Structure, Vol. 12, 18811889, October, 2004, 2004 Elsevier Ltd. All rights reserved.

DOI 10.1016/j.str.2004.08.006

A Novel Structure of DNA Repair Protein RecO from Deinococcus radiodurans

Nodar Makharashvili,1 Olga Koroleva,1 Sibes Bera,2 Duane P. Grandgenett,2 and Sergey Korolev1,* 1 Edward A. Doisy Department of Biochemistry and Molecular Biology 2 Institute for Molecular Virology Saint Louis University School of Medicine 1402 South Grand Boulevard St. Louis, Missouri 63104 (Daly et al., 1994b; Gutman et al., 1994; Kim et al., 2002). RecA homologs are found in all organisms and are essential for DNA repair processes that require homologous DNA pairing and recombination (Cox, 1999). Two different recombinational pathways exist in E. coli, the RecBCD and the RecF pathways, both of which require RecA functions. A third pathway of recombination, the RecE pathway, is found in some strains of E. coli and is thought to originate from cryptic prophage (Chang and Julin, 2001; Gillen et al., 1981). In E. coli, RecBCD is a predominant recombinational pathway and is responsible for the repairs of DSBs. In some bacteria, RecBCD is substituted by its functional analog AddAB (Chedin et al., 2000; Kooistra et al., 1988, 1993). Surprisingly, despite the extreme efficiency in DSB repair, the D. radiodurans genome lacks RecBC and AddAB homologs. Homology to RecE is also absent in the D. radiodurans genome. By contrast, most proteins associated with the RecF pathway have highly conserved homologs in D. radiodurans. The proteins of this pathway were originally characterized as a minor recombinational pathway in E. coli that functioned as a backup pathway to RecBCD. Later it was found to be essential for the repair of single-stranded DNA (ssDNA) gaps (SSGs) (Horii and Clark, 1973; Tseng et al., 1994; Wang and Smith, 1984). Moreover, in the absence of RecBCD, the RecF pathway can be activated by mutating specific nuclease genes, sbcB, sbcC (or sbcD), to fully complement the recBC phenotype with respect to recombination and sensitivity to DSB damage (Kowalczykowski et al., 1994; Lloyd and Buckman, 1985). Because of the absence of RecBC/ AddAB homologs, it seems reasonable to consider that the RecF pathway may be similarly upregulated in D. radiodurans. The proteins of the RecF pathway play a ubiquitous role in the recovery of arrested replication forks (Chow and Courcelle, 2004; Courcelle et al., 1997, 1999; Cox et al., 2000; Mahdi and Lloyd, 1989) and have functional analogs and sequence homologs in eukaryotes (Karow et al., 2000; Mohaghegh and Hickson, 2001). The failure to accurately replicate the genomic template in the presence of DNA damage is believed to be a primary cause of mutagenesis, genomic rearrangements, and lethality in all cells (Kuzminov, 1995). If a replication fork encounters the nick on one parental DNA strand, it produces DSBs and causes replication fork disintegration. When replication is halted by other types of DNA lesions or nonreplicable barriers, it produces SSGs (Kowalczykowski, 2000). The nonlethal and nonmutagenic completion of replication in such cases requires concerted actions of the RecBCD pathway in case of DSBs, and the RecF pathway in case of SSGs (Asai and Kogoma, 1994; Horii and Clark, 1973). Both pathways produce a similar intermediateextended ssDNA coated with RecAto initiate homologous strand pairing and/or recombinational repair (Courcelle et al., 1997; Cox, 2002; Donaldson et al., 2004). In the RecF pathway, nascent DNA is processed by RecQ helicase and RecJ nuclease to create extended

Summary Recovery of arrested replication requires coordinated action of DNA repair, replication, and recombination machineries. Bacterial RecO protein is a member of RecF recombination repair pathway important for replication recovery. RecO possesses two distinct activities in vitro, closely resembling those of eukaryotic protein Rad52: DNA annealing and RecA-mediated DNA recombination. Here we present the crystal structure of the RecO protein from the extremely radiation resistant bacteria Deinococcus radiodurans (DrRecO) and characterize its DNA binding and strand annealing properties. The RecO structure is totally different from the Rad52 structure. DrRecO is comprised of three structural domains: an N-terminal domain which adopts an OB-fold, a novel -helical domain, and an unusual zinc-binding domain. Sequence alignments suggest that the multidomain architecture is conserved between RecO proteins from other bacterial species and is suitable to elucidate sites of proteinprotein and DNA-protein interactions necessary for RecO functions during the replication recovery and DNA repair. Introduction The Deinococcaceae family of bacteria represents the most radiation resistant organisms known (Anderson et al., 1956; Battista et al., 1999; Minton, 1994). They belong to an ancient group of extremophilesThermos/Deinococcus (Makarova et al., 2001)and have remarkable resistance to a range of severe conditions that are known to damage DNA (Minton, 1994). The best characterized member of the family, Deinococcus radiodurans, is able to survive acute radiation up to 1.7 Mrads and successfully repair hundreds of double-stranded DNA (dsDNA) breaks (DSBs) without induced mutations (Daly et al., 1994a; Lin et al., 1999). The mechanism of such remarkable resistance to DNA damage is not known. Surprisingly, the number of DNA repair enzymes currently annotated in the D. radiodurans genome is less than found in E. coli (White et al., 1999). One of DNA repair proteins shown to be involved in repair of damage caused by acute radiation in D. radiodurans is RecA
*Correspondence: korolevs@slu.edu

