Lipids (2011) 46:189199 DOI 10.

1007/s11745-010-3521-1

ORIGINAL ARTICLE

Insulin Stimulates Lipogenesis and Attenuates Beta-Oxidation in White Adipose Tissue of Fed Rainbow Trout
S. Polakof F. Medale L. Larroquet C. Vachot G. Corraze S. Panserat

Received: 23 September 2010 / Accepted: 20 December 2010 / Published online: 15 January 2011 AOCS 2011

Abstract As lipid deposition tissue in sh, the white adipose tissue (WAT) has important functions related to reproduction and the challenges of long-term fasting. In the study reported here, we infused sh fed a high-carbohydrate diet with two doses of insulin for 5 days in order to explore the effects of this hormone on lipogenesis and beta-oxidation-related enzymes. We demonstrated the presence of some of the main lipogenic enzymes at molecular, protein and activity levels (ATP-citrate lyase and fatty acid synthase). However, while ATP-citrate lyase was unexpectedly down-regulated, fatty acid synthase was up-regulated (at protein and activity levels) in an insulin dose-dependent manner. The main enzymes acting as NADPH donors for lipogenesis were also characterized at biochemical and molecular levels, although there was no evidence of their regulation by insulin. On the other hand, lipid oxidation potential was found in this tissue through the measurement of gene expression of enzymes involved in b-oxidation, highlighting two carnitine palmitoyltransferase isoforms, both down-regulated by insulin infusion. We found that insulin acts as an important regulator of trout WAT lipid metabolism, inducing the nal stage of lipogenesis at molecular, protein and enzyme activity levels and

suppressing b-oxidation at least at a molecular level. These results suggest that WAT in sh may have a role that is important not only as a lipid deposition tissue but also as a lipogenic organ (with possible involvement in glucose homeostasis) that could also be able to utilize the lipids stored as a local energy source. Keywords Insulin Fish Dietary carbohydrates White adipose tissue Lipogenesis Lipid oxidation Abbreviations 6PGDH 6-Phosphogluconate dehydrogenase ACLY ATP citrate lyase CPT Carnitine palmitoyltransferase EF1a Elongation factor 1 alpha FFA Free fatty acids G6PDH Glucose 6-phosphate dehydrogenase HOAD 3-Hydroxyacyl-CoA dehydrogenase HSL Hormone-sensitive lipase ICDH Isocitrate dehydrogenase LPL Lipoprotein lipase ME Malic enzyme NAPDH Nicotine adenine dinucleotide phosphate, reduced TAG Triacylglycerols TNF Tumor necrosis factor-alpha WAT White adipose tissue

S. Polakof (&) F. Medale L. Larroquet C. Vachot G. Corraze S. Panserat INRA, UMR1067 Nutrition Aquaculture et Genomique, Pole dhydrobiologie, CD918, 64310 Saint-Pee-sur-Nivelle, France e-mail: spolakof@st-pee.inra.fr S. Polakof Laboratorio de Fisioloxa Animal, Departamento de Bioloxa Funcional e Ciencias da Saude, Facultade de Bioloxa, Universidade de Vigo, 36310 Vigo, Spain

Introduction White adipose tissue (WAT) has a role in energy storage and as insulation from environmental temperature and trauma, storing lipids in the form of triacylglycerols (TAG)

123

190

Lipids (2011) 46:189199

and in mobilizing them via breakdown into free fatty acids (FFA) and glycerol [1]. In mammals, several studies have been able to document the presence of lipogenic enzymes and the conversion of glucose into fat in insulin-stimulated adipocytes [2], although very little is known about WAT lipid oxidation capacities [3]. FFA originating from dietary intake or de novo synthesis are stored as TAG. With its storage capacity and its ability to hydrolyze TAG, WAT provides a FFA buffering system for other organs [4]. WAT is one of the most important lipid stores in several teleosts, although the liver and muscle also constitute lipid storage organs in some species [5]. In salmonids, WAT is distributed primarily in the abdominal cavity, in association with the mesenteric and pyloric caeca [6]. In sh, as in mammals, the development of WAT and accumulation of lipids is a continuous process that depends on nutritional [7, 8] and reproductive status [9]. The WAT provides capital for sh reproduction [10] as well as for the challenges of long-term fasting [7]. As the enzymatic machinery responsible for lipid mobilization and deposition in sh, WAT is similar to that found in mammals [6], and both lipoprotein lipase (LPL) [11, 12] and hormone-sensitive lipase (HSL) [13, 14] have been characterized. However, other aspects of lipid metabolism such as the lipogenic and lipid oxidation potential have not been fully explored in sh WAT. Early studies have shown the presence of lipogenic enzyme activities in visceral fat in the eel [15], channel catsh [16] and coho salmon [17]. More recent studies have also investigated the presence of NADPH-donor enzymes involved in lipogenesis in gilthead seabream [18]. However, on the basis of ndings in the rainbow trout, in which the liver accounts for more TAG synthesis than the adipose tissue [19], and the lower levels of lipogenic enzyme activity in WAT present in coho salmon [17], Henderson and Sargent [20] proposed a minor role for WAT in the whole sh lipogenic potential. The lipid oxidation capacities of sh WAT are poorly understood, although b-oxidation was recently reported to be regulated by different fatty acids in vivo [21] and in vitro [22] in Atlantic salmon. Functional data are scarce, and only gene expression of carnitine palmitoyltransferase (CPT) has been described in the WAT of rainbow trout [23] and salmon [24], while no expression was found in gilthead seabream [25]. Other enzymes involved in lipid oxidation are also expressed in salmon WAT, including acyl-CoA oxidase and acyl-CoA dehydrogenase, although they are not regulated by the nature of the oil present in the feed [24]. Lipid metabolism in sh WAT is regulated by several endocrine factors, such as insulin, GH and somatolactin, [26], glucagon [27] and norepinephrine [28], and also by other factors such as TNF-a [13, 29]. Clearly, most of the

