User Guide for the Transgenomic SURVEYOR Check-It Kit for Clone Sequence Validation

www.transgenomic.com

For technical support and/or technical tips, please contact Transgenomic Technical Support: US Toll Free (888) 233-9283 or 402-452-5400 UK +44 1670-732-992 Europe +33 1-30-68-90-00 E-mail: support@transgenomic.com

Contents

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 SURVEYOR Check-It Kit Components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Detecting Mutations with the Transgenomic SURVEYOR Check-It Kit . . . . . . . . . . . . . 2 An Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Factors Affecting the Quality of Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 Signal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 Noise (Background) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Step-by-Step Instructions Detecting Mutations with the SURVEYOR Check-It Kit . . . . . . 5 Step 1 PCR Amplification of Reference and Test Samples . . . . . . . . . . . . . . . . . . 5 Amplification of DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 Preparing PCR Products . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 Step 2 DNA Hybridization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 Performing Heteroduplex Formation using a Thermocycler . . . . . . . . . . . . . . . . . 9 Performing Heteroduplex Formation without a Thermocycler . . . . . . . . . . . . . . . 9 Step 3 Treatment with SURVEYOR Nuclease . . . . . . . . . . . . . . . . . . . . . . . 10 Step 4 Analysis of DNA Fragments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 Control Experiments Using Control G and Control C Plasmid DNA . . . . . . . . . . . . . 11 Confirmation of Mutations Introduced by Site-Directed Mutagenesis . . . . . . . . . . . . . . 15 Appendix A: Agarose Gel Electrophoresis Preparing Gels . . . . . . . . . . . . . Running Gels . . . . . . . . . . . . . Photographing Gels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17 . 17 . 17 . 18

Appendix B: Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . Problem 1 Low PCR yield or no PCR product . . . . . . . . . . . . Problem 2 Multiple PCR products . . . . . . . . . . . . . . . . . . Problem 3 No cleavage products observed upon analysis after SURVEYOR Nuclease treatment of known heteroduplex . . . . Problem 4 High background after SURVEYOR Nuclease treatment

. . . . . . . . . . . . 19 . . . . . . . . . . . . 19 . . . . . . . . . . . . 20 . . . . . . . . . . . . 20 . . . . . . . . . . . . 21

References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22

SURVEYOR Check-It Kit

ii

SURVEYOR Check-It Kit

Introduction
The Transgenomic SURVEYOR Check-It Kit for Clone Sequence Validation has been designed to detect mutations in cloned DNA using a new mismatch-specific plant endonuclease. Key applications and benefits of using the SURVEYOR Check-It Kit include:

Identification of error-free cDNA or genomic DNA clones that have been generated using PCR-based cloning methods Verification that clones modified specifically by site-directed mutagenesis contain the desired mutation and lack undesired mutations Elimination of the need to isolate and sequence DNA from multiple colonies

PCR-based cloning and site-directed mutagenesis are established methods that require confirmation that the cloned insert possesses the desired sequence. This confirmation and identification step usually requires direct DNA sequencing of the insert DNA in multiple clones. Sequencing is necessary either to confirm the presence of the desired sequence and the absence of PCR or cloning errors, or to verify that the desired mutation has been properly introduced and that unwanted mutations are absent. Colonies generated by cDNA or genomic DNA cloning, or derived from site-directed mutagenesis experiments can be easily checked directly to determine whether unwanted mutations are absent, or whether desired mutations are present. This eliminates the need to isolate and sequence DNA from multiple single colonies. The kit is designed to digest unlabeled DNA with SURVEYOR Nuclease for subsequent analysis by agarose gel electrophoresis. SURVEYOR Nuclease, the key component of the kit, is a member of a new family of mismatch-specific plant endonucleases that cleaves DNA heteroduplexes at mismatch sites1,2. These DNA endonucleases cut both strands of a DNA heteroduplex on the 3-side of the mismatch site3,4. Insertion/deletion mismatches and all base-substitution mismatches are recognized, but the efficiency of cleavage varies with the sequence of the mismatch1,4. SURVEYOR Nuclease has been used to verify the presence of known mutations in a number of genes in human peripheral blood DNA5, to carry out screening for induced point mutations in barley6, and to screen for error-free clones generated from a plant cDNA library by PCRbased cloning7. FOR SUCCESSFUL USE OF THIS KIT, WE RECOMMEND STRONGLY THAT YOU READ THIS MANUAL THOROUGHLY AND FOLLOW THE INSTRUCTIONS AND GUIDELINES PROVIDED. If you have further questions or need assistance, please contact Transgenomic Technical Support Hotline/Help Desk: US Toll Free (888) 233-WAVE (9283) or 402-452-5400 UK - +44 1670-732-992 Europe - +33 1-30-68-90-00 Technical Support E-mail: support@transgenomic.com

SURVEYOR Check-It Kit

SURVEYOR Check-It Kit Components

The SURVEYOR Check-It Kit (Catalog No. 706040) has been designed for 100 reactions. Component Amount Provided 100 Reactions SURVEYOR Nuclease S Stop Solution Control C Control G Store all components at 20 C. 4 x 0.03 mL 0.25 mL 0.02 mL 0.02 mL

Detecting Mutations with the Transgenomic SURVEYOR Check-It Kit

An Overview
Mutation detection and confirmation with SURVEYOR Nuclease involves four steps: Step 1 Preparation of PCR amplicons from mutant (test) and wild-type (reference) DNA. Step 2 Mixing equal amounts of test and reference DNA; hybridizing them by heating and cooling the mixture to form hetero- and homoduplexes. Step 3 Treatment of the annealed heteroduplex/homoduplex mixture with SURVEYOR Nuclease. The reference DNA alone, treated similarly, serves as a background control. Step 4 Analysis of the DNA fragments by agarose gel electrophoresis. The formation of new cleavage products indicates the presence of a mutation, while their size indicates the location of the mutation.

