African Journal of Microbiology Research Vol. 4(23), pp. 2617-2621, 4 December, 2010 Available online http://www.academicjournals.

org/ajmr ISSN 1996-0808 2010 Academic Journals

Full Length Research Paper

A novel loop-mediated isothermal amplification (LAMP) method for detection of Fusobacterium necrophorum from footrot
Sun D. B., Wu R., He X. J., Zheng J. S., Wang J. F., Zhu D. B., Zhao X. Y., Guo T., Sun B., Fan C. L. and Guo D. H.*
College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University, Daqing High-tech Industrial Development Zone, Daqing 163319, P.R. China.
Accepted 26 October, 2010

A loop-mediated isothermal amplification method (Fn-LAMP) was developed for detection of Fusobacterium necrophorum from footrot using a set of four specific primers designed from the lktA gene of Fusobacterium necrophorum. The Fn-LAMP method, performed for 45 min at 61 was capable C, of detecting 1 cfu/mL of F. necrophorum and was 10 times more sensitive than conventional PCR method. The Fn-LAMP had no cross-reaction with enterotoxigenic Escherichia coli, Salmonella, Pasteurella multocida, Mycoplasma, Campylobacter fetus from cattle. Detection of clinical samples indicated relative sensitivity and relative specificity of Fn-LAMP to PCR was 100 and 87.5%, respectively. The percentage of observed agreement was 92.0% between Fn-LAMP and PCR methods. Visual detection of the Fn-LAMP products showed negative and positive results could be clearly confirmed using fluorescent dyes as detection reagent. Key words: Fusobacterium necrophorum, footrot, loop-mediated isothermal amplification (LAMP). INTRODUCTION Footrot is an infectious disease in cattle that is characterized by lameness, and the inflammation of soft tissues between the hooves, and has a serious impact on animal production performance, particularly for dairy cow (Smith et al., 1993; Saginala et al., 1997; Nagaraja et al., 2007). Footrot occurs year round but prevalence is higher in the wet seasons. All breeds and all ages of cattle can be affected, although the youngest are most susceptible. Since footrot was firstly reported in Netherlands in 1960, the disease has frequently broken out in many bovineraising countries in recent decades, and has led to severe economic losses, notably in Europe and Asia (Guo et al., 2010; Sun et al., 2009; Nagaraja et al., 2005). In China, incidence rate of footrot disease is about 8 to 20%, but in cold and wet areas, the incidence rate is able to reach 50% (Li, 2000). Footrot is generally caused by coinfections with Fusobacterium necrophorum (F. necrophorum), Dichelobacter nodosus, and other pathogenic factors (Berg et al., 1975; Roberts et al., 1968). The present study demonstrates that footrot is mainly caused by the pathogen F. necrophorum. Further research reveals leukotoxin A (lktA) of F. necrophorum is a major virulence factor that causes footrot (Narayanan et al., 2003; Tan et al., 1994). Clinical diagnosis of footrot caused by F. necrophorum is difficult because clinical signs of footrot are common to other pathogens. At present, these methods have been used to detect F. necrophorum in footrot, such as bacterium isolation (BI), polymerase chain reaction (PCR), and real-time polymerase chain reaction (Realtime PCR) (Baek et al., 2010; Aliyu et al., 2004). Although BI is highly specific and sensitive, it is often too time consuming and expensive for routine use in clinical test. PCR and Real-time PCR methods have been widely applied for laboratory diagnosis of F. necrophorum in footrot because of its sensitivity, specificity, and rapid diagnosis requiring about 3 h for detection of bacterial

*Corresponding author. E-mail: amu0406@yahoo.com.cn. Tel: +86-459-6819200. Fax: +86-459-6819190.

2618

Afr. J. Microbiol. Res.

Table 1. Primers for Fn-LAMP and PCR of the lktA gene of F. necrophorum.

