes and invadopodia. Curr. Opin. Cell Biol. 20, 235–241.
Gingras, I., Gebhart, G., de Azambuja, E., and Piccart-Gebhart, M. (2017). HER2-positive
breast cancer is lost in translation: time for patient-centered research. Nat. Rev. Clin.
Oncol. 14, 669–681.
Gligorijevic, B., Wyckoff, J., Yamaguchi, H., Wang, Y., Roussos, E.T., and Condeelis, J.
(2012). N-WASP-mediated invadopodium formation is involved in intravasation and
lung metastasis of mammary tumors. J. Cell Sci. 125, 724–734.
Gligorijevic, B., Bergman, A., and Condeelis, J. (2014). Multiparametric Classification Links
Tumor Microenvironments with Tumor Cell Phenotype. PLOS Biol. 12, e1001995.
Gnant, M., Filipits, M., Greil, R., Stoeger, H., Rudas, M., Bago-Horvath, Z., Mlineritsch, B.,
Kwasny, W., Knauer, M., Singer, C., et al. (2014). Predicting distant recurrence in
receptor-positive breast cancer patients with limited clinicopathological risk: using the
PAM50 Risk of Recurrence score in 1478 postmenopausal patients of the ABCSG-8
trial treated with adjuvant endocrine therapy alone. Ann. Oncol. 25, 339–345.
Goetz, M.P., Toi, M., Campone, M., Sohn, J., Paluch-Shimon, S., Huober, J., Park, I.H., Trédan,
O., Chen, S.-C., Manso, L., et al. (2017). MONARCH 3: Abemaciclib As Initial
Therapy for Advanced Breast Cancer. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 35,
3638–3646.
Goicoechea, S.M., Zinn, A., Awadia, S.S., Snyder, K., and Garcia-Mata, R. (2017). A RhoG-
mediated signaling pathway that modulates invadopodia dynamics in breast cancer

194
cells. J. Cell Sci. jcs.195552.
Gonzalez-Angulo, A.M., Timms, K.M., Liu, S., Chen, H., Litton, J.K., Potter, J., Lanchbury,
J.S., Stemke-Hale, K., Hennessy, B.T., Arun, B.K., et al. (2011). Incidence and
Outcome of BRCA Mutations in Unselected Patients with Triple Receptor-Negative
Breast Cancer. Clin. Cancer Res. 17, 1082–1089.
Greer, K., Maruta, H., L’Hernault, S.W., and Rosenbaum, J.L. (1985). Alpha-tubulin acetylase
activity in isolated Chlamydomonas flagella. J. Cell Biol. 101, 2081–2084.
Haeger, A., Wolf, K., Zegers, M.M., and Friedl, P. (2015). Collective cell migration: guidance
principles and hierarchies. Trends Cell Biol. 25, 556–566.
Hanahan, D., and Weinberg, R.A. (2000). The hallmarks of cancer. Cell 100, 57–70.
Hanahan, D., and Weinberg, R.A. (2011). Hallmarks of cancer: the next generation. Cell 144,
646–674.
Hankey, W., Frankel, W.L., and Groden, J. (2018). Functions of the APC tumor suppressor
protein dependent and independent of canonical WNT signaling: implications for
therapeutic targeting. Cancer Metastasis Rev. 37, 159–172.
Harbeck, N., Schmitt, M., Meisner, C., Friedel, C., Untch, M., Schmidt, M., Sweep, C.G.J.,
Lisboa, B.W., Lux, M.P., Beck, T., et al. (2013). Ten-year analysis of the prospective
multicentre Chemo-N0 trial validates American Society of Clinical Oncology
(ASCO)-recommended biomarkers uPA and PAI-1 for therapy decision making in
node-negative breast cancer patients. Eur. J. Cancer 49, 1825–1835.
van Haren, J., Charafeddine, R.A., Ettinger, A., Wang, H., Hahn, K.M., and Wittmann, T.
(2018). Local control of intracellular microtubule dynamics by EB1 photodissociation.
Nat. Cell Biol. 20, 252–261.
Harris, E.S., and Nelson, W.J. (2010). Adenomatous polyposis coli regulates endothelial cell
migration independent of roles in beta-catenin signaling and cell-cell adhesion. Mol.
Biol. Cell 21, 2611–2623.
Hayashi, I., and Ikura, M. (2003). Crystal structure of the amino-terminal microtubule-binding
domain of end-binding protein 1 (EB1). J. Biol. Chem. 278, 36430–36434.
Hayashi, I., Plevin, M.J., and Ikura, M. (2007). CLIP170 autoinhibition mimics intermolecular
interactions with p150Glued or EB1. Nat. Struct. Mol. Biol. 14, 980–981.
Hill, A., McFarlane, S., Mulligan, K., Gillespie, H., Draffin, J.E., Trimble, A., Ouhtit, A.,
Johnston, P.G., Harkin, D.P., McCormick, D., et al. (2006). Cortactin underpins CD44-
promoted invasion and adhesion of breast cancer cells to bone marrow endothelial
cells. Oncogene 25, 6079–6091.

195
Holmfeldt, P., Brattsand, G., and Gullberg, M. (2002). MAP4 counteracts microtubule
catastrophe promotion but not tubulin-sequestering activity in intact cells. Curr. Biol.
CB 12, 1034–1039.
Honnappa, S., Okhrimenko, O., Jaussi, R., Jawhari, H., Jelesarov, I., Winkler, F.K., and
Steinmetz, M.O. (2006). Key interaction modes of dynamic +TIP networks. Mol. Cell
23, 663–671.
Honnappa, S., Gouveia, S.M., Weisbrich, A., Damberger, F.F., Bhavesh, N.S., Jawhari, H.,
Grigoriev, I., Rijssel, F.J.A. van, Buey, R.M., Lawera, A., et al. (2009). An EB1-
Binding Motif Acts as a Microtubule Tip Localization Signal. Cell 138, 366–376.
Honoré, S., Pagano, A., Gauthier, G., Bourgarel-Rey, V., Verdier-Pinard, P., Civiletti, K.,
Kruczynski, A., and Braguer, D. (2008). Antiangiogenic vinflunine affects EB1
localization and microtubule targeting to adhesion sites. Mol. Cancer Ther. 7, 2080–
2089.
Hortobagyi, G.N., Stemmer, S.M., Burris, H.A., Yap, Y.-S., Sonke, G.S., Paluch-Shimon, S.,
Campone, M., Blackwell, K.L., André, F., Winer, E.P., et al. (2016). Ribociclib as
First-Line Therapy for HR-Positive, Advanced Breast Cancer. N. Engl. J. Med. 375,
1738–1748.
Hortobagyi, G.N., Connolly, J.L., D’Orsi, C.J., Edge, S.B., Mittendorf, E.A., Rugo, H.S., Solin,
L.J., Weaver, D.L., Winchester, D.J., and Giuliano, A. (2017). Breast. In AJCC Cancer
Staging Manual, M.B. Amin, S.B. Edge, F.L. Greene, D.R. Byrd, R.K. Brookland,
M.K. Washington, J.E. Gershenwald, C.C. Compton, K.R. Hess, D.C. Sullivan, et al.,
eds. (Cham: Springer International Publishing), pp. 589–636.
Hui, R., Ball, J.R., Macmillan, R.D., Kenny, F.S., Prall, O.W., Campbell, D.H., Cornish, A.L.,
McClelland, R.A., Daly, R.J., Forbes, J.F., et al. (1998). EMS1 gene expression in
primary breast cancer: relationship to cyclin D1 and oestrogen receptor expression and
patient survival. Oncogene 17, 1053–1059.
Iizuka, S., Abdullah, C., Buschman, M.D., Diaz, B., and Courtneidge, S.A. (2016). The role of
Tks adaptor proteins in invadopodia formation, growth and metastasis of melanoma.
Oncotarget 7.
Inoue, K., Saito, T., Okubo, K., Kimizuka, K., Yamada, H., Sakurai, T., Ishizuna, K., Hata, S.,
Kai, T., and Kurosumi, M. (2016). Phase II clinical study of eribulin monotherapy in
Japanese patients with metastatic breast cancer who had well-defined taxane
resistance. Breast Cancer Res. Treat. 157, 295–305.
Izzard, C.S., and Lochner, L.R. (1976). Cell-to-substrate contacts in living fibroblasts: an

196
interference reflexion study with an evaluation of the technique. J. Cell Sci. 21, 129–
159.
Jaïs, P., Sabourin, J.C., Bombled, J., Rougier, P., Lasser, P., Duvillard, P., Bénard, J., and
Bressac-de Paillerets, B. (1998). Absence of somatic alterations of the EB1 gene
adenomatous polyposis coli-associated protein in human sporadic colorectal cancers.
Br. J. Cancer 78, 1356–1360.
Jänicke, F., Prechtl, A., Thomssen, C., Harbeck, N., Meisner, C., Untch, M., Sweep, C.G.,
Selbmann, H.K., Graeff, H., Schmitt, M., et al. (2001). Randomized adjuvant
chemotherapy trial in high-risk, lymph node-negative breast cancer patients identified
by urokinase-type plasminogen activator and plasminogen activator inhibitor type 1.
J. Natl. Cancer Inst. 93, 913–920.
Janke, C. (2014). The tubulin code: molecular components, readout mechanisms, and functions.
J. Cell Biol. 206, 461–472.
Janke, C., and Montagnac, G. (2017). Causes and Consequences of Microtubule Acetylation.
Curr. Biol. CB 27, R1287–R1292.
Jeannot, P., and Besson, A. (2017a). Cortactin function in invadopodia. Small GTPases 1–15.
Jeannot, P., Nowosad, A., Perchey, R.T., Callot, C., Bennana, E., Katsube, T., Mayeux, P.,
Guillonneau, F., Manenti, S., and Besson, A. (2017). p27(Kip1) promotes invadopodia
turnover and invasion through the regulation of the PAK1/Cortactin pathway. Elife 6,
e22207.
Jiang, K., Toedt, G., Montenegro Gouveia, S., Davey, N.E., Hua, S., van der Vaart, B.,
Grigoriev, I., Larsen, J., Pedersen, L.B., Bezstarosti, K., et al. (2012). A Proteome-
wide screen for mammalian SxIP motif-containing microtubule plus-end tracking
proteins. Curr. Biol. CB 22, 1800–1807.
Jiang, Y.-Y., Shang, L., Shi, Z.-Z., Zhang, T.-T., Ma, S., Lu, C.-C., Zhang, Y., Hao, J.-J., Shi,
C., Shi, F., et al. (2016). Microtubule-associated protein 4 is an important regulator of
cell invasion/migration and a potential therapeutic target in esophageal squamous cell
carcinoma. Oncogene 35, 4846–4856.
Jin, Z., Tamura, G., Tsuchiya, T., Sakata, K., Kashiwaba, M., Osakabe, M., and Motoyama, T.
(2001). Adenomatous polyposis coli (APC) gene promoter hypermethylation in
primary breast cancers. Br. J. Cancer 85, 69–73.
Jolly, A.L., Kim, H., Srinivasan, D., Lakonishok, M., Larson, A.G., and Gelfand, V.I. (2010).
Kinesin-1 heavy chain mediates microtubule sliding to drive changes in cell shape.
Proc. Natl. Acad. Sci. U. S. A. 107, 12151–12156.