SURVEYOR Check-It Kit

The combination of these four steps is outlined in the flow chart in Figure 1.

Figure 1. A schematic representation of mutation detection using SURVEYOR Nuclease.

Factors Affecting the Quality of Results

The two key factors that influence the quality of results are signal and noise (background).

Signal
The magnitude of the signal depends upon

The amount of DNA analyzed on a gel. The amount of DNA used as substrate for SURVEYOR Nuclease digestion should be at least 200 ng and as much as 400 ng. All of the digested DNA should be analyzed during gel electrophoresis.

The intensity of the fluorescent signal emitted during transillumination of the dye-intercalated DNA. We recommend the use of ethidium bromide (EtBr) to stain DNA, but alternative fluorescent dyes such as SYBR Gold can also be used with the appropriate detection system. For EtBr-stained DNA a transilluminator platform emitting light at the appropriate wavelength, i.e. 250 to 300 nm, must be used.

The sensitivity of the photography system used to capture the image of the gel. The sensitivities of commercial digital photography systems vary.

SURVEYOR Check-It Kit

The quality of the PCR amplified DNA. The presence of high concentrations of primer-dimers in PCR products dramatically inhibits SURVEYOR Nuclease cleavage at mismatch sites. Examine each amplified DNA product before digestion by gel electrophoresis to be sure it is a single sharp band of the expected size.

The relative proportion of mutant (test) to wild-type (reference) DNA in the hybridized sample. Whenever possible test and reference PCR products should be hybridized in equal proportion to maximize the amount of heteroduplex DNA available for digestion. After hybridization of equal amounts of test and reference DNA, on average half of the resulting DNA molecules will reanneal as homoduplexes and the other half as heteroduplexes; the heteroduplex population will contain two distinct heteroduplexes, each representing approximately 25% of the total population.

The efficiency of heteroduplex cleavage. SURVEYOR Nuclease cleaves heteroduplexes with efficiencies that can vary over a broad range. However, each substrate with a mismatch will have at least one heteroduplex species that will be efficiently cleaved at an ideal rate for analysis as described here.

Noise (Background)
The digestion pattern obtained by digesting heteroduplex DNA can also reveal the presence of fragments derived from PCR artifacts e.g., primer-dimers, products from primer mis-annealing, and DNA polymerase errors. A nearly identical background should be present in the digestion pattern of reference DNA, and this background can be identified by visual comparison of test and reference digestion patterns (see Figure 4 and 6). When the quality of the PCR product is poor, the background after SURVEYOR Nuclease digestion can reach a magnitude sufficient to obscure the signal. Examine each amplified DNA product before digestion by agarose gel electrophoresis to be sure it is a single sharp band. If it is not, optimize the PCR conditions until you obtain a single-band quality PCR product. SURVEYOR Nuclease has 5-exonuclease activity that gives rise to non-specific background products as digestion time is increased, and as the ratio of enzyme to DNA is increased. The SURVEYOR Check-It Kit has been designed to set up optimal reaction conditions that keep this background to a minimum. Reaction conditions for SURVEYOR Nuclease recommended in published literature and in an early version of this kit required dilution of DNA substrate into a reaction mixture containing a 1X reaction buffer. Subsequent research has shown that digestion of substrate DNA directly in PCR reaction buffer without dilution reduces background resulting in improved signal to noise.

SURVEYOR Check-It Kit

Step-by-Step Instructions Detecting Mutations with the SURVEYOR Check-It Kit

This section provides detailed instructions for the four-step process used for detection of mutations using the SURVEYOR Check-It Kit. The step-by-step process described can be stopped subsequent to completion of any step. DNA should be stored at 20 C until the next step is carried out.

Step 1 PCR Amplification of Reference and Test Samples

THIS STEP IS CRITICAL TO THE SUCCESS OF THE SURVEYOR NUCLEASE DIGESTION. DO NOT PROCEED UNTIL:

Your PCR yield is sufficiently high (>25 ng/L). Your PCR product has low background (preferably a single band species of the correct size).

The first step in the process involves the preparation of the amplified DNA samples. Amplification of DNA PCR product from a test sample must be hybridized with PCR product from a reference sample in order to generate potential mismatches for SURVEYOR Nuclease cleavage. Both test sample and reference DNA are amplified with the same primer pair. Test sample and reference PCR products are mixed in a 1:1 ratio to maximize the formation of heteroduplexes during hybridization.

For genomic or cDNA gene cloning, amplify the gene or gene segment from genomic or cDNA to generate reference DNA and amplify the gene of interest from 5 to 10 individual colonies to generate a set of test DNAs. For site-directed mutagenesis applications, amplify the gene of interest from the original non-mutated plasmid to generate reference DNA and from 5 to 10 individual colonies to generate a set of test DNAs.

Several factors must be considered carefully in preparing PCR amplified DNA to be used as substrate for SURVEYOR Nuclease analysis. Primer placement and amplified product quality and yield are crucial to obtaining good results. The following should be considered:

Amplified DNA fragments in the size range of 200 to 4,000 bp can be analyzed for mutations with SURVEYOR Nuclease on agarose gels. With smaller substrates (<1,000 bp), place primers at least 50 bp outside the region of interest to ensure that the cleavage products are at least 70 bp, since shorter cleavage products are not resolved easily from potential PCR product artifacts (e.g. primer dimers) and are not visualized efficiently on agarose gels. For larger substrates (>1,000 bp), it becomes important to place primers at a distance from a potential mutation equivalent to >10% of the length of the substrate, so that large digestion products can be separated from undigested substrate and the length and amount of small digestion products are sufficient to give visible bands.