Structure 1882

ssDNA, which subsequently gets coated with ssDNA binding protein (SSB). RecF, RecR, and RecO proteins, also known as replication/recombination mediators (Beernink and Morrical, 1999), limit the digestion of nascent DNA by RecQ and RecJ (Courcelle and Hanawalt, 1999), load RecA on SSB-coated ssDNA to initiate triplehelix filament formation with homologous dsDNA (Umezu and Kolodner, 1994), preserve such nucleoprotein filaments from disassembly (Shan et al., 1997), and prevent RecA filament extension beyond SSGs (Webb et al., 1997). Interestingly, the absence of RecQ and RecJ function does not prevent replication restart, although it causes elevated levels of illegitimate recombination and chromosome breakage. Disruption of RecFOR activities blocks the replication restart in UVdamaged E. coli (Courcelle et al., 1999). RecO forms an epistatic group with RecF and RecR (Morrison et al., 1989). Mutations in any one of these genes results in identical phenotypes with respect to recombinational assays, survival following DNA damage, and the resumption of the arrested replication fork (Chow and Courcelle, 2004; Courcelle et al., 2003; Liu et al., 1998). E. coli RecO (EcRecO) has two known activities in vitro. First, it facilitates annealing of homologous ssDNA, even in the presence of SSB (Kantake et al., 2002; Luisi-DeLuca and Kolodner, 1994). Second, together with RecR, it promotes RecA loading on SSBcoated ssDNA and facilitates the formation of triplestranded DNA protein filaments (Bork et al., 2001). The triple complex of RecO with RecF and RecR was shown to initiate formation of RecA-ssDNA filaments at the ss/ dsDNA junction of SSG (Morimatsu and Kowalczykowski, 2003). RecO may be considered as a functional homolog of the eukaryotic protein Rad52, which possesses similar strand annealing and strand exchange activities (Paques and Haber, 1999). In spite of the ubiquitous role of RecFOR proteins, there was no structural information available for them. Very recently, the structure of RecR from D. radiodurans was published (Lee et al., 2004). There was only a single report about crystallization of RecO from T. thermophilus, although the structure itself was not reported (Aono et al., 2003). In this report, we present the crystal structure of RecO protein from D. radiodurans (DrRecO), its DNA binding and annealing properties, analysis of the structure in light of known in vivo and in vitro activities of RecO, and the potential implications for DNA repair in Deinococcus radiodurans. Results DrRecO Structure The DrRecO structure was solved at 2.0 A resolution using a two-wavelength MAD data set collected near the absorption edge of zinc and refined to R 19.8% and Rfree 21.3% with excellent refinement and geometrical parameters. There are two molecules in the asymmetric unit, designated as A and B chains. Residues A1, A64, B43B46, B104, B238B244, and side chains of residues A42A44, A103, B100, B102, and B229 were omitted from the final model because of the poor electron density. Two molecules had identical conforma tions with overall rmsd of 0.8 A2 for 225 C atoms.

DrRecO forms an elongated globule with the approxi mate dimensions of 70 35 25 A (Figures 1A and 1B) comprising three structural domains: the N-terminal domain (NTD), which adopts a oligonucleotide/oligosaccharide binding fold (OB-fold) (Murzin, 1993); the C-terminal -helical domain (CTD) composed of six helices; and a zinc binding domain (ZnD), which is inserted between C and D of the CTD. The NTD and ZnD are located on opposite sides of the CTD. A search for similar structures with the program DALI (Walter et al., 1996) revealed a high degree of structural similarity of the NTD with other known proteins with OB-fold domains. No structural analogs with a Z score above 4 were found for the CTD or ZnD. The NTD adopts a typical structure for many nucleic acid binding proteins with OB-folds (Murzin, 1993), consisting of two three-stranded sheets with a strand 1 shared by both sheets. One end of the barrel (top of the barrel) formed by 1, 3, and a loop between 4 and 5 (referred as L45) is open in molecule A, while in molecule B, it is partially covered by the N terminus. The bottom of the barrel is covered by the flexible loop L34, which often adopts an -helical conformation in many OB-fold structures. In DrRecO, this loop is highly flexible. The loop was partially omitted from the model in molecule A and was modeled as a polyalanine in molecule B, where it is stabilized by interaction with the C terminus of molecule A. Unlike other ssDNA binding OB-folds, DrRecO NTD lacks surface-exposed aromatic residues near the canonical nucleic acid binding site, which usually make stacking interactions with DNA bases. Another unusual feature is a positively charged surface area formed around the top of the barrel and extended to the surface formed by 2 and 3 strands (Figure 1C). The later surface makes a positively charged shallow groove together with the A of the CTD. The CTD consists of six helices. The first three form a helical bundle that is parallel to the axis of the barrel. Helixes A and B contact the barrel through an extensive hydrophobic core. The C-terminal tail is ordered only in molecule A, where it interacts solely with L34 loop and 5 of the OB-fold of molecule B (Figure 1D). The ZnD connects helices C and D. It resembles the zinc ribbon fold found in the structure of the RPA protein (Bochkareva et al., 2000; Krishna et al., 2003). Zn2 is coordinated by two CXXC motifs separated by a long loop, but unlike in RPA, in DrRecO this loop is twisted 180 .

ssDNA Annealing and DNA Binding Because the sequence similarities between EcRecO and DrRecO are relatively low (21% identical residues and 51% homolgous residues) (Figure 2), we verified strand annealing and DNA binding properties of DrRecO (Figure 3). Measurements of strand annealing were done at 30 C with 1-and 10-fold excesses of protein versus DNA (Figure 3A). DrRecO in equal concentration to DNA did not show strand annealing activity, while a 10-fold excess of DrRecO clearly showed annealing activity. EcRecO annealed ssDNA at both concentrations. EcRecO in equal to DNA concentration annealed DNA at a rate

Crystal Structure of DNA-Annealing Protein RecO 1883

Figure 1. Ribbon Diagram of DrRecO and Surface Representation of the NTD and Its Interaction with the C Terminus of the Second Molecule (A) A ribbon representation of DrRecO structure. The protein is color-coded according to secondary structure elements, with numbered strands (green) and lettered helices (red). Zinc ion is shown as a cyan sphere, and zinc-coordinating cysteines are shown in stick representation. (B) Similar representation of DrRecO, but the molecule was rotated 90 around the vertical axis relative to the orientation in (A) (the N terminus is facing the viewer). (C) Surface representation of the NTD with the top part of the CTD in the same orientation as in (A) and color-coded according to the electrostatic potential, with blue color corresponding to positive charges and red to negative charges, calculated with program ICM. (D) Interaction of the C terminus of molecule A (shown as a stick representation in yellow) with the bottom of the barrel of molecule B (shown as a molecular surface) observed in the crystal structure.