197
Jönsson, M., Borg, A., Nilbert, M., and Andersson, T. (2000). Involvement of adenomatous
polyposis coli (APC)/beta-catenin signalling in human breast cancer. Eur. J. Cancer
Oxf. Engl. 1990 36, 242–248.
Jordan, M.A. (2002). Mechanism of action of antitumor drugs that interact with microtubules
and tubulin. Curr. Med. Chem. Anti-Cancer Agents 2, 1–17.
Jordan, M.A., and Wilson, L. (2004). Microtubules as a target for anticancer drugs. Nat. Rev.
Cancer 4, 253–265.
Jordan, M.A., Kamath, K., Manna, T., Okouneva, T., Miller, H.P., Davis, C., Littlefield, B.A.,
and Wilson, L. (2005). The primary antimitotic mechanism of action of the synthetic
halichondrin E7389 is suppression of microtubule growth. Mol. Cancer Ther. 4, 1086–
1095.
Juanes, M.A., Bouguenina, H., Eskin, J.A., Jaiswal, R., Badache, A., and Goode, B.L. (2017).
Adenomatous polyposis coli nucleates actin assembly to drive cell migration and
microtubule-induced focal adhesion turnover. J. Cell Biol. 216, 2859–2875.
Juin, A., Billottet, C., Moreau, V., Destaing, O., Albiges-Rizo, C., Rosenbaum, J., Génot, E.,
and Saltel, F. (2012). Physiological type I collagen organization induces the formation
of a novel class of linear invadosomes. Mol. Biol. Cell 23, 297–309.
Juin, A., Martino, J.D., Leitinger, B., Henriet, E., Gary, A.-S., Paysan, L., Bomo, J., Baffet, G.,
Gauthier-Rouvière, C., Rosenbaum, J., et al. (2014). Discoidin domain receptor 1
controls linear invadosome formation via a Cdc42–Tuba pathway. J. Cell Biol. 207,
517–533.
Kalluri, R., and Weinberg, R.A. (2009). The basics of epithelial-mesenchymal transition. J.
Clin. Invest. 119, 1420–1428.
Kamath, K., Smiyun, G., Wilson, L., and Jordan, M.A. (2014). Mechanisms of inhibition of
endothelial cell migration by taxanes. Cytoskelet. Hoboken NJ 71, 46–60.
Kametani, F., and Hasegawa, M. (2018). Reconsideration of Amyloid Hypothesis and Tau
Hypothesis in Alzheimer’s Disease. Front. Neurosci. 12, 25.
Kanojia, D., Morshed, R.A., Zhang, L., Miska, J.M., Qiao, J., Kim, J.W., Pytel, P.,
Balyasnikova, I.V., Lesniak, M.S., and Ahmed, A.U. (2015). βIII-Tubulin Regulates
Breast Cancer Metastases to the Brain. Mol. Cancer Ther. 14, 1152–1161.
Kapoor, S., and Panda, D. (2012). Kinetic stabilization of microtubule dynamics by indanocine
perturbs EB1 localization, induces defects in cell polarity and inhibits migration of
MDA-MB-231 cells. Biochem. Pharmacol. 83, 1495–1506.
Karagiannis, G.S., Goswami, S., Jones, J.G., Oktay, M.H., and Condeelis, J.S. (2016).

198
Signatures of breast cancer metastasis at a glance. J. Cell Sci. 129, 1751–1758.
Kaufman, P.A., Awada, A., Twelves, C., Yelle, L., Perez, E.A., Velikova, G., Olivo, M.S., He,
Y., Dutcus, C.E., and Cortes, J. (2015). Phase III Open-Label Randomized Study of
Eribulin Mesylate Versus Capecitabine in Patients With Locally Advanced or
Metastatic Breast Cancer Previously Treated With an Anthracycline and a Taxane. J.
Clin. Oncol. JCO.2013.52.4892.
Kavallaris, M. (2010). Microtubules and resistance to tubulin-binding agents. Nat. Rev. Cancer
10, 194–204.
Kaverina, I., Krylyshkina, O., and Small, J.V. (1999). Microtubule targeting of substrate
contacts promotes their relaxation and dissociation. J. Cell Biol. 146, 1033–1044.
Kawasaki, Y., Senda, T., Ishidate, T., Koyama, R., Morishita, T., Iwayama, Y., Higuchi, O.,
and Akiyama, T. (2000). Asef, a link between the tumor suppressor APC and G-protein
signaling. Science 289, 1194–1197.
Kelly, T., Mueller, S.C., Yeh, Y., and Chen, W.T. (1994). Invadopodia promote proteolysis of
a wide variety of extracellular matrix proteins. J. Cell. Physiol. 158, 299–308.
Kenific, C.M., Wittmann, T., and Debnath, J. (2016). Autophagy in adhesion and migration. J.
Cell Sci. 129, 3685–3693.
Kikuchi, K., and Takahashi, K. (2008). WAVE2- and microtubule-dependent formation of long
protrusions and invasion of cancer cells cultured on three-dimensional extracellular
matrices. Cancer Sci. 99, 2252–2259.
Kirkbride, K.C., Sung, B.H., Sinha, S., and Weaver, A.M. (2011). Cortactin: a multifunctional
regulator of cellular invasiveness. Cell Adhes. Migr. 5, 187–198.
Klapholz, B., and Brown, N.H. (2017). Talin - the master of integrin adhesions. J. Cell Sci. 130,
2435–2446.
Klotz, D.M., Nelson, S.A., Kroboth, K., Newton, I.P., Radulescu, S., Ridgway, R.A., Sansom,
O.J., Appleton, P.L., and Näthke, I.S. (2012). The microtubule poison vinorelbine kills
cells independently of mitotic arrest and targets cells lacking the APC tumour
suppressor more effectively. J. Cell Sci. 125, 887–895.
Knauer, M., Cardoso, F., Wesseling, J., Bedard, P.L., Linn, S.C., Rutgers, E.J.T., and van ’t
Veer, L.J. (2010b). Identification of a low-risk subgroup of HER-2-positive breast
cancer by the 70-gene prognosis signature. Br. J. Cancer 103, 1788–1793.
Knauer, M., Mook, S., Rutgers, E.J.T., Bender, R.A., Hauptmann, M., van de Vijver, M.J.,
Koornstra, R.H.T., Bueno-de-Mesquita, J.M., Linn, S.C., and van ’t Veer, L.J. (2010a).
The predictive value of the 70-gene signature for adjuvant chemotherapy in early

199
breast cancer. Breast Cancer Res. Treat. 120, 655–661.
Komarova, Y., De Groot, C.O., Grigoriev, I., Gouveia, S.M., Munteanu, E.L., Schober, J.M.,
Honnappa, S., Buey, R.M., Hoogenraad, C.C., Dogterom, M., et al. (2009).
Mammalian end binding proteins control persistent microtubule growth. J. Cell Biol.
184, 691–706.
Komlodi-Pasztor, E., Sackett, D., Wilkerson, J., and Fojo, T. (2011). Mitosis is not a key target
of microtubule agents in patient tumors. Nat. Rev. Clin. Oncol. 8, 244–250.
Komlodi-Pasztor, E., Sackett, D.L., and Fojo, A.T. (2012). Inhibitors Targeting Mitosis: Tales
of How Great Drugs against a Promising Target Were Brought Down by a Flawed
Rationale. Clin. Cancer Res. 18, 51–63.
Krebs, A.M., Mitschke, J., Lasierra Losada, M., Schmalhofer, O., Boerries, M., Busch, H.,
Boettcher, M., Mougiakakos, D., Reichardt, W., Bronsert, P., et al. (2017). The EMT-
activator Zeb1 is a key factor for cell plasticity and promotes metastasis in pancreatic
cancer. Nat. Cell Biol. 19, 518–529.
Krylyshkina, O., Anderson, K.I., Kaverina, I., Upmann, I., Manstein, D.J., Small, J.V., and
Toomre, D.K. (2003). Nanometer targeting of microtubules to focal adhesions. J. Cell
Biol. 161, 853–859.
Kumar, P., and Wittmann, T. (2012). +TIPs: SxIPping along microtubule ends. Trends Cell
Biol. 22, 418–428.
Kumar, A., Manatschal, C., Rai, A., Grigoriev, I., Degen, M.S., Jaussi, R., Kretzschmar, I.,
Prota, A.E., Volkmer, R., Kammerer, R.A., et al. (2017). Short Linear Sequence Motif
LxxPTPh Targets Diverse Proteins to Growing Microtubule Ends. Struct. Lond. Engl.
1993 25, 924-932.e4.
Kumar, M., Mehra, S., Thakar, A., Shukla, N.K., Roychoudhary, A., Sharma, M.C., Ralhan,
R., and Chauhan, S.S. (2016). End Binding 1 (EB1) overexpression in oral lesions and
cancer: A biomarker of tumor progression and poor prognosis. Clin. Chim. Acta Int.
J. Clin. Chem. 459, 45–52.
Kumar, P., Lyle, K.S., Gierke, S., Matov, A., Danuser, G., and Wittmann, T. (2009). GSK3beta
phosphorylation modulates CLASP-microtubule association and lamella microtubule
attachment. J. Cell Biol. 184, 895–908.
Kwa, M.J., and Adams, S. (2018). Checkpoint inhibitors in triple-negative breast cancer
(TNBC): Where to go from here. Cancer.
Kwiatkowska, A., Didier, S., Fortin, S., Chuang, Y., White, T., Berens, M.E., Rushing, E.,
Eschbacher, J., Tran, N.L., Chan, A., et al. (2012). The small GTPase RhoG mediates