SURVEYOR Check-It Kit

For a new PCR amplicon, the PCR parameters must be optimized carefully. The PCR amplicon should appear as a single sharp band of the expected size when analyzed by agarose gel electrophoresis. Mispriming during PCR amplification can result in the formation of spurious DNA fragments that produce increased background during SURVEYOR Nuclease digestion. This places a premium on the careful design of primers and optimization of PCR conditions. Use primers that are at least 20 nucleotides long (25 to 35 oligomers are preferred), and have a G-C content of 45-60%. If after careful design of primers and optimization of PCR conditions non-specific PCR products persist, consider using a hot-start DNA polymerase, a touchdown PCR protocol, and/or a second amplification with nested primers. Both the amount and concentration of DNA in a SURVEYOR Nuclease reaction mixture influence the efficiency and specificity of SURVEYOR Nuclease digestion. For the amount of enzyme recommended for use in a reaction mixture (1 L of SURVEYOR Nuclease S), 200 - 400 ng of substrate at 50 ng/L is optimal. If DNA product yield is <25 ng/L, consider a second amplification with nested primers or concentrating the DNA by ethanol precipitation to increase the DNA concentration. For a new PCR amplicon derived directly from cDNA or genomic DNA, the primer sequences must be optimized carefully. Primers that do not prime in pseudogenes or sequence repeats for example, can be designed using Primer3 (http://www.broad.mit.edu/ cgibin/primer/primer3_www.cgi).

Continue with the Preparing PCR Products section. Preparing PCR Products To prepare smaller PCR products (<2,000 bp) from E. coli colonies, we recommend T-Taq DNA polymerase (Transgenomic Catalog Number 703105 or 703110). For amplification of larger fragments in good yield, use a DNA polymerase blend (Taq DNA polymerase plus a proofreading DNA polymerase). We recommend Maximase Polymerase (Transgenomic Catalog Number 703205 and 703245): 1 Suspend 5 to 10 individual E. coli colonies from an overnight plate in separate tubes in 10 L of TE (10 mM Tris-HCl, pH 7.5, 1 mM EDTA) by gentle agitation. After removing the required amount (about 2 L) of the suspension for the PCR amplification, add 10 volumes of culture medium with antibiotic and store the cell suspension at 4 C. The bacteria are stable for several weeks for replating. 2 Add the following components to each of the required number of 0.2-mL tubes (kept on ice). One tube will be used for reference DNA and the others for individual colony DNAs:

Sterile, deionized water sufficient to bring the final volume to 50 L 5 L 10X Taq DNA polymerase reaction buffer (includes MgCl2) 2 L colony suspension or reference DNA (10 ng plasmid DNA or 100 ng genomic
DNA or cDNA)

4 L dNTPs (2.5 mM each of dTTP, dATP, dCTP and dGTP; final concentration of each
dNTP is 0.2 mM)

10 picomoles sense primer (~80 ng of a 25-mer) 10 picomoles antisense primer 0.5 L Taq DNA polymerase (2.5 units)
6
SURVEYOR Check-It Kit

Note the following:

The PCR amplified reference DNA must be prepared in sufficient quantity (800-1,500 ng total) to hybridize to each colonys amplified DNA and to itself. Depending upon PCR product yield, it may be necessary to set up several PCR amplifications of reference DNA. Determine the annealing temperature (Ta) by calculating the Tm for each primer using the following equation: Tm = 63.728 + (0.41 x %GC) (600/length) %GC = percentage GC of the primer length = length of the primer in nucleotides Ta is the average of the two primer Tms + 3 C

3 Set up the PCR amplification using the following program for a heated-lid thermocycler: 94 C 94 C Ta C 72 C 2 min x 1 cycle

30 s 30 s x 35 cycles 30 s per 500 bp

72 C 5 min 4 C Hold 4 Analyze 2- to 5-L aliquots of each product by electrophoresis in the appropriate percentage agarose gel (see Appendix A: Agarose Gel Electrophoresis). Add 1/6 volume of a 6X loading dye buffer [10 mM Tris-HCl (pH 8.0), 10 mM EDTA (pH 8.0), 50% (w/v) sucrose, 0.15% (w/v) bromophenol blue] or your own loading dye buffer of choice and mix. Also run several different amounts of a DNA mass ladder, such as a 100-bp DNA Ladder (New England Biolabs, Beverly, MA), as a reference. 5 Visualize the DNA bands using a UV transilluminator at 254 or 302 nm and photograph the gel. 6 Use the DNA ladder to estimate the concentration of the amplified DNAs by visual inspection. If a single band is visible in each sample, proceed; if not, consider optimizing the PCR procedure further. The DNA concentration of the PCR product should be >25 g/ L and is usually in the 4050 ng/L range. 7 The amplified DNA can be used without further purification. Alternatively, the DNA can be concentrated by ethanol precipitation. To precipitate DNA, transfer the reaction mixtures to microcentrifuge tubes that can be centrifuged at high speed. Add 2.5 volumes of ethanol and store the tubes at 20 C for 30 min. Centrifuge the tubes at 13,000 rpm for 10 min in a microcentrifuge. Carefully remove the ethanol with a micro-pipetter, being sure not to disturb the invisible pellet on the tube sidewall and bottom. Concentrated PCR products are resuspended in a reduced volume of 1X PCR buffer. Estimate the DNA concentration on an agarose gel as described above. Once you have prepared the PCR products, continue with Step 2 DNA Hybridization.