studies on endocrine control of lipid metabolism in sh WAT have been focused on the insulin action [12, 27, 30, 31]. Unfortunately, all these studies were carried out in order to understand the regulation of key enzymes involved in lipid storage and mobilization such as LPL and HSL (see above), and no information about hormone control of lipogenesis or lipid oxidation is available for sh WAT. On the other hand, insulin action on other tissues such as the liver and white skeletal muscle has been widely studied, with the predominant lipogenic and anti-lipolytic action of this hormone [30, 32]. We recently reported similar results at the molecular level in fasted rainbow trout infused with bovine insulin for 4 days [33], although details regarding the WAT were not available in that study. Insulin receptors have also been studied in rainbow trout WAT, showing the rst evidence of insulin regulation of lipid metabolism in this tissue [34]. In order to characterize the lipogenic potential and its regulation by insulin in sh WAT, rainbow trout were infused with two different doses of bovine insulin for 5 days. We assessed two of the main enzymes involved in lipogenesis at enzymatic, protein and molecular levels (ACLY (ATP citrate lyase) and FAS (fatty acid synthase)) as well as the main enzymes acting as NADPH donors, including 6PGDH (6-phosphogluconate dehydrogenase), G6PDH (glucose 6-phosphate dehydrogenase), ICDH (isocitrate dehydrogenase) and ME (malic enzyme). RNA levels of two enzymes involved in lipid oxidation were also assessed, including HOAD (hydroxyacyl-CoA dehydrogenase) and CPT-1 isoforms. WAT insulin sensitivity was studied on the basis of the phosphorylation status of Akt, and sh were fed a high carbohydrate diet in order to counteract the insulin-induced hypoglycemia caused by the pump infusion [35] and to induce lipogenesis, as in other sh tissues [16, 3638].

Materials and Methods Fish Rainbow trout (Oncorhynchus mykiss Walbaum) were obtained from the INRA experimental sh farm facilities of Donzacq (Landes, France). Fish were maintained in tanks with well-aerated water at 17 C and a controlled photoperiod (LD12:12), and fed a standard trout commercial diet during the acclimatization period (T-3P classic, Trouw, France). Fish weight was 200 10 g. The experiments were conducted in accordance with the Guidelines of the National Legislation on Animal Care of the French Ministry of Research (Decret N8 2001-464, May 29, 2001) and were approved by the Ethics Committee of INRA (according to INRA 2002-36, April 14, 2002).

123

Lipids (2011) 46:189199

191

Experimental Protocols For sustained hormone infusions, sh were food-deprived for 48 h and then implanted with 1003D Alzet miniosmotic pumps (Alza, USA) containing either saline (control, n = 6) or bovine insulin solution at two different concentrations (n = 6) (*27 units/mg; Sigma Chemical Co.). Fish were rst anesthetized and weighed, and pumps were then inserted into the peritoneal cavity through a 1.0-cm incision made in the ventral midline at ca. 2.0 cm rostral of the pelvic ns. The incision was closed with one stitch and an antibiotic gel was applied topically to the incision area. Pumps were implanted in the morning and sh were allowed to recover. The next morning (24 h later), sh were fed a diet containing a high-level of carbohydrate (30% dextrin, 57% sh meal and 10% sh oil) for 5 days and sampled 6 h after their last meal. Pump ow rate was established at 0.39 ll h-1, which at 17 C should provide sustained release of 0.35 (Ins1x) or 0.7 (Ins2x) IU kg-1 day-1 insulin for 11 days. The doses chosen were based on previous studies carried out in fasted rainbow trout [35, 39]. Tissue and Blood Sampling Trout were sacriced by a sharp blow on the head. Blood was removed from the caudal vessels and centrifuged (3,000g, 5 min); the plasma recovered was immediately frozen and kept at -20 C pending analyses. Gut content of each sh was systematically checked to conrm that the sh sampled had in fact consumed the diet. The perivisceral

WAT was collected and frozen in liquid nitrogen and kept at -80 C pending analyses. Molecular and Biochemical Analyses Plasma glucose (Biomerieux, France), triglycerides (Bio merieux, France) and FFA (Wako Chemicals GmbH, Germany) levels were determined using commercial kits adapted to a microplate format. Bovine insulin levels were measured using a bovine-specic commercial ELISA kit (Mercodia, Sweden) as in [35]. Tissue mRNA levels of proteins involved in lipid metabolism were determined by real-time quantitative RTPCR (q-PCR) [33]. The transcripts assessed FAS, G6PDH, ACLY, HOAD, CPTIA, CPTIB, CPTIC, CPTID, ME, 6PGDH and ICDH. Primers (Table 1) were designed to overlap an intron where possible (Primer3 software) using known sequences found in trout nucleotide databases (Genbank and INRA-Sigenae) as previously described [33]. Quantication of the target gene transcript level was performed using ef1a gene expression as reference [40], which was found to be stable in this study. Quantication of the target gene transcript in relation to the ef1a reference gene transcript was performed following the Pfaf method [40]. Protein extraction (20 lg) and Western blotting were undertaken using anti-phospho-Akt Ser473 (Cell Signaling Technology), anti-FAS (Santa Cruz Biotechnology), antib-tubulin (Cell Signaling Technology) and anti-ACLY (Cell Signaling Technology) against human proteins. Tissue used to assess enzyme activities was homogenized with 10 vol of ice-cold buffer consisting of 20 mmol l-1 Tris

Table 1 Sequences of the primer pairs used for real-time quantitative PCR determination of the transcript levels of several rainbow trout genes involved in lipid metabolism Gene ACLY FAS G6PDH 6PGDH ICDH ME CPT1A CPT1B CPT1C CPT1D HOAD EF1a 50 30 forward primer CTGAAGCCCAGACAAGGAAG GAGACCTAGTGGAGGCTGTC CTCATGGTCCTCAGGTTTG ATGCCAGGGGGACACAAAGA GACAGCACCAACAGGGCAA TACGTGCGGTGTGTGTGACG TCGATTTTCAAGGGTCTTCG CCCTAAGCAAAAAGGGTCTTCA CGCTTCAAGAATGGGGTGAT CCGTTCCTAACAGAGGTGCT GGACAAAGTGGCACCAGCAC TCCTCTTGGTCGTTTCGCTG 50 30 reverse primer CAGATTGGAGGCCAAGATGT TCTTGTTGATGGTGAGCTGT AGAGAGCATCTGGAGCAAGT CAAAAGCCTGTGCCATCACG AAGCCAGCCTCGATGGTCTC GTGCCCACATCCAGCATGAC CACAACGATCAGCAAACTGG CATGATGTCACTCCCGACAG CAACCACCTGCTGTTTCTCA ACACTCCGTAGCCATCGTCT GGGACGGGGTTGAAGAAGTG ACCCGAGGGACATCCTGTG Annealing temperature (C) 60 59 59 60 59 60 55 55 59 59 59 59