comparable with a 1:10 ratio of DrRecO, while a 10-fold excess of EcRecO considerably increased the strandannealing rate. Our initial attempts to use electrophoretic mobility DNA shift assays to measure DNA binding by DrRecO and EcRecO were not successful. Alternatively, fluorescence polarization measurements were used to study the binding of both EcRecO and DrRecO to ssDNA and dsDNA. To estimate the DNA binding properties of each protein, we used a simple approximation of one binding site model to calculate the apparent dissociation constants for each data set (Figures 3B and 3C). EcRecO 11 ( 3) nM and dsDNA with bound ssDNA with KD 42 ( 6) nM. DrRecO bound ssDNA with KD 79 KD ( 7) nM and dsDNA with KD 480 ( 27) nM. It is worth to note that most of the EcRecO binding to ssDNA occurred in the range of 150 nM of protein concentration (insert in Figure 3B), and the binding of EcRecO to ssDNA was likely a more complex process than the approximation we used. Additional measurements will be necessary for detailed analysis of EcRecO DNA binding. Overall, both proteins bound ssDNA and dsDNA and had higher affinity to ssDNA, and EcRecO bound both DNA substrates with a higher affinity than DrRecO. These data resemble the previously reported DNA binding activity of EcRecO measured with nitrocellulose filter binding assays using ss- or dsDNA plasmids (LuisiDeLuca and Kolodner, 1994), where EcRecO also had higher affinity toward ssDNA. Modeling of EcRecO We modeled the structure of EcRecO to investigate the origin of different DNA binding affinities and strand annealing activities (Figure 4). The modeling was performed with program ICM (Cardozo et al., 1995) and was based on the DrRecO structure and multiple sequence alignment generated using RecO sequences from ten

different organisms (Figure 2). The positively charged groove formed by the OB-fold of the NTD and A of the CTD was well preserved in the EcRecO model. An extended surface of the CTD was also positively charged, thus providing an additional potential DNA binding site. EcRecO had an additional tryptophane residue (W18) at the end of the 1 which could be involved in stacking interactions with DNA bases as seen in other OB-fold structures. Interestingly, EcRecO lacked the four-cysteine zinc binding sequence. Only one out of four cysteines was preserved. Instead, there were additional histidine and a few acidic residues around this area that could potentially coordinate zinc or other divalent ion. The prediction of the secondary structure produced by the 3DPSSM program (Kelley et al., 2000) suggested a well-preserved pattern of secondary structure elements between DrRecO and EcRecO structures including the area around the zinc binding motif. Therefore, it is likely that a domain structurally similar to the DrRecO ZnD is also present in the EcRecO structure. Discussion Two activities have been reported for the RecO proteins: (1) annealing of complementary ssDNA to form duplex DNA and (2) facilitation of strand invasion and strand exchange by RecA protein. During strand annealing, RecO interacts with DNA and is likely involved in specific interactions with SSB, since it can anneal DNA strands coated with cognate SSB (Kantake et al., 2002). During the strand exchange, RecO interacts with SSB, RecR, and potentially with RecA (Umezu et al., 1993). The multidomain structure of DrRecO (Figure 1) is suitable for numerous interactions with other proteins and DNA. Indeed, all three structural domains may potentially be involved in protein-protein interactions. Interestingly,

Structure 1884

Figure 2. Multiple Alignment of 11 Distant RecO Sequences from Different Organisms Organisms are designated on the left of the alignment with the following abbreviations: Dr, D. radiodurans; Ec, E. coli; Bs, B. subtilis; Cp, C. pneumoniae; Fn, F. nucleatum; Mp, M. pulmonis; Rp, R. prowazekii; Sa, S. aureus; Tp, T. pallidum; Uu, Ureaplasma urealyticum; Xf, X. fastidiosa. Alignment was calculated with the program CLUSTLV (Pearson and Lipman, 1988), and the figure was prepared with the program ESPript2.0 (Gouet et al., 1999). Similar residues are highlighted in yellow, identical residues are in red, and zinc-coordinating cysteines of DrRecO and homologous cysteines in other sequences are highlighted by green. Secondary structure elements of DrRecO are shown above the sequences.

RecO has the least number of conserved residues among other RecF pathway proteins. This fact may reflect two points: (1) that the overall folding has to be preserved rather than specific active sites, and (2) that the recognition of other protein partners by RecO is species specific. All RecO proteins from diverse species are similar in length (Figure 2). Prediction of the secondary structure with the 3DPSSM program showed high degrees of conservation of secondary structure elements in spite of the low overall sequence homology. Therefore, the DrRecO tertiary structure should include all of the major structural domains common for RecO from other organisms. Structures of DrRecO Domains The NTD is the most apparent place for DNA binding. There are about 100 different OB-fold-containing structures in Protein Data Bank (Andreeva et al., 2004; Berman et al., 2000), and the nucleic acid binding group is the largest within known OB-folds (Bochkarev and

Bochkareva, 2004; Theobald et al., 2003). OB-folds tend to use a common ligand binding interface centered around strands 2 and 3. Together with surrounding loops, they form a single-stranded nucleic acid recognition surface, where a few nucleotides often bind through aromatic stacking interactions. Other types of interactions, including hydrogen bonding, hydrophobic packing, and polar interactions, are also contribute to binding, especially when extended surfaces are involved allowing interaction with longer ssDNA stretches. For example, in the E. coli SSB-DNA complex, a 35-mer ssDNA molecule was wrapped around a protein dimer (Raghunathan et al., 2000). The OB-fold domain of RecG protein interacts simultaneously with two ssDNA strands branching from a ds/ssDNA junction (Singleton et al., 2001). The DrRecO structure lacks aromatic residues in the vicinity of strands 2 and 3. There are few arginines that could potentially make stacking interactions with DNA bases, as shown in other structures (Peersen et

Crystal Structure of DNA-Annealing Protein RecO 1885

Figure 3. DNA-Annealing and Binding Properties of DrRecO and EcRecO (A) Annealing of complementary oligonucleotides. Two concentrations of both DrRecO and EcRecO proteins (10 nM and 100 nM) were used for measurements, and the concentration of DNA was 10 nM. The extent of DNA annealing was expressed as a percentage of the observed fluorescence quenching. (B) The ssDNA binding of DrRecO (dashed line) and EcRecO (solid line) to Fam-oligo1. The binding was monitored by measuring a change in fluorescence anisotropy of 10 nM solution of labeled oligonucleotide as a function of increasing protein concentrations. The results of titration were plotted as a relative anisotropy change. The initial phase of ssDNA binding (protein concentration less than 150 nM) is shown in the inset. (C) Similar measurements obtained with same ssDNA fragment annealed with complementary strand.