SURVEYOR Check-It Kit

Step 2 DNA Hybridization

Hybridize each test sample DNA with reference DNA to form potential hetero- and homoduplexes. Hybridize the reference DNA alone to form a reference control. The use of a heated-lid thermocycler is recommended. Because amplified PCR products are hybridized and digested with SURVEYOR Nuclease directly in 1X PCR buffer, careful consideration must be given to the 1X PCR buffer composition. Read the manufacturers literature to determine the salt concentration of the 1X PCR buffer before carrying out the hybridization step. The salt concentration in the PCR product solution should be in the range of 50 to 75 mM to ensure that complete annealing of complementary DNA strands takes place. Reaction buffers used for most PCR DNA polymerases do not require additional salt. For example a PCR buffer for a Taq polymerase is typically 10 mM Tris-HCl, 50 mM KCl and 1.5 mM MgCl2; for Optimase Polymerase the 1X PCR buffer consists of 10 mM Tris-HCl, 75 mM KCl and 1.5 mM MgCl2. Therefore PCR products amplified with these buffers can be annealed directly without the addition of KCl. However, if the PCR product was prepared with a low salt PCR buffer, sufficient 0.5 M KCl should be added to adjust the final KCl concentration to be within the range of 50 to 75 mM. Please note that KCl concentrations above 75 mM inhibit the SURVEYOR Nuclease; therefore it is critical that KCl be added only when it is required. Read the manufacturers literature to determine the other constituents of the 1X PCR buffer before carrying out the SURVEYOR Nuclease digestion step. The constituents of most 1X PCR buffers support efficient digestion of heteroduplex DNA by SURVEYOR Nuclease. These include 10 to 20 mM Tris-HCl or Tris-SO4 (pH 8.3 to 9.3), 50 to 75 mM KCl, 1 to 3 mM MgCl2 or MgSO4, 0.1% to 1% nonionic detergent, and BSA or gelatin. (NH4)2SO4 at 10 to 20 mM is also acceptable as long as the KCl concentration is <50 mM. PCR additives such as DMSO (>5%), glycerol (>10%), betaine (>1 M), and 1X PCRx Enhancer (Invitrogen) inhibit SURVEYOR Nuclease above the concentrations listed. If any of these or other additives are present in the PCR reaction mixture, they must be removed before the PCR product is treated with SURVEYOR Nuclease. If additives are present, we suggest using ethanol precipitation to clean up the PCR product before the hybridization step (see Preparing PCR Products section). The precipitated DNA should be dissolved in a 1X PCR buffer compatible with the hybridization and SURVEYOR Nuclease digestion steps, such as 10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2, and 50 mM KCl. If the manufacturer does not reveal the contents of the PCR buffer, precipitate the DNA product and dissolve it in a compatible PCR buffer. If you are using a thermocycler, go to the Performing Heteroduplex Formation using a Thermocycler section below. If your thermocycler cannot be programmed appropriately for hybridization or if it lacks a heated lid, go to the Performing Heteroduplex Formation without a Thermocycler section below.

SURVEYOR Check-It Kit

Performing Heteroduplex Formation using a Thermocycler To perform heteroduplex formation using a thermocycler: 1 Mix equal amounts of test sample and reference PCR products in a 0.2-mL tube. Place reference DNA alone in a separate 0.2-mL tube. For efficient annealing the final volume should be at least 10 L. NOTE the following: The concentration of test sample DNA and reference DNA should be at least 25 ng/L. About 200 ng of hybridized DNA is treated with SURVEYOR Nuclease S, so that each tube should contain >200 ng total DNA. 2 Place the tubes in a thermocycler and run the following program: 95 C 95 C to 85 C 85 C to 25 C 4 C 2 min (-2 C/s) (-0.1 C/s) Hold

The product is now ready to be treated with SURVEYOR Nuclease for heteroduplex analysis. Continue with Step 3 Treatment with SURVEYOR Nuclease. Performing Heteroduplex Formation without a Thermocycler To perform heteroduplex formation without a thermocycler: 1 Mix equal masses of the two PCR products intended to generate the heteroduplex as described above. As a control, set up reference DNA in a separate tube as above. 2 Place the tubes in a 1-liter beaker filled with 800 mL of water, preheated to 95 C. 3 Incubate the tubes at 95 C for 5 min and then allow the water to cool to <30 C. NOTE the following: Evaporation of liquid at the tube bottom and condensation inside the tube lid can change the concentrations of constituents in the mixture at the bottom of the tube. To minimize this effect, the volume at the bottom of the tube should be >20 L. 4 Spin the tube contents to the bottom of the tube. Store the DNA at 20 C if it is not digested immediately. The products are now ready to be treated with SURVEYOR Nuclease for heteroduplex analysis. Continue with Step 3 Treatment with SURVEYOR Nuclease.

SURVEYOR Check-It Kit

Step 3 Treatment with SURVEYOR Nuclease

Once you have prepared the test sample/reference hetero/homoduplex mixtures and hybridized reference control, you must treat them separately with SURVEYOR Nuclease directly in appropriate 1X PCR buffer (for details see Step 2 DNA Hybridization). To treat the test/reference mixtures and reference control with SURVEYOR Nuclease: 1 Digest the test/reference DNA samples and reference control DNA in separate tubes. 2 For each digestion, add the following components in the order shown to a nuclease-free 0.2-mL tube (kept on ice):

200 - 400 ng (4 to 16 L) hybridized DNA 1 L SURVEYOR Nuclease S

3 Mix by vortexing gently, by agitation or by aspiration/expulsion in a pipette tip using a micro-pipetter. 4 Incubate at 42 C for 20 min. 5 Add 1/10 volume of Stop Solution and mix. Store the digestion products at 20 C if they are not going to be analyzed immediately. Continue with Step 4 Analysis of DNA Fragment.