ACLY ATP citrate lyase, FAS fatty acid synthase, G6PDH glucose 6-phosphate dehydrogenase, 6PGDH 6-phosphogluconate dehydrogenase, ICDH isocitrate dehydrogenase, ME malic enzyme, CPT carnitine palmitoyltransferase, HOAD 3-hydroxyacyl-CoA dehydrogenase, EF1-a elongation factor-alpha

123

192

Lipids (2011) 46:189199

(pH 7.4), 250 mM sucrose, 2 mmol l-1 EDTA, 10 mmol l-1 b-mercaptoethanol, 100 mM NaF and 0.5 mM EDTA. The homogenate was centrifuged for 20 min at 17,000g and the supernatant was used immediately for enzyme assays at 37 C in pre-established conditions. HOAD was assessed as in [41], while G6PDH (nal substrate concentration 0.5 mM glucose-6-phosphate) and FAS (nal substrate concentration 50 lM malonyl-CoA) were assessed following the method described by Figueiredo-Silva et al. [42] adapted to trout tissues. ME, ICDH and 6PGDH were assessed as in [43], adapting the conditions to the WAT. ACLY activity was determined as in [44]. Levels of enzyme activity are expressed in terms of mg protein. Protein concentration was determined using a Bradford protein assay kit (Bio-Rad, Germany) with BSA as standard. Statistical Analysis The results are expressed as means SEM (n = 6). Data were analyzed by one-way ANOVA. When necessary, data were log-transformed to fulll the conditions of the analysis of variance. Post-hoc comparisons were made using a StudentNewmanKeuls test, and differences were considered statistically signicant at P \ 0.05.

9 8 7

Plasma triglycerides (mM)

6 5 4 3 2 1 0

B
Plasma free fatty acids -1 (mEqL )

0.20

0.15

a b b

0.10

0.05

0.0

Results Plasma triglyceride levels (Fig. 1a) were unaffected by the insulin infusion. In contrast, FFA levels in plasma (Fig. 1b) were reduced after the insulin infusion regardless of the dose. Bovine insulin levels were constant in all trout with insulin pumps, averaging 3.11 0.34 and 6.36 0.65 ng ml-1 for 1x and 2x, respectively. Plasma glucose levels were lower than in the controls in the Ins1x group (7.67 0.42 mM), while glycemia was similar in the Ins2x group (9.02 0.44 mM) to the saline-infused group (9.08 0.42 mM). The phosphorylation status of Akt (at Ser473) is shown in Fig. 2. A twofold increase in phosphorylation of the kinase was observed when sh were infused with the higher insulin dose when compared with the saline-treated sh. ACLY and FAS enzyme activity and protein and mRNA transcript levels are shown in Fig. 3. ACLY in particular was affected by insulin at the protein level, with lower levels in sh infused with either insulin dose than in the control group. In contrast, mRNA levels were only reduced with the Ins1x dose, while activity was down-regulated by the higher insulin dose. The main differences were found at the protein level, since insulin was able to reduce ACLY levels by more than 50%. In this study FAS was positively affected by insulin infusion at activity, protein and gene expression levels. The effect on activity was dose dependent, while

Con

Ins 1x

Ins 2x

Fig. 1 Plasma triglyceride (a) and free fatty acid (b) levels in rainbow trout fed a carbohydrate-enriched diet and sacriced 6 h after the last meal. Fish were implanted with pumps containing saline (control) or two insulin doses: Ins1x (0.35 IU kg-1 day-1) and Ins2x (0.7 IU kg-1 day-1) and then fed for 5 days. Results are expressed as means SEM (n = 6) and were analyzed by one-way ANOVA followed by StudentNewmanKeuls multiple comparison test. Different letters indicate signicant differences among groups (P \ 0.05)

mRNA levels were less affected. Protein FAS levels were increased up to fourfold when insulin was infused (regardless of the dose infused). On the other hand, WAT FAS activity (0.320.97 mU mg-1 protein = 411 mU g-1 tissue) was higher than in other studies involving sh liver [38, 41], although lower than in liver samples from the present study, ranging from 0.25 to 1 mU mg-1 protein = 2986 mU g-1 tissue. Changes in enzyme activity and mRNA levels of proteins acting as NADPH donors are shown in Fig. 4. The four enzymes studied were affected by insulin in different ways: no changes in 6PGDH or ICDH were found at either biochemical or molecular levels. G6PDH mRNA levels were reduced only with the Ins1x dose, with no impact on activity, which remained unchanged by the treatments. Finally, ME mRNA levels increased 2-fold when the Ins2x dose was infused in comparison with the control group.

123

Lipids (2011) 46:189199

193

p-Akt

important ndings at both protein and molecular levels. We also present original ndings showing the molecular expression of key enzymes involved in the b-oxidation of lipids in the WAT. Insulin Effects on Plasma Parameters and Sensitivity of White Adipose Tissue
b

Akt
3

p-Akt/Akt (arbitrary units)

ab

0
Con Ins 1x Ins 2x

Fig. 2 Effects of insulin infusion (5 days) on WAT Akt phosphorylation status (Western blot analysis) in trout fed a high carbohydrate diet. Gels were loaded with 20 lg total protein per lane. Protein and phosphorylation levels were normalized to total tissue Akt levels and are indicated as fold-change compared with the saline-treated group. Results are expressed as means SEM (n = 6) and were analyzed by one-way ANOVA followed by StudentNewmanKeuls comparison test. Different letters indicate signicant differences among groups (P \ 0.05)

These changes were not followed by enzyme activity, that showed higher levels than the control group only when sh were infused with the Ins1x dose. mRNA levels of the main enzymes involved in b-oxidation are presented in Fig. 5. No changes were observed in mRNA levels of HOAD. However, the different isoforms of CPT were regulated by insulin. No signicant expression was found for CPT1A or CPT1B (data not shown). In contrast, the mRNA levels for CPT1C and D were affected by the treatment, an effect that was particularly clear in the latter isoform, responding to both insulin doses, while in the former reduced mRNA levels were found only with the Ins1x dose.