200
glioblastoma cell invasion. Mol. Cancer 11, 65.
Ladd, J.J., Busald, T., Johnson, M.M., Zhang, Q., Pitteri, S.J., Wang, H., Brenner, D.E., Lampe,
P.D., Kucherlapati, R., Feng, Z., et al. (2012). Increased plasma levels of the APC-
interacting protein MAPRE1, LRG1, and IGFBP2 preceding a diagnosis of colorectal
cancer in women. Cancer Prev. Res. Phila. Pa 5, 655–664.
Lafanechère, L., Courtay-Cahen, C., Kawakami, T., Jacrot, M., Rüdiger, M., Wehland, J., Job,
D., and Margolis, R.L. (1998). Suppression of tubulin tyrosine ligase during tumor
growth. J. Cell Sci. 111 ( Pt 2), 171–181.
Lagoutte, E., Villeneuve, C., Lafanechère, L., Wells, C.M., Jones, G.E., Chavrier, P., and Rossé,
C. (2016). LIMK Regulates Tumor-Cell Invasion and Matrix Degradation Through
Tyrosine Phosphorylation of MT1-MMP. Sci. Rep. 6, 24925.
Lambert, A.W., Pattabiraman, D.R., and Weinberg, R.A. (2017). Emerging Biological
Principles of Metastasis. Cell 168, 670–691.
Lener, T., Burgstaller, G., Crimaldi, L., Lach, S., and Gimona, M. (2006). Matrix-degrading
podosomes in smooth muscle cells. Eur. J. Cell Biol. 85, 183–189.
Leong, H.S., Robertson, A.E., Stoletov, K., Leith, S.J., Chin, C.A., Chien, A.E., Hague, M.N.,
Ablack, A., Carmine-Simmen, K., McPherson, V.A., et al. (2014). Invadopodia Are
Required for Cancer Cell Extravasation and Are a Therapeutic Target for Metastasis.
Cell Rep. 8, 1558–1570.
Li, C.M.-C., Chen, G., Dayton, T.L., Kim-Kiselak, C., Hoersch, S., Whittaker, C.A., Bronson,
R.T., Beer, D.G., Winslow, M.M., and Jacks, T. (2013). Differential Tks5 isoform
expression contributes to metastatic invasion of lung adenocarcinoma. Genes Dev. 27,
1557–1567.
Li, Y., Tondravi, M., Liu, J., Smith, E., Haudenschild, C.C., Kaczmarek, M., and Zhan, X.
(2001). Cortactin potentiates bone metastasis of breast cancer cells. Cancer Res. 61,
6906–6911.
Lizárraga, F., Poincloux, R., Romao, M., Montagnac, G., Le Dez, G., Bonne, I., Rigaill, G.,
Raposo, G., and Chavrier, P. (2009). Diaphanous-related formins are required for
invadopodia formation and invasion of breast tumor cells. Cancer Res. 69, 2792–2800.
Lock, P., Abram, C.L., Gibson, T., and Courtneidge, S.A. (1998). A new method for isolating
tyrosine kinase substrates used to identify Fish, an SH3 and PX domain-containing
protein, and Src substrate. EMBO J. 17, 4346–4357.
Look, M.P., van Putten, W.L.J., Duffy, M.J., Harbeck, N., Christensen, I.J., Thomssen, C.,
Kates, R., Spyratos, F., Fernö, M., Eppenberger-Castori, S., et al. (2002). Pooled

201
analysis of prognostic impact of urokinase-type plasminogen activator and its inhibitor
PAI-1 in 8377 breast cancer patients. J. Natl. Cancer Inst. 94, 116–128.
Luo, Y., Li, D., Ran, J., Yan, B., Chen, J., Dong, X., Liu, Z., Liu, R., Zhou, J., and Liu, M.
(2014). End-binding protein 1 stimulates paclitaxel sensitivity in breast cancer by
promoting its actions toward microtubule assembly and stability. Protein Cell 1–11.
Ly, N., Elkhatib, N., Bresteau, E., Piétrement, O., Khaled, M., Magiera, M.M., Janke, C., Le
Cam, E., Rutenberg, A.D., and Montagnac, G. (2016). αTAT1 controls longitudinal
spreading of acetylation marks from open microtubules extremities. Sci. Rep. 6,
35624.
Ma, J., and Jemal, A. (2013). Breast Cancer Statistics. In Breast Cancer Metastasis and Drug
Resistance, (Springer, New York, NY), pp. 1–18.
Mader, C.C., Oser, M., Magalhaes, M.A.O., Bravo-Cordero, J.J., Condeelis, J., Koleske, A.J.,
and Gil-Henn, H. (2011). An EGFR–Src–Arg–Cortactin Pathway Mediates Functional
Maturation of Invadopodia and Breast Cancer Cell Invasion. Cancer Res. 71, 1730–
1741.
Magalhaes, M.A.O., Larson, D.R., Mader, C.C., Bravo-Cordero, J.J., Gil-Henn, H., Oser, M.,
Chen, X., Koleske, A.J., and Condeelis, J. (2011). Cortactin phosphorylation regulates
cell invasion through a pH-dependent pathway. J. Cell Biol. 195, 903–920.
Maiato, H., Fairley, E.A.L., Rieder, C.L., Swedlow, J.R., Sunkel, C.E., and Earnshaw, W.C.
(2003). Human CLASP1 is an outer kinetochore component that regulates spindle
microtubule dynamics. Cell 113, 891–904.
Marchesin, V., Castro-Castro, A., Lodillinsky, C., Castagnino, A., Cyrta, J., Bonsang-Kitzis,
H., Fuhrmann, L., Irondelle, M., Infante, E., Montagnac, G., et al. (2015). ARF6-
JIP3/4 regulate endosomal tubules for MT1-MMP exocytosis in cancer invasion. J.
Cell Biol. 211, 339–358.
Marchisella, F., Coffey, E.T., and Hollos, P. (2016). Microtubule and microtubule associated
protein anomalies in psychiatric disease. Cytoskelet. Hoboken NJ 73, 596–611.
Margolis, R.L., and Wilson, L. (1981). Microtubule treadmills--possible molecular machinery.
Nature 293, 705–711.
Martin, M., Holmes, F.A., Ejlertsen, B., Delaloge, S., Moy, B., Iwata, H., Minckwitz, G. von,
Chia, S.K.L., Mansi, J., Barrios, C.H., et al. (2017). Neratinib after trastuzumab-based
adjuvant therapy in HER2-positive breast cancer (ExteNET): 5-year analysis of a
randomised, double-blind, placebo-controlled, phase 3 trial. Lancet Oncol. 18, 1688–
1700.

202
Marzo, I., and Naval, J. (2013). Antimitotic drugs in cancer chemotherapy: Promises and
pitfalls. Biochem. Pharmacol. 86, 703–710.
Maurer, S.P., Bieling, P., Cope, J., Hoenger, A., and Surrey, T. (2011). GTPgammaS
microtubules mimic the growing microtubule end structure recognized by end-binding
proteins (EBs). Proc. Natl. Acad. Sci. U. S. A. 108, 3988–3993.
Maurer, S.P., Cade, N.I., Bohner, G., Gustafsson, N., Boutant, E., and Surrey, T. (2014). EB1
Accelerates Two Conformational Transitions Important for Microtubule Maturation
and Dynamics. Curr. Biol. 24, 372–384.
McCartney, B.M., and Näthke, I.S. (2008). Cell regulation by the Apc protein: Apc as master
regulator of epithelia. Curr. Opin. Cell Biol. 20, 186–193.
McKean, P.G., Vaughan, S., and Gull, K. (2001). The extended tubulin superfamily. J. Cell Sci.
114, 2723–2733.
Mialhe, A., Lafanechère, L., Treilleux, I., Peloux, N., Dumontet, C., Brémond, A., Panh, M.H.,
Payan, R., Wehland, J., Margolis, R.L., et al. (2001). Tubulin detyrosination is a
frequent occurrence in breast cancers of poor prognosis. Cancer Res. 61, 5024–5027.
Mili, S., and Macara, I.G. (2009). RNA localization and polarity: from A(PC) to Z(BP). Trends
Cell Biol. 19, 156–164.
Miller, P.M., Folkmann, A.W., Maia, A.R.R., Efimova, N., Efimov, A., and Kaverina, I. (2009).
Golgi-derived CLASP-dependent microtubules control Golgi organization and
polarized trafficking in motile cells. Nat. Cell Biol. 11, 1069–1080.
Mimori-Kiyosue, Y. (2011). Shaping microtubules into diverse patterns: molecular connections
for setting up both ends. Cytoskelet. Hoboken NJ 68, 603–618.
Mimori-Kiyosue, Y., Grigoriev, I., Lansbergen, G., Sasaki, H., Matsui, C., Severin, F., Galjart,
N., Grosveld, F., Vorobjev, I., Tsukita, S., et al. (2005). CLASP1 and CLASP2 bind
to EB1 and regulate microtubule plus-end dynamics at the cell cortex. J. Cell Biol.
168, 141–153.
Mitchison, T.J. (2012). The proliferation rate paradox in antimitotic chemotherapy. Mol. Biol.
Cell 23, 1–6.
Mitchison, T., and Kirschner, M. (1984). Dynamic instability of microtubule growth. Nature
312, 237–242.
Mitchison, T.J., Pineda, J., Shi, J., and Florian, S. (2017). Is inflammatory micronucleation the
key to a successful anti-mitotic cancer drug? Open Biol. 7, 170182.
Mohan, R., Katrukha, E.A., Doodhi, H., Smal, I., Meijering, E., Kapitein, L.C., Steinmetz,
M.O., and Akhmanova, A. (2013). End-binding proteins sensitize microtubules to the

