The Plant Journal (2004) 40, 622631

doi: 10.1111/j.1365-313X.2004.02233.x

TECHNICAL ADVANCE

Virus-induced gene silencing as a tool for functional genomics in a legume species

Gabriela D. Constantin1, Britta N. Krath1,, Stuart A. MacFarlane2, Mogens Nicolaisen3, Ida Elisabeth Johansen1,* and Ole S. Lund1 1 Department of Plant Biology, Danish Institute of Agricultural Sciences, Thorvaldsensvej 40, DK-1871 Frederiksberg C, Denmark, 2 Scottish Crop Research Institute, Invergowrie, Dundee, Scotland DD2 5DA, UK, and 3 Department of Crop Protection, Research Centre Flakkebjerg, Danish Institute of Agricultural Sciences, DK-4200 Slagelse, Denmark
Received 14 May 2004; revised 22 July 2004; accepted 17 August 2004. * For correspondence (fax 45 3528 2589; e-mail e.johansen@dias.kvl.dk). Present address: Danish Institute for Food and Veterinary Research, Mrkhj Bygade 19, DK-2860 Sborg, Denmark.

Summary Virus-induced gene silencing (VIGS) is an attractive reverse-genetics tool for studies of gene function. However, efcient VIGS has only been accomplished in a few plant species. In order to extend the application of VIGS, we examined whether a VIGS vector based on Pea early browning virus (PEBV) would produce recognizable phenotypes in Pisum sativum. A plasmid vector of PEBV was modied to allow agro-inoculation and insertion of heterologous sequences. cDNA fragments of the P. sativum phytoene desaturase (PDS), LEAFY (LFY) and KORRIGAN1 (KOR1) homologues were inserted into the PEBV RNA2 vector, replacing the genes required for nematode transmission. Pisum sativum inoculated with PEBV carrying a fragment of PsPDS developed characteristic photo-bleached leaves and this phenotype was associated with a signicant reduction in PsPDS mRNA. The P. sativum homologue of LFY is known as UNIFOLIATA (UNI). Plants inoculated with PEBV carrying a fragment of UNI developed distorted owers and leaves with modied architecture, which are also observed in UNI-mutants. In Arabidopsis thaliana, the KOR1-mutant is characterized by an extreme dwarf phenotype. Pisum sativum plants inoculated with PEBV carrying a fragment of PsKOR1 displayed a signicant reduction in height and inhibition of root growth. The PEBV VIGS vector did not affect the ability of P. sativum to ower, set seeds, and form nodules characteristic of symbiosis with rhizobium. These results suggest that the PEBV vector can be applied to functional genomics in a legume species to study genes involved in a wide range of biological processes. Keywords: tobravirus, agrobacterium, meristem, cell wall, carotenoid, dual silencing, virus-induced gene silencing.

Introduction Plant viruses can be used as vectors for overexpression of proteins as well as induction of sequence-specic virusinduced gene silencing (VIGS) (Baulcombe, 1999; Lindbo et al., 2001; Lu et al., 2003a). Both approaches have proved to be important tools for studying gene function (Kumagai et al., 1995; Liu et al., 2002a,b; Peart et al., 2002b). To obtain VIGS, a fragment of the gene of interest is inserted in the virus vector either substituting genes that are dispensable for virus replication and movement or as an extra gene
622

fragment. Following inoculation, the inserted fragment is replicated and spread in the test plant as part of the recombinant virus. Double-stranded RNA intermediates formed during viral replication trigger the RNA-mediated defense system, resulting in degradation of RNA with highsequence identity to the recombinant virus, including mRNA of the gene of interest (Baulcombe, 1999; Waterhouse et al., 2001). Compared with stable transformation of plants, the use of virus vectors has the advantage that the time from
2004 Blackwell Publishing Ltd

VIGS in pea 623 cloning the gene of interest to phenotype analysis is relatively short. In addition, VIGS allows analysis of genes having a lethal phenotype in T-DNA-tagged knockout mutants as well as in stable transformants expressing a silencinginducing transgene (Baulcombe, 1999). The drawbacks are the difculties in identifying a suitable virus vector for the host species of interest and the possibility that the virus infection obscures the phenotype associated with silencing of the gene of interest (Ratcliff et al., 2001). Nicotiana benthamiana is by far the best-studied host for VIGS and the VIGS response is generally stronger and more persistent in N. benthamiana than in other plants (Lu et al., 2003a). As a result, some researchers have transferred the gene controlling the pathway under study in other plants to N. benthamiana for experiments applying VIGS analysis. Examples are the N-gene resistance response to Tobacco mosaic virus (TMV) in N. tabacum (Liu et al., 2002b; Peart et al., 2002a), the Rx-gene response to Potato virus X in potato and the Pto-gene response to Pseudomonas syringae in tomato (Lu et al., 2003b). This choice probably reects difculties in triggering efcient silencing in other plant species, because the above-mentioned genes originate from plant species hosting viruses that have been developed for VIGS (Hiriart et al., 2002; Liu et al., 2002a; Ruiz et al., 1998). However, transfer of a genetic/biochemical pathway to N. benthamiana is only possible if the pathway is under the control of a single or a few well-characterized genes and if the heterologous pathway will be functional in N. benthamiana. As a consequence of these limitations, efforts have been made to develop efcient VIGS systems for other hosts. Among the reported systems are: Barley stripe mosaic virus for VIGS in barley (Hordeum vulgare) (Holzberg et al., 2002), Cabbage leaf curl virus for VIGS in Arabidopsis thaliana (Turnage et al., 2002), and Tobacco rattle virus (TRV) for VIGS in tomato (Liu et al., 2002a). Legumes are important crops in sustainable agriculture because of their ability to form nitrogen-xing symbiosis with rhizobia. Accordingly, development of functional genomics tools for these plants is in demand. While the model plants Lotus japonicus and Medicago truncatula are readily transformed (Stiller et al., 1997; Trieu et al., 2000) methods are still sought for analysis of essential genes (Andersen et al., 2003) and for high throughput analysis by transient RNA silencing (Kumagai and Kouchi, 2003). There is a need to transfer results from these model plants to the agriculturally important legumes (Borisov et al., 2003). Unfortunately, several of the crop legumes including P. sativum are difcult to transform (Udvardi, 2001) and none of the recognized VIGS vectors are known to infect legumes efciently. In order to develop a VIGS system in a legume species, we decided to test the tobravirus Pea early browning virus (PEBV) as a silencing vector in P. sativum. One reason for choosing PEBV is that this virus belongs to
Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 622631

