com
EAMCET Botany Model Test
www.sakshieducation.com
www.sakshieducation.com
3) Richmond-Lang effect hormone 4) Bolting hormone
12. Read the following lists and choose the correct match
List – I List – II A B C D
Parasitic in cells having
A) Virus with ssDNA I) 1) II III IV V
peptidoglycan cell wall
Forms irregularly shape and sized
B) Plant virus with dsDNA II) chloretic areas on leaf of plant with 2) I II IV V
2n = 48
Causes disease in plant with
C) Plant virus with dsRNA III) compound corymb and parietal *3) I III IV II
placentation
Causes stunting in plants with
D) Plant virus with ssRNA IV) 4) I V IV II
caryopsis fruit.
Forms malformation in plants with
V)
hesperidium fruit
13. [A]: Triticum aestivum is naturally formed polyploid
[R]: Polyploids are common in Poaceae
1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false *4) A is false but R is true
14. Crop variety that shows anti-ethylene influence is
1) Roundup ready *2) Flavr-Savr 3) Taipei 4) Transgenic papaya
15. Study the following lists and choose the correct match
List – I List – II A B C D
A) Pusa Moti I) Pure line selection 1) IV III V I
B) Kufri safed II) Polyploidy breeding 2) V III IV I
C) Aruna III) Clonal selection 3) III IV V II
D) Bread wheat IV) Mutational breeding *4) V III IV II
V) Mass selection
16. During stomatal opening of Photoactive plants, the decrease in water potential of guard cells is
due to
1) Passive movement of H+ into guard cells 2) Active movement of Cl- into guard cells
3) Active movement of K+ into guard cells *4) Active movement of H+ into subsidiary cells
17. If the number of ATP used for the production of 6 hexoses in dark reaction of Maize is equal to
the number of ATP used during carbon assimilation in the dark reaction of Chlorella for the
production of ‘n’ number of hexoses, then ‘n’ is
1) 12 *2) 10 3) 6 4) 18
18. The following reaction is catalyzed by a protein in mitochondrial matrix but the reaction is not an
integral part of Tricarboxylic acid cycle.
1) Conversion of Phosphoenol pyruvic acid to Pyruvic acid
*2) Oxidative decarboxylation of Pyruvic acid
3) Oxidative decarboxylation of Oxalo Succinic acid
4) Oxidation of Succinic acid.
19. Genetic code for serine is degenerate, because the codons for Serine are
I. UCG II. CGU III. GCU IV. AGU
1) II, III *2) I, IV 3) I, III 4) I, II, III
20. Study the following table showing the components of water potential during day time in linearly
arranged mesophyll cells P, Q, R, and S from xylem towards substomatal chamber. Arrange
them in a sequence of nearest to farthest to sub-stomatal chamber.
Cell Osmotic potential (MPa) Pressure potential (MPa)
www.sakshieducation.com
www.sakshieducation.com
P -0.31 0.031
Q -0.50 0.40
R -0.44 0.23
S -0.25 0.10
1) Q,P,R,S *2) P, R, S, Q 3) Q, R, P, S4) Q, S, R, P
21. [A]: Calcium is an essential element in Plant Nutrition
[R]: Calcium plays an important role in mitosis
*1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false 4) A is false but R is true
22. Choose the pair of physiological effects of two phytohormones that are synthesized from
connecting link of Glycolysis and Kreb’s cycle.
I. Promotion of seed germination II. Inhibition of seed germination
III. Promotion of Apical dominance IV. Promotion of Stomatal opening
*1) I, II 2) III, IV 3) I, III 4) II, IV
23. Arrange the following with respect to the correct order of formation of the following sugar
phosphates in Calvin cycle.