The main and well known effect of insulin in sh lipid metabolism is to decrease FFA levels in plasma (reviewed by [32]). The reduced levels of plasma FFA in our study conrm this insulin action as well as the physiological effects of insulin dose as applied in this experiment. Further conrmation of insulin action can be demonstrated by plasma glycemia and the phosphorylation status of a key protein in the insulin signalling pathway, such as Akt. In our study, Akt phosphorylation in the WAT was increased with the higher insulin dose, providing supporting evidence of insulin sensitivity of this tissue in the trout, as previously demonstrated by other authors [34, 45]. Bouraoui et al. (2010) [45] demonstrated the involvement of insulin in the development of adipocytes and also in glucose metabolism. The fact that Akt phosphorylation status can be signicantly affected by insulin in vivo, as in the present study, conrms that insulin can activate its own signalling pathway in this tissue, suggesting an important role in WAT metabolism. It was recently demonstrated in rat adipocytes that Akt activity is required for the effects of insulin on lipid metabolism [46]. In this model, Akt was essential in the antilipolytic action of insulin and, when inhibited, the lipogenic role of insulin was counteracted. We can therefore hypothesize that the insulin-induced Akt phosphorylation in this sh model could be related to both increased lipogenic and decreased lipid oxidation potential in the WAT of rainbow trout, as discussed below. Lipogenesis in White Adipose Tissue Carbohydrates consumed in excess of energy requirements and of hepatic glycogen storage capacity must be converted into lipids for subsequent storage. De novo lipogenesis is the metabolic pathway that synthesizes fatty acids from excess carbohydrates to be incorporated into TAG for energy storage. In mammals the WAT is the main lipidstoring tissue [47], while in sh the liver has been traditionally considered as the main tissue responsible for lipogenesis [17, 20]. Due to this minor role in lipogenesis, this pathway has been little studied in sh WAT and therefore very little information is available in the literature. Enzymes central to the process of lipogenesis are those that catalyze fatty acid biosynthesis, i.e. ACC, FAS and ACLY, which is involved in the transfer of acetyl-coenzyme A (acetyl-CoA) from the mitochondrion to the cytosol,

Discussion The effects of insulin on sh WAT lipid metabolism are little known and, although the storage of TAG has been demonstrated, the lipogenic role of this tissue has been traditionally considered as minor compared with that of the liver [30]. In the present study we conrmed the presence of the main enzymes responsible for de novo lipid synthesis at a biochemical level in sh, and demonstrated

123

194

Lipids (2011) 46:189199

mRNA levels
(fold-induction)

Protein levels
(arbitrary units)

Enzyme activity
(mUmg -1 protein)

1.5
a

1.5
a

2
a

ACLY

1.0
b

ab

1.0
ab

1
b

0.5

0.5

b b

0.0

0.0

2.0
b

1.5
c

6
b
b

1.5

1.0
b a

FAS

1.0 0.5 0.0 Con Ins 1x Ins 2x

0.5

0 Con Ins 1x Ins 2x

0.0 Con Ins 1x Ins 2x

Fig. 3 Effects of insulin infusion (5 days) on ATP-citrate lyase (ACLY) and fatty acid synthase (FAS) mRNA levels, protein levels and levels of enzyme activity in WAT of trout fed a highcarbohydrate diet. mRNA levels were estimated using real-time RT-PCR. Expression levels were normalized to elongation factor 1a (EF1a)-expressed transcripts which did not change under the experimental conditions and are presented as fold-change against the saline solution-treated group set at 1. Enzyme activity units (mIU)

are dened as nmol of substrate converted to product, per min, at 37 C, were expressed/mg protein. Protein (20 lg per lane) and phosphorylation levels were normalized to tissue b-tubulin levels and are indicated as fold-change compared with the saline-treated group. Results are presented as means SEM (n = 6) and were analyzed by one-way ANOVA followed by StudentNewmanKeuls comparison test. Different letters indicate signicant differences among groups (P \ 0.05). More details in Fig. 1

where fatty acid synthesis occurs [48]. ACLY has only been described previously in coho salmon WAT, although its activity was unaffected by different diets [17]. In the present study ACLY was inhibited by insulin, especially at the protein level. This is the rst time that this enzyme has been fully characterized in sh WAT. Insulin regulation of ACLY in mammals is not fully understood, and although this hormone is able to stimulate lipogenesis in rat adipocytes, ACLY activity and mRNA levels are often unaffected [49, 50]. Although intriguing, our results are not surprising in view of the fact that in other lipogenic tissue in the trout (the liver) ACLY is not regulated at the molecular level by either nutritional status [51] or insulin [33]. In fact, the inhibition of ACLY by insulin in the trout shows that this step of lipogenesis in sh WAT is regulated in a different way from that described in mammals. In mammals ACLY is phosphorylated by Akt into serine 455, abolishing the homotropic allosteric regulation by citrate and enhancing the catalytic activity of the enzyme [52]. This differential level of regulation compared to the mammalian model is further supported by the increased Akt phosphorylation with the

higher insulin dose in the present study. We also analyzed FAS mRNA, protein and activity levels. Although FAS has been widely studied in the sh liver, information regarding the WAT is scarce [16, 17]. In the study presented here we showed similar levels of activity to those previously reported in salmon WAT [17] and higher levels than those reported in the trout liver, the traditional lipogenic organ in sh [38, 41]. Moreover, in accordance with the ndings reported in mammals [47], FAS mRNA levels and protein and activity levels were stimulated by insulin, in line with the increased Akt phosphorylation status, which in mammals is considered to be essential to the insulin-stimulated lipogenesis in adipocytes [46]. This is the rst time that insulin-induced lipogenic potential has been described in sh WAT, in agreement with the stimulating effects of dietary carbohydrates shown in catsh [16]. This study demonstrated that some of the main lipogenic enzymes are signicantly expressed at both mRNA and protein levels in WAT and that the levels of activity are consistent with a biologically signicant lipogenic pathway. Insulin-stimulated FAS regulation thus seems to be as