203
action of microtubule-targeting agents. Proc. Natl. Acad. Sci. U. S. A. 110, 8900–8905.
Molinski, T.F., Dalisay, D.S., Lievens, S.L., and Saludes, J.P. (2009). Drug development from
marine natural products. Nat. Rev. Drug Discov. 8, 69–85.
Montagnac, G., Meas-Yedid, V., Irondelle, M., Castro-Castro, A., Franco, M., Shida, T.,
Nachury, M.V., Benmerah, A., Olivo-Marin, J.-C., and Chavrier, P. (2013). αTAT1
catalyses microtubule acetylation at clathrin-coated pits. Nature 502, 567–570.
Monteiro, P., Rossé, C., Castro-Castro, A., Irondelle, M., Lagoutte, E., Paul-Gilloteaux, P.,
Desnos, C., Formstecher, E., Darchen, F., Perrais, D., et al. (2013). Endosomal WASH
and exocyst complexes control exocytosis of MT1-MMP at invadopodia. J. Cell Biol.
203, 1063–1079.
Moores, C.A., Perderiset, M., Kappeler, C., Kain, S., Drummond, D., Perkins, S.J., Chelly, J.,
Cross, R., Houdusse, A., and Francis, F. (2006). Distinct roles of doublecortin
modulating the microtubule cytoskeleton. EMBO J. 25, 4448–4457.
Mortuza, G.B., Cavazza, T., Garcia-Mayoral, M.F., Hermida, D., Peset, I., Pedrero, J.G.,
Merino, N., Blanco, F.J., Lyngsø, J., Bruix, M., et al. (2014). XTACC3–XMAP215
association reveals an asymmetric interaction promoting microtubule elongation. Nat.
Commun. 5.
Moshfegh, Y., Bravo-Cordero, J.J., Miskolci, V., Condeelis, J., and Hodgson, L. (2015). A
Trio-Rac1-Pak1 signalling axis drives invadopodia disassembly. Nat. Cell Biol. 17,
350–350.
Munemitsu, S., Souza, B., Müller, O., Albert, I., Rubinfeld, B., and Polakis, P. (1994). The
APC gene product associates with microtubules in vivo and promotes their assembly
in vitro. Cancer Res. 54, 3676–3681.
Murphy, D.A., and Courtneidge, S.A. (2011). The “ins” and “outs” of podosomes and
invadopodia: characteristics, formation and function. Nat. Rev. Mol. Cell Biol. 12,
413–426.
Nakagawa, H., Koyama, K., Murata, Y., Morito, M., Akiyama, T., and Nakamura, Y. (2000).
EB3, a novel member of the EB1 family preferentially expressed in the central nervous
system, binds to a CNS-specific APC homologue. Oncogene 19, 210–216.
Nakahara, H., Otani, T., Sasaki, T., Miura, Y., Takai, Y., and Kogo, M. (2003). Involvement of
Cdc42 and Rac small G proteins in invadopodia formation of RPMI7951 cells. Genes
Cells Devoted Mol. Cell. Mech. 8, 1019–1027.
Nakamura, M., Zhou, X.Z., and Lu, K.P. (2001). Critical role for the EB1 and APC interaction
in the regulation of microtubule polymerization. Curr. Biol. CB 11, 1062–1067.

204
Nakamura, S., Grigoriev, I., Nogi, T., Hamaji, T., Cassimeris, L., and Mimori-Kiyosue, Y.
(2012). Dissecting the Nanoscale Distributions and Functions of Microtubule-End-
Binding Proteins EB1 and ch-TOG in Interphase HeLa Cells. PLoS ONE 7, e51442.
Nawrotek, A., Knossow, M., and Gigant, B. (2011). The determinants that govern microtubule
assembly from the atomic structure of GTP-tubulin. J. Mol. Biol. 412, 35–42.
Neel, N.F., Rossman, K.L., Martin, T.D., Hayes, T.K., Yeh, J.J., and Der, C.J. (2012). The RalB
small GTPase mediates formation of invadopodia through a GTPase-activating
protein-independent function of the RalBP1/RLIP76 effector. Mol. Cell. Biol. 32,
1374–1386.
Nehlig, A., Molina, A., Rodrigues-Ferreira, S., Honoré, S., and Nahmias, C. (2017). Regulation
of end-binding protein EB1 in the control of microtubule dynamics. Cell. Mol. Life
Sci. CMLS 74, 2381–2393.
Nelson, S., and Nathke, I.S. (2013). Interactions and functions of the adenomatous polyposis
coli (APC) protein at a glance. J. Cell Sci. 126, 873–877.
Niethammer, P., Bastiaens, P., and Karsenti, E. (2004). Stathmin-tubulin interaction gradients
in motile and mitotic cells. Science 303, 1862–1866.
Nieto, M.A., Huang, R.Y.-J., Jackson, R.A., and Thiery, J.P. (2016). EMT: 2016. Cell 166, 21–
45.
Nieuwenhuis, J., Adamopoulos, A., Bleijerveld, O.B., Mazouzi, A., Stickel, E., Celie, P.,
Altelaar, M., Knipscheer, P., Perrakis, A., Blomen, V.A., et al. (2017). Vasohibins
encode tubulin detyrosinating activity. Science 358, 1453–1456.
Noetzel, T.L., Drechsel, D.N., Hyman, A.A., and Kinoshita, K. (2005). A comparison of the
ability of XMAP215 and tau to inhibit the microtubule destabilizing activity of
XKCM1. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 360, 591–594.
de Nonneville, A., Sabatier, R., Gonçalves, A., Extra, J.-M., Tarpin, C., Launay, S., Tassy, L.,
Viens, P., and Rousseau, F. (2017). Safety and efficacy of eribulin for “real-world”
older patients with metastatic breast cancer. J. Geriatr. Oncol.
Odenwald, M.A., Prosperi, J.R., and Goss, K.H. (2013). APC/β-catenin-rich complexes at
membrane protrusions regulate mammary tumor cell migration and mesenchymal
morphology. BMC Cancer 13, 12.
Oikawa, T., Itoh, T., and Takenawa, T. (2008). Sequential signals toward podosome formation
in NIH-src cells. J Cell Biol 182, 157–169.
Okada, K., Bartolini, F., Deaconescu, A.M., Moseley, J.B., Dogic, Z., Grigorieff, N.,
Gundersen, G.G., and Goode, B.L. (2010). Adenomatous polyposis coli protein

205
nucleates actin assembly and synergizes with the formin mDia1. J. Cell Biol. 189,
1087–1096.
Orgaz, J.L., Pandya, P., Dalmeida, R., Karagiannis, P., Sanchez-Laorden, B., Viros, A.,
Albrengues, J., Nestle, F.O., Ridley, A.J., Gaggioli, C., et al. (2014). Diverse matrix
metalloproteinase functions regulate cancer amoeboid migration. Nat. Commun. 5,
4255.
Oser, M., Yamaguchi, H., Mader, C.C., Bravo-Cordero, J.J., Arias, M., Chen, X., DesMarais,
V., Rheenen, J. van, Koleske, A.J., and Condeelis, J. (2009). Cortactin regulates cofilin
and N-WASp activities to control the stages of invadopodium assembly and
maturation. J. Cell Biol. 186, 571–587.
Oser, M., Dovas, A., Cox, D., and Condeelis, J. (2011). Nck1 and Grb2 localization patterns
can distinguish invadopodia from podosomes. Eur. J. Cell Biol. 90, 181–188.
Osmani, N., Peglion, F., Chavrier, P., and Etienne-Manneville, S. (2010). Cdc42 localization
and cell polarity depend on membrane traffic. J. Cell Biol. 191, 1261–1269.
Oudin, M.J., Hughes, S.K., Rohani, N., Moufarrej, M.N., Jones, J.G., Condeelis, J.S.,
Lauffenburger, D.A., and Gertler, F.B. (2016). Characterization of the expression of
the pro-metastatic Mena(INV) isoform during breast tumor progression. Clin. Exp.
Metastasis 33, 249–261.
Pagano, A., Honoré, S., Mohan, R., Berges, R., Akhmanova, A., and Braguer, D. (2012).
Epothilone B inhibits migration of glioblastoma cells by inducing microtubule
catastrophes and affecting EB1 accumulation at microtubule plus ends. Biochem.
Pharmacol. 84, 432–443.
Paget, S. (1889). THE DISTRIBUTION OF SECONDARY GROWTHS IN CANCER OF
THE BREAST. The Lancet 133, 571–573.
Paik, S., Shak, S., Tang, G., Kim, C., Baker, J., Cronin, M., Baehner, F.L., Walker, M.G.,
Watson, D., Park, T., et al. (2004). A Multigene Assay to Predict Recurrence of
Tamoxifen-Treated, Node-Negative Breast Cancer. N. Engl. J. Med. 351, 2817–2826.
Paik, S., Tang, G., Shak, S., Kim, C., Baker, J., Kim, W., Cronin, M., Baehner, F.L., Watson,
D., Bryant, J., et al. (2006). Gene expression and benefit of chemotherapy in women
with node-negative, estrogen receptor-positive breast cancer. J. Clin. Oncol. Off. J.
Am. Soc. Clin. Oncol. 24, 3726–3734.
Palamidessi, A., Frittoli, E., Garré, M., Faretta, M., Mione, M., Testa, I., Diaspro, A., Lanzetti,
L., Scita, G., and Di Fiore, P.P. (2008). Endocytic trafficking of Rac is required for the
spatial restriction of signaling in cell migration. Cell 134, 135–147.