al., 2002). RecO proteins from other species do have aromatic residues in this region. For example, EcRecO has tryptophane (W18) at the end of strand 1, which could contribute to stronger ssDNA binding. Basic amino acids forming a positively charged groove around 3 are conserved throughout all species. This basic surface extends from the open top of the barrel toward the canonical nucleic acids binding site formed around 2 and 3 (Figure 1C). Other DNA binding OB-folds do not possess an extended positively charged surface around this area, because of the mixed types of interactions with DNA bases (Theobald et al., 2003). Thus, RecO may represent an unusual DNA binding OB-fold which interacts mostly with a DNA backbone. Such binding will leave DNA bases exposed to allow annealing with the complementary strand, similarly to the annealing model proposed for Rad52 (Singleton et al., 2002). Whether other sides of the DrRecO OB-fold contribute to DNA binding is difficult to predict based only on structural comparisons, since interactions of nucleic acids with OB-folds are very diverse in general. For example, if RecO can bind two ssDNA fragments like in the case of RecG, it would lead to DNA

Figure 4. EcRecO Model (A) Ribbon and (B) electrostatic potential surface representation of the EcRecO structures in the same orientation as DrRecO in Figure 1A. (C) Electrostatic potential surface representation of DrRecO molecule A in a similar orientation.

condensation on the RecO monomer as a mechanism of strand annealing (Singleton et al., 2001). The RecO OB-fold may be involved in protein-protein interactions as well. OB-folds were shown to interact also with peptides, and in the case of RPA, the same structural surface binds alternatively either to ssDNA or to peptide (Bochkareva et al., 2002). Interestingly, in the DrRecO crystal structure, the C terminus of molecule A is bound to the bottom of the barrel of molecule B, where it interacts with loop L34 and strand 5 (Figure 1D). The loop L34 is flexible, and its conformation may be stabilized through interactions with other protein partners or with DNA. In solution, DrRecO exist as a monomer under a variety of conditions, as analyzed by size-exclusion chromatography experiments (data not shown). Therefore, interactions between two monomers are likely a consequence of crystal packing. At the same time, existence of such interactions in the crystal structure evidences that these regions may be involved in protein-protein interactions in solution. The ZnD is located at the opposite side of CTD (Figure 1). It can be classified as a zinc ribbon structure (Krishna et al., 2003). A similar structural insert has been found in the DBD-C domain of the eukaryotic ssDNA binding protein RPA, where it forms an extension of the L12 loop of the OB-fold. The exact role of this domain is not known, but it was shown that zinc strongly modulates DNA binding activity of the RPA trimer by stabilizing the tertiary structure of the RPA70 C-terminal domain (Bochkareva et al., 2000, 2002). The zinc ribbon structure is also present in several known primase structures (Kato et al., 2003; Pan and Wigley, 2000), where it is attached to the edge of the sheet in both structures and probably is important for the stability of the sheet domain. In RecO, four cysteines of the zinc binding motif are conserved only in one-third of the RecO sequences and may be a species-specific feature. Interestingly, glycine 145 is the only absolutely conserved residue among more than 200 homologous sequences (data not shown). It is located next to the helix C (Figures 1 and 2) at the beginning of ZnD and may be essential for ZnD folding or stability. The 3DPSSM program predicts that

Structure 1886

similar structural elements exist in this region of EcRecO sequence. Zinc or other divalent ion can be coordinated by acidic residues, which are present in many RecO. In general, small zinc binding domains are involved in a broad range of molecular interactions from nucleic acid binding to protein-protein and membrane-protein interactions (Krishna et al., 2003; Leon and Roth, 2000). Taking into account the numerous protein partners of RecO, it is logical to presume that this domain is important for the binding of one or more partner proteins. The CTD may play a role of a structural scaffold keeping the OB-fold and ZnD together. It also may be involved in DNA binding through the positively charged groove formed with NTD and may interact with other proteins. For example, the C-terminal flexible tail binds NTD of the other molecule in our crystal structure (Figure 1D). Comparison with the Structure of the Rad52 N-Terminal Fragment Two in vitro activities of the EcRecO are similar to those observed with the eukaryotic Rad52 protein (Kantake et al., 2002). The two proteins do not share any noticeable sequence homology, but different sequences still can adopt a similar tertiary fold. The DrRecO structure does not resemble the folding of the Rad52 N-terminal domain (residues 1209), which was shown to have DNA-annealing activity (Singleton et al., 2002). The core of Rad521- structure. Monomers form an 11209 has a mixed fold symmetric ring with the deep positively charged groove on the outside surface of the ring. This groove was proposed to bind the phosphodiester backbone of ssDNA with bases pointing away from the surface of the protein, which should facilitate strand annealing. None of the DrRecO structural domains resembles the folding of the Rad521-209 subunit. In solution, both Ecand DrRecO existed as a monomers, although there were indications of protein oligomerization upon DNA binding (Luisi-DeLuca and Kolodner, 1994). Thus, it will be interesting to study whether these two proteins lacking sequence and structural similarities perform the same strand annealing and strand exchange reactions by similar mechanisms. The only weak structural resemblance is a positively charged groove formed by the NTD and CTD (Figure 1C). The positive charges of this groove in RecO are conserved through all species (Figures 2 and 4). In contrast to Rad52, where a deep and narrow positively charged groove can adopt only ssDNA, DrRecO forms a shallow groove which is suitable for binding of the phosphodiester backbone of both ssDNA and dsDNA. DNA Binding and Strand Annealing Properties We demonstrated that DrRecO binds both ss- and dsDNA and facilitates strand annealing. Comparatively to EcRecO, DrRecO had approximately 10% of the strand annealing activity of EcRecO and had weaker affinities of binding both ss- and dsDNA. DNA filter binding assays also demonstrated the overall trend of stronger DNA binding by EcRecO (data not shown). Currently, we cannot rule out the possibility that the identical purification protocol for DrRecO and EcRecO yields a smaller percentage of active protein in the case of

