Question 1:

a). What is the name of the Gene with the ID 3039?

Answer: The names of the gene are hemoglobin, alpha 1.

b) What is the description for this gene?

Answer: The human alpha globin gene cluster located on chromosome 16 spans
about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 -
alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding
sequences are identical. These genes differ slightly over the 5' untranslated
regions and the introns, but they differ significantly over the 3' untranslated
regions. Two alpha chains plus two beta chains constitute HbA, which in normal
adult life comprises about 97% of the total hemoglobin; alpha chains combine
with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes
up the remaining 3% of adult hemoglobin. Alpha thalassemias result from
deletions of each of the alpha genes as well as deletions of both HBA2 and
HBA1; some nondeletion alpha thalassemias have also been reported.

c) What organism contains the gene?

Answer: The organism that contains this gene is Homo sapiens(Human).

d). On which chromosome is this gene located?

Answer: The human alpha globin gene cluster located on chromosome 16 .

e) Is it on positive or negative stand?

Answer: It is on Positive stand

f). How many introns does the gene contain?

Answer: The number of Introns are 2.

g). How many exons does the gene contain?

Answer: The Number of exons are 3.

h) What is the location of the gene ion the choromosome?

Answer: The gene is at the location chromosome: 16; Location: 16p13.3

i) This gene is the part of the gene cluster. What are the other genes in the cluster?
Answer: The other genes in the cluster are:
                 *Hemoglobin alpha 2
                 * Hemoglobin theta 1
   * Hemoglobin zeta
This cluster also contains 3 pseudogenes
   * pseudozeta
   *pseudoalpha 1
  * pseudoalpha 2
j)What protein does this gene code for?
Answer: the gene is coded for the protein alpha 1 globin.

k). What is the function of the protein?

Answer: The functions of the protein are:
* heme binding
*iron ion binding
*metal ion binding
*oxygen binding
*oxygen transporter activity

l).What is the sequence of the protein?(In FASTA format).

Answer: the sequence of te protein in the FASTA format is as below:
GATCACGCCATTGCACTCCACCCTGGGCGACAGAGCGACGAGACCCCGTATCAAAAAAAAAAAAAAGAAA
GAAAGAAAGAAAAAA…….. ………………
CTTTTCCTCAGAAATGGTATTCTCAAGGTGACACTGAGGAAAAGTGGACAGGCCGGGCGCGGTGGCTCACG
CCTGTAATCCCAGCACTCCGGGAGGCCGAGGCG
GGCGGATC

m). The protein is the part of protein complex. What is the complex? What are the other
components in the complex?

n) Are the genes for the other parts of the complex on the same chromosome? If not
where are they?

o) Gene ontology(GO) annotation provides information about the function of the gene
products using a control vocabulary to describe the protein function, the biological
process in which it participates, and its cellular component. What are the GO
annotations for the product of the gene?
Answer: The GO annotations for the product of the gene are:
­ Function
i. heme binding
ii. iron ion binding
iii. metal ion binding
iv. oxygen binding
v. oxygen transporter activity
­ Process
i. oxygen transport
ii. transport
­ Component
i. hemoglobin complex