206
Pang, M.-F., Georgoudaki, A.-M., Lambut, L., Johansson, J., Tabor, V., Hagikura, K., Jin, Y.,
Jansson, M., Alexander, J.S., Nelson, C.M., et al. (2016). TGF-β1-induced EMT
promotes targeted migration of breast cancer cells through the lymphatic system by
the activation of CCR7/CCL21-mediated chemotaxis. Oncogene 35, 748–760.
Parsons, J.T., Horwitz, A.R., and Schwartz, M.A. (2010). Cell adhesion: integrating
cytoskeletal dynamics and cellular tension. Nat. Rev. Mol. Cell Biol. 11, 633–643.
Pasquier, E., Kavallaris, M., and André, N. (2010). Metronomic chemotherapy: new rationale
for new directions. Nat. Rev. Clin. Oncol. 7, 455–465.
Patsialou, A., Wang, Y., Lin, J., Whitney, K., Goswami, S., Kenny, P.A., and Condeelis, J.S.
(2012). Selective gene-expression profiling of migratory tumor cells in vivo predicts
clinical outcome in breast cancer patients. Breast Cancer Res. BCR 14, R139.
Paturle-Lafanechère, L., Manier, M., Trigault, N., Pirollet, F., Mazarguil, H., and Job, D.
(1994). Accumulation of delta 2-tubulin, a major tubulin variant that cannot be
tyrosinated, in neuronal tissues and in stable microtubule assemblies. J. Cell Sci. 107
( Pt 6), 1529–1543.
Paul, C.D., Mistriotis, P., and Konstantopoulos, K. (2017). Cancer cell motility: lessons from
migration in confined spaces. Nat. Rev. Cancer 17, 131–140.
Paz, J., and Lüders, J. (2018). Microtubule-Organizing Centers: Towards a Minimal Parts List.
Trends Cell Biol. 28, 176–187.
Pecqueur, L., Duellberg, C., Dreier, B., Jiang, Q., Wang, C., Plückthun, A., Surrey, T., Gigant,
B., and Knossow, M. (2012). A designed ankyrin repeat protein selected to bind to
tubulin caps the microtubule plus end. Proc. Natl. Acad. Sci. U. S. A. 109, 12011–
12016.
Peris, L., Wagenbach, M., Lafanechère, L., Brocard, J., Moore, A.T., Kozielski, F., Job, D.,
Wordeman, L., and Andrieux, A. (2009). Motor-dependent microtubule disassembly
driven by tubulin tyrosination. J. Cell Biol. 185, 1159–1166.
Perou, C.M., Sørlie, T., Eisen, M.B., van de Rijn, M., Jeffrey, S.S., Rees, C.A., Pollack, J.R.,
Ross, D.T., Johnsen, H., Akslen, L.A., et al. (2000). Molecular portraits of human
breast tumours. Nature 406, 747–752.
Peters, J.D., Furlong, M.T., Asai, D.J., Harrison, M.L., and Geahlen, R.L. (1996). Syk, activated
by cross-linking the B-cell antigen receptor, localizes to the cytosol where it interacts
with and phosphorylates alpha-tubulin on tyrosine. J. Biol. Chem. 271, 4755–4762.
Pignatelli, J., Tumbarello, D.A., Schmidt, R.P., and Turner, C.E. (2012). Hic-5 promotes
invadopodia formation and invasion during TGF-β–induced epithelial–mesenchymal

207
transition. J. Cell Biol. 197, 421–437.
Pignatelli, J., Bravo-Cordero, J.J., Roh-Johnson, M., Gandhi, S.J., Wang, Y., Chen, X., Eddy,
R.J., Xue, A., Singer, R.H., Hodgson, L., et al. (2016). Macrophage-dependent tumor
cell transendothelial migration is mediated by Notch1/MenaINV-initiated
invadopodium formation. Sci. Rep. 6, 37874.
Piperno, G., and Fuller, M.T. (1985). Monoclonal antibodies specific for an acetylated form of
alpha-tubulin recognize the antigen in cilia and flagella from a variety of organisms.
J. Cell Biol. 101, 2085–2094.
Pollack, J.R., Sørlie, T., Perou, C.M., Rees, C.A., Jeffrey, S.S., Lonning, P.E., Tibshirani, R.,
Botstein, D., Børresen-Dale, A.-L., and Brown, P.O. (2002). Microarray analysis
reveals a major direct role of DNA copy number alteration in the transcriptional
program of human breast tumors. Proc. Natl. Acad. Sci. U. S. A. 99, 12963–12968.
Pollard, T.D., and Borisy, G.G. (2003). Cellular motility driven by assembly and disassembly
of actin filaments. Cell 112, 453–465.
Portran, D., Schaedel, L., Xu, Z., Théry, M., and Nachury, M.V. (2017). Tubulin acetylation
protects long-lived microtubules against mechanical ageing. Nat. Cell Biol. 19, 391–
398.
Powell, S.M., Zilz, N., Beazer-Barclay, Y., Bryan, T.M., Hamilton, S.R., Thibodeau, S.N.,
Vogelstein, B., and Kinzler, K.W. (1992). APC mutations occur early during colorectal
tumorigenesis. Nature 359, 235–237.
Qiang, L., Yu, W., Andreadis, A., Luo, M., and Baas, P.W. (2006). Tau protects microtubules
in the axon from severing by katanin. J. Neurosci. Off. J. Soc. Neurosci. 26, 3120–
3129.
Quintavalle, M., Elia, L., Price, J.H., Heynen-Genel, S., and Courtneidge, S.A. (2011). A Cell-
Based High-Content Screening Assay Reveals Activators and Inhibitors of Cancer
Cell Invasion. Sci Signal 4, ra49–ra49.
Rajadurai, C.V., Havrylov, S., Coelho, P.P., Ratcliffe, C.D.H., Zaoui, K., Huang, B.H., Monast,
A., Chughtai, N., Sangwan, V., Gertler, F.B., et al. (2016). 5′-Inositol phosphatase
SHIP2 recruits Mena to stabilize invadopodia for cancer cell invasion. J. Cell Biol.
214, 719–734.
Ramirez-Rios, S., Denarier, E., Prezel, E., Vinit, A., Stoppin-Mellet, V., Devred, F., Barbier,
P., Peyrot, V., Sayas, C.L., Avila, J., et al. (2016). Tau antagonizes end-binding protein
tracking at microtubule ends through a phosphorylation-dependent mechanism. Mol.
Biol. Cell 27, 2924–2934.

208
Ramkumar, A., Jong, B.Y., and Ori-McKenney, K.M. (2018). ReMAPping the microtubule
landscape: How phosphorylation dictates the activities of microtubule-associated
proteins. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 247, 138–155.
Ren, X.D., Kiosses, W.B., and Schwartz, M.A. (1999). Regulation of the small GTP-binding
protein Rho by cell adhesion and the cytoskeleton. EMBO J. 18, 578–585.
Robinson, B.D., Sica, G.L., Liu, Y.-F., Rohan, T.E., Gertler, F.B., Condeelis, J.S., and Jones,
J.G. (2009). Tumor microenvironment of metastasis in human breast carcinoma: a
potential prognostic marker linked to hematogenous dissemination. Clin. Cancer Res.
Off. J. Am. Assoc. Cancer Res. 15, 2433–2441.
Rooney, C., White, G., Nazgiewicz, A., Woodcock, S.A., Anderson, K.I., Ballestrem, C., and
Malliri, A. (2010). The Rac activator STEF (Tiam2) regulates cell migration by
microtubule-mediated focal adhesion disassembly. EMBO Rep. 11, 292–298.
Rossé, C., Lodillinsky, C., Fuhrmann, L., Nourieh, M., Monteiro, P., Irondelle, M., Lagoutte,
E., Vacher, S., Waharte, F., Paul-Gilloteaux, P., et al. (2014). Control of MT1-MMP
transport by atypical PKC during breast-cancer progression. Proc. Natl. Acad. Sci. U.
S. A. 111, E1872-1879.
Roussos, E.T., Goswami, S., Balsamo, M., Wang, Y., Stobezki, R., Adler, E., Robinson, B.D.,
Jones, J.G., Gertler, F.B., Condeelis, J.S., et al. (2011a). Mena invasive (Mena(INV))
and Mena11a isoforms play distinct roles in breast cancer cell cohesion and association
with TMEM. Clin. Exp. Metastasis 28, 515–527.
Roussos, E.T., Condeelis, J.S., and Patsialou, A. (2011b). Chemotaxis in cancer. Nat. Rev.
Cancer 11, 573–587.
Roussos, E.T., Balsamo, M., Alford, S.K., Wyckoff, J.B., Gligorijevic, B., Wang, Y., Pozzuto,
M., Stobezki, R., Goswami, S., Segall, J.E., et al. (2011c). Mena invasive (MenaINV)
promotes multicellular streaming motility and transendothelial migration in a mouse
model of breast cancer. J. Cell Sci. 124, 2120–2131.
Roux, K.J., Kim, D.I., Raida, M., and Burke, B. (2012). A promiscuous biotin ligase fusion
protein identifies proximal and interacting proteins in mammalian cells. J. Cell Biol.
196, 801–810.
Sabatier, R., Diéras, V., Pivot, X., Brain, E., Roché, H., Extra, J.-M., Monneur, A., Provansal,
M., Tarpin, C., Bertucci, F., et al. (2017). Safety Results and Analysis of Eribulin
Efficacy according to Previous Microtubules-Inhibitors Sensitivity in the French
Prospective Expanded Access Program for Heavily Pre-treated Metastatic Breast
Cancer. Cancer Res. Treat. Off. J. Korean Cancer Assoc.