Step 4 Analysis of DNA Fragments

To analyze the SURVEYOR Nuclease digestion products by agarose gel electrophoresis: 1 Add 1/6 volume of a 6X loading dye buffer [10 mM Tris-HCl (pH 8.0), 10 mM EDTA, 50% (w/v) sucrose, 0.15% (w/v) bromophenol blue] or your own loading dye buffer of choice to each SURVEYOR Nuclease reaction mixture and mix. 2 For each digestion/loading dye mixture load all the mixture into the well of an appropriate percentage agarose gel (see Appendix A: Agarose Gel Electrophoresis) run in appropriate running buffer. Also load a DNA ladder as a size reference marker in one of the adjacent wells. Run the gel at 5 V/cm until the bromophenol blue has migrated 2/3 of the length of the gel. 3 Illuminate the gel using a UV transilluminator (254 or 302 nm) to visualize the bands and take a photograph. Note: Small SURVEYOR Nuclease digestion products (<100 bp) are more easily detected early during a gel electrophoresis run. We recommend that the run be stopped after the dye has migrated about 1/3 of the length of the gel for the purpose of photographing the gel early in the run. To resolve the larger fragments, continue with the electrophoresis process until the dye has run 2/3 of the length of the gel, and photograph the gel a second time.

10

SURVEYOR Check-It Kit

Control Experiments Using Control G and Control C Plasmid DNA

Two DNAs, Control G and Control C, are provided in the SURVEYOR Check-It Kit. These two control DNAs are plasmids with inserts that differ at a single base pair. They are provided in separate vials each at a concentration of 5 ng/L; forward and reverse primers needed for PCR amplification are already combined with the plasmid templates. The sequence of the PCR product for Control G is shown below. Control C differs from Control G because it has a C in lieu of the G (underlined). Primer sequences are underlined at the 5 and 3 end of the amplicon sequence. ACACCTGATCAAGCCTGTTCATTTGATTACCAGAGAGACTGTCATTGATCCACAT GGAGGGAAGGACATGTGTGTTGCTGGAGCCATTCAAAATTTCACATCTCAGCTTG GCCATTTCCGCCATGGAACATCTGATCGTCGATATAATATGACAGAGGCTTTGTT ATTTTTATCCCACTTCATGGGAGATATTCATCAGCCTATGCATGTTGGATTTACA AGTGATATGGGAGGAAACAGTATAGATTTGCGCTGGTTTCGCCACAAATCCAACC TGCACCATGTTTGGGATAGAGAGATTATTCTTACAGCTGCAGCAGATTACCATGG TAAGGATATGCACTCTCTCCTACAAGACATACAGAGGAACTTTACAGAGGGTAGT TGGTTGCAAGATGTTGAATCCTGGAAGGAATGTGATGATATCTCTACTAGCGCCA ATAAGTATGCTAAGGAGAGTATAAAACTAGCCTGTAACTGGGGTTACAAAGATGT TGAATCTGGCGAAACTCTGTCAGATAAATACTTCAACACAAGAATGCCAATTGTC ATGAAACGGATAGCTCAGGGTGGAATCCGTTTATCCATGATTTTGAACCGAGTTC TTGGAAGCTCCGCAGATCATTCTTTGGCG PCR amplification of 2 L of each DNA solution in a 50-L reaction should produce 20-50 g/L of a 632-bp amplicon. Sufficient DNA is provided to perform ten PCR reactions with each control. Control G and Control C can be used to troubleshoot the PCR amplification, hybridization, and SURVEYOR Nuclease digestion steps of the SURVEYOR Check-It Kit. Use the control plasmids Control G and Control C as follows: 1 Amplify Control G and Control C DNA using Taq DNA polymerase and the reaction conditions and the PCR program described in Step 1 PCR Amplification of Reference and Test Samples where Ta = 65 C and the 72 C extension time is 1 min. 2 After amplification, analyze a 2-L aliquot of each amplified DNA and a DNA ladder on a 2% high-resolution agarose gel and compare the band intensities with those of the DNA ladder to estimate the DNA concentration. 3 Hybridize Control G- and Control C-amplified DNA in equal amounts as described in Step 2 DNA Hybridization. This produces a population of molecules containing 50% homoduplex, 25% heteroduplex with a C/C mismatch, and 25% heteroduplex with a G/G mismatch. 4 Digest 200 ng of hybridized Control G/C DNA and 200 ng of Control G or C with SURVEYOR Nuclease as described in Step 3 Treatment with SURVEYOR Nuclease. 5 Analyze the digested Control G/C DNA and Control G or C DNA as described in Step 4 Analysis of DNA Fragments.

SURVEYOR Check-It Kit

11

SURVEYOR Nuclease digestion of hybridized Control G/C PCR products gives rise to two cleavage products, 217 and 415 bp in size, which are clearly distinguishable by agarose gel electrophoresis as shown in Figure 2. Since SURVEYOR Nuclease cleaves the mismatched DNA substrate strands on the 3 side of the mismatched base, the two resulting fragments have a single base 3 overhang.

632 bp Substrate 415 bp Product 1 217 bp Product 2

Figure 2. SURVEYOR Nuclease digestion products derived from 200 ng of Control G/C heteroduplex (lane 1), Control G homoduplex (lane 2), and Control C homoduplex (lane 3) analyzed by electrophoresis on a 1.5 % standard agarose gel run in 1X TBE. The Control G/C heteroduplex was formed by hybridizing equal amounts of Control G and C homoduplex PCR product DNA and contains C/C and G/G mismatched heteroduplexes and the two original homoduplexes. Lane M shows a 100-bp Ladder (New England BioLabs, Beverly, MA). DNA substrates were digested with 1 L of SURVEYOR Nuclease S for 20 min at 42 C.