I. Glyceraldehyde phosphate II. Ribulose monophosphate
III. Xylulose monophosphate IV. Fructose monophosphate
1) I, IV, II, III 2) IV, I, III, II *3) I, IV, III, II 4) I, III, IV, II
2) Energy conservation site of respiratory electron transport chain is
I. Complex I II. Complex II III. Complex III IV. Complex IV
1) I, II 2) II, III, IV 3) III and IV *4) I, III, IV
24. [A]: Citric acid cycle is an oxidation pathway
[R]: C-C bonds are not formed during TCA cycle
1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
*3) A is true but R is false 4) A is false but R is true
25. This intermediate of Glycolysis, which is CO2 acceptor in C4 plants is formed by the catalytic
activity of
1) Mutase 2) Kinase *3) Enolase 4) Dehydrogenase
26. Study the following table with respect to C2 cycle and choose the correct combinations
Chloroplast Peroxisome Mitochondrion
I) O2 is utilized O2 is generated NH4+ is released
II) ATP are utilized O2 is utilized NADPH are generated
III) CO2 is utilized H2O2 is liberated CO2 is liberated
IV) NADPH are produced NADPH are used Glycine is formed
1) II, III 2) I, IV *3) I, II 4) III, IV
27. [A]: Calvin Benson cycle is also called as Reductive Pentose Phosphate cycle
[R]: In C3 cycle the oxidation state of Carbon of CO2 is reduced to zero or one or two.
*1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false 4) A is false but R is true
28. Xylulose-5-phosphate formed in C3 cycle has the carbon atoms directly obtained from
I. Glyceraldehyde-3-phosphate II. Fructose-6-phosphate
III. Sedohaptulose-7-phosphate IV. Dihydroxyacetone phosphate
1) I, II 2) II, III 3) II,III, IV *4) I, II, III
29. [A]: Light harvesting complex is involved in Photochemical reaction.
[R]: Light harvesting complex pigments transfer the absorbed light energy to reaction centre
www.sakshieducation.com
www.sakshieducation.com
1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false *4) A is false but R is true
30. [A]: Grana thylakoids have more PS II than PS I
[R]: Granum has more oppressed region than non-oppressed region
*1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false 4) A is false but R is true
31. [A]: Q cycle helps in transport of more protons than electrons
[R]: During photosynthetic electron transport, out of two electrons accepted by PQ, one is
transported linearly and the remaining one is carried in cyclic manner via Cytochrome b6.
*1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false 4) A is false but R is true
32. From the following explanations, identify the correct ones with respect to respiration of an obligate aerobe
which is provided one molecule of Glucose and one molecule of Oxygen.
I. The net gain of ATP is 6 II. Krebs cycle does not occur
III. Electron transport system is not operated
IV. Respiration comes to an end with the formation of Pyruvic acid
1) I, II 2) II, III, IV 3) I, II, IV 4) III, IV
33. Study the following with respect to inner membrane of Mitochondrion and choose the correct groups.
Component Function 1 Function 2
+
I) Complex I Transfers H from matrix to Reduces UQ
perimitochondrial space
II) Complex II Involved in ETS and Krebs cycle Reduces Co.Q
III) Complex III Has Cytochrome C1 Can directly reduce O2
IV) Complex IV Has no Fe-S centers For each e- transfer removes
4 H+ from matrix
1) II, III *2) I, II 3) I, IV 4) II, IV
34. Arrange the following components of ETS in a sequence with respect to their first involvement during
aerobic breakdown of a molecule of Glucose.
A. Complex I B. Complex II C. UQ D. Complex III
E. Cytochrome C F. Complex IV
1) A, B, C, D, E, F 2) B, C, D, E, F, A *3) C, D, E, F, A, B 4) C, D, E, F, B, A
35. During Aerobic oxidation a molecule of Glucose, after removal of how many protons of the matrix of
mitochondrion, there is involvement of Complex II.
1) 72 2) 80 3) 104 *4) 88
36. Arrange the following respiratory substrates in an order of gradual increase in the number of Oxygen atoms
consumed during oxidation of each its molecules.
I. Oleic acid II. Tartaric acid III. Malic acid IV. Tripalmitin
1) II, III, IV, I 2) III, II, I, IV 3) III, II, IV, I *4) II, III, I, IV
37. The sequence of bases in the coding region of mRNA of E.coli is 5' AUGUGUAGCUUUUGA 3'. If its
translation is started with reading frame having GUG, the following events of translation do not occur for the
translation of the given mRNA.