209
Sadoul, K., and Khochbin, S. (2016). The growing landscape of tubulin acetylation: lysine 40
and many more. Biochem. J. 473, 1859–1868.
Saini, P., and Courtneidge, S.A. (2018). Tks adaptor proteins at a glance. J. Cell Sci. 131,
jcs203661.
Sakurai-Yageta, M., Recchi, C., Le Dez, G., Sibarita, J.-B., Daviet, L., Camonis, J., D’Souza-
Schorey, C., and Chavrier, P. (2008). The interaction of IQGAP1 with the exocyst
complex is required for tumor cell invasion downstream of Cdc42 and RhoA. J. Cell
Biol. 181, 985–998.
Sansom, O.J., Reed, K.R., Hayes, A.J., Ireland, H., Brinkmann, H., Newton, I.P., Batlle, E.,
Simon-Assmann, P., Clevers, H., Nathke, I.S., et al. (2004). Loss of Apc in vivo
immediately perturbs Wnt signaling, differentiation, and migration. Genes Dev. 18,
1385–1390.
Sanz-Moreno, V., and Marshall, C.J. (2010). The plasticity of cytoskeletal dynamics underlying
neoplastic cell migration. Curr. Opin. Cell Biol. 22, 690–696.
Sato, T.K., Overduin, M., and Emr, S.D. (2001). Location, Location, Location: Membrane
Targeting Directed by PX Domains. Science 294, 1881–1885.
Sayas, C.L., Tortosa, E., Bollati, F., Ramírez-Ríos, S., Arnal, I., and Avila, J. (2015). Tau
regulates the localization and function of End-binding proteins 1 and 3 in developing
neuronal cells. J. Neurochem. 133, 653–667.
Schimming, R., Mason, K.A., Hunter, N., Weil, M., Kishi, K., and Milas, L. (1999). Lack of
correlation between mitotic arrest or apoptosis and antitumor effect of docetaxel.
Cancer Chemother. Pharmacol. 43, 165–172.
Schlosshauer, P.W., Brown, S.A., Eisinger, K., Yan, Q., Guglielminetti, E.R., Parsons, R.,
Ellenson, L.H., and Kitajewski, J. (2000). APC truncation and increased beta-catenin
levels in a human breast cancer cell line. Carcinogenesis 21, 1453–1456.
Schöffski, P., Chawla, S., Maki, R.G., Italiano, A., Gelderblom, H., Choy, E., Grignani, G.,
Camargo, V., Bauer, S., Rha, S.Y., et al. (2016). Eribulin versus dacarbazine in
previously treated patients with advanced liposarcoma or leiomyosarcoma: a
randomised, open-label, multicentre, phase 3 trial. Lancet Lond. Engl. 387, 1629–
1637.
Schoumacher, M., Goldman, R.D., Louvard, D., and Vignjevic, D.M. (2010). Actin,
microtubules, and vimentin intermediate filaments cooperate for elongation of
invadopodia. J. Cell Biol. 189, 541–556.
Schuuring, E., Verhoeven, E., Mooi, W.J., and Michalides, R.J. (1992). Identification and

210
cloning of two overexpressed genes, U21B31/PRAD1 and EMS1, within the amplified
chromosome 11q13 region in human carcinomas. Oncogene 7, 355–361.
Schwartz, E.L. (2009). Antivascular actions of microtubule-binding drugs. Clin. Cancer Res.
Off. J. Am. Assoc. Cancer Res. 15, 2594–2601.
Seals, D.F., Azucena, E.F., Pass, I., Tesfay, L., Gordon, R., Woodrow, M., Resau, J.H., and
Courtneidge, S.A. (2005). The adaptor protein Tks5/Fish is required for podosome
formation and function, and for the protease-driven invasion of cancer cells. Cancer
Cell 7, 155–165.
Seetapun, D., Castle, B.T., McIntyre, A.J., Tran, P.T., and Odde, D.J. (2012). Estimating the
microtubule GTP cap size in vivo. Curr. Biol. CB 22, 1681–1687.
Senkus, E., Kyriakides, S., Ohno, S., Penault-Llorca, F., Poortmans, P., Rutgers, E., Zackrisson,
S., Cardoso, F., and ESMO Guidelines Committee (2015). Primary breast cancer:
ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann.
Oncol. Off. J. Eur. Soc. Med. Oncol. 26 Suppl 5, v8-30.
Sestak, I., Cuzick, J., Dowsett, M., Lopez-Knowles, E., Filipits, M., Dubsky, P., Cowens, J.W.,
Ferree, S., Schaper, C., Fesl, C., et al. (2015). Prediction of Late Distant Recurrence
After 5 Years of Endocrine Treatment: A Combined Analysis of Patients From the
Austrian Breast and Colorectal Cancer Study Group 8 and Arimidex, Tamoxifen Alone
or in Combination Randomized Trials Using the PAM50 Risk of Recurrence Score. J.
Clin. Oncol. 33, 916–922.
Sève, P., and Dumontet, C. (2008). Is class III beta-tubulin a predictive factor in patients
receiving tubulin-binding agents? Lancet Oncol. 9, 168–175.
Severin, F., Habermann, B., Huffaker, T., and Hyman, T. (2001). Stu2 promotes mitotic spindle
elongation in anaphase. J. Cell Biol. 153, 435–442.
Sharifi, M.N., Mowers, E.E., Drake, L.E., Collier, C., Chen, H., Zamora, M., Mui, S., and
Macleod, K.F. (2016). Autophagy Promotes Focal Adhesion Disassembly and Cell
Motility of Metastatic Tumor Cells through the Direct Interaction of Paxillin with LC3.
Cell Rep. 15, 1660–1672.
Sharma, V.P., Eddy, R., Entenberg, D., Kai, M., Gertler, F.B., and Condeelis, J. (2013). Tks5
and SHIP2 Regulate Invadopodium Maturation, but Not Initiation, in Breast
Carcinoma Cells. Curr. Biol. 23, 2079–2089.
Sharp, D.J., and Ross, J.L. (2012). Microtubule-severing enzymes at the cutting edge. J. Cell
Sci. 125, 2561–2569.
Shida, T., Cueva, J.G., Xu, Z., Goodman, M.B., and Nachury, M.V. (2010). The major alpha-

211
tubulin K40 acetyltransferase alphaTAT1 promotes rapid ciliogenesis and efficient
mechanosensation. Proc. Natl. Acad. Sci. U. S. A. 107, 21517–21522.
Siegel, R., Ma, J., Zou, Z., and Jemal, A. (2014). Cancer statistics, 2014. CA. Cancer J. Clin.
64, 9–29.
Sirajuddin, M., Rice, L.M., and Vale, R.D. (2014). Regulation of microtubule motors by tubulin
isotypes and post-translational modifications. Nat. Cell Biol. 16, 335–344.
Sledge, G.W., Toi, M., Neven, P., Sohn, J., Inoue, K., Pivot, X., Burdaeva, O., Okera, M.,
Masuda, N., Kaufman, P.A., et al. (2017). MONARCH 2: Abemaciclib in
Combination With Fulvestrant in Women With HR+/HER2- Advanced Breast Cancer
Who Had Progressed While Receiving Endocrine Therapy. J. Clin. Oncol. Off. J. Am.
Soc. Clin. Oncol. 35, 2875–2884.
Slep, K.C., Rogers, S.L., Elliott, S.L., Ohkura, H., Kolodziej, P.A., and Vale, R.D. (2005).
Structural determinants for EB1-mediated recruitment of APC and spectraplakins to
the microtubule plus end. J. Cell Biol. 168, 587–598.
Sørlie, T., Perou, C.M., Tibshirani, R., Aas, T., Geisler, S., Johnsen, H., Hastie, T., Eisen, M.B.,
van de Rijn, M., Jeffrey, S.S., et al. (2001). Gene expression patterns of breast
carcinomas distinguish tumor subclasses with clinical implications. Proc. Natl. Acad.
Sci. U. S. A. 98, 10869–10874.
Sorlie, T., Tibshirani, R., Parker, J., Hastie, T., Marron, J.S., Nobel, A., Deng, S., Johnsen, H.,
Pesich, R., Geisler, S., et al. (2003). Repeated observation of breast tumor subtypes in
independent gene expression data sets. Proc. Natl. Acad. Sci. U. S. A. 100, 8418–8423.
Soucek, K., Kamaid, A., Phung, A.D., Kubala, L., Bulinski, J.C., Harper, R.W., and Eiserich,
J.P. (2006). Normal and prostate cancer cells display distinct molecular profiles of
alpha-tubulin posttranslational modifications. The Prostate 66, 954–965.
Sparano, J.A., Gray, R.J., Makower, D.F., Pritchard, K.I., Albain, K.S., Hayes, D.F., Geyer,
C.E., Dees, E.C., Perez, E.A., Olson, J.A., et al. (2015). Prospective Validation of a
21-Gene Expression Assay in Breast Cancer. N. Engl. J. Med. 373, 2005–2014.
Stanton, S.E., Adams, S., and Disis, M.L. (2016). Variation in the Incidence and Magnitude of
Tumor-Infiltrating Lymphocytes in Breast Cancer Subtypes: A Systematic Review.
JAMA Oncol. 2, 1354–1360.
Steffen, A., Le Dez, G., Poincloux, R., Recchi, C., Nassoy, P., Rottner, K., Galli, T., and
Chavrier, P. (2008). MT1-MMP-dependent invasion is regulated by TI-
VAMP/VAMP7. Curr. Biol. CB 18, 926–931.
Stehbens, S., and Wittmann, T. (2012). Targeting and transport: How microtubules control focal