123

Lipids (2011) 46:189199 Fig. 4 Effects of insulin infusion (5 days) on glucose 6-phosphate dehydrogenase (G6PDH), 6-phosphogluconate dehydrogenase (6PGDH), isocitrate dehydrogenase (ICDH) and malic enzyme (ME) mRNA and levels of enzyme activity in WAT of trout fed a high-carbohydrate diet. mRNA levels were estimated using real-time RT-PCR. Expression levels were normalized to elongation factor 1a (EF1a)expressed transcripts which did not change under the experimental conditions and are presented as fold-changes against the saline solutiontreated group set at 1. Enzyme activity units (mIU) are dened as nmol of substrate converted to product, per min, at 37 C, were expressed/mg protein. Results are presented as means SEM (n = 6) and were analyzed by one-way ANOVA followed by Student NewmanKeuls comparison test. Different letters indicate signicant differences among groups (P \ 0.05). More details in Fig. 1

195

mRNA levels
(fold-induction)
1.5

Enzyme activity
(mUmg -1 protein)

100 80

6PGDH

1.0 60 40 20 0.0 0 140 120

0.5

1.5

1.0

100 80

ICDH

0.5

60 40 20

0.0
1.5

0 200

a
1.0

a
150

G6PDH

100 0.5

b
50

0.0

0 20

b
3

b a ab
15

ME

10

a
1

a
5

Con

Ins 1x

Ins 2x

Con

Ins 1x

Ins 2x

expected, in view of the anabolic action of insulin in sh [30] and the insulin-induced lipogenesis in hyperinsulinemic rats [53, 54]. However, the global inhibition of ACLY by insulin is surprising although consistent, since it was found at all the levels studied. More studies are needed to clarify whether this pathway is fully functional in sh

WAT. On the other hand, the fact that lipogenesis can be up-regulated in trout WAT when sh are fed an excess of dietary carbohydrates also suggests a possible role in glucose metabolism and homeostasis. Lipogenesis in the liver in rainbow trout also fed with carbohydrates [38] was shown to be induced by the anti-diabetic drug metformin,

123

196
1.5

Lipids (2011) 46:189199

hypoglycemic effect of this hormone, thus improving control of glycemia in this glucose intolerant species [55]. NADPH Donors in White Adipose Tissue are Poorly Regulated by Insulin The de novo synthesis of lipids in the cytoplasm of vertebrate tissues requires a carbon source (acetyl CoA), reducing equivalents (NADPH) produced by one or more of four cytoplasmic dehydrogenases (G6PDH, 6PGDH, ME and ICDH). We present here for the rst time in sh the molecular and biochemical regulation by insulin of the four enzymes in the trout WAT. When compared with other sh species the reducing power generated in trout WAT (5.3 nmol NADPH min-1 g-1 = 347 nmol NADPH min-1 mg protein-1) lipogenesis is variable and related to the species and the assay temperature. Trout WAT generates up to 4.5-fold more NADPH than the eel (assessed at 20 C) [15] and catsh (assessed at 25 C) [16] visceral adipose tissue. When compared with the salmon (assessed at 18 C) [17], the difference is tenfold higher. Taking into account the assay temperatures and species-dependence of the ndings described above, we can suggest that the WAT in trout has a similar lipogenic potential to other sh species such as the catsh and eel, but higher than that of other salmonids. Overall, it seems that the generation of reduction potential for lipogenesis in trout WAT is high enough to sustain lipogenic activity, although its potential is lower than in the liver. In view of the relative contributions of the different enzymes assessed as NAPDH donors, it should be noted that the ME activity was about 9.5-fold lower than that of the others, and thus its relative contribution to the total NADPH is probably low, as in the liver. These results are similar to those described in the sh species cited above, in which ME also presents low levels of activity. The activity levels of other enzymes involved in the generation of NADPH are relatively high, similar to levels found in the liver [41] and about tenfold higher than in other species studied [1517]. However, despite this high potential NADPH production capacity, only minor changes in ME were found in trout WAT. The fact that the enzymes exhibiting higher levels of activity were unaffected by insulin suggests that the NADPH production pathway does not constitute the limiting step for lipogenesis in trout WAT. Beta Oxidation Pathway in White Adipose Tissue: Regulation by Insulin In this study, we examined two key enzymes involved in regulating FFA oxidation in trout WAT and the effects of insulin infusion at the molecular level. CPT-I is considered to be a key regulatory enzyme in FFA oxidation. It

HOAD gene expression (fold-induction)

1.0

0.5

0.0 1.5

CPT1C gene expression (fold-induction)

a a
1.0

0.5

0.0

1.5

CPT1D gene expression

a
(fold-induction)
1.0

b b
0.5

0.0

Con

Ins 1x

Ins 2x

Fig. 5 Effects of insulin infusion (5 days) on 3-hydroxyacyl-CoA dehydrogenase (HOAD),carnitine palmitoyltransferase 1B (CPT1B), CPT1C and CPT1D and mRNA levels in WAT of trout fed a highcarbohydrate diet. mRNA levels were estimated using real-time RT-PCR. mRNA levels were normalized to elongation factor 1a (EF1a)-expressed transcripts which did not change under the experimental conditions and are presented as fold-changes against the saline solution-treated group set at 1. Results are presented as means SEM (n = 6) and were analyzed by one-way ANOVA followed by Student NewmanKeuls comparison test. Different letters indicate signicant differences among groups (P \ 0.05). More details in Fig. 1

improving the glycemic prole and glucose homeostasis. The induction of WAT lipogenesis by the lower insulin dose in the present study may also be involved in the