I. Activation of amino acids II. Chain initiation
III. Involvement of Releasing factors IV. Chain elongation
1) II, IV 2) I, III, IV *3) Only IV 4) All
38. Arrange the involvement of following parts of initiator tRNA in correct sequence during translation.
I. Anticodon arm II. Acceptor arm
III. DHU arm IV. Ribosome recognition arm
1) II, I, III, IV 2) II, III, I, IV *3) III, II, I, IV 4) II, IV, III, I
www.sakshieducation.com
www.sakshieducation.com
39. Choose the correct statements with respect to biological nitrogen fixation.
I. Both component I and Component II of nitrogenase have Mo.
- +
II. Nitrogenase accepts both e and H from Ferredoxin.
III. Pyruvic acid supplies both e- and H+ for the reduction of N2.
IV. 2 ATP are utilized for the transfer of an electron from Pyruvic acid to N2.
1) I, III 2) II, III *3) III, IV 4) II, IV
40. The following stage of nitrogen cycle can not be completed with the involvement of only one species.
1) Nitrogen fixation 2) Ammonification *3) Nitrification 4) Denitrification
43. Study the following with respect to nitrogen cycle and identify the correct math
List – I List – II A B C D
A) N2 → 2NH3 I) Nitrosomonas *1) III V I II
B) RCHNH2COOH → NH3 II) Micrococcus 2) III V IV II
C) NH3 → NO2 III) Clostridium 3) IV III II V
D) NO3 → N2 IV) Nitrobacter 4) III II I IV
V) Bacillus
44. Study the following table with respect to structures of Symbiotic Biological nitrogen fixation and choose the
correct combinations
Microsymbiont Host character 1 Host character 2
I) Rhizobium Anterior odd petal Marginal placentation
II) Frankia Whorled phyllotaxy Sorosis
III) Nostoc Sporophyte parasitic on gametophyte Atracheate
IV) Anabaena Free floating hydrophyte Sessile archegonia
1) All except IV 2) All *3) All except I 4) II and III only
45. If the coding region of mRNA has 600 nucleotides, the number of tRNA molecules that can bind to A-site of
ribosome during translation is
1) 200 2) 199 *3) 198 4) 598
46. Codons that can not be recognized by tRNA are recognized by
1) rRNA 2) IF3 3) EFT *4) RF2
47. Arrange the involvement of the following in correct sequence during translation for the formation of a
polypeptide chain.
I. RF3 II. IF2 III. EFG IV. IF3
V. RF1 VI. IF1
www.sakshieducation.com
www.sakshieducation.com
1) VI, II, IV, III, V, I *2) IV, VI, II, III, V, I 3) IV, II, VI, III, V, I 4) IV, VI, II, III, I, V
48. If a mRNA has information for the formation of protein as 5' AUGUUUUCAAGUUCGGGGUAA 3', the amino
acid with free –COOH group in the formed protein must be
1) Serine 2) Phenyl Alanine 3) Methionine *4) Glycine
49. If the number of translocations during the formation of a polypeptide chain on a ribosome is 200, the total
number of GTP utilized during translation is
1) 399 2) 199 3) 201 *4) 401
50. Study the following table and choose the correct combination
Substrate/s Enzyme Product/s
I) Oxaloacetate, Aectyl Citrate synthetase Citric acid, Co.A
Co.A
II) Succinyl Co.A, ADP Thiokinase Succinic acid, ATP, Co.A
III) Fumaric acid Fumarase Malic acid
IV) Citric acid Aconitase Cis-aconitic aicid
From the above identify the correct sets that utilize H2O in their respective reactions.