212
adhesion dynamics. J Cell Biol 198, 481–489.
Stehbens, S.J., Paszek, M., Pemble, H., Ettinger, A., Gierke, S., and Wittmann, T. (2014).
CLASPs link focal-adhesion-associated microtubule capture to localized exocytosis
and adhesion site turnover. Nat. Cell Biol. 16, 558–570.
Steinmetz, M.O. (2007). Structure and thermodynamics of the tubulin-stathmin interaction. J.
Struct. Biol. 158, 137–147.
Stoletov, K., Montel, V., Lester, R.D., Gonias, S.L., and Klemke, R. (2007). High-resolution
imaging of the dynamic tumor cell vascular interface in transparent zebrafish. Proc.
Natl. Acad. Sci. U. S. A. 104, 17406–17411.
Stylli, S.S., I, S.T.T., Verhagen, A.M., Xu, S.S., Pass, I., Courtneidge, S.A., and Lock, P.
(2009). Nck adaptor proteins link Tks5 to invadopodia actin regulation and ECM
degradation. J. Cell Sci. 122, 2727–2740.
Stypula-Cyrus, Y., Mutyal, N.N., Dela Cruz, M., Kunte, D.P., Radosevich, A.J., Wali, R., Roy,
H.K., and Backman, V. (2014). End-binding protein 1 (EB1) up-regulation is an early
event in colorectal carcinogenesis. FEBS Lett. 588, 829–835.
Su, L.K., Burrell, M., Hill, D.E., Gyuris, J., Brent, R., Wiltshire, R., Trent, J., Vogelstein, B.,
and Kinzler, K.W. (1995). APC binds to the novel protein EB1. Cancer Res. 55, 2972–
2977.
Sulzmaier, F.J., Jean, C., and Schlaepfer, D.D. (2014). FAK in cancer: mechanistic findings
and clinical applications. Nat. Rev. Cancer 14, 598–610.
Sun, X., Li, D., Yang, Y., Ren, Y., Li, J., Wang, Z., Dong, B., Liu, M., and Zhou, J. (2012).
Microtubule-binding protein CLIP-170 is a mediator of paclitaxel sensitivity. J. Pathol.
226, 666–673.
Swain, S.M., Clark, E., and Baselga, J. (2015). Treatment of HER2-positive metastatic breast
cancer. N. Engl. J. Med. 372, 1964–1965.
Swayampakula, M., McDonald, P.C., Vallejo, M., Coyaud, E., Chafe, S.C., Westerback, A.,
Venkateswaran, G., Shankar, J., Gao, G., Laurent, E.M.N., et al. (2017). The
interactome of metabolic enzyme carbonic anhydrase IX reveals novel roles in tumor
cell migration and invadopodia/MMP14-mediated invasion. Oncogene 36, 6244–
6261.
Taguchi, A., Rho, J.-H., Yan, Q., Zhang, Y., Zhao, Y., Xu, H., Tripathi, S.C., Wang, H.,
Brenner, D.E., Kucherlapati, M., et al. (2015). MAPRE1 as a plasma biomarker for
early-stage colorectal cancer and adenomas. Cancer Prev. Res. Phila. Pa 8, 1112–1119.
Tamura, N., Simon, J.E., Nayak, A., Shenoy, R., Hiroi, N., Boilot, V., Funahashi, A., and

213
Draviam, V.M. (2015). A proteomic study of mitotic phase-specific interactors of EB1
reveals a role for SXIP-mediated protein interactions in anaphase onset. Biol. Open 4,
155–169.
Tarone, G., Cirillo, D., Giancotti, F.G., Comoglio, P.M., and Marchisio, P.C. (1985). Rous
sarcoma virus-transformed fibroblasts adhere primarily at discrete protrusions of the
ventral membrane called podosomes. Exp. Cell Res. 159, 141–157.
Tischfield, M.A., Cederquist, G.Y., Gupta, M.L., and Engle, E.C. (2011). Phenotypic spectrum
of the tubulin-related disorders and functional implications of disease-causing
mutations. Curr. Opin. Genet. Dev. 21, 286–294.
Tolde, O., Rösel, D., Veselý, P., Folk, P., and Brábek, J. (2010). The structure of invadopodia
in a complex 3D environment. Eur. J. Cell Biol. 89, 674–680.
Tortosa, E., Galjart, N., Avila, J., and Sayas, C.L. (2013). MAP1B regulates microtubule
dynamics by sequestering EB1/3 in the cytosol of developing neuronal cells. EMBO
J. 32, 1293–1306.
Towle, M.J., Salvato, K.A., Wels, B.F., Aalfs, K.K., Zheng, W., Seletsky, B.M., Zhu, X., Lewis,
B.M., Kishi, Y., Yu, M.J., et al. (2011). Eribulin Induces Irreversible Mitotic
Blockade: Implications of Cell-Based Pharmacodynamics for In vivo Efficacy under
Intermittent Dosing Conditions. Cancer Res. 71, 496–505.
Tran, H.D., Luitel, K., Kim, M., Zhang, K., Longmore, G.D., and Tran, D.D. (2014). Transient
SNAIL1 expression is necessary for metastatic competence in breast cancer. Cancer
Res. 74, 6330–6340.
Tropini, C., Roth, E.A., Zanic, M., Gardner, M.K., and Howard, J. (2012). Islands containing
slowly hydrolyzable GTP analogs promote microtubule rescues. PloS One 7, e30103.
Vaart, B. van der, Akhmanova, A., and Straube, A. (2009). Regulation of microtubule dynamic
instability. Biochem. Soc. Trans. 37, 1007–1013.
Vaart, B. van der, Manatschal, C., Grigoriev, I., Olieric, V., Gouveia, S.M., Bjelić, S.,
Demmers, J., Vorobjev, I., Hoogenraad, C.C., Steinmetz, M.O., et al. (2011). SLAIN2
links microtubule plus end–tracking proteins and controls microtubule growth in
interphase. J. Cell Biol. 193, 1083–1099.
Van der Auwera, I., Van Laere, S.J., Van den Bosch, S.M., Van den Eynden, G.G., Trinh, B.X.,
van Dam, P.A., Colpaert, C.G., van Engeland, M., Van Marck, E.A., Vermeulen, P.B.,
et al. (2008). Aberrant methylation of the Adenomatous Polyposis Coli (APC) gene
promoter is associated with the inflammatory breast cancer phenotype. Br. J. Cancer
99, 1735–1742.

214
Varon, C., Tatin, F., Moreau, V., Van Obberghen-Schilling, E., Fernandez-Sauze, S., Reuzeau,
E., Kramer, I., and Génot, E. (2006). Transforming growth factor beta induces rosettes
of podosomes in primary aortic endothelial cells. Mol. Cell. Biol. 26, 3582–3594.
Verma, S., Miles, D., Gianni, L., Krop, I.E., Welslau, M., Baselga, J., Pegram, M., Oh, D.-Y.,
Diéras, V., Guardino, E., et al. (2012). Trastuzumab emtansine for HER2-positive
advanced breast cancer. N. Engl. J. Med. 367, 1783–1791.
Virmani, A.K., Rathi, A., Sathyanarayana, U.G., Padar, A., Huang, C.X., Cunnigham, H.T.,
Farinas, A.J., Milchgrub, S., Euhus, D.M., Gilcrease, M., et al. (2001). Aberrant
methylation of the adenomatous polyposis coli (APC) gene promoter 1A in breast and
lung carcinomas. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 7, 1998–2004.
Vitre, B., Coquelle, F.M., Heichette, C., Garnier, C., Chrétien, D., and Arnal, I. (2008). EB1
regulates microtubule dynamics and tubulin sheet closure in vitro. Nat. Cell Biol. 10,
415–421.
Wadsworth, P. (1999). Regional regulation of microtubule dynamics in polarized, motile cells.
Cell Motil. Cytoskeleton 42, 48–59.
Walker, R.A., O’Brien, E.T., Pryer, N.K., Soboeiro, M.F., Voter, W.A., Erickson, H.P., and
Salmon, E.D. (1988). Dynamic instability of individual microtubules analyzed by
video light microscopy: rate constants and transition frequencies. J. Cell Biol. 107,
1437–1448.
Wang, P.J., and Huffaker, T.C. (1997). Stu2p: A microtubule-binding protein that is an essential
component of the yeast spindle pole body. J. Cell Biol. 139, 1271–1280.
Wang, W., Zhang, H., Wang, X., Patterson, J., Winter, P., Graham, K., Ghosh, S., Lee, J.C.,
Katsetos, C.D., Mackey, J.R., et al. (2017). Novel mutations involving βI-, βIIA-, or
βIVB-tubulin isotypes with functional resemblance to βIII-tubulin in breast cancer.
Protoplasma 254, 1163–1173.
Wang, Y., Zhou, X., Zhu, H., Liu, S., Zhou, C., Zhang, G., Xue, L., Lu, N., Quan, L., Bai, J.,
et al. (2005). Overexpression of EB1 in human esophageal squamous cell carcinoma
(ESCC) may promote cellular growth by activating beta-catenin/TCF pathway.
Oncogene 24, 6637–6645.
Watanabe, T., Wang, S., Noritake, J., Sato, K., Fukata, M., Takefuji, M., Nakagawa, M., Izumi,
N., Akiyama, T., and Kaibuchi, K. (2004). Interaction with IQGAP1 links APC to
Rac1, Cdc42, and actin filaments during cell polarization and migration. Dev. Cell 7,
871–883.
Waterman-Storer, C.M., and Salmon, E.D. (1997). Microtubule dynamics: treadmilling comes