DrRecO, although EcRecO has much lower solubility and smaller overall yield during purification. At the same time, the modeling of EcRecO points to structural features which may explain a stronger DNA binding by EcRecO. There is an additional aromatic residue (tryptophan 18) near the conventional DNA binding site of the OB-fold in EcRecO, which may play role in ssDNA binding and, consequently, in strand annealing activity. The positively charged groove formed by NTD and CTD also possesses more basic side chains in EcRecO. The CTD of EcRecO has an additional extended positively charged surface area adjacent to the described above groove. These features may contribute to stronger ssand dsDNA binding. Whether the weaker strand annealing and DNA binding of DrRecO is of functional importance for efficient DNA repair needs to be investigated further. While the RecA-stimulated strand invasion activity of RecO logically fits into the RecF pathway for recombinational repair, the biological role of RecO strand annealing activity is unknown. RecO is the only strand annealing enzyme so far found in the D. radiodurans genome. Its weak strand annealing activity may suggest perhaps the overall downregulation of ssDNA annealing in this organism, which may help to lower possibilities of illegitimate recombination following massive chromosomes breakage. Such speculation should be considered with caution, since there could be other novel uncharacterized proteins with strand annealing activity in D. radiodurans. For example, a very weak homolog of Rad52 has been reported in D. radiodurans genome (Iyer et al., 2002). Multiple activities and numerous protein partners interacting with RecO during recombinational repair present an enormous challenge for its biochemical characterization. The high-resolution structure reported here will advance our understanding of the mechanism of RecO activity, for example allowing rational design of site-directed mutants of this protein and its better studied E. coli homolog. Specific features of RecO in D. radiodurans have to be further investigated using purified protein partners including RecA, SSB, and RecR from the same organism. Recent in vitro experiments have demonstrated different properties of the D. radiodurans RecA protein (DrRecA) in relation to the E. coli RecA (EcRecA) (Kim and Cox, 2002; Kim et al., 2002). The strand exchange by DrRecA occurs in the inverse order to that of EcRecA, where DrRecA first forms filaments on dsDNA and then interacts with the homologous ssDNA fragment. The relation of such observations with the in vivo activity of DrRecA is not known. At the same time, it points to potential differences of the mechanism of RecF proteins in D. radiodurans, which may play a role in the extreme efficiency for protection against illegitimate recombination, mutagenesis, and chromosome instability under conditions that generate hundreds of dsDNA breaks per genome.
Experimental Procedures Cloning, Expression, Purification, and Crystallization The gene DR0819 encoding the RecO homolog was amplified by polymerase chain reaction from D. radiodurans R1 genomic DNA obtained from the American Type Culture Collection and cloned into the pMCSG7 vector as described (Stols et al., 2002). The DrRecO

Crystal Structure of DNA-Annealing Protein RecO 1887

Table 1. Data Collection and Refinement Statistics Wavelength (A) Peak Inflection Refinement Resolution (A) No. protein non-H atoms No. Zn atoms No. water molecules No. reflections No. reflections, test set (5%) R (%)a Free R (%)a Rmsd bonds (A) Angles Overall B factor (A2) Ramachandran plotb Most favored regions (%) Allowed regions (%) Generously allowed (%) Disallowed (%)
a b

Resolution (A) 502.0 502.2

R Merge (%)a 4.6 (55.3) 5.2 (41.7)

Completeness (%)a 97.8 (94.6) 99.5 (98.1)

I/ at High Resolution 2.1 4.1

1.28255 1.28309

502.0 3590 2 273 43,228 2,299 19.8 (26.3) 21.3 (26.7) 0.008 1.7 32.9 91 9 0 0

Values for highest resolution shell: 2.02.07 A for peak data, 2.22.28 A for inflection point, and 2.02.05 A are shown in parentheses. Ramachandran plot parameters were calculated by program PROCHECK (Laskowski et al., 1993).

protein was expressed in E. coli strain BL21(DE3)pLysS (Novagen) in 1 liter Luria-Bertani media supplemented with 50 g/ml ampicillin and incubated at 37 C with shaking until the culture reached an OD of 0.5 at 600 nm. Expression of DrRecO was induced by adding IPTG (Calbiochem) to a final concentration of 0.5 mM. The culture was allowed to grow overnight with shaking at 16 C. Cells were harvested by centrifugation and lysed in buffer containing 0.5 M NaCl, 10% glycerol, 50 mM HEPES (pH 7.5), 0.1% Triton X100, 5 mM ME, 1 mM PMSF, and 0.5 mg/ml lysozyme. Cells were sonicated, and the insoluble cellular material was removed by centrifugation. DrRecO was purified from other proteins using Ni-NTA (Qiagen) affinity chromatography. Fractions containing DrRecO were incubated with TEV protease at molar ratio of 40:1 overnight at 4 C to cleave the N-terminal His-tag. The sample was passed through a NiNTA column to remove His-tagged proteins and other contaminants with elevated NiNTA affinity. Protein purity was assayed by Comassie blue-stained SDS-PAGE, and the concentration was determined using a Bradford protein assay kit. Typical yields were 30 mg of 98% pure protein from 1 liter of cell culture. Protein was stored in liquid nitrogen. RecO from E. coli (EcRecO) was cloned from plasmid pBLW21 (provided by Dr. M. Cox) into pMCSG7 and was expressed and purified similarly to DrRecO. DrRecO was crystallized by the hanging drop vapor diffusing method against the buffer containing 0.2 M MgCl2, 15% PEG 4K, and 0.1 M HEPES (pH 8.0). It formed monoclinic crystals with cell dimensions a 135.0 A, b 52.2 A, c 100.7 A, 107.09 , with two molecules per asymmetric unit. Crystals diffracted to 2.4 A with the MMX-007/RaxisIV X-ray system and to 2.0 A at the synchrotron beamline. Data Collection and Structure Determination Crystals were transferred into cryoprotectant solution containing crystallization solution with addition of 10% glycerol and 10% 2-methyl-2,4-pentanediol and flash frozen in liquid nitrogen. MAD data near the zinc absorption edge were collected at beamline 19BM of the Structural Biology Center at the Advanced Photon Source, ANL, and processed with HKL2000 (Otwinowski and Minor, 1997). The absorption edge for zinc was experimentally detected with a fluorescent scan from the crystal as described previously (Walsh et al., 1999). The structure was solved using the autoSHARP program, which automatically performed all steps from data scaling to model building with the ARP/wARP program (Perrakis et al., 1999). This