1) I, II 2) III, IV 3) II, III, IV *4) I, II, III
51. Identify the respiratory substrates whose RQ in aerobic respiration is equivalent to Glucose
I. Pyruvic acid II. Glyceraldehyde-3-phosphate
III. Acetyl Co.A IV. 1,3 bisphospho glyceric acid
1) I, II *2) II, III 3) only II 4) III, IV
52. Morphologically similar Parenchyma cells A, B, C and D are kept respectively in solution P having 1%
Sucrose, Q with 2% sucrose solution, R with 3% sucrose solution and S with 4% sucrose solution. Cell D
has shown withdrawal of plasma membrane at the corners and the other cells have not shown any such
signs. Choose the correct statements among the following.
I. Cell A is isotonic to solution P II. Cell B is isotonic to solution Q
III. Cell C is isotonic to solution R IV. Cell D is hypotonic to solution S
1) All except IV 2) All except III
*3) All except I and II 4) All except III and IV
www.sakshieducation.com
www.sakshieducation.com
1) 76 *2) 60 3) 40 4) 80
57. A, B, C and D are the mycelia of a species of Rhizopus. Zygospore formation is seen when A is grown
along with D. Zygospore formation is noticed when B is grown along with C. When C is with D no such
zygospore formatin is noticed. With respect to this information choose the correct statements.
I. Zygospores can be formed when C is grown with A.
II. Zygophore formation can be noticed when B is grown with D.
III. Zygospores are not formed when B is grown with A.
IV. A and C belong to one type of strain and C and D belong to another type of strain.
*1) All except IV 2) All except III 3) only I and II are correct 4) II and IV are correct
58. Choose the wrong statements
1) A sporophyll of Pteris longifolia has 50 sori. 2) A sporophyll of Pteris vittata has 54 sori
3) Number of sori of Pteris sporophyll is equivalent to number of false indusia
*4) A unipinnate sporophyll of Pteris has 52 sori.
64. Study the following table and choose the correct combinations
Type of Crop in which it is applied Significance
Biofertiliser
I) Azolla pinnata Paddy Reduces the heavy metal levels in the crop
plants
II) Glomus Potato Improves the pest tolerance of the crop
III) Azospirillum Wheat Provides Growth hormones to crop
IV) Rhizobium Soybean Improves tolerance to water stress in the
crop
1) I and II 2) III and IV *3) II and III 4) III and IV
65. If a C3 plant Rubisco enzyme is involved in adding 6 CO2 to RuBP and later 6 O2 to another 6 RuBP in the
same chloroplast, the ratio between the carbon atoms fixed to carbon atoms lost in the cell is
www.sakshieducation.com
www.sakshieducation.com
1) 1:1 2) 4:3 3) 3:2 *4) 2:1
66. [A]: In Photosynthesis, the absorbed VIBYO of visible spectrum is used in the form of red photons.
[R]: The reaction centres of Photosytems II and I respectively have P680 and P700.
*1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false 4) A is false but R is true
67. Choose the correct statement
1) Plantlets can not be produced in tissue culture without embryogenesis
*2) Plantlets can not be produced in tissue culture without organogenesis
3) Plantlets can not be produced in tissue culture without callus formation
4) Plantlets can not be produced in tissue culture without embryogenesis and callus formation
68. The principle of sterilization is applied during
I. Nutrient medium preparation II. Preparation of Explant
III. Inoculation of explant IV. Acclimatisation
1) I and III 2) II and IV 3) I and IV *4) II and III
76. Study the following table and choose the correct combination
SCP organism Plant Group Demerit
I) Scenedesmus Algae Low cell density
II) Paecilomyces Bacterium High RNA content
III) Chaetomium Fungus Slow growth rate
IV) Brevibacterium Bacterium Poor in Methionine
*1) I, III 2) II, IV 3) I, II 4) III, IV
77. Study the following table and choose the correct combination
SCP organism Plant Group Demerit
I) Scenedesmus Algae Low cell density
II) Paecilomyces Bacterium High RNA content
III) Chaetomium Fungus Slow growth rate
IV) Brevibacterium Bacterium Poor in Methionine
*1) I, III 2) II, IV 3) I, II 4) III, IV
78. Varieties developed by the following methods are always heterozygous
I. Mass selection II. Pureline selection III. Clonal selection
1) I and II 2) II and III *3) I and III 4) I, II, III
79. Study the following table and choose the correct combination
Crop Method used for development Variety developed
I) Paddy Pureline selection IR-8
II) Bajra Mass selection Pusa Moti
III) Cotton Mass selection Dodahatti Local
IV) Mango Clonal selection Kufri Safed
1) I and II 2) III and IV *3) II and III 4) I and IV
80. Match the following with respect to Hybridisation
List – I List – II A B C D
A) Selfing in Parent I) To select the desirable hybrids 1) III II I V
B) Emasculation II) To avoid self pollination 2) III II V IV
C) Bagging III) To develop homozygosity 3) II III IV I
D) Selfing in F1 plants IV) Artificial cross pollination *4) III II V I
V) To avoid unwanted cross pollination
81. [A]: Agar Agar is used in making semisolid media
[R]: It provides required carbohydrates to the explant in tissue culture.