123

Lipids (2011) 46:189199

197

catalyzes the formation of long-chain acyl-carnitine, the transportable form of activated FFAs, thus committing FFAs to oxidation in the mitochondria [56]. In sh, FFA oxidation takes place mainly in the liver and cardiac and skeletal muscle, where CPT-I is present [23, 25] and regulated by insulin [33]. However, information about CPT-I in sh WAT is limited: CPT-I gene expression has been described in the rainbow trout [23, 57], although no transcripts were found in seabream [25]. As far as we are aware, this is the rst study in which WAT CPT-I regulation is explored in sh, especially in relation to insulin. Very interestingly, we found that the two major CPT-I isoforms expressed in the liver and muscle of rainbow trout (CPT-IA and CPT-IB) [33] were not signicantly expressed in the WAT. Moreover, the main isoforms found in this tissue were CPT-IC (brain type) and D (larval type) (personal observations). The expression patterns of trout CPT-I compared to those of mammals, where the CPT-I-M (the muscle type) is the predominant isoform in the adipose tissue [58], were especially interesting. Overall, we found that the two isoforms expressed in the WAT were downregulated by the insulin infusion, although no relationship with insulin dose was found. This nding agrees with the global anabolic role (anti-lipolytic effects) of insulin in sh [27, 59] and the down-regulation of CPT-IA and CPT-IB transcripts in muscle of fasted trout infused with insulin [33]. This is in accordance with the ndings reported in rat adipocytes, in which the presence of insulin in the medium down-regulates CPT-I mRNA levels [3]. However, the relative contributions of the isoform transcripts studied to the total pool of CPT-I activity in WAT remain unidentied and further studies must therefore be conducted to clarify the regulation of this enzyme in sh WAT. Finally, we present here the presence of transcripts for the HOAD enzyme involved in the b-oxidation of lipids. Lipid oxidation in the WAT has been little explored in sh to date [21, 22] and, although the expression of HOAD does not seem to be regulated by insulin, its presence suggests the utilization of this substrate as a local energy source. Conclusions and Perspective Although the role of the WAT in sh as a lipid deposition organ is well recognized [6], both the lipogenic capacity and lipid energy metabolism have been traditionally considered to be of minor importance, and its biological signicance and regulation have remained undemonstrated [20]. We present here original ndings regarding lipid metabolism in the WAT of rainbow trout fed a high carbohydrate diet and infused with insulin that emphasize the functions of this tissue, mainly as energy storage for long-term periods of fasting [7] and for reproduction purposes [10]. In these conditions, we found the presence of some of the main

enzymes required for lipogenesis at molecular, protein and activity levels, such as ACLY and FAS. The up-regulation of FAS activity by insulin in a dose-dependent manner reinforces the lipogenic role of WAT in the trout. We may thus hypothesize that this increased lipogenic potential can help trout to control glycemia when fed high-carbohydrate diets, as this pathway has been shown to be involved in control of glucose homeostasis in this species [38, 39]. Moreover, the presence of the major NADPH donors for lipogenesis with relatively high rates of activity (equivalent to those found in the liver in this species) supports this lipogenic role of WAT. However, the lack of response to insulin infusion suggests that NADPH production is not a lipogenesis limiting step in this tissue. On the other hand, lipid oxidation potential was found through the mRNA levels of enzymes involved in b-oxidation, such as HOAD, the brain isoform of CPT-IC, and an exclusive isoform of this tissue, CPT-ID. Although no levels of activity were assessed for these enzymes, a novel oxidation potential can be suggested in the WAT of rainbow trout, probably for local use. We found that insulin acts as an important regulator of trout WAT lipid metabolism as a whole, as recently proposed by Bouraoui et al. (2010) [45], inducing the nal stage of lipogenesis and suppressing b-oxidation at a molecular level. Although preliminary, these results suggest that the WAT in sh may have an important role not only as lipid deposition tissue, but also as a lipogenic organ, that could also be able to utilize lipids stored as a local energy source.
Acknowledgments This study was supported by research grants from the Agence Nationale de la Recherche (ANR-08-JCJC-0025-01) and INRA PHASE Department. SP was recipient of a postdoctoral fellowship from the Xunta de Galicia (Program Angeles Alvarino). We thank the technical stuff (Y. Hontang, F. Sandres, and F. Terrier) of the INRA experimental sh farm of Donzacq for supplying the experimental animals.

References
1. Bezaire V, Langin D (2009) Regulation of adipose tissue lipolysis revisited. Proc Nutr Soc 68:350360 2. Minehira K, Bettschart V, Vidal H, Vega N, Di Vetta V, Rey V, Schneiter P, Tappy L (2003) Effect of carbohydrate overfeeding on whole body and adipose tissue metabolism in humans. Obes Res 11:10961103 3. Zang Y, Wang T, Xie W, Wang-Fischer YL, Getty L, Han J, Corkey BE, Guo W (2005) Regulation of acetyl CoA carboxylase and carnitine palmitoyl transferase-1 in rat adipocytes. Obes Res 13:15301539 4. Frayn KN (2002) Adipose tissue as a buffer for daily lipid ux. Diabetologia 45:12011210 5. Sheridan MA (1988) Lipid dynamics in sh: aspects of absorption, transportation, deposition and mobilization. Comp Biochem Physiol B Biochem Mol Biol 90:679690 6. Sheridan MA, Harmon JS (1994) Adipose tissue. In: Hochachka PW, Mommsen TP (eds) Biochemistry and molecular biology of shes, vol 3. Elsevier, Amsterdam, pp 305311