12

SURVEYOR Check-It Kit

cDNA Cloning and Verification of Clone Fidelity

Inserts in cDNA clones (and also genomic clones) that have been generated using a PCR cloning method can be analyzed very effectively for errors using SURVEYOR Nuclease. An example of how the SURVEYOR Check-It Kit can be used to identify error-free cDNA clones generated by RT-PCR cloning is presented below. The procedures for cDNA generation and clone verification are summarized in the flowchart in Figure 3, and specific clone verification results for three different cDNA constructs are presented in Figure 4.
Generation of cDNA Clones by RT-PCR Cloning Isolation of total RNA RNA template First Strand cDNA Synthesis using an appropriate primer and reverse transcriptase First strand cDNA template PCR Amplification using a thermostable DNA polymerase and gene-specific primers Double-stranded cDNA Ligation into appropriate plasmid vector Transformation of E. coli Plating of transformants Colonies representing individual cDNA clones Verification of Cloning Fidelity. Does this clone contain the correct sequence? Colony PCR of Test DNA Generate PCR products derived from the cDNA insert in the recombinant plasmid clone cDNA PCR of Reference DNA Generate PCR products derived from the original cDNA sequences used for cDNA cloning

Combine PCR Products Heating and Cooling for Hybridization and Heteroduplex Formation SURVEYOR Nuclease Treatment Analysis by Agarose Gel Electrophoresis

Figure 3. Flowchart outlining the steps involved in cDNA clone generation and clone verification using the SURVEYOR Check-It Kit. Note the cDNA obtained at the stages marked by an arrowhead (), or a cDNA library, can be used as a source of reference cDNA for amplification. 13

SURVEYOR Check-It Kit

Results obtained while screening cDNA clones with PCR methods to check the insert sizes, and results obtained with the SURVEYOR Check-It Kit used to identify error-free clones are shown in Figure 4. Panel A shows the sizes of the inserts amplified by PCR methods, and Panel B shows SURVEYOR Nuclease digestion products obtained for these amplicons annealed with amplified cDNA. When compared to the control in lanes labeled c, bona fide error-free clones show no extra bands in their SURVEYOR Nuclease digests and are marked by asterisks. NADP+ clone #2, SUT1 clones #1 and #4, and Mat2 clones #4 and #5, are errorfree.

NADP+

SUT1

Mat2
1 2 3 4 5 c L

1 2 3 4 5 c L 1 2 3 4 5 c L

* *

Figure 4. Analysis of cDNA inserts by PCR (Panel A) and by digestion with SURVEYOR Nuclease (Panel B). Three different PCR primer pairs were used to generate and clone three distinct cDNA inserts encoding a NADP+, SUT1 and Mat2 gene, respectively. Five colonies from each group of transformants were picked for colony PCR. The PCR products for these fifteen colonies were analyzed by agarose gel electrophoresis as shown in Panel A. In each group the PCR fragments derived from individual colonies are shown in lanes 1 to 5, and the PCR fragment derived from the original cDNA is in lane c. Lane L shows the 1 Kb DNA ladder. Panel B shows the digestion products obtained by SURVEYOR Nuclease digestion of the amplified individual clone inserts (lanes 1-5) hybridized with the amplified original cDNA (lane c). Lanes for clones containing error-free inserts are marked with asterisks.

14

SURVEYOR Check-It Kit

Confirmation of Mutations Introduced by Site-Directed Mutagenesis

Generation of Clones Modified by Site-Directed Mutagenesis Target DNA template (cloned DNA in a plasmid cloning vector) Also to be used as a source of reference DNA Site-Directed Mutagenesis Transformation of E. coli Plating of transformants Colonies representing individual clones with modified sequence Confirmation of Site-Directed Mutagenesis. Does this clone contain the desired modification in its sequence? Colony PCR of Test DNA PCR of Reference DNA Generate PCR products derived from cloned mutant DNA Generate PCR products derived from original cloned DNA

Combine PCR Products Heating and Cooling for Hybridization and Heteroduplex Formation SURVEYOR Nuclease Treatment Analysis by Standard Gel Electrophoresis

Figure 5. Flowchart outlining the steps involved in site-directed mutagenesis and verification of the presence of the desired mutation in the target sequence using the SURVEYOR Check-It Kit.

SURVEYOR Check-It Kit

15

Figure 6 shows the results obtained while using the SURVEYOR Check-It Kit to check 11 colony clones that had been modified by amplification-based site-directed mutagenesis. Panel A shows the amplicons for the 11 clones. Note that the amplicon for clone #3 is slightly larger than the others indicating that this clone contains a cloning artifact. The other clones appear to be identical. Panel B shows the cleavage products obtained when these amplicons were hybridized with the original reference DNA amplicon (lane 12) and then digested with SURVEYOR Nuclease. Clones #3 and #4 show patterns that differ from the others indicating that these contained undesired mutations. The fact that several extra bands appear in clone #4 indicates that this colony DNA contains an undesired mutation in this region. All other clones contain the desired mutation and no cloning artifacts or PCR errors. 1 2 3 4 5 6 7 8 9 10 11 12 M

* *

* * * * * * *

Figure 6. Analysis of DNA derived from potential mutant colonies obtained by site-directed mutagenesis. Amplification-based site-directed mutagenesis was used to introduce a 3-base insertion into plasmid pQIS155. PCR products and SURVEYOR Nuclease digestion products were analyzed by agarose gel electrophoresis. Panel A: PCR products of individual colonies bearing a potential mutant plasmid were analyzed by agarose gel electrophoresis. Lanes 1 to 11 show PCR products from colony #1 through #11. Lane 12 contains PCR products from the wild-type plasmid pQIS155. Panel B: PCR products shown in panel A were annealed with amplified wild-type DNA (Reference DNA), digested with SURVEYOR Nuclease, and analyzed by electrophoresis (lanes 1-11). Lane 12 contains PCR products from wild-type homoduplex reference DNA that was treated with SURVEYOR Nuclease as well. Note that all clones contained the 3-base insertion introduced by site-directed mutagenesis. However, clones #3 and #4 have additional banding patterns that differ from the other clones indicating that these two clones also contain cloning artifacts or PCR errors. Lane L shows a 100-bp ladder as a marker. Lanes for clones containing error-free inserts are marked with asterisks.