Primer name lktA-F3 lktA-B3 lktA-FIP (F1C+TTTT+F2) lktA-BIP (B1C+TTTT+B2) lktA-U lktA-R

Oligonucleotide sequence of the primers 5AAGAAAAAAGATGGAGCGG3 5CATTCACAACAACAGTAGATGA3 5GTATTGACTGCAATAGCTACTCCTCTTTTATTGTAAATGCTGCTTTATCGG3 5AATTGAGTGGAAGCAATAAGGAAGCTTTTCTCCACATTTACATGTTTCGC3 5'AGGAGAATCTAAAAGCCA3' 5'CCATTTAGTAAAGCCTGA3'

The primers lktA-F3 and lktA-B3 are forward outer primer and reverse outer primer, respectively. The primers lktA-FIP and lktA-BIP are forward inner primer and reverse inner primer, respectively. The primers lktA-U and lktA-R were used for PCR amplification of lktA gene of F. necrophorum.

genomic DNA, but the two methods need to be carried out in diagnostic laboratory with specialized equipment. Therefore, development of a simple and rapid assay for detection of F. necrophorum from footrot with high specificity and sensitivity is imperative. In our study, the loop-mediated isothermal amplification (LAMP) method was introduced to establish a rapid diagnostic method for detection of F. necrophorum from footrot of cattle.

Fn-LAMP was carried out in a 25 l mixtures containing 1 l of the primers lktA-F3 (5 M), lktA-B3 (5 M), lktA-FIP (40 M) and lktABIP (40 M) each, 1 l of MgSO4 (100 uM), 2 l of dNTP (10 mM), 1 l of Betaine (25 mM, Sigma Aldrich), 2.5 l of 10Thermopol buffer (New England Biolabs, NEB), 1 l of Bst DNA polymerase (New England Biolabs, NEB), 1 l of diluted genomic DNA of F. necrophorum strain H05, and 12.5 l of ddH2O. The mixture was incubated at 61 for 45 min, and 3 l of Fn-LAMP products was C analyzed by electrophoresis in 0.8% agarose gel.

MATERIALS AND METHODS Bacterial strain and plasmid F. necrophorum strain H05 (Genbank accession no. DQ672338) was stocked in Clinical Veterinary Medicine Laboratory, College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University. The field isolates from cattle, enterotoxigenic Escherichia coli, Salmonella, Pasteurella multocida, Mycoplasma, and Campylobacter fetus were isolated and identified according to the conventional culture and biochemical tests, respectively.

PCR reaction The 25-l PCR mixtures contained 1 l of diluted genomic DNA of F. necrophorum strain H05, 2.5 l of 10buffer, 0.25 l of Tag DNA polymerase (Takara, Dalian, China), 2 l of dNTP (2.5 mM each), 1 l of lktA-U primer (10 M), 1 l of lktA-R primer (10 M), 17.25 l of ddH2O. The amplification conditions were 5 min of denaturation at 95 followed by 30 cycles of 95 for 1 min, 50C for 30 s, and C, C 72 for 30 s and a final extension step of 72C for 10 min. 3 l of C PCR products was analyzed by electrophoresis in 0.8% agarose gel.

Primers for Fn-LAMP and PCR Four specific oligonucleotide primers for Fn-LAMP, named lktA-F3, lktA-B3, lktA-FIP, and lktA-BIP, were designed using the PrimerExploer V3 software online (http://primerexplorer.jp/e/) based on nucleotide sequence of lktA gene of F. necrophorum (Genbank accession no. DQ672338). A pair of primers for PCR amplification, named lktA-U and lktA-R, respectively, were designed using the Primer Premier 5.0 software based on nucleotide sequence of lktA gene of F. necrophorum strain H05 (Genbank accession no. DQ672338). All primers were synthesized by Shanghai Sangon Biological Engineering Technology and Services Co. Ltd. (Shanghai, China). All sequences of the primers are shown in Table 1.