123

198 7. Navarro I, Gutierrez J (1995) Fasting and starvation. In: Hochachka PW, Mommsen TP (eds) Metabolic biochemistry, vol 4. Elsevier, Amsterdam, pp 394434 8. Company R, Calduch-Giner JA, Kaushik S, Perez-Sanchez J (1999) Growth performance and adiposity in gilthead sea bream (Sparus aurata): risks and benets of high energy diets. Aquaculture 171:279292 9. Sheridan MA (1989) Alterations in lipid metabolism accompanying smoltication and seawater adaptation of salmonid sh. Aquaculture 82:191203 10. Tocher DR (2003) Metabolism and functions of lipids and fatty acids in teleost sh. Rev Fish Sci 11:107184 11. Albalat A, Sanchez-Gurmaches J, Gutierrez J, Navarro I (2006) Regulation of lipoprotein lipase activity in rainbow trout (Oncorhynchus mykiss) tissues. Gen Comp Endocrinol 146:226 235 12. Albalat A, Saera-Vila A, Capilla E, Gutierrez J, Perez-Sanchez J, Navarro I (2007) Insulin regulation of lipoprotein lipase (LPL) activity and expression in gilthead sea bream (Sparus aurata). Comp Biochem Physiol B Biochem Mol Biol 148:151159 13. Cruz-Garcia L, Saera-Vila A, Navarro I, Calduch-Giner J, PerezSanchez J (2009) Targets for TNFalpha-induced lipolysis in gilthead sea bream (Sparus aurata L.) adipocytes isolated from lean and fat juvenile sh. J Exp Biol 212:22542260 14. Harmon JS, Rieniets LM, Sheridan MA (1993) Glucagon and insulin regulate lipolysis in trout liver by altering phosphorylation of triacylglycerol lipase. Am J Physiol Regul Integr Comp Physiol 265:R255R260 15. Aster PL, Moon TW (1981) Inuence of fasting and diet on lipogenic enzymes in the American eel, Anguilla rostrata LeSueur. J Nutr 111:346354 16. Likimani TA, Wilson RP (1982) Effects of diet on lipogenic enzyme activities in channel catsh hepatic and adipose tissue. J Nutr 112:112117 17. Lin H, Romsos DR, Tack PI, Leveille GA (1977) Inuence of dietary lipid on lipogenic enzyme activities in coho salmon, Oncorhynchus kisutch (Walbaum). J Nutr 107:846854 18. Bouraoui L, Sanchez-Gurmaches J, Cruz-Garcia L, Gutierrez J, Benedito-Palos L, Perez-Sanchez J, Navarro I (2010) Effect of dietary sh meal and sh oil replacement on lipogenic and lipoprotein lipase activities and plasma insulin in gilthead sea bream (Sparus aurata) Aquacult Nut 17:5463. doi: 10.1111/j.1365-2095. 2009.00706.x 19. Henderson RJ, Sargent JR (1981) Lipid biosynthesis in rainbow trout, Salmo gairdneri, fed diets of differing lipid content. Comp Biochem Physiol C Comp Pharmacol 69:3137 20. Henderson RJ, JR Sargent (1985) Fatty acid metabolism in sh. In: Cowey CB, Mackie AM, Bell JG (eds) Nutrition and feeding in sh. Academic Press, New York, pp 349364 21. Todorcevic M, Kjaer MA, Djakovic N, Vegusdal A, Torstensen BE, Ruyter B (2009) N-3 HUFAs affect fat deposition, susceptibility to oxidative stress, and apoptosis in Atlantic salmon visceral adipose tissue. Comp Biochem Physiol B Biochem Mol Biol 152:135143 22. Todorcevic M, Vegusdal A, Gjoen T, Sundvold H, Torstensen BE, Kjaer MA, Ruyter B (2008) Changes in fatty acids metabolism during differentiation of Atlantic salmon preadipocytes; effects of n-3 and n-9 fatty acids. Biochim Biophys Acta 1781:326335 23. Gutieres S, Damon M, Panserat S, Kaushik S, Medale F (2003) Cloning and tissue distribution of a carnitine palmitoyltransferase I gene in rainbow trout (Oncorhynchus mykiss). Comp Biochem Physiol B Biochem Mol Biol 135:139151 24. Torstensen B, Nanton D, Olsvik P, Sundvold H, Stubhaug I (2009) Gene expression of fatty acid-binding proteins, fatty acid transport proteins (cd36 and FATP) and b-oxidation-related

Lipids (2011) 46:189199 genes in Atlantic salmon (Salmo salar L.) fed sh oil or vegetable oil. Aquac Nutr 15:440451 Boukouvala E, Leaver MJ, Favre-Krey L, Theodoridou M, Krey G (2010) Molecular characterization of a gilthead sea bream (Sparus aurata) muscle tissue cDNA for carnitine palmitoyltransferase 1B (CPT1B). Comp Biochem Physiol B Biochem Mol Biol 157:189197 Mingarro M, Vega-Rubn de Celis S, Astola A, Pendon C, Valdivia MM, Perez-Sanchez J (2002) Endocrine mediators of seasonal growth in gilthead sea bream (Sparus aurata): the growth hormone and somatolactin paradigm. Gen Comp Endocrinol 128:102111 Harmon JS, Sheridan MA (1992) Effects of nutritional state, insulin, and glucagon on lipid mobilization in rainbow trout, Oncorhynchus mykiss. Gen Comp Endocrinol 87:214221 Vianen GJ, Obels PP, van den Thillart GE, Zaagsma J (2002) Beta-adrenoceptors mediate inhibition of lipolysis in adipocytes of tilapia (Oreochromis mossambicus). Am J Physiol Endocrinol Metab 282:E318E325 Albalat A, Liarte C, MacKenzie S, Tort L, Planas JV, Navarro I (2005) Control of adipose tissue lipid metabolism by tumor necrosis factor-a in rainbow trout (Oncorhynchus mykiss). J Endocrinol 184:527534 Navarro I, Capilla E, Castillo A, Albalat A, Daz M, Gallardo M A, Blasco J, Planas JV, Gutierrez J (2006) Insulin metabolic effects in sh tissues. In: Reinecke M, Zaccone G, Kapoor BG (eds) Fish endocrinology Science Publishers Inc., Eneld, pp 1548 Albalat A, Gutierrez J, Navarro I (2005) Regulation of lipolysis in isolated adipocytes of rainbow trout (Oncorhynchus mykiss): the role of insulin and glucagon. Comp Biochem Physiol B Biochem Mol Biol 142:347354 Mommsen TP, Plisetskaya EM (1991) Insulin in shes and agnathans: history, structure, and metabolic regulation. Rev Aquat Sci 4:225259 Polakof S, Medale F, Skiba-Cassy S, Corraze G, Panserat S (2010) Molecular regulation of lipid metabolism in liver and muscle of rainbow trout subjected to acute and chronic insulin treatments. Domest Anim Endocrinol 39:2633 Planas JV, Mendez E, Banos N, Capilla E, Navarro I, Gutierrez J (2000) Insulin and IGF-I receptors in trout adipose tissue are physiologically regulated by circulating hormone levels. J Exp Biol 203:11531159 Polakof S, Skiba-Cassy S, Choubert G, Panserat S (2010) Insulininduced hypoglycaemia is co-ordinately regulated by liver and muscle during acute and chronic insulin stimulation in rainbow trout (Oncorhynchus mykiss). J Exp Biol 213:14431452 Dias J, Alvarez MJ, Dez A, Arzel J, Corraze G, Bautista JM, Kaushik S (1998) Regulation of hepatic lipogenesis by dietary protein/energy in juvenile European seabass (Dicentrarchus labrax). Aquaculture 161:169186 Lin H, Romsos DR, Tack PI, Leveille GA (1977) Effects of fasting and feeding various diets on hepatic lipogenic enzyme activities in coho salmon (Oncorhynchus kisutch (Walbaum)). J Nutr 107:14771483 Panserat S, Skiba-Cassy S, Seiliez I, Lansard M, Plagnes-Juan E, Vachot C, Aguirre P, Larroquet L, Chavergnac G, Medale F, Corraze G, Kaushik S, Moon TW (2009) Metformin improves postprandial glucose homeostasis in rainbow trout fed dietary carbohydrates: a link with the induction of hepatic lipogenic capacities? Am J Physiol Regul Integr Comp Physiol 293:707715 Polakof S, Skiba-Cassy S, Panserat S (2009) Glucose homeostasis is impaired by a paradoxical interaction between metformin and insulin in carnivorous rainbow trout. Am J Physiol Regul Integr Comp Physiol 297:17691776