the same genus as TRV, which has proved to be an efcient silencing vector in N. benthamiana and tomato (Liu et al., 2002a; Ratcliff et al., 2001). In addition, PEBV was already developed as an expression vector for the reporter gene GFP in both P. sativum and N. benthamiana (MacFarlane and Popovich, 2000). PEBV is a bipartite, rod-shaped virus with an RNA genome consisting of RNA1 and RNA2. RNA1 encodes all viral proteins required for replication and movement of the virus and can produce infection without RNA2. RNA2 encodes the coat protein and proteins needed for nematode transmission (MacFarlane, 1999). In the PEBVGFP vector, GFP is placed under control of the TRV coat protein promoter, substituting the nematode transmission genes (MacFarlane and Popovich, 2000). Results Construction of PEBV infectious clones for agro-inoculation It has been reported that agro-inoculation is the most efcient method for introducing cDNA-derived viral RNA into plants (Lu et al., 2003a). The PEBV-GFP expression vector was available as plasmids pCaN1 and pCaN2-GFP with cDNA of RNA1 and RNA2-GFP, respectively, cloned under control of the 35S promoter and the NOS terminator. In order to optimize inoculation of PEBV we transferred the RNA1 and RNA2 expression cassettes from the plasmids pCaN1 and pCaN2-GFP to a binary agrobacterium vector. The commercially available vector pCAMBIA1300 was chosen because it has a relatively small size, which was further reduced by removing the hygromycin expression cassette. Because the rst attempts to transfer the RNA1 expression cassette to the binary vector failed, an intron was inserted into RNA1 in the open reading frame encoding the RNAdependent RNA polymerase. Insertion of introns is known to stabilize infectious clones of RNA viruses in Escherichia coli (Johansen, 1996), and a similar strategy was used to clone RNA1 of TRV into the binary vector pBIN61 (Ratcliff et al., 2001). The pCAMBIA1300-derived plasmids with the expression cassette of RNA1 containing an intron and the expression cassette of RNA2-GFP were named pCAPE1 and pCAPE2GFP, respectively (Figure 1). Agrobacterium cultures carrying pCAPE1 and pCAPE2-GFP were mixed and inltrated into leaves of P. sativum. Fourteen to 21 days post-inoculation (dpi), GFP uorescence was observed in non-inoculated leaves conrming that the agro-inoculation had been successful (data not shown). In subsequent experiments cDNA fragments of approximately 500 bp derived from P. sativum replaced GFP in pCAPE2-GFP in order to obtain VIGS of the corresponding endogenous genes. In addition, a vector control, pCAPE2Con, containing a 529 bp cDNA insert derived from a bean yellow mosaic virus isolate was also constructed.

624 Gabriela D. Constantin et al.

(a)
pCAPE1

RB
35S

Intron
T

LB PEBV RNA1

(b)
pCAPE2-GFP

RB 35S
CP GFP
T

LB

(c)
pCAPE2-PDS

RB 35S
CP PDS
T

LB

(d)
pCAPE2-PDS-UNI

RB 35S
CP PDS UNI
T

LB

Figure 1. Pea early browning virus (PEBV) binary vectors. PEBV expression cassettes of RNA1 and RNA2 were inserted between right and left border (RB and LB) of a pCAMBIA1300 derived plasmid. Transcriptional control was exerted by a 35S promoter and a NOS terminator (T). (a) pCAPE1 containing full-length cDNA of PEBV RNA-1 with an intron inserted to stabilize the plasmid in bacteria. (b) pCAPE2-GFP containing cDNA of PEBV RNA-2 with the GFP coding sequence replacing the genes required for nematode transmission. CP is the coat protein coding region. (c) pCAPE2-PDS with a 470 bp cDNA fragment of Pisum sativum phytoene desaturase (PDS) inserted in the RNA2 cDNA. The plasmids, pCAPE2-UNI and pCAPE2-KOR had the same structure with a fragment of UNIFOLIATA or the P. sativum KORRIGAN1 homologue inserted. (d) pCAPE2-PDS-UNI containing both PsPDS and UNI cDNA inserts in the RNA2 cDNA. The construct pCAPE2-PDS-KOR had the same structure. The restriction sites displayed are not found elsewhere in the pCAPE2 vector and can be used for insertion of other gene fragments.

pCAPE2-Con was used to monitor the effect of PEBV carrying an insert that did not target an endogenous gene. In all experiments, a 1:1 ratio of agrobacterium cultures carrying pCAPE1 and the pCAPE2-derived plasmids was used for inoculation. Therefore, pCAPE1 will not be mentioned in the description of the experiments below. Unless otherwise stated, each construct was inoculated to at least ve plants in three independent experiments. Silencing of phytoene desaturase in P. sativum We chose phytoene desaturase (PDS) for the rst test of PEBV-induced silencing of an endogenous gene in P. sativum, because this gene has successfully been targeted in other VIGS systems (Gossele et al., 2002; Holzberg et al., 2002; Liu et al., 2002a; Ratcliff et al., 2001; Turnage et al., 2002). PDS is essential for the production of carotenoids that protect plants from photo-bleaching (Demmig-Adams and Adams, 1996). Leaves of plants in which PDS is silenced turn white as a result of the lack of carotenoids and destruction of chlorophyll by photo-oxidation (Kumagai et al., 1995). A

Figure 2. Virus-induced gene silencing (VIGS) of PsPDS and UNIFOLIATA. Phenotypes of Pisum sativum 28 days (a) and 42 days (b and c) postinoculation with PEBV carrying a fragment of PsPDS (pCAPE2-PDS), UNI (pCAPE2-UNI) or a control carrying a fragment from the potyvirus Bean yellow mosaic virus (pCAPE2-Con). (a) Representative upper leaets of plants inoculated with pCAPE2-PDS (top row) or pCAPE2-Con (bottom row). (b) Flower from a plant inoculated with pCAPE2-UNI showing a characteristic indeterminate growth and lack of petals (above) and a wild-type ower from a plant inoculated with pCAPE2-Con (below). (c) Leaf from a plant inoculated with pCAPE2-UNI showing a characteristic phenotype with no tendrils (above) and an unmodied leaf from a plant inoculated with pCAPE2-Con (below).

