Académique Documents
Professionnel Documents
Culture Documents
Bioinformatics: Definition?
Definition: Computational methods for collecting, organizing, and analyzing large amounts of biological data
Biological Data
Biological Data
DNA sequence (A,T,G,C) RNA sequence (A,U,G,C) RNA abundance Protein sequence (20 amino acids) Protein abundance Protein structure and post-translational modifications Protein - protein interactions Protein - DNA (RNA) interactions Metabolic products and pathways
Bioinformatics: Scope
DNA sequence analysis Predicting genes Sequence alignment Phylogenetics Gene expression analysis DNA microarray data analysis High-throughput sequencing Protein sequence analysis Sequence alignment Secondary/tertiary structure prediction Proteomics Protein abundance, modifications, interactions Metabolomics Gene Networks / Mathematical Modeling
Central Dogma
Gene: Definition
Definition: A gene is a sequence of DNA that codes for an RNA; in protein-coding genes, the RNA in turn codes for a protein Transcription:
RNA Polymerase
DNA
Genetic Code
Translation: RNA Protein
5 GGCAUGGACCAUAGAGGACAGUGACAAAAAA 3
G Q Stop
Stop
Gene Elements: An open reading frame (ORF) Start codon (AUG) Intervening codons Stop codon (UAA, UAG, UGA) A promoter DNA sequences that regulate the transcription of the gene
intron
intron
Exons make up the processed mRNA sequence Exons contain the coding sequence, 5 UTR, and 3UTR Classes of Exons 5 exons Internal exons 3 exons intronless genes Introns are spliced out of the mRNA sequence Introns start with GU (GT) and end with an AG sequence
Genome Organization
transcriptional control
transport control
nuclear envelope
Stop
Gene Elements: An open reading frame (ORF) Start codon (AUG) Intervening codons Stop codon (UAA, UAG, UGA) A promoter DNA sequences that regulate the transcription of the gene
TATA box
Transcribed Region
Distal Promoter
Core Promoter
Promoter elements consist of short (~5-20 bp) DNA elements that serve as binding sites for transcription factor proteins Transcription factor proteins can activate or repress the transcription of an adjacent gene