resulted in about 85% complete tracing of two molecules of DrRecO. The model was completed using program O and refined with program REFMAC (Murshudov et al., 1999). The statistics of data collection and structure refinement are shown in Table 1, and coordinates were deposited into PDB with ID code 1U5K. DNA Annealing DNA annealing was measured following the fluorescence quenching of ssDNA labeled at the 5 end with fluorescein (6-FAM) (TCCTTTTGA TAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAATTGC, designated as Fam-oligo1) upon annealing with complementary ssDNA labeled with Dabcyl at the 3 end (oligo2-Dab). Fam-oligo1 (10 nM) was incubated (30 ) in 200 l of reaction buffer containing 5 mM Mg(OAc)2, 5% glycerol, 10 mM HEPES (pH 7.5), and 2 mM ME at the indicated concentrations of proteins, followed by oligo2-Dab (10 nM) addition. Fluorescence was monitored with an SLM-Aminco spectrofluorometer set to excitation and emission wavelengths of 490 and 520 nm, respectively. Oligonucleotides were obtained from Integrated DNA Technologies. Fluorescence Polarization Spectroscopy DNA binding was measured using the fluorescent polarization anisotropy method as described (Heyduk et al., 1996). Fam-oligo1 (10 nM) alone or annealed with complementary nonlabeled ssDNA (oligo2) was incubated with different amount of proteins, and the polarization anisotropy was measured using a Fluoromax-3. Measurements involved excitation at 490 nm of fluorescein with polarized light and determination of the extent of the emitted light (520 nm) anisotropy, which depends on the rotational mobility of fluorochrome-labeled molecule in solution. DNA bound to protein has reduced mobility and increased anisotropy. The relative anisotropy change, AR (A A0)/A0, where A0 and A are anisotropy of free DNA and DNA bound to protein, respectively, was calculated as a function of increasing protein concentration. Data were fitted implicitly to the series of equations describing the simple approximation of one site binding model using Sigma plot software, with the apparent dissociation constant expressed as KD ([P]F[D]F)/[PD], where [P]F, [D]F, and [PD] are free protein, free DNA, and protein-DNA complex concentrations, respectively. Concentrations of free protein and free DNA can be expressed as [P]F [P]T [PD] and [D]F [D]T [PD], respectively, and [P]T and [D]T are total protein and DNA concentrations. In fitting, the relative anisotropy change was assumed to be directly proportional to the protein-DNA complex formed (Moss,

Structure 1888

2001): AR where C

C([D]T [P]T 0.5Amax/[D]T.

KD

(([D]T

[P]T

KD)2

4[D]T [P]T)),

Courcelle, J., and Hanawalt, P.C. (1999). RecQ and RecJ process blocked replication forks prior to the resumption of replication in UV-irradiated Escherichia coli. Mol. Gen. Genet. 262, 543551. Courcelle, J., Carswell-Crumpton, C., and Hanawalt, P.C. (1997). recF and recR are required for the resumption of replication at DNA replication forks in Escherichia coli. Proc. Natl. Acad. Sci. USA 94, 37143719. Courcelle, J., Crowley, D.J., and Hanawalt, P.C. (1999). Recovery of DNA replication in UV-irradiated Escherichia coli requires both excision repair and recF protein function. J. Bacteriol. 181, 916922. Courcelle, J., Donaldson, J.R., Chow, K.H., and Courcelle, C.T. (2003). DNA damage-induced replication fork regression and processing in Escherichia coli. Science 299, 10641067. Cox, M.M. (1999). Recombinational DNA repair in bacteria and the RecA protein. Prog. Nucleic Acid Res. Mol. Biol. 63, 311366. Cox, M.M. (2002). The nonmutagenic repair of broken replication forks via recombination. Mutat. Res. 510, 107120. Cox, M.M., Goodman, M.F., Kreuzer, K.N., Sherratt, D.J., Sandler, S.J., and Marians, K.J. (2000). The importance of repairing stalled replication forks. Nature 404, 3741. Daly, M.J., Ling, O., and Minton, K.W. (1994a). Interplasmidic recombination following irradiation of the radioresistant bacterium Deinococcus radiodurans. J. Bacteriol. 176, 75067515. Daly, M.J., Ouyang, L., Fuchs, P., and Minton, K.W. (1994b). In vivo damage and recA-dependent repair of plasmid and chromosomal DNA in the radiation-resistant bacterium Deinococcus radiodurans. J. Bacteriol. 176, 35083517. Donaldson, J.R., Courcelle, C.T., and Courcelle, J. (2004). RuvAB and RecG are not essential for the recovery of DNA synthesis following UV-induced DNA damage in Escherichia coli. Genetics 166, 16311640. Gillen, J.R., Willis, D.K., and Clark, A.J. (1981). Genetic analysis of the RecE pathway of genetic recombination in Escherichia coli K-12. J. Bacteriol. 145, 521532. Gouet, P., Courcelle, E., Stuart, D.I., and Metoz, F. (1999). ESPript: analysis of multiple sequence alignments in PostScript. Bioinformatics 15, 305308. Gutman, P.D., Carroll, J.D., Masters, C.I., and Minton, K.W. (1994). Sequencing, targeted mutagenesis and expression of a recA gene required for the extreme radioresistance of Deinococcus radiodurans. Gene 141, 3137. Heyduk, T., Ma, Y., Tang, H., and Ebright, R.H. (1996). Fluorescence anisotropy: rapid, quantitative assay for protein-DNA and proteinprotein interaction. Methods Enzymol. 274, 492503. Horii, Z., and Clark, A.J. (1973). Genetic analysis of the recF pathway to genetic recombination in Escherichia coli K12: isolation and characterization of mutants. J. Mol. Biol. 80, 327344. Iyer, L.M., Koonin, E.V., and Aravind, L. (2002). Classification and evolutionary history of the single-strand annealing proteins, RecT, Red , ERF and RAD52. BMC Genomics 3, 818. Kantake, N., Madiraju, M.V., Sugiyama, T., and Kowalczykowski, S.C. (2002). Escherichia coli RecO protein anneals ssDNA complexed with its cognate ssDNA-binding protein: a common step in genetic recombination. Proc. Natl. Acad. Sci. USA 99, 1532715332. Karow, J.K., Wu, L., and Hickson, I.D. (2000). RecQ family helicases: roles in cancer and aging. Curr. Opin. Genet. Dev. 10, 3238. Kato, M., Ito, T., Wagner, G., Richardson, C.C., and Ellenberger, T. (2003). Modular architecture of the bacteriophage T7 primase couples RNA primer synthesis to DNA synthesis. Mol. Cell 11, 13491360. Kelley, L.A., MacCallum, R.M., and Sternberg, M.J. (2000). Enhanced genome annotation using structural profiles in the program 3DPSSM. J. Mol. Biol. 299, 499520. Kim, J.I., and Cox, M.M. (2002). The RecA proteins of Deinococcus radiodurans and Escherichia coli promote DNA strand exchange via inverse pathways. Proc. Natl. Acad. Sci. USA 99, 79177921. Kim, J.I., Sharma, A.K., Abbott, S.N., Wood, E.A., Dwyer, D.W., Jambura, A., Minton, K.W., Inman, R.B., Daly, M.J., and Cox, M.M. (2002). RecA protein from the extremely radioresistant bacterium Deinococ-