215
around again. Curr. Biol. CB 7, R369-372.
Weidmann, M.D., Surve, C.R., Eddy, R.J., Chen, X., Gertler, F.B., Sharma, V.P., and
Condeelis, J.S. (2016). MenaINVdysregulates cortactin phosphorylation to promote
invadopodium maturation. Sci. Rep. 6, 36142.
Weisbrich, A., Honnappa, S., Jaussi, R., Okhrimenko, O., Frey, D., Jelesarov, I., Akhmanova,
A., and Steinmetz, M.O. (2007). Structure-function relationship of CAP-Gly domains.
Nat. Struct. Mol. Biol. 14, 959–967.
Wen, Y., Eng, C.H., Schmoranzer, J., Cabrera-Poch, N., Morris, E.J.S., Chen, M., Wallar, B.J.,
Alberts, A.S., and Gundersen, G.G. (2004). EB1 and APC bind to mDia to stabilize
microtubules downstream of Rho and promote cell migration. Nat. Cell Biol. 6, 820–
830.
Widlund, P.O., Stear, J.H., Pozniakovsky, A., Zanic, M., Reber, S., Brouhard, G.J., Hyman,
A.A., and Howard, J. (2011). XMAP215 polymerase activity is built by combining
multiple tubulin-binding TOG domains and a basic lattice-binding region. Proc. Natl.
Acad. Sci. U. S. A. 108, 2741–2746.
Wiesner, C., Faix, J., Himmel, M., Bentzien, F., and Linder, S. (2010). KIF5B and
KIF3A/KIF3B kinesins drive MT1-MMP surface exposure, CD44 shedding, and
extracellular matrix degradation in primary macrophages. Blood 116, 1559–1569.
Wilson, L., Lopus, M., Miller, H.P., Azarenko, O., Riffle, S., Smith, J.A., and Jordan, M.A.
(2015). Effects of eribulin on microtubule binding and dynamic instability are
strengthened in the absence of the βIII tubulin isotype. Biochemistry (Mosc.) 54,
6482–6489.
Wolf, K., Wu, Y.I., Liu, Y., Geiger, J., Tam, E., Overall, C., Stack, M.S., and Friedl, P. (2007).
Multi-step pericellular proteolysis controls the transition from individual to collective
cancer cell invasion. Nat. Cell Biol. 9, 893–904.
Wolf, K., Te Lindert, M., Krause, M., Alexander, S., Te Riet, J., Willis, A.L., Hoffman, R.M.,
Figdor, C.G., Weiss, S.J., and Friedl, P. (2013). Physical limits of cell migration:
control by ECM space and nuclear deformation and tuning by proteolysis and traction
force. J. Cell Biol. 201, 1069–1084.
Wozniak, K.M., Vornov, J.J., Wu, Y., Liu, Y., Carozzi, V.A., Rodriguez-Menendez, V.,
Ballarini, E., Alberti, P., Pozzi, E., Semperboni, S., et al. (2018). Peripheral
Neuropathy Induced by Microtubule-Targeted Chemotherapies: Insights into Acute
Injury and Long-term Recovery. Cancer Res. 78, 817–829.
Xia, P., Wang, Z., Liu, X., Wu, B., Wang, J., Ward, T., Zhang, L., Ding, X., Gibbons, G., Shi,

216
Y., et al. (2012). EB1 acetylation by P300/CBP-associated factor (PCAF) ensures
accurate kinetochore-microtubule interactions in mitosis. Proc. Natl. Acad. Sci. U. S.
A. 109, 16564–16569.
Xia, P., Liu, X., Wu, B., Zhang, S., Song, X., Yao, P.Y., Lippincott-Schwartz, J., and Yao, X.
(2014). Superresolution imaging reveals structural features of EB1 in microtubule
plus-end tracking. Mol. Biol. Cell 25, 4166–4173.
Yamaguchi, H. (2012). Pathological roles of invadopodia in cancer invasion and metastasis.
Eur. J. Cell Biol. 91, 902–907.
Yamaguchi, H., Lorenz, M., Kempiak, S., Sarmiento, C., Coniglio, S., Symons, M., Segall, J.,
Eddy, R., Miki, H., Takenawa, T., et al. (2005). Molecular mechanisms of
invadopodium formation: the role of the N-WASP-Arp2/3 complex pathway and
cofilin. J. Cell Biol. 168, 441–452.
Yamana, N., Arakawa, Y., Nishino, T., Kurokawa, K., Tanji, M., Itoh, R.E., Monypenny, J.,
Ishizaki, T., Bito, H., Nozaki, K., et al. (2006). The Rho-mDia1 pathway regulates cell
polarity and focal adhesion turnover in migrating cells through mobilizing Apc and c-
Src. Mol. Cell. Biol. 26, 6844–6858.
Yu, X., and Machesky, L.M. (2012). Cells assemble invadopodia-like structures and invade
into matrigel in a matrix metalloprotease dependent manner in the circular invasion
assay. PloS One 7, e30605.
Zaidel-Bar, R., Itzkovitz, S., Ma’ayan, A., Iyengar, R., and Geiger, B. (2007). Functional atlas
of the integrin adhesome. Nat. Cell Biol. 9, 858–867.
Zambonin-Zallone, A., Teti, A., Carano, A., and Marchisio, P.C. (1988). The distribution of
podosomes in osteoclasts cultured on bone laminae: effect of retinol. J. Bone Miner.
Res. Off. J. Am. Soc. Bone Miner. Res. 3, 517–523.
Zanic, M., Stear, J.H., Hyman, A.A., and Howard, J. (2009). EB1 recognizes the nucleotide
state of tubulin in the microtubule lattice. PloS One 4, e7585.
Zanic, M., Widlund, P.O., Hyman, A.A., and Howard, J. (2013). Synergy between XMAP215
and EB1 increases microtubule growth rates to physiological levels. Nat. Cell Biol. 15,
688–693.
Zaoui, K., Honoré, S., Isnardon, D., Braguer, D., and Badache, A. (2008). Memo-RhoA-mDia1
signaling controls microtubules, the actin network, and adhesion site formation in
migrating cells. J. Cell Biol. 183, 401–408.
Zaoui, K., Benseddik, K., Daou, P., Salaun, D., and Badache, A. (2010). ErbB2 receptor
controls microtubule capture by recruiting ACF7 to the plasma membrane of migrating

217
cells. Proc. Natl. Acad. Sci. 107, 18517–18522.
Zhang, R., Alushin, G.M., Brown, A., and Nogales, E. (2015). Mechanistic Origin of
Microtubule Dynamic Instability and Its Modulation by EB Proteins. Cell 162, 849–
859.
Zheng, X., Carstens, J.L., Kim, J., Scheible, M., Kaye, J., Sugimoto, H., Wu, C.-C., LeBleu,
V.S., and Kalluri, R. (2015). Epithelial-to-mesenchymal transition is dispensable for
metastasis but induces chemoresistance in pancreatic cancer. Nature 527, 525–530.
Zimniak, T., Stengl, K., Mechtler, K., and Westermann, S. (2009). Phosphoregulation of the
budding yeast EB1 homologue Bim1p by Aurora/Ipl1p. J. Cell Biol. 186, 379–391.
Zumbrunn, J., Kinoshita, K., Hyman, A.A., and Näthke, I.S. (2001). Binding of the
adenomatous polyposis coli protein to microtubules increases microtubule stability
and is regulated by GSK3 beta phosphorylation. Curr. Biol. CB 11, 44–49.
(1998). Polychemotherapy for early breast cancer: an overview of the randomised trials. Early
Breast Cancer Trialists’ Collaborative Group. Lancet Lond. Engl. 352, 930–942.
(2001). Current Protocols in Cell Biology (Hoboken, NJ, USA: John Wiley & Sons, Inc.).
(2012). WHO classification of tumours of the breast: views of a working group that convened
for a consensus and editorial meeting at the International Agency for Research on
Cancer (IARC), Lyon, September 1 - 3, 2011 (Lyon: Internat. Agency for Research on
Cancer).
(2013). Estimation nationale de l’incidence et de la mortalité par cancer en France entre 1980
et 2012: étude à partir des registres des cancers du réseau Francim (Saint-Maurice:
Institut de veille sanitaire).
Browse the SEER Cancer Statistics Review 1975-2014.

Intitulés des doctorats AMU


Mentions et Spécialités des doctorats votées en CS le 16/10/2012
d. ED 62 – SCIENCES DE LA VIE ET DE LA SANTE
• Biologie
o Biochimie structurale
o Génomique et Bioinformatique
o Biologie du développement
o Immunologie
o Génétique
o Microbiologie
o Biologie végétale
• Neurosciences

218
• Pathologie humaine
o Oncologie
o Maladies infectieuses
o Génétique humaine
o Conseil en Génétique
o Pathologie vasculaire et nutrition
o Ethique
o Recherche clinique et Santé Publique

e. ED 67 – SCIENCES JURIDIQUES ET POLITIQUES


• Droit privé
• Droit public
• Histoire du droit
• Droit
• Science politique

f. ED 184 – MATHEMATIQUES ET INFORMATIQUE


• Mathématiques
• Informatique
• Automatique

g. ED 250 – SCIENCES CHIMIQUES DE MARSEILLE


• Sciences chimiques

h. ED 251 – SCIENCES DE L’ENVIRONNEMENT


• Anthropologie biologique
• Ecologie
• Géosciences de l’environnement
• Génie des procédés
• Océanographie
• Chimie de l’environnement

i. ED 352 – PHYSIQUE ET SCIENCES DE LA MATIERE


• Astrophysique et Cosmologie
• Biophysique
• Energie, Rayonnement et Plasma
• Instrumentation
• Optique, Photonique et Traitement d’Image
• Physique des Particules et Astroparticules
• Physique Théorique et Mathématique
• Matière Condensée et Nanosciences

j. ED 353 – SCIENCES POUR L’INGENIEUR : MECANIQUE, PHYSIQUE,

219
MICRO ET NANOELECTRONIQUE
• Energétique
• Mécanique et Physique des Fluides
• Acoustique
• Mécanique des Solides
• Micro et Nanoélectronique
• Génie Civil et Architecture

k. ED 354 – LANGUES, LETTRES ET ARTS


• Etudes anglophones
• Etudes germaniques
• Etudes slaves
• Langue et littérature chinoises
• Langue et Littérature françaises
• Littérature générale et comparée
• Arts plastiques et sciences de l’Art
• Musicologie
• Etudes cinématographiques
• Arts du spectacle

l. ED 355 – ESPACES, CULTURES, SOCIETES


• Géographie
• Urbanisme et Aménagement du territoire
• Préhistoire
• Archéologie
• Histoire de l’Art
• Histoire
• Sciences de l’Antiquité
• Mondes arabe, musulman et sémitique
• Etudes romanes
• Sociologie
• Anthropologie
• Architecture

m. ED 356 – COGNITION, LANGAGE, EDUCATION


• Philosophie
• Psychologie
• Sciences du Langage
• Sciences de l’Information et de la Communication
• Sciences de l’Education

220
n. ED 372 – SCIENCES ECONOMIQUES ET DE GESTION
• Sciences de Gestion
• Sciences Economiques
• Sciences Economiques : AMSE

o. ED 463 – SCIENCES DU MOUVEMENT HUMAIN


• Sciences du Mouvement Humain
• Biomécanique
• Contrôle Perceptivo-Moteur et Apprentissage
• Physiologie de l’exercice
• Sciences de l’Homme et de la Société

221

Vous aimerez peut-être aussi