16

SURVEYOR Check-It Kit

Appendix A: Agarose Gel Electrophoresis

Appropriate preparation, electrophoresis, and photography of agarose gels are critical steps to achieving success with SURVEYOR Nuclease particularly for achieving maximum detection sensitivity.

Preparing Gels
Select the percentage and type of agarose appropriate for the DNA fragment sizes to be analyzed. For DNA fragments <1.5 kb, use a high resolution agarose such as TransOneK Agarose (Transgenomic Catalog No. 556001). TransOneK Agarose is specifically formulated to resolve smaller DNA fragments at a lower percentage gel (see Table 1), and produces minimal fluorescent background during transillumination and photography. For DNA fragments >1.5 kb, use a standard agarose such as TransFiveK Agarose (Transgenomic Catalog No. 556005). TransFiveK Agarose can be used to resolve DNA fragments in the 300 to 5,000 kb range at the appropriate percentage (see Table 1), and also produces minimal fluorescent background during gel analysis. Select the appropriate buffer to cast and run the gel. 1X TAE buffer [40 mM Tris-acetate (pH 8.3), 1 mM EDTA] is generally used for resolution of fragments >0.5 kb. For smaller fragments, particularly when analyzing digestion products in the 100 to 300 bp range, 1X TBE [89 mM Tris-borate (pH 8.3), 1 mM EDTA] should be used. 1X TBE helps to reduce diffusion of small DNA fragments during electrophoresis, giving a sharper, more focused band. To visualize DNA any time during an electrophoresis run, cast the gel in a UV-transparent gel tray and incorporate a DNA intercalating dye into the gel-casting buffer. Inclusion of dye in the gel running buffer is not necessary. We recommend the use of ethidium bromide (EtBr) at 0.1 0.5 g/mL in the gel. Within this concentration range, higher concentrations of EtBr tend to give more intense staining of DNA bands at the cost of higher fluorescence background in the gel lanes. Before bringing the agarose into solution by boiling in a microwave oven, hydration of the solid agarose by soaking in buffer for 20-30 min will reduce melting time and foaming. Weigh the container before and after bringing the agarose into solution and restore any liquid lost during heating with water. Let the agarose cool to 55 to 65 C before pouring the gel. Use a comb <1 mm thick to help sharpen bands. Make the gel only as thick as necessary to accommodate in the wells the maximum volume of sample loaded.

Running Gels
Carry out electrophoresis at 5 10 V/cm where distance in cm is measured between electrodes. Small SURVEYOR Nuclease digestion products (<100 bp) are more easily detected early during a gel electrophoresis run, particularly when larger substrates are analyzed. We recommend that the electrophoresis be stopped after the bromophenol blue (BPB) has migrated about 1/3 of the length of the gel for the purpose of photographing the gel early in the run. Then continue electrophoresis until the BPB has run 2/3 of the length of the gel and photograph the gel a second time.

SURVEYOR Check-It Kit

17

Photographing Gels
The sensitivity of DNA fragment detection in agarose gels varies both with the wavelength of the UV transilluminator used and the sensitivity of the photography system. Most transilluminators allow selection for illumination of DNA at several wavelengths. Use illumination at the shortest wavelength possible to increase signal intensity. We have used several different commercial digital photography systems, and have found the AlphaImager 2200 Imaging System from Alpha Innotech Corp. (San Leandro, CA) to give the most sensitive detection of EtBr stained DNA. Photograph the gel at several different exposure settings to achieve the best ratio of signal to background fluorescence. Table 1 Relationship of DNA Substrate Size, Agarose Type and Gel Concentration, and Running Buffer Agarose Type TransOneK Agarose Agarose Agarose
aSpecifically a

DNA Fragment Size (kb) <1.5 1.5 2.5 2.5 - 5

Agarose (%) 2 1.5 1.2

Buffer TBE or TAE TAE or TBE TAE

TransFiveK
b

TransFiveK
b

formulated agarose for high resolution of small fragments agarose formulated for separation of larger fragments

bMulti-purpose

18

SURVEYOR Check-It Kit

Appendix B: Troubleshooting
Effective use of the SURVEYOR Mutation Detection Kit depends upon successful completion of a number of steps. One of the most critical is PCR amplification that must result in the production of specific, uniform-sized DNAs in sufficient quantity to be detected after hybridization and cleavage. Also critical is matching the amount of DNA and SURVEYOR Nuclease used. If you are a first-time user, you should process the control DNAs provided through all the steps as described in Control Experiments Using Control G and Control C Plasmid DNA. The Control DNAs should be used also to troubleshoot various steps in the procedure. This appendix section covers a list of issues that you might encounter when using the SURVEYOR Mutation Detection Kit and how to resolve them.

Problem 1 Low PCR yield or no PCR product

POSSIBLE CAUSE Inhibition of PCR by colony Not enough template and/ or too few cycles Suboptimal PCR parameters SOLUTION Use less cell suspension or dilute the original cell suspension. Increase the volume of cell suspension and/or add more PCR cycles. Do one or more of the following:

Decrease the annealing temperature in increments of 2 C. Increase the extension time. For Taq DNA polymerase, use 1 min per 1 kb.

Suboptimal DNA polymerase for target Target fragment too large for Taq DNA polymerase

Use Taq DNA polymerase or a hot-start version of Taq DNA polymerase. Increase the amount of DNA polymerase. Use a Taq DNA polymerase blend (a mixture containing Taq DNA polymerase and a proofreading DNA polymerase) such as Maximase Polymerase (Transgenomic Catalog No. 703245).