1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
*3) A is true but R is false 4) A is false but R is true
82. One of the following is first to induce test tube fertilization in Plants.
1) M.O. P. Iyengar *2) P.C.Maheswari 3) Birbal Sahni 4) Nawaschin
83. Match the following
List – I List – II A B C D
Gametophyte parasitic on
A) I) Fire Moss 1) II V IV I
sporophyte of another species
A gametophyte possesses
B) gametophyte of another species as II) Pyricularia *2) II IV V I
symbiont
Sporophyte of a species parasitic
C) III) Chlorella 3) III IV V II
on sporophyte of another species
www.sakshieducation.com
www.sakshieducation.com
Sporophyte of a species parasitic
D) on the gametophyte of the same IV) Anthoceros 4) II III I V
species
V) Orobanche
84. Modified aerial adventitious roots are seen in
I. Asparagus II. Tinospora III. Jussiaea IV. Striga
1) I and II 2) II and III 3) III and IV 4) I and IV
85. Functional modified roots eventually become functionless in
1) Taeniophyllum 2) Avicennia 3) Vanda *4) Santalum
86. Choose the correct statement
*1) Phylloclades have modified leaves
2) In Asparagus assimilatory branches arise in the axil of spines
3) A sucker has adventitious roots at every node
4) Offsets are horizontally growing axillary branches seen only in hydrophytes
87. Arrange the following plants in sequence of their modified stems showing positive geotropism to
negative geotropism.
I. Amorphophallus II. Helianthus tuberosus III. Lippia nodiflora IV. Chrysanthemum
1) III, II, IV, I 2) II, III, I, IV *3) II, III, IV, I 4) III, IV, I, II
88. Primary rachis lacks leaflets in
1) Tamarindus 2) Moringa *3) Acacia 4) Coriandrum
89. Arrange the following plants with gradual increase in the number of leaflets per leaf.
I. Clematis II. Hardwickia III. Pisum IV. Aegle
*1) II, IV, I, III 2) II, I, IV, III 3) I, II, III, IV 4) II, III, I, IV
90. Opening of flowers is neither centripetal nor centrifugal in
1) Coriandrum 2) Chrysanthemum 3) Jasminum *4) Ficus
91. Study the following table and choose the correct combination
Plant Leaf character Inflorescence character
I) Yucca Spinous leaf Compound cyme
II) Gynandropsis Pentafoliate compound Simple corymb
leaf
III) Coriandrum Decompound leaf Involucreated
IV) Acalypha Leaf mosaic Simple spike
1) I and II *2) II and III 3) III and IV 4) II and IV
92. [A]: Self pollination is absent in Vanda
[R]: Orchidaceae plants are self incompatible
1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false *4) A is false but R is true
93. Choose the plants in which 5 margins of their perianth lobes of a cycle are overlapped in their
aestivation.