Evaluation of Fn-LAMP The Fn-LAMP method was evaluated by sensitivity assay, specificity assay, and detection of clinical samples. In sensitivity assay, F. necrophorum strain H05 was cultured according to the recommended methods. The fresh cultures were diluted from 104 CFU/mL to 10-1 CFU/mL in phosphate buffered saline (PBS, pH7.4). Genomic DNAs of diluted bacteria were extracted using a DNeasy Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturers protocol, respectively. The extracted genomic DNAs as templates were detected using the Fn-LAMP method and conventional PCR method, respectively. Products of Fn-LAMP and PCR were analyzed by electrophoresis in 0.8% agarose gel. In specificity assay, the genomic DNAs of the field isolates from cattle, enterotoxigenic E. coli, Salmonella, P. multocida, Mycoplasma, and C. fetus, were extracted with the method described before. The extracted genomic DNAs were detected by using the LAMP method. The genomic DNA of F. necrophorum strain H05 was used as positive controls in the LAMP. In detection of clinical samples, a total of 37 decomposed soft tissues of hooves from cow with footrot were collected in 13 cattle farms of Heilongjiang Province, northeast China. All samples were diluted 1:5 in PBS (pH 7.4), and the genomic DNA from each

Fn-LAMP reaction Three crucial components, Mg2+ concentration, reaction temperature and reaction time, were optimized using the genomic DNA of F. necrophorum strain H05 as template in electronic constant temperature water bath pot. The best reaction of the

Sun et al.

2619

sample was extracted according to the method described previously. The extracted genomic DNAs were simultaneously detected using LAMP method and PCR method. Using PCR method as the golden standard, relative sensitivity of LAMP to PCR and relative specificity of LAMP to PCR were analyzed based on the following formula. Relative sensitivity = 100 LAMP positive numbers/PCR positive numbers. Relative specificity = 100 LAMP negative numbers/PCR negative numbers. Visual detection of Fn-LAMP products with naked eye In order to determine result of Fn-LAMP products by visual observation quickly, the Fn-LAMP reaction was performed by adding 2 l of fluorescent dye EvaGreenTM (Biotium Inc. Hayward, CA, USA) to a 25 l total reaction mixture volume. The genomic DNAs of F. necrophorum (102, 101, 100, and 10-1 CFU/mL, respectively) and the genomic DNA of enterotoxigenic E. coli as negative control were detected by the Fn-LAMP reaction containing fluorescent dye EvaGreenTM. Different fluorescent colors in the reaction mixture each were checked when the reaction was completed.

RESULTS Fn-LAMP amplification The amplified products of Fn-LAMP and PCR were analyzed by electrophoresis in 0.8% agarose gel. Result indicated a ladder-like DNA electrophoresis band was showed in the lane of Fn-LAMP products, a 435 bp of DNA band was shown in the lane of PCR products, and no amplified products were shown in the lane of FnLAMP negative control (Figure 1). Sensitivity and specificity assay In sensitivity assay, detection limit of the Fn-LAMP method was 1 cfu/mL of F. necrophorum, and detection limit of the PCR method was 10 cfu/mL of F. necrophorum (Figure 2). In specificity assay, no amplification was shown in result of the Fn-LAMP amplification for the field isolates enterotoxigenic E. coli, Salmonella, P. multocida, Mycoplasma, and C. fetus (Figure 3). Detection of clinical samples A total of 37 decomposed soft tissues of hooves from footrot were simultaneously detected using Fn-LAMP and the PCR methods. Result demonstrated that relative sensitivity of Fn-LAMP to PCR was 100%, relative specificity of Fn-LAMP to PCR was 87.5%, and percentage of the observed agreement was 92.0% between Fn-LAMP and PCR methods (Table 2). Visual detection of the LAMP products Reaction tubes of the genomic DNAs of F. necrophorum

Figure 1. Amplification of lktA gene by Fn-LAMP and PCR. Lane 1 is Fn-LAMP products. Lane 2 is Fn-LAMP negative control. Lane 3 is PCR products. Lane M is DNA Marker.