Acknowledgments These studies were supported by the Doisy fund and an SLU Medical School start-up fund. We are grateful to T. Heyduk for help in DNA binding experiments and the opportunity to use his equipment in fluorescent measurements, to M. Cox for providing plasmid with EcRecO, to F. Collart and M. Donnaly for providing pMCSG3 and pMCSG7 vectors, to the staff of SBC at beamline 19BM, and to J. Courcelle, A. Niedziela-Majka, and O. Lubman for fruitful discussions during manuscript preparation. Use of the Argonne National Laboratory Structural Biology Center beamline at the Advanced Photon Source was supported by the U.S. Department of Energy, Office of Energy Research, under Contract No. W-31-109-ENG-38. Received: June 28, 2004 Revised: July 29, 2004 Accepted: August 11, 2004 Published: October 5, 2004 References Anderson, A.I., Nordan, H.C., Cain, F.R., Parrish, G., and Dugan, D. (1956). Studies on a radioresistant micrococcus. I. Isolation, morphology, cultural characteristics, and resistence to gamma radiation. Food Technol. 10, 575578. Andreeva, A., Howorth, D., Brenner, S.E., Hubbard, T.J., Chothia, C., and Murzin, A.G. (2004). SCOP database in 2004: refinements integrate structure and sequence family data. Nucleic Acids Res. 32, D226D229. Aono, S., Hartsch, T., and Schulze-Gahmen, U. (2003). Crystallization of a member of the recFOR DNA repair pathway, RecO, with and without bound oligonucleotide. Acta Crystallogr. D Biol. Crystallogr. 59, 576579. Asai, T., and Kogoma, T. (1994). The RecF pathway of homologous recombination can mediate the initiation of DNA damage-inducible replication of the Escherichia coli chromosome. J. Bacteriol. 176, 71137114. Battista, J.R., Earl, A.M., and Park, M.J. (1999). Why is Deinococcus radiodurans so resistant to ionizing radiation? Trends Microbiol. 7, 362365. Beernink, H.T., and Morrical, S.W. (1999). RMPs: recombination/ replication mediator proteins. Trends Biochem. Sci. 24, 385389. Berman, H.M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T.N., Weissig, H., Shindyalov, I.N., and Bourne, P.E. (2000). The Protein Data Bank. Nucleic Acids Res. 28, 235242. Bochkarev, A., and Bochkareva, E. (2004). From RPA to BRCA2: lessons from single-stranded DNA binding by the OB-fold. Curr. Opin. Struct. Biol. 14, 3642. Bochkareva, E., Korolev, S., and Bochkarev, A. (2000). The role for zinc in replication protein A. J. Biol. Chem. 275, 2733227338. Bochkareva, E., Korolev, S., Lees-Miller, S.P., and Bochkarev, A. (2002). Structure of the RPA trimerization core and its role in the multistep DNA-binding mechanism of RPA. EMBO J. 21, 18551863. Bork, J.M., Cox, M.M., and Inman, R.B. (2001). The RecOR proteins modulate RecA protein function at 5 ends of single- stranded DNA. EMBO J. 20, 73137322. Cardozo, T., Totrov, M., and Abagyan, R. (1995). Homology modeling by the ICM method. Proteins 23, 403414. Chang, H.W., and Julin, D.A. (2001). Structure and function of the Escherichia coli RecE protein, a member of the RecB nuclease domain family. J. Biol. Chem. 276, 4600446010. Chedin, F., Ehrlich, S.D., and Kowalczykowski, S.C. (2000). The Bacillus subtilis AddAB helicase/nuclease is regulated by its cognate Chi sequence in vitro. J. Mol. Biol. 298, 720. Chow, K.H., and Courcelle, J. (2004). RecO acts with RecF and RecR to protect and maintain replication forks blocked by UV-induced DNA damage in Escherichia coli. J. Biol. Chem. 279, 34923496.

Crystal Structure of DNA-Annealing Protein RecO 1889

cus radiodurans: expression, purification, and characterization. J. Bacteriol. 184, 16491660. Kooistra, J., Vosman, B., and Venema, G. (1988). Cloning and characterization of a Bacillus subtilis transcription unit involved in ATPdependent DNase synthesis. J. Bacteriol. 170, 47914797. Kooistra, J., Haijema, B.J., and Venema, G. (1993). The Bacillus subtilis addAB genes are fully functional in Escherichia coli. Mol. Microbiol. 7, 915923. Kowalczykowski, S.C. (2000). Initiation of genetic recombination and recombination-dependent replication. Trends Biochem. Sci. 25, 156165. Kowalczykowski, S.C., Dixon, D.A., Eggleston, A.K., Lauder, S.D., and Rehrauer, W.M. (1994). Biochemistry of homologous recombination in Escherichia coli. Microbiol. Rev. 58, 401465. Krishna, S.S., Majumdar, I., and Grishin, N.V. (2003). Structural classification of zinc fingers: survey and summary. Nucleic Acids Res. 31, 532550. Kuzminov, A. (1995). Collapse and repair of replication forks in Escherichia coli. Mol. Microbiol. 16, 373384. Laskowski, R.A., MacArthur, M.W., Moss, D.S., and Thornton, J.M. (1993). PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Crystallogr. 26, 283291. Lee, B.I., Kim, K.H., Park, S.J., Eom, S.H., Song, H.K., and Suh, S.W. (2004). Ring-shaped architecture of RecR: implications for its role in homologous recombinational DNA repair. EMBO J. 23, 20292038. Leon, O., and Roth, M. (2000). Zinc fingers: DNA binding and proteinprotein interactions. Biol. Res. 33, 2130. Lin, J., Qi, R., Aston, C., Jing, J., Anantharaman, T.S., Mishra, B., White, O., Daly, M.J., Minton, K.W., Venter, J.C., and Schwartz, D.C. (1999). Whole-genome shotgun optical mapping of Deinococcus radiodurans. Science 285, 15581562. Liu, Y.H., Cheng, A.J., and Wang, T.C. (1998). Involvement of recF, recO, and recR genes in UV-radiation mutagenesis of Escherichia coli. J. Bacteriol. 180, 17661770. Lloyd, R.G., and Buckman, C. (1985). Identification and genentic analysis of sbcC mutations in commonly used recBC sbcB strains of Escherichia coli K-12. J. Bacteriol. 164, 836844. Luisi-DeLuca, C., and Kolodner, R. (1994). Purification and characterization of the Escherichia coli RecO protein. Renaturation of complementary single-stranded DNA molecules catalyzed by the RecO protein. J. Mol. Biol. 236, 124138. Mahdi, A.A., and Lloyd, R.G. (1989). Identification of the recR locus of Escherichia coli K-12 and analysis of its role in recombination and DNA repair. Mol. Gen. Genet. 216, 503510. Makarova, K.S., Aravind, L., Wolf, Y.I., Tatusov, R.L., Minton, K.W., Koonin, E.V., and Daly, M.J. (2001). Genome of the extremely radiationresistant bacterium Deinococcus radiodurans viewed from the perspective of comparative genomics. Microbiol. Mol. Biol. Rev. 65, 4479. Minton, K.W. (1994). DNA repair in the extremely radioresistant bacterium Deinococcus radiodurans. Mol. Microbiol. 13, 915. Mohaghegh, P., and Hickson, I.D. (2001). DNA helicase deficiencies associated with cancer predisposition and premature ageing disorders. Hum. Mol. Genet. 10, 741746. Morimatsu, K., and Kowalczykowski, S.C. (2003). RecFOR proteins load RecA protein onto gapped DNA to accelerate DNA strand exchange. A universal step of recombinational repair. Mol. Cell 11, 13371347. Morrison, P.T., Lovett, S.T., Gilson, L.E., and Kolodner, R. (1989). Molecular analysis of the Escherichia coli recO gene. J. Bacteriol. 171, 36413649. Moss, T. (2001). DNA-Protein Interactions: Principles and Protocols, Second Edition (Totowa, NJ: Human Press Inc.). Murshudov, G.N., Vagin, A.A., Lebedev, A., Wilson, K.S., and Dodson, E.J. (1999). Efficient anisotropic refinement of macromolecular structures using FFT. Acta Crystallogr. D Biol. Crystallogr. 55, 247255. Murzin, A.G. (1993). OB(oligonucleotide/oligosaccharide binding)-fold: common structural and functional solution for non-homologous sequences. EMBO J. 12, 861867.