I. Calyx of Hibiscus II. Corolla of Datura
III. Corolla of Crotalaria IV. Calyx of Catheranthus
1) I, II 2) III, IV 3) I, III *4) II, IV
94. Unilocular ovary with axile placentation is seen in
*1) Capsicum 2) Dianthus 3) Brassica 4) Cucurbita
www.sakshieducation.com
www.sakshieducation.com
95. If complete megaspore mother cell transforms into an embryosac, the ratio between the number
of meiotic and mitotic spindles is
1) 3:7 2) 4:3 *3) 3:4 4) 2:7
96. Mesocotyl is
1) Region of tigellum where cotyledon is inserted
*2) Region of tigellum between insertion of cotyledon and point of origin of coleoptyle
3) Region of tigellum between the point of origin of coleoptyle and coleorhiza
4) Region between plumule and cotyledonary node
97. Flowers of Kigelia are pollinated by
1) Bird 2) Insect *3) Mammal 4) Snail
98. Vienna code – 2006 was the outcome of
1) XVI International Botanical cogress *2) XVII International Botanical congress
3) XVIII International Botanical cogress 4) XIX International Botanical cogress
99. Match the following
List – I List – II A B C D
Classified plants on the basis of
A) Charak I) *1) II V IV I
Habit
Classifed Plant kingdom into 50
B) Susruta II) 2) II IV V I
groups
Classified plants on the basis of
C) Linnaeus III) 3) III V IV II
habitat
Classifed plant kingdom into 87
D) Theopharstus IV) 4) II V I IV
orders
Classified medicinal plants into
V)
37 sections
120. Study the following table and choose the correct combination
Plant Character Family
I) Sida cordifolia Pentalocular ovary Malvaceae
II) Ulex Spinous leaflets Fabaceae
III) Hyoscyamus niger Obliquely placed ovary Solanaceae
IV) Lilium Polyembryony Liliaceae
1) III, IV 2) I, II *3) II, III 4) I, IV
121. Study the following table and choose the correct combination
141. Study the following table and choose the correct combination
Fruit Feature I Feature II
I) Syconus Edible peduncle Several achenes
II) Sorosis Developed from racemose Always fleshy
inflorescence
III) Schizocarp Developed from multicarpellary ovary Splits vertically
IV) Hesperidium Developed from multicarpellary ovary Edible mesocarp
1) I and II 2) II and III 3) III and IV *4) I and III
142. The resolving power of human eye is
1) 1 mm *2) 0.1 mm 3) 10 µ 4) 0.5 mm
143. A DNA molecule has 150 hydrogen bonds. 14% of them are present in the 1st spiral, 16% in the
2nd spiral, 18% in the 3rd spiral, 20% in the 4th spiral, 14% in the 5th spiral and the remaining in the
6th spiral. The percentage of Adenine in the DNA molecule is
1) 25% 2) 30% 3) 20% 4) 15%
144. [A]: All dicots show secondary growth.
[R]: Vascular bundles of Dicot stem are open type.
www.sakshieducation.com
www.sakshieducation.com
1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false *4) A is false but R is true
145. Tracheids containing special tissue is seen in
1) Pinus 2) Ficus 3) Eucalyptus *4) Pothos
146. [A]: Vascular bundles of roots are described as separate vascular bundles.
[R]: Xylem and Phloem of root bundles are in different radii
1) Both A and R are true and R is the correct explanation of A
*2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false 4) A is false but R is true
147. Photosynthetic secondary tissue is
1) Periderm *2) Phelloderm 3) Exodermis 4) Exothecium
148. [A]: Cuticle is absent in ceratophyllum
[R]: Ceratophyllum is submerged hydrophyte
*1) Both A and R are true and R is the correct explanation of A
2) Both A and R are true but R is not the correct explanation of A
3) A is true but R is false 4) A is false but R is true
149. Choose the genotypes that show Mendelian recombinations
I. TT yy II. Tt YY III. Tt Yy IV. tt Yy
1) I and III 2) II and IV 3) I and III *4) I and IV
150. Trichoblasts are absent in
I. Assimilatory roots II. Adventitious roots III. Haustorial roots IV. Ectomycorrhizae
*1) I, III, IV 2) II, III, IV 3) I, II, IV 4) I, II, III
www.sakshieducation.com