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

123

Lipids (2011) 46:189199 40. Pfaf MW (2001) A new mathematical model for relative quantication in real-time RT-PCR. Nucleic Acids Res 29:e45 41. Kolditz C, Borthaire M, Richard N, Corraze G, Panserat S, Vachot C, Lefevre F, Medale F (2008) Liver and muscle metabolic changes induced by dietary energy content and genetic selection in rainbow trout (Oncorhynchus mykiss). Am J Physiol Regul Integr Comp Physiol 294:R1154R1164 42. Figueiredo-Silva AC, Corraze G, Borges P, Valente LMP (2010) Dietary protein/lipid level and protein source effects on growth, tissue composition and lipid metabolism of blackspot seabream (Pagellus bogaraveo). Aquac Nutr 16:173187 43. Mommsen TP, Osachoff HL, Elliott ME (2003) Metabolic zonation in teleost gastrointestinal tract effects of fasting and cortisol in tilapia. J Comp Physiol B Biochem Syst Environ Physiol 173:409418 44. Alvarez MJ, Dez A, Lopez-Bote C, Gallego M, Bautista JM (2000) Short-term modulation of lipogenesis by macronutrients in rainbow trout (Oncorhynchus mykiss) hepatocytes. Br J Nutr 84:619628 45. Bouraoui L, Capilla E, Gutierrez J, Navarro I (2010) Insulin and insulin-like growth factor I signaling pathways in rainbow trout (Oncorhynchus mykiss) during adipogenesis and their implication in glucose uptake. Am J Physiol Regul Integr Comp Physiol 299:3341 46. Berggreen C, Gormand A, Omar B, Degerman E, Goransson O (2009) Protein kinase B activity is required for the effects of insulin on lipid metabolism in adipocytes. Am J Physiol Endocrinol Metab 296:E635E646 47. Strable MS, Ntambi JM (2010) Genetic control of de novo lipogenesis: role in diet-induced obesity. Crit Rev Biochem Mol Biol 45:199214 48. Towle HC, Kaytor EN, Shih HM (1997) Regulation of the expression of lipogenic enzyme genes by carbohydrate. Annu Rev Nutr 17:405433 49. Saggerson ED, McAllister TW, Baht HS (1988) Lipogenesis in rat brown adipocytes effects of insulin and noradrenaline, contributions from glucose and lactate as precursors and comparisons with white adipocytes. Biochem J 251:701709 50. Fukuda H, Iritani N (1999) Regulation of ATP citrate-lyase gene expression in hepatocytes and adipocytes in normal and genetically obese rats. J Biochem 126:437444

199 51. Skiba-Cassy S, Lansard M, Panserat S, Medale F (2009) Rainbow trout genetically selected for greater muscle fat content display increased activation of liver TOR signaling and lipogenic gene expression. Am J Physiol Regul Integr Comp Physiol 297: 14211429 52. Potapova IA, El-Maghrabi MR, Doronin SV, Benjamin WB (2000) Phosphorylation of recombinant human ATP:citrate lyase by cAMP-dependent protein kinase abolishes homotropic allosteric regulation of the enzyme by citrate and increases the enzyme activity. Allosteric activation of ATP: citrate lyase by phosphorylated sugars. Biochemistry 39:11691179 53. Cusin I, Terrettaz J, Rohner-Jeanrenaud F, Jeanrenaud B (1990) Metabolic consequences of hyperinsulinaemia imposed on normal rats on glucose handling by white adipose tissue, muscles and liver. J.Biochem 267:99103 54. Larue-Achagiotis C, Goubern M, Laury MC (1988) Concomitant food intake and adipose tissue responses under chronic insulin infusion in rats. Physiol Behav 44:95100 55. Moon TW (2001) Glucose intolerance in teleost sh: fact or ction? Comp Biochem Physiol B Biochem Mol Biol 129: 243249 56. Louet JF, Le May C, Pegorier JP, Decaux JF, Girard J (2001) Regulation of liver carnitine palmitoyltransferase I gene expression by hormones and fatty acids. Biochem Soc Trans 29:310 316 57. Morash AJ, Bureau DP, McClelland GB (2009) Effects of dietary fatty acid composition on the regulation of carnitine palmitoyltransferase (CPT) I in rainbow trout (Oncorhynchus mykiss). Comp Biochem Physiol B Biochem Mol Biol 152:8593 58. Esser V, Brown NF, Cowan AT, Foster DW, McGarry JD (1996) Expression of a cDNA isolated from rat brown adipose tissue and heart identies the product as the muscle isoform of carnitine palmitoyltransferase I (M-CPT I): M-CPT I is the predominant CPT I isoform expressed in both white (epididymal) and brown adipocytes. J Biol Chem 271:69726977 59. Plisetskaya EM, Sheridan MA, Mommsen TP (1989) Metabolic changes in Coho and Chinook salmon resulting from acute insufciency in pancreatic hormones. J Exp Zool 249:158164

123