1000 bp fragment of PsPDS was sequenced (GenBank accession no. AJ621573), and pCAPE2-PDS was constructed by replacing the GFP coding region of pCAPE2-GFP with a 470 bp fragment of PsPDS (Figure 1c). Two-week-old plants of P. sativum were agro-inoculated with pCAPE2-PDS or pCAPE2-Con into the third pair of leaves. Nine to 10 dpi, plants inoculated with pCAPE2-PDS showed bleaching on upper, non-inoculated leaves indicating that PDS had been silenced. Representative upper leaves harvested 28 dpi are shown in the top row in Figure 2(a). In contrast, all leaves of plants inltrated with pCAPE2-Con remained green (Figure 2a, bottom row). At 42 dpi, approximately 95% of upper leaves displayed bleaching (429 out of 450 leaves counted on a total of 15 plants). Bleaching continued to develop on emerging leaves beyond 42 dpi and white pods and seeds with white seed coats were observed on plants kept in the greenhouse during owering and seed set.
Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 622631

VIGS in pea 625

Table 1 Determination of phytoene desaturase (PDS) mRNA levels by real-time polymerase chain reaction (RT-PCR) in three experiments PDS/18S (AU)a Inhibitione Experiment Relative b c d Sample A Sample B PDS mRNA (%) (%) no. 1 2 3
a

0.782 0.869 0.810

0.452 0.048 0.075

57.8 5.5 9.2

42.2 94.5 90.8

Arbitrary Unit for calculated ratios of PDS mRNA relative to 18S rRNA determined by interpolation between RT Ct values in samples and the corresponding Ct values of standard curve dilution series for PDS mRNA and 18S rRNA, respectively. b Green tissue from plants inoculated with pCAPE2-Con. c White tissue from plants inoculated with pCAPE2-PDS. d The percentage of PDS mRNA of sample B relative to sample A. e Reduction of the PDS mRNA levels in the PDS silenced plants relative to the normal PDS mRNA levels in the control plants.

inserted in pCAPE2 to generate pCAPE2-UNI. P. sativum plants were agro-inoculated with pCAPE2-UNI or pCAPE2-Con. On plants inoculated with pCAPE2-UNI, owers displaying a phenotype resembling the UNI mutant described by Hofer et al. (1997) were seen 28 dpi. At 42 dpi, owers and leaves were examined and counted. On plants inltrated with pCAPE2-UNI more than 50% of the owers (29 of 57) displayed a distorted phenotype. Flowers developed with indeterminate growth, resulting in clusters of exposed ovaries and stigmas and with only few anthers and petals (Figure 2b). A smaller fraction of the leaves, 13% (33 of 354), displayed an altered architecture with tendrils developing into leaets (Figure 2c). Altered leaves were most numerous on lower auxiliary shoots, but were also observed on the primary stem. No distorted owers (0 of 47) and no altered leaves (0 of 296) were observed on plants inoculated with pCAPE2-Con. Silencing of a KORRIGAN1 homologue in P. sativum The A. thaliana gene KORRIGAN1 (KOR1) encodes an endo1,4-b-D-glucanase involved in cellulose synthesis (Sato et al., 2001). KOR1 is expressed in all organs and cytological studies have indicated a function related to cell wall elongation and cell plate formation (Nicol et al., 1998). To our knowledge, a null mutation of this gene has not been characterized, but mutants carrying T-DNA insertions in the putative promoter region display an extreme dwarf phenotype with severe stunting of both stem and roots (Nicol et al., 1998). To test if the characteristics of the KOR1 mutant phenotype could be reproduced by VIGS in P. sativum, plants were inoculated with PEBV carrying a fragment of PsKOR1. Based on published sequences of KOR1 and KOR1 homologues, degenerate primers were designed to amplify a fragment of the pea gene from a cDNA library of P. sativum cultivar (cv.) Scout. The resulting 688 bp fragment was sequenced (GenBank accession no. AJ621355) and the deduced amino acid sequence was 83% identical to the corresponding segment of KOR1 from A. thaliana. Based on this sequence a 470 bp fragment was amplied and inserted into pCAPE2 to generate pCAPE2-KOR. In three experiments, 2-week-old plants of P. sativum were agro-inoculated with pCAPE2-KOR, pCAPE2-Con or Agrobacteria without a T-DNA plasmid as a mock control. The plants were inspected visually and stunting was determined by measuring the height of the plants. Figure 3(a) shows mock-, pCAPE2-Con- and pCAPE2-KOR-inoculated plants 28 dpi. The height of pCAPE2-KOR-inoculated plants was approximately 50% of pCAPE2-Con-inoculated plants, but it was also clear from these experiments that inoculation with pCAPE2Con reduced plant height to approximately 50% of mockinoculated plants. In a larger experiment, the growth of plants inoculated with pCAPE2-KOR was compared with that of plants inoculated with pCAPE2-PDS, pCAPE2-UNI,

Phytoene desaturase mRNA levels were quantied by real-time polymerase chain reaction (RT-PCR) using 18S rRNA as an internal control. Three samples from three independent experiments were analysed. Total RNA extracted from infected plants was rst transcribed in an RT reaction. RT-PCR was then used in order to assess the mRNA levels in plants inoculated with pCAPE2-PDS or pCAPE2Con. The results from these experiments, showed that PDS mRNA levels in three samples of bleached tissue from plants inoculated with pCAPE2-PDS were reduced by approximately 42, 91, and 94%, respectively, compared with plants inoculated with pCAPE2-Con (Table 1). Silencing of UNIFOLIATA Pea early browning virus is seed-transmitted and is present in male and female gametes as well as all cells of developing P. sativum embryos (Wang et al., 1997), which suggests that it might be possible to silence genes expressed in leaf and ower primordia of P. sativum. Using TRV as a VIGS vector in N. benthamiana, it was previously shown to be possible to silence NLF, the Nicotiana homologue of the genes FLORICAULA (FLO) and LEAFY (LFY) from Antirrhinum and Arabidopsis, respectively (Ratcliff et al., 2001). The P. sativum gene UNIFOLIATA (UNI) (or PEAFLO) is a homologue of the FLO and LFY genes (Hofer et al., 1997). UNI is expressed in primordia of leaves, leaets, inorescences, and lateral shoots while expression declines as organs develop (Hofer et al., 1997). Mutants in the UNI gene are characterized by indeterminate development of owers and alterations in development of the compound leaf (Hofer et al., 1997; Prajapati and Kumar, 2002). To clone cDNA of UNI, RNA was extracted from P. sativum shoot apical tips and used as template for cDNA synthesis. A 459 bp fragment of UNI cDNA was amplied by PCR and
Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 622631

626 Gabriela D. Constantin et al.

Figure 4. Rhizobium dependent nodulation in Pisum sativum inoculated with pCAPE2-Con. (a) Nodule formation on roots of hydroponically grown plants supplemented with symbiont rhizobia 14 dpi of pCAPE2-Con. (b) Roots of plants inoculated with pCAPE2-Con that did not receive rhizobia.