Otwinowski, Z., and Minor, W. (1997). Processing of X-Ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307326. Pan, H., and Wigley, D.B. (2000). Structure of the zinc-binding domain of Bacillus stearothermophilus DNA primase. Struct. Fold. Des. 8, 231239. Paques, F., and Haber, J.E. (1999). Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63, 349404. Pearson, W.R., and Lipman, D.J. (1988). Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85, 24442448. Peersen, O.B., Ruggles, J.A., and Schultz, S.C. (2002). Dimeric structure of the Oxytricha nova telomere end-binding protein alpha-subunit bound to ssDNA. Nat. Struct. Biol. 9, 182187. Perrakis, A., Morris, R., and Lamzin, V.S. (1999). Automated protein model building combined with iterative structure refinement. Nat. Struct. Biol. 6, 458463. Raghunathan, S., Kozlov, A.G., Lohman, T.M., and Waksman, G. (2000). Structure of the DNA binding domain of E. coli SSB bound to ssDNA. Nat. Struct. Biol. 7, 648652. Shan, Q., Bork, J.M., Webb, B.L., Inman, R.B., and Cox, M.M. (1997). RecA protein filaments: end-dependent dissociation from ssDNA and stabilization by RecO and RecR proteins. J. Mol. Biol. 265, 519540. Singleton, M.R., Scaife, S., and Wigley, D.B. (2001). Structural analysis of DNA replication fork reversal by RecG. Cell 107, 7989. Singleton, M.R., Wentzell, L.M., Liu, Y., West, S.C., and Wigley, D.B. (2002). Structure of the single-strand annealing domain of human RAD52 protein. Proc. Natl. Acad. Sci. USA 99, 1349213497. Stols, L., Gu, M., Dieckman, L., Raffen, R., Collart, F.R., and Donnelly, M.I. (2002). A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site. Protein Expr. Purif. 25, 815. Theobald, D.L., Mitton-Fry, R.M., and Wuttke, D.S. (2003). Nucleic acid recognition by OB-fold proteins. Annu. Rev. Biophys. Biomol. Struct. 32, 115133. Tseng, Y.C., Hung, J.L., and Wang, T.C. (1994). Involvement of RecF pathway recombination genes in postreplication repair in UV-irradiated Escherichia coli cells. Mutat. Res. 315, 19. Umezu, K., and Kolodner, R.D. (1994). Protein interactions in genetic recombination in Escherichia coli. Interactions involving RecO and RecR overcome the inhibition of RecA by single-stranded DNAbinding protein. J. Biol. Chem. 269, 3000530013. Umezu, K., Chi, N.W., and Kolodner, R.D. (1993). Biochemical interaction of the Escherichia coli RecF, RecO, and RecR proteins with RecA protein and single-stranded DNA binding protein. Proc. Natl. Acad. Sci. USA 90, 38753879. Walsh, M.A., Evans, G., Sanishvili, R., Dementieva, I., and Joachimiak, A. (1999). MAD data collectioncurrent trends. Acta Crystallogr. D Biol. Crystallogr. 55, 17261732. Walter, R.L., Ealick, S.E., Friedman, A.M., Blake, R.C., II, Proctor, P., and Shoham, M. (1996). Multiple wavelength anomalous diffraction (MAD) crystal structure of rusticyanin: a highly oxidizing cupredoxin with extreme acid stability. J. Mol. Biol. 263, 730751. Wang, T.V., and Smith, K.C. (1984). recF-dependent and recF recBindependent DNA gap-filling repair processes transfer dimer-containing parental strands to daughter strands in Escherichia coli K-12 uvrB. J. Bacteriol. 158, 727729. Webb, B.L., Cox, M.M., and Inman, R.B. (1997). Recombinational DNA repair: the RecF and RecR proteins limit the extension of RecA filaments beyond single-strand DNA gaps. Cell 91, 347356. White, O., Eisen, J.A., Heidelberg, J.F., Hickey, E.K., Peterson, J.D., Dodson, R.J., Haft, D.H., Gwinn, M.L., Nelson, W.C., Richardson, D.L., et al. (1999). Genome sequence of the radioresistant bacterium Deinococcus radiodurans R1. Science 286, 15711577. Accession Numbers Coordinates were deposited into the PDB with ID code 1U5K.