SURVEYOR Check-It Kit

19

Problem 2 Multiple PCR products

POSSIBLE CAUSE Poor primer design Annealing temperature too low Extension time too long Cycle number too high Suboptimal PCR conditions SOLUTION Redesign primers to improve specificity, Tm, and GC content. Increase the annealing temperature in increments of 2 C. Reduce the extension time. For Taq DNA polymerase, use 1 min per 1 kb. Reduce cycle number in increments of 2. Use hot-start PCR and/or touchdown PCR or perform nested PCR.

Problem 3 No cleavage products observed upon analysis after SURVEYOR Nuclease treatment of known heteroduplex
POSSIBLE CAUSE Proportion of mismatch target too low Cleavage site too close to PCR product end Inactive SURVEYOR Nuclease Too little enzyme Too little substrate SOLUTION Mix equal amounts of test and reference DNA before annealing. Redesign the primer set to move the target site away from ends. Perform the Control reaction to verify enzyme performance. Increase the amount of SURVEYOR Nuclease 2-fold and repeat digestion. Concentrate the PCR products by ethanol precipitation before annealing.

20

SURVEYOR Check-It Kit

Problem 4 High background after SURVEYOR Nuclease treatment

POSSIBLE CAUSE Suboptimal hybridization step SOLUTION Do the following: 1 Make sure the DNA concentration is in the range of >25 ng/L to <50 ng/L. 2 Repeat the hybridization step, taking care to cool the annealing mixture slowly. 3 Add 1X PCR reaction buffer to precipitated products before annealing. 4 Use sufficient sample volume (>20 L) during hybridization in a water bath. 5 Add 1/10 volume 0.5 M KCl to PCR product contained in low salt 1X PCR reaction buffer Errors introduced by PCR enzyme Incubation time too long Too much SURVEYOR Nuclease DNA amount too low Nonspecific PCR products Use a Taq DNA polymerase-based blend with higher fidelity. Reduce the SURVEYOR Nuclease digestion time by increments of 5 min. Reduce the SURVEYOR Nuclease amount 2-fold and repeat digestion. Increase the DNA amount to at least 200 ng of substrate per 1 L of SURVEYOR Nuclease used. Optimize the PCR parameters to increase specificity. Always use an appropriate substrate as a control to identify background.

SURVEYOR Check-It Kit

21

References
1 Oleykowski, C.A., Bronson Mullins, C.R., Godwin, A.K. and Yeung, A.T. (1998) Mutation detection using a novel plant endonuclease. Nucleic Acids Res. 26, 4597-4602. 2 Yang, B., Wen, X., Kodali, N.S., Oleykowski, C.A., Miller, C.G., Kulinski, J., Besack, D., Yeung, J.A., Kowalski, D. and Yeung, A.T. (2000) Purification, cloning, and characterization of CEL I nuclease. Biochemistry 39, 3533-3541. 3 Sokurenko, E.V., Tchesnokova, V., Yeung, A.T., Oleykowski, C.A., Trintchina, E., Hughes, K.T., Rashid, R.A., Brint, J.M., Moseley, S.L. and Lory, S. (2001) Detection of simple mutations and polymorphisms in large genomic regions. Nucleic Acids Res. 29, e111. 4 Qiu, P. Shandilya, H., DAlessio, J.M., OConnor, K., Durocher, J. and Gerard, G.F. (2004) Mutation detection using Surveyor Nuclease. BioTechniques, 36, 702-707. 5 Scaffino, M.F., Pilotto, A., Papadimitriou, S., Sbalzarini, M., Ansaldi, S., Diegoli, M., Porcu, E., Grasso, M., Brega, A. and Arbustini, E. (2004) Heteroduplex detection with a plant DNA endonuclease for standard gel electrophoresis. Transgenics 4, 157-166. 6 Caldwell, D.G., McCallum, N., Shaw, P., Muehlbauer, G.J., Marshall, D.F. and Waugh, R. (2004) A structured mutant population for forward and reverse genetics in Barley (Hordeum vulgare L.). The Plant Journal doi: 10.1111/j.1365-313X.2004.02190.x. 7 Qiu, P., Shandilya, H. and Gerard, G.F. (2005) A method for clone confirmation using a mismatch-specific DNA endonuclease. Mol. Biotechnol. 29, 11-18.

22

SURVEYOR Check-It Kit

Corporate Headquarters
Transgenomic, Inc. 12325 Emmet Street Omaha, NE 68164, USA Phone: +1 (888) 233-9283* or +1 (402) 452-5400 Fax: +1 (402) 452-5401 E-mail: info@transgenomic.com *In North America only

Europe
Transgenomic Ltd. Z.A. de la Clef Saint Pierre 10B, Rue Blaise Pascal 78990 ELANCOURT France Phone: +33 (0) 1 30 68 90 00 Fax: +33 (0) 1 30 68 90 01

Technical Support E-mail: support@transgenomic.com

www.transgenomic.com

This product is manufactured under exclusive license to US Patents 6,391,557; 5,869,245; and other patents pending. Use of SURVEYOR Nuclease requires a license from Transgenomic. Academic, not-for-profit and for-profit organizations have limited rights to use SURVEYOR Nuclease for research purposes with purchase of this product. Resale or other uses are strictly prohibited. Please contact Transgenomic for more information. TRANSGENOMICtransforming the world and the globe logo are , registered trademarks, and SURVEYOR TransOneKTransFiveK and , , Maximase are trademarks of Transgenomic, Inc. All other trademarks are trademarks of their respective holders. 2005 Transgenomic, Inc. All rights reserved. Printed in USA. Document Part No. 482108-01