pCAPE2-Con and mock-inoculated plants. A comparison of heights determined 21 dpi is shown in Figure 3(b). The results veried that the growth of plants inoculated with pCAPE2-KOR was inhibited compared with plants inoculated with pCAPE2-PDS, pCAPE2-UNI or pCAPE2-Con indicating that silencing of the endogenous PsKOR1 gene had been obtained. We also examined the effect of VIGS by PEBV carrying PsKOR1 on root growth. In two separate experiments, 2-week-old P. sativum plants grown in hydroponic culture were inoculated with either pCAPE2-Con or pCAPE2KOR. At 14 dpi, roots were cut back to approximately 3 cm and root growth was allowed to re-initiate. Figure 3(c) shows root lengths 4 weeks after the roots were cut back. Roots of all plants inoculated with pCAPE2-KOR were signicantly shorter than roots of plants inoculated with pCAPE2-Con. The results conrmed that the pCAPE2-KOR construct was able to induce a phenotype both in stems and roots as would be expected if silencing of the PsKOR1 gene had taken place. Silencing in roots provides the possibility of applying VIGS to investigate the process of root nodulation in legumes. To test if nodulation was affected by the presence of PEBV constructs per se, symbiotic rhizobia were added to the growth media 14 dpi with pCAPE2-Con or pCAPE2-PDS. Root nodulation was induced in both types of plants as well as control plants that had not received any virus inoculum. The extent of nodulation in PEBV inoculated plants was indistinguishable from control plants in both hydroponic culture and in pots and was found to be perfectly dependent on the supplementation of symbiotic bacteria (Figure 4). We therefore conclude that inoculation with PEBV constructs does not prevent nodule formation.
Figure 3. Virus-induced gene silencing (VIGS) of Pisum sativum KORRIGAN1 (PsKOR1) homologue. Growth of plants inoculated with PEBV carrying a fragment of a P. sativum homologue of KOR1 (pCAPE2-KOR). (a) Representative P. sativum plants 28 days after inoculation (dpi) with either pCAPE2-Con (center) or pCAPE2-KOR (right). A mock-inoculated plant is shown for comparison (left). (b) Bars represent heights with standard deviations of plants inoculated with each of the four different pCAPE2-constructs and mock-inoculated plants. Heights were measured 21 dpi in three independent experiments. (c) Roots of P. sativum in hydroponic culture inoculated with pCAPE2-Con or pCAPE2-KOR. Roots were cut back 14 dpi to approximately 3 cm as indicated by dotted line and photographed 28 days later.

Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 622631

VIGS in pea 627 Dual silencing Simultaneous silencing of two genes by VIGS has been demonstrated in N. benthamiana (Peele et al., 2001) and in A. thaliana (Turnage et al., 2002). In order to test the possibility of silencing two endogenous genes simultaneously in P. sativum, the constructs pCAPE2-PDS-UNI and pCAPE2-PDS-KOR were designed to target the PsPDS gene combined with UNI or PsKOR1. The fragments of PsPDS, UNI and PsKOR1 used in these constructs were identical to the 470, 459, and 470 bp DNAs, respectively, used in the constructs above. Two-week-old P. sativum plants were agro-inoculated with pCAPE2-PDS-UNI or pCAPE2-PDSKOR. Plants were observed for bleaching, ower and leaf development, and plant height was measured. Results are presented in Figure 5. Approximately 14 dpi bleaching started to occur in both groups of plants and by 21 dpi all plants showed bleaching of upper leaves. At 42 dpi, more than 70% of upper leaves were found to display bleaching. Relative stunting of pCAPE2-PDS-KOR-inoculated plants, measured as reduced plant height compared with pCAPE2PDS-UNI-inoculated plants, increased during the observation period. At 42 dpi, the average height of pCAPE2-PDSKOR plants was 23.4 cm and the average height of pCAPE2-PDS-UNI inoculated plants was 38.5 cm. Growth rate, measured as the relative increase in height in 1 week, revealed that pCAPE2-PDS-KOR-inoculated plants grew at a slower rate than pCAPE2-PDS-UNI-inoculated plants throughout the observation period (Figure 5a). The simultaneous bleaching and stunting of plants inoculated with pCAPE2-PDS-KOR indicated that both PsPDS and PsKOR1 were silenced. On plants inoculated with pCAPE2-PDS-UNI, distorted owers and leaves with altered architecture were observed in combination with bleached leaves 42 dpi (Figure 5b). A signicant fraction of owers (34%) and leaves (11%) displayed morphological changes resembling the previously reported UNI phenotypes, whereas all owers and leaves on pCAPE2-PDS-KOR inoculated plants looked normal. Based on the observed phenotypes our results indicate that simultaneous silencing of two endogenous genes is feasible by combining the gene fragments in the PEBV RNA2 vector pCAPE2. Discussion Virus-induced gene silencing has proved to be a powerful tool to study gene function and has, in particular, been useful for assigning functions to genes involved in host responses to other pathogens (Liu et al., 2002b, 2003; Lu et al., 2003b; Peart et al., 2002a; Sharma et al., 2003; Slaymaker et al., 2002; Yoshioka et al., 2003). The most widely used vectors are based on PVX (Liu et al., 2003; Lu et al., 2003b; Sharma et al., 2003; Slaymaker et al., 2002; Yoshioka et al., 2003) or TRV (Liu et al., 2002b; Peart et al., 2002a). However, the applications of these silencing vectors have so far been mainly restricted to N. benthamiana. For example, the Pto gene from tomato and the N-gene from N. tabacum were transferred to N. benthamiana in order to study genes involved in the response to P. syringae and TMV, respectively (Liu et al., 2002b; Slaymaker et al., 2002). This reects not only the efciency of VIGS in

(a)

Days p.i. 0 7 Bleaching

14

21

28

35

42

Plant height (cm)

PDS-UNI PDS-KOR

9 cm

9.1 9.0

19.1 16.9

23.4 18.5

27.9 20.9

32.5 22.0

% Growth (height)
PDS-UNI 59.4 30.8 21.8 22.7 9.5 19.1 13.0 16.6 5.4 18.2 6.4 % % PDS-KOR 54.6

14.6 13.9

(b)
Bleaching leaflets Distorted flowers Modified leaves

PDS-UNI 74% 333 (450) 34% 23 (67) 11% 33 (296)

PDS-KOR 88% 398 (450) 0% 0 (14) 0% 0 (283)

Day 42 p.i.

Day 42 p.i.

PDS-UNI

PDS-KOR

PDS-UNI PDS-KOR

Figure 5. Dual silencing in Pisum sativum. In three experiments, simultaneous silencing of genes encoding phytoene desaturase (PDS) and either UNIFOLIATA (UNI) or Pisum sativum homologue of KORRIGAN1 (KOR) was tested. (a) Emergence of bleached leaves and height of plants (black bars: PDS-UNI; gray bars: PDS-KOR) were determined for a period of 42 days. Vertical lines indicate standard deviation of plant height and the average height at inoculation is indicated by stippled horizontal line (9 cm). The growth rate was measured as the increase in height in one week. (b) VIGS phenotypes of dual silenced plants 42 days post-inoculation. The percentage bleached leaets, was calculated as the number of leaets affected among the 30 uppermost leaets on each plant. The percentages of distorted owers and modied leaves were calculated based on the total number of owers or leaves on the plants. Total numbers are given in brackets. The left photograph shows representative dual VIGS phenotypes of PDS-UNI and PDS-KOR leaves, respectively. The right photograph shows the uppermost seven internodes of defoliated PDS-UNI and PDS-KOR plants.

Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 622631

38.4 23.4

628 Gabriela D. Constantin et al. N. benthamiana but also the difculty of developing efcient VIGS vectors for other hosts (Lu et al., 2003a). The ability to induce VIGS depends on the ability of the virus vector to infect the plant species of interest. However, other factors must play a role because although PVX infects N. tabacum and TRV infects A. thaliana, these viruses do not function well as VIGS vectors in these hosts (Lu et al., 2003a; Ratcliff et al., 2001). Our results indicate that we have overcome these problems by developing PEBV as a VIGS vector for P. sativum. Recombinant PEBV induced an efcient and reliable gene silencing in pea. In addition, strong gene silencing using PEBV has also been observed in N. benthamiana (Petersen et al., 2004). Inoculation was based on agro-inltration, which resulted in 100% infection in all experiments. The reliable and efcient inoculation will permit development of PEBV for high throughput analysis as demonstrated for PVX (Lu et al., 2003b). Three genes, with known function and a clear mutant phenotype were targeted in P. sativum by inoculation with recombinant PEBV. The genes targeted, PsPDS, UNI, and PsKOR1, all have single gene homologues in the sequenced A. thaliana genome. These genes are therefore likely to exist as single copy genes or as low copy genes also in legumes. Each construct was found to cause phenotypic alterations corresponding to the previously described mutant phenotype of the gene targeted. The silencing phenotypes of all three genes were clearly displayed, despite the general growth reduction of the plants resulting from the virus infection. Symptoms of virus infection are also induced by VIGS vectors based on PVX and TRV (Ratcliff et al., 2001), but have not been a serious problem for their use in a wide range of experiments. Except for the general growth reduction, P. sativum plants infected with the PEBV vector grow normally, ower, set seed, and form nodules in the presence of rhizobium. The effect on mRNA levels was measured in P. sativum inoculated with PEBV carrying PsPDS. Although some variation was observed between experiments, the reduction was in the same range as measured in tomato and N. benthamiana plants inoculated with TRV vectors carrying 409 bp of PDS from tomato and N. benthamiana, respectively (Liu et al., 2002a; Ratcliff et al., 2001). For both TRV- and PVX-based silencing vectors it has been observed that there was a reduction in the development of the silencing phenotype in N. benthamiana after 4 weeks (Ratcliff et al., 2001). Recovery from silencing was also reported in response to VIGS induced by TMV leading to a mixture of silenced and recovered phenotypes (Hiriart et al., 2003). In comparison, the silencing phenotypes induced by PEBV appeared stable over time. The bleached silencing phenotype of plants inoculated with PEBV carrying a fragment of PsPDS, continued to develop beyond 42 dpi. Plants inoculated with PEBV carrying a fragment of PsKOR1 did not show any visible signs of recovery during an observation period up to 84 dpi (data not shown). In the dual silencing experiment, growth rate of plants inoculated with pCAPE2-PDS-KOR was markedly reduced without any signs of decline from 14 to 42 dpi (Figure 5a). For some purposes, for instance analyses of genes involved in development, it is necessary that silencing is manifested in the growing points. The P. sativum gene UNI is expressed in primordia of leaves, owers and lateral shoots (Hofer et al., 1997). Several mutants of UNI have been described (Hofer et al., 1997; Prajapati and Kumar, 2002). These mutants are characterized either by simple unifoliate leaves or leaves having the terminal tendril replaced by a leaet and owers with profusions of sepalloid and carpelloid oral organs. In P. sativum plants inoculated with pCAPE2-UNI, modied owers and leaves were observed resembling those reported for UNI mutants. This observation suggested that PEBV triggered VIGS in the growing points of P. sativum and those genes controlling development can be targeted for silencing by PEBV. Silencing in meristems has also been demonstrated using Tomato golden mosaic virus (TGMV) (Peele et al., 2001). However, unlike TRV and PEBV, TGMV does not enter the meristems but is restricted to vascular tissues. Therefore, infection of the growing points may not be a pre-requisite for obtaining silencing in meristematic cells (Peele et al., 2001). An attractive feature offered by VIGS is the possibility of studying essential genes of which insertion mutants and transgenic plants expressing silencing-inducing self-complementary RNAs are not viable. The A. thaliana gene KOR1 is an example of a gene for which no null alleles were reported but a mutant was identied with a T-DNA insertion in the promoter region resulting in an extreme dwarf phenotype and strongly reduced KOR1 mRNA and protein levels (Nicol et al., 1998). Plants inoculated with PEBV carrying a fragment of PsKOR1 displayed a phenotype similar to the A. thaliana KOR1 mutant (Nicol et al., 1998). The sizes of all plant organs were reduced including stems, leaves, owers, and pods. In addition, growth of roots was severely affected when analysed in a hydroponic system. Silencing has also been observed in roots of N. tabacum (Gossele et al., 2002), where reduced mRNA levels of plastid transketolase were measured in plants targeted for silencing by Satellite tobacco mosaic virus. In P. sativum, silencing in roots by PEBV could be a useful tool for the investigation of the symbiotic relationship between legumes and nitrogenxing bacteria. As demonstrated for several other VIGS vectors (Peele et al., 2001; Sharma et al., 2003; Turnage et al., 2002), the PEBV system readily allows simultaneous silencing of two endogenous non-homologous genes. However, in all cases we observed a milder silencing phenotype when two genes were targeted for silencing compared with targeting of a single gene. The milder silencing by dual vectors may be a
Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 622631

VIGS in pea 629 result of the larger insert in the virus but this needs to be investigated further. Silencing of two or more genes could be an important feature when two redundant or partially redundant pathways need to be inhibited in order to see a strong phenotype. We conclude that the PEBV vector described here is a very suitable tool for producing VIGS in P. sativum. The silencing symptoms appeared early, the phenotypes were persistent and consistent with existing knowledge on the genes tested. The plasmid pCAPE2 is easy to manipulate by standard cloning procedures and inoculation is based on agroinoculation, which will allow use of the PEBV silencing system for high throughput analysis. Experimental procedures Construction of pCAPE1 and pCAPE2-GFP
Standard cloning methods (Sambrook et al., 1989) were used for all vector constructs. Restriction and modication enzymes from New England Biolabs (Beverly, MA, USA), Fermentas (Vilnius, Lithuania), GIBCO BRL (Chechire, UK), Invitrogen (Taastrup, Denmark) and Roche Diagnostics GmbH (Mannhein, Germany) were used according to manufacturers instruction. All PCR products were cloned into the vector pCR2.1-TOPO using the TA-TOPO cloning kit from Invitrogen. Oligonucleotide primer synthesis and custom sequencing was performed by MWG-Biotech AG (Munich, Germany). Pea early browning virus RNA1 and RNA2 were previously cloned and placed under control of the 35S promoter and the NOS terminator in the plasmids pCaN1 and pCaN2, respectively (MacFarlane et al., 1992). pCaN2-GFP is a derivative of pCaN2 in which the open reading frames 2b and 2c of RNA2 are replaced by the GFP coding sequence (MacFarlane and Popovich, 2000). For agro-inoculation the expression cassettes including the 35S promoter, PEBV RNA and the NOS terminator were transferred to the binary vector pCAMBIA1300 (Cambia, Canberra, Australia). Initially, RNA1 in pCaN1 was modied by insertion of the 189 bp intron IV from the Solanum tuberosum gene LS1. The intron was inserted as a PstINsiI fragment (Johansen, 1996) into the PstI site at nucleotide 736741 of the PEBV RNA1. Subsequently, the RNA1 expression cassette was excised as a BsrBIXhoI fragment and inserted into SmaIXhoI digested pCAMBIA1300 replacing the hygromycin resistance gene. This plasmid was named pCAPE1 (Figure 1a). To construct the agro-inoculation vector of PEBV RNA2 expressing GFP, the hygromycin resistance gene was rst deleted from pCAMBIA1300 by digestion with SacI and XhoI, subsequent blunting of recessed ends by T4 DNA polymerase and relegation. Secondly, the PEBV RNA2-GFP expression cassette including the 35S promoter and the NOS terminator was inserted as an XbaIPstI fragment into the modied pCAMBIA1300, generating pCAPE2-GFP (Figure 1b). The GFP coding region of pCAPE2-GFP is anked by unique NcoI and EcoRI restriction sites allowing easy replacement with other DNA fragments. and 5-GCTTCCCAGAAAGAACAGCACC were designed to PCRamplify a PDS fragment from a cDNA library of P. sativum cv. Scout kindly provided by Dr A. J. Maule, John Innes Centre, UK. The resulting 1077 bp fragment was sequenced (GenBank accession no. AJ621573) and found to encode a polypeptide of 359 amino acids being 92% identical to soybean PDS. Based on this sequence a 470 bp fragment was PCR-amplied using forward primer 5-cccatggactagtctagATTGGGCGGTGAACTCCATCTTAATTC and reverse primer 5-cctcgaGATCTGCAGAAATTTCATCAGGG (gene specic nucleotides in capitals). The 470 bp fragment was cloned and subsequently inserted into pCAPE2-GFP as an NcoIEcoRI fragment generating pCAPE2-PDS. This construct was designed to avoid translation of the PDS fragment by including the sequence ATGGACTAG in frame in the forward primer. In order to ease subsequent replacement by other cDNA fragments several other restriction sites were included in the primers (forward: SpeI and XbaI; reverse: PstI, BglII, and XhoI). A vector control plasmid, pCAPE2-Con, was constructed in the same way by replacing the PDS sequence in pCAPE2-PDS by a 529 bp insert derived from a cDNA fragment of Bean yellow mosaic virus (GenBank accession no. AJ622899). The 529 bp fragment was PCR-amplied using forward primer 5-ccatggGCATCAAAAGAAACAGATT and reverse primer 5-GAATTCCAACTATGAACCCATCTT.

Construction of pCAPE2-UNI and pCAPE2-PDS-UNI

To clone cDNA of UNI, RNA was extracted from tissue of pea shoot apical tips using the RNEASY Plant Mini Kit (Qiagen, Hilden, Germany). cDNA was synthesized by M-MLV reverse transcriptase (Invitrogen) using the primer 5-GTGACAAAGCTGCCGGAGTTTG. A 459 bp fragment was PCR-amplied using UNI-specic primers generated from the published UNI sequence GenBank accession no. AF010190 (forward primer: 5-gccatggGGCGGCGGTGTTGGTGG and reverse primer: 5-gctgcagGCACGTACCATATCGAAAG). The fragment was cloned in pCR2.1-TOPO and subsequently excised as an NcoIPstI fragment. This fragment was inserted into pCAPE2 by replacing PsPDS of pCAPE2-PDS to generate the plasmid pCAPE2UNI. A plasmid, pCAPE2-PDS-UNI, carrying both the 470 bp fragment of PsPDS and the 459 bp fragment of UNI was generated by inserting the 459 bp UNI sequence from the TOPO-clone as a PstI PstI fragment at the 3-end of the PsPDS sequence in pCAPE2-PDS.

Construction of pCAPE2-KOR and pCAPE2-PDS-KOR

Primers to amplify a fragment of the KOR1 homologue from P. sativum were designed on the basis of the A. thaliana sequence (GenBank accession no. AF073875) and published homologous EST sequences of G. max and M. truncatula. The forward primer 5-ATCTGGGATAACAAGCTTGCTGGTGCTCA and reverse primer 5-CTTATGGTTTCCATGG(CT)GCTGG(AGCT)GG amplied a 688 bp fragment from the cDNA library of P. sativum cv. Scout. The fragment was cloned and the sequence determined (GenBank accession no. AJ621355). The PsKOR1 fragment was sequenced and found to encode a peptide being 83% identical to the corresponding segment of KOR1 from A. thaliana. For insertion into pCAPE2, a 470 bp fragment of PsKOR1 was amplied with forward primer: 5-gccaTGGGTATCCATATGAAGAA and reverse primer 5-gctgCAGCAACCATGGCACCAA. The 470 bp fragment was cloned in pCR2.1-TOPO and inserted as a SpeIPstI fragment into pCAPE 2-PDS by replacement of the PDS sequence. This generated the plasmid pCAPE2-KOR. The construct was designed to generate a PsKOR1 gene fragment that was not translated upon insertion into pCAPE2. A plasmid, pCAPE2-PDS-KOR, carrying both the 470 bp

Construction of pCAPE2-PDS and vector control, pCAPE2-Con

Based on the published Glycine max PDS sequence (GenBank accession no. M64704) and homologous ESTs from M. truncatula, the primers 5-GGCATTAATGATCGGTTACAATGG Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 622631

630 Gabriela D. Constantin et al.

fragment of PsPDS and the 470 bp fragment of PsKOR1, was generated by inserting the 470 bp PsKOR1 fragment as a PstIPstI fragment at the 3-end of the PsPDS sequence in pCAPE2-PDS. Real-time PCR was performed using ABI Prism 7700 Sequence Detection System (PE Applied Biosystems). Primers were PDS (forward) 5-ATGTTGAGGCTCAAGATGGTGTT, PDS (reverse) 5-CCTGCTTTCTCATCCATTCTTTAA, 18S (forward) 5GACTACGTCCCTGCCCTTTG, and 18S (reverse) 5AACACTTCACCGGACCATTCA. Each 25 ll PCR reaction contained 4 ll RT-reaction, 12.5 ll SYBR Green Master Mix (PE Applied Biosystems) and 0.5 pM of each primer. Samples were heated to 95C for 10 min, followed by 40 cycles of 15 sec at 95C and 1 min at 60C. PCRs of a twofold dilution series of the RT-template were included for calculation of relative amounts of PsPDS cDNA and ribosomal 18S cDNA in samples. The material used in the experiments reported here is available for non-commercial purposes upon request. Potential users should contact e.johansen@dias.kvl.dk.

Plant material and growth conditions

Pisum sativum cv. Dark Skinned Perfection plants (L. Dhnfeldt A/S, Odense, Denmark) were used for all experiments, although silencing of PsPDS was also observed in other P. sativum genotypes (data not shown). Seeds were germinated on moist lter paper in the dark for 3 days before planting in Pindstrup no. 2 Peat Substrate (Pindstrup Mosebrug A/S, Pindstrup, Denmark) in 11 cm pots or transfer to hydroponic culture. The substrate for hydroponics consisted of a nutrient solution (Mattsson and Schjrring, 2002), which was continuously aerated and changed every week. Potted plants were fertilized with standard fertilizer N:P:K (100:15:130). Plants were grown in an insect proof greenhouse with a 20/18C day/night temperature regime and 6585% RH. During summer temperature was regulated with automatic ventilation and shade curtains. The photoperiod was 16 h day)1, regulated with supplementary light from September to May. For nodulation experiments plants were grown in sterilized Pindstrup no. 2 Peat Substrate mixed with PERLITE (3:1) and watered with sterilized water or in hydroponics supplemented with Jensen medium (Van Brussel et al., 1982) Rhizobium leguminosarum bv. viciae strain 248 was used as the inoculant (Josey et al., 1979). The rhizobium culture was grown to OD660 0.30.5 in a YMB liquid growth medium (Handberg et al., 1994) and added to the plant growth substrate.

Acknowledgements
We thank Merete Albrechtsen for helpful discussions on VIGS. G.C. was supported by a Marie Curie fellowship under contract number HPMT-CT-2000-00204. B.K. and O.S.L. were supported by Danish Agricultural and Veterinary Research Council grants nos 9702802 and 53-00-0330, respectively. We thank the Danish Agricultural and Veterinary Research Council for grant no. 23-03-0118 to continue the research.

References
Andersen, S.U., Cvitanich, C., Hougaard, B.K., Roussis, A., Grnlund, M., Jensen, D.B., Frkjr, L.A. and Jensen, E.O. (2003) The glucocorticoid-inducible GVG system causes severe growth defects in both root and shoot of the model legume Lotus japonicus. Mol. Plant Microbe Interact. 16, 10691076. Baulcombe, D.C. (1999) Fast forward genetics based on virusinduced gene silencing. Curr. Opin. Plant Biol. 2, 109113. Borisov, A.Y., Madsen, L.H., Tsyganov, V.E. et al. (2003) The Sym35 gene required for root nodule development in pea is a ortholog of Nin from Lotus japonicus. Plant Physiol. 101, 10091017. Demmig-Adams, B. and Adams, W.W. (1996) The role of xanthophyll cycle carotenoids in the protection of photosyntesis. Trends Plant Sci. 1, 2126. Gossele, V., Fache, I., Meulewaeter, F., Cornelissen, M. and Metzlaff, M. (2002) SVISS a novel transient gene silencing system for gene function discovery and validation in tobacco plants. Plant J. 32, 859866. Handberg, K., Stiller, J., Thykjaer, T. and Stougaard, J. (1994) Transgenic plants: Agrobacterium-mediated transformation of the diploid legume Lotus japonicus. In Cell Biology: A Laboratory Handbook (Celis, J.E., ed.). New York: Academic Press Inc., pp. 119127. Hiriart, J.-B., Lehto, K., Tyystjarvi, E., Junttila, T. and Aro, E.-M. (2002) Suppression of a key gene in chlorophyll biosynthesis by means of virus-inducing gene silencing. Plant Mol. Biol. 50, 213224. Hiriart, J.-B., Aro, E.-M. and Lehto, K. (2003) Dynamics of the VIGSmediated chimeric silencing of the Nicotiana benthamiana ChlH gene and of the tobacco mosaic virus vector. Mol. Plant Microbe Interact. 16, 99106. Hofer, J., Turner, L., Hellens, R., Ambrose, M., Matthews, P., Michael, A. and Ellis, N. (1997) Unifoliata regulates leaf and ower morphogenesis in pea. Curr. Biol. 7, 581587. Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 622631

Agrobacterium inltration
The binary vectors derived from pCAMBIA1300 were introduced in Agrobacterium tumefaciens strain GV3101 by electroporation (Gene Pulser II, Bio-Rad, Herlev, Denmark) as described by Shen and Forde (1989). Individual clones were grown in 20 ml of Luria broth supplemented with 100 lg ml)1 rifampicin and 50 lg ml)1 kanamycin at 28C for 1618 h with shaking. At OD550 1.21.5 the bacteria were harvested by centrifugation (3500 g, room temperature). Cells were resuspended in inltration medium (10 mM NaCl, 1.75 mM CaCl2, 100 lM acetosyringone), and incubated at room temperature for 90 min without shaking. Agrobacterium cultures harboring pCAPE1 and a pCAPE2 derivative were mixed 1:1 prior to inltration. The mixed culture was inltrated to the abaxial side of the youngest pair of leaves on 2-week-old P. sativum using a 1-ml syringe.

RT-PCR
For each sample, total RNA was extracted from 100 mg leaf tissue using RNEASY Plant Mini Kit (Qiagen). The eluted RNA was DNase treated for 45 min at 37C by RQ1 RNASE-free DNASE (Promega, Madison, WI, USA). DNase reaction was terminated by addition of RQ1 DNASE Stop Solution (Promega) and subsequent incubation for 10 min at 65C. RNA concentration was determined by measuring absorbance at 260 nm (Ultrospec 2000, Amersham Biosciences, Hillerd, Denmark). For RT-reactions 0.5 lg RNA was used as template in a total volume of 100 ll 50 mM Tris pH 8.3, 75 mM KCl, 3 mM MgCl2, 2.5 U/ll M-MLV reverse transcriptase (Invitrogen), 1 U/ll RNASIN (Promega), 0.625 lM Random Hexamers (PE Applied Biosystems, Forster City, CA, USA) and 0.5 mM dNTP (Roche). RT-reactions were incubated 90 min at 37C.

VIGS in pea 631

Holzberg, S., Brosio, P., Gross, C. and Pogue, G.P. (2002) Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant J. 30, 315327. Johansen, I.E. (1996) Intron insertion facilitates amplication of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc. Natl Acad. Sci. USA, 93, 1240012405. Josey, D.P., Beynon, J.L., Johnston, A.W.B. and Beringer, J.E. (1979) Strain identication in Rhizobium using intrinsic antibiotic resistance. J. Appl. Bacteriol. 46, 343350. Kumagai, H. and Kouchi, H. (2003) Gene silencing by expression of hairpin RNA in Lotus japonicus roots and root nodules. Mol. Plant Microbe Interact. 16, 663668. Kumagai, M.H., Donson, J., Della-Cioppa, G., Harvey, D., Hanley, K. and Grill, L.K. (1995) Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. Proc. Natl Acad. Sci. USA, 92, 16791683. Lindbo, J.A., Fitzmaurice, W.P. and della-Cioppa, G. (2001) Virusmediated reprogramming of gene expression in plants Curr. Opin. Plant Biol. 4, 181185. Liu, Y., Schiff, M. and Dinesh-Kumar, S.P. (2002a) Virus-induced gene silencing in tomato. Plant J. 31, 777786. Liu, Y., Schiff, M., Marathe, R. and Dinesh-Kumar, S.P. (2002b) Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Plant J. 30, 415 429. Liu, Y., Jin, H., Yang, K.-Y., Kim, C.Y., Baker, B. and Zhang, S. (2003) Interaction between tow mitogen-activated protein kinases during tobacco defense signalling. Plant J. 34, 149160. Lu, R., Martin-Hernandez, A.M., Peart, J.R., Malcuit, I. and Baulcombe, D.C. (2003a) Virus-induced gene silencing in plants. Methods, 30, 296303. Lu, R., Malcuit, I., Moffett, P., Ruiz, M.T., Peart, J., Wu, A.-J., Rathjen, J.P., Bendahmane, A., Day, L. and Baulcombe, D.C. (2003b) High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO J. 22, 5690 5699. MacFarlane, S.A. (1999) Molecular biology of the tobraviruses. J. Gen. Virol. 80, 27992807. MacFarlane, S.A. and Popovich, A.H. (2000) Efcient expression of foreign proteins in roots from tobravirus vectors. Virology, 267, 2935. MacFarlane, S.A., Gilmer, D. and Davies, J.W. (1992) Efcient inoculation with CaMV 35S promoter-driven DNA clones of the tobravirus PEBV. Virology, 187, 829831. Mattsson, M. and Schjrring, J.K. (2002) Dynamic and steady-state responses of inorganic nitrogen pools and NH3 exchange in leaves of Lolium perenne and Bromus erectus to changes in root nitrogen supply. Plant Physiol. 128, 742750. Nicol, F., His, I., Jauneau, A., Vernhettes, S., Canut, H. and Hofte, H. (1998) A plasma membrane-bound putative endo-1,4-b-D-glucanase is required for normal wall assembly and cell elongation in Arabidopsis. EMBO J. 17, 55635576. Peart, J.R., Cook, G., Feys, B.J., Parker, J.E. and Baulcombe, D.C. (2002a) An EDS1 orthologue is required for N-mediated resistance against tobacco mosaic virus. Plant J. 29, 569579. Peart, J.R., Lu, R., Sadanandom, A. et al. (2002b) Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proc. Natl Acad. Sci. USA, 99, 1086510869. Peele, C., Jordan, C.V., Muangsan, N., Turnage, M., Egelkrout, E., Eagle, P., Hanley-Bowdoin, L. and Robertson, D. (2001) Silencing of a meristematic gene using geminivirus-derived vectors. Plant J. 27, 357366. Petersen, B.O., Jrgensen, B. and Albrechtsen, M. (2004) Isolation and RNA silencing of homologues of the RNase L-inhibitor in Nicotiana species. Plant Sci. 167, 12831289. Prajapati, S. and Kumar, S. (2002) Interaction of the UNIFOLIATATENDRILLED ACACIA gene with AFILA and TENDRIL-LESS genes in the determination of leaf blade growth and morphology in pea Pisum sativum. Plant Sci. 162, 713721. Ratcliff, F., Martin-Hernandez, A.M. and Baulcombe, D.C. (2001) Tobacco rattle virus as a vector for analysis of gene function by silencing. Plant J. 25, 237245. Ruiz, M.T., Voinnet, O. and Baulcombe, D.C. (1998) Initiation and maintenance of virus-induced gene silencing. Plant Cell, 10, 937 946. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Sato, S., Kato, T., Kakegawa, K. et al. (2001) Role of the putative membrane-bound endo-1,4-b-glucanase KORRIGAN in cell elongation and cellulose synthesis in Arabidopsis thaliana. Plant Cell Physiol. 42, 251263. Sharma, P.C., Ito, A., Shimizu, T., Terauchi, R., Kamoun, S. and Saitoh, H. (2003) Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol. Genet. Genomics, 269, 583591. Shen, W.-J. and Forde, B.G. (1989) Efcient transformation of Agrobacterium ssp. by high voltage electroporation. Nucleic Acids Res. 17, 8385. Slaymaker, D.H., Navarre, D.A., Clark, D., del Pozo, O., Martin, G.B. and Klessig, D.F. (2002) The tobacco salicylic acid-binding protein 3 (SABP3) is the chloroplast carbonic anhydrase, which exhibits antioxidant activity and plays a role in the hypersensitive defense response. Proc. Natl Acad. Sci. USA, 99, 1164011645. Stiller, J., Martirani, L., Tuppale, S., Chian, R., Chiurazzi, M. and Gresshoff, P. (1997) High frequency transformation and regeneration of transgenic plants in the model legume Lotus japonicus. J. Exp. Bot. 48, 13571365. Trieu, A.T., Burleigh, S.H., Kardailsky, I.V. et al. (2000) Transformation of Medicago truncatula via inltration of seedlings or owering plants with Agrobacterium. Plant J. 22, 531541. Turnage, M.A, Muangsan, N., Peele, C.G. and Robertson, D. (2002) Geminivirus-based vectors for gene silencing in Arabidopsis. Plant J. 30, 107114. Udvardi, M.K. (2001) Legume models strut their stuff. Mol. Plant Microbe Interact. 14, 69. Van Brussel, A.A.N., Tak, T., Wetselaar, A., Pees, E. and Wijffelman, C.A. (1982) Small leguminosae as test plants for nodulation of Rhizobium leguminosarum and other rhizobia and agrobacteria harbouring a leguminosarum Sym-plasmid. Plant Sci. Lett. 27, 317325. Wang, D., MacFarlane, S.A. and Maule, A.J. (1997) Viral determinants of Pea early browning virus seed transmission in pea. Virology, 234, 112117. Waterhouse, P.M., Wang, M-B. and Lough, T. (2001) Gene silencing as an adaptive defence against viruses. Nature, 411, 834842. Yoshioka, H., Numata, N., Nakajima, K., Katou, S., Kawakita, K., Rowland, O., Jones, J.D.G. and Doke, N. (2003) Nicotiana benthamiana gp91 phox homologs NbrbohA and NbrbohB participate in H2O2 accumulation and resistance to Phytophthora infestans. Plant Cell, 15, 706718.

Accession numbers: AJ621573, AJ621355, and AJ622899

Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 622631