Figure 2. Comparison of sensitivity of Fn-LAMP and PCR. Lane M is DNA Marker. Lane 1-6 is Fn-LAMP amplification products of the diluted F. necrophorum. Lane 1 is 104 CFU/mL. Lane 2 is 103 CFU/mL. Lane 3 is 102 CFU/mL. Lane 4 is 101 CFU/mL. Lane 5 is 1 CFU/mL. Lane 6 is 10-1 CFU/mL. Lane 7-12 is PCR amplification products of the diluted F. necrophorum. Lane 7 is 104 CFU/mL. Lane 8 is 103 CFU/mL. Lane 9 is 102 CFU/mL. Lane 10 is 101 CFU/mL. Lane 11 is 1 CFU/mL. Lane 12 is 10-1 CFU/mL.

from 10 CFU/mL, 10 CFU/mL, and 1 CFU/mL showed clearly green fluorescence, and no green fluorescence was observed in reaction tubes of the genomic DNA of F. -1 necrophorum from 10 CFU/mL and the genomic DNA of enterotoxigenic E. coli as negative control (Figure 4). These observations agreed with gel electrophoresis results. DISCUSSION Footrot is a serious bovine disease resulting severe economic losses worldwide. In China, incidence rate of

2620

Afr. J. Microbiol. Res.

Figure 3. Specificity of the Fn-LAMP. Lane M is DNA Marker. Lane 1 is F. necrophorum strain H05. Lane 2 is Enterotoxigenic Escherichia coli. Lane 3 is Salmonella. Lane 4 is Pasteurella multocida. Lane 5 is Mycoplasma. Lane 6 is Campylobacter fetus. Lane 7 is Fn-LAMP negative control.

Table 2. Comparison of Fn-LAMP and PCR in detection of clinical samples

Methods PCR + +

+ 13 0 13 0

0 24 3 21

Total 13 24 16 21

Fn-LAMP

Percentage of observed agreement: (13 + 21)/37 100% = 92.0%. Relative sensitivity: 13/13 100% = 100%. Relative specificity: 21/24 100% = 87.5%.

Figure 4. Visual detection of the Fn-LAMP products. Lane 1 is 102 CFU/mL of F. necrophorum; Lane 2 is 101 CFU/mL of F. necrophorum; Lane 3 is 1 CFU/mL of F. necrophorum. Lane 4 is 10-1 CFU/mL of F. necrophorum. Lane 5 is Genomic DNA control of Escherichia coli.

especially when instituted early in the disease course. However, footrot disease is a slower cause of surgical disease in clinical cases; its early symptoms are easily overlooked. Thus, it is desirable to develop a sensitive and specific diagnostic method for detection of footrot F. necrophorum. At present, specific pathogen detection methods of F. necrophorum mainly rely on PCR and Real-time PCR methods (Baek et al., 2010; Aliyu et al., 2004). Two methods need expensive equipment, special operation, and sophisticated determination of results. So PCR and Real-time PCR methods are not suitable for detection-on-spot field situations or primitive laboratories in developing countries. Loop-mediated isothermal amplification (LAMP), as a novel nucleic acid amplification method, was developed for one-step amplification of the target DNA sequence with high sensitivity and specificity under isothermal conditions. Since LAMP was originally reported by Notomi et al. (2000), LAMP had been widely used in etiological diagnosis due to its unique advantage as a rapid, accurate, cost-effective, and visual product method (Notomi et al., 2000; Misawa et al., 2007; Hara-Kudo et al., 2005). In this study, a specific and sensitive LAMP method (Fn-LAMP) was developed for detecting F. necrophorum from footrot of cattle based on lktA gene which is a conservative virulence gene. The Fn-LAMP method did not require special equipment and expensive reagents, and it could be performed in one hour in water bath. Result of the Fn-LAMP method could be clearly confirmed by visual detection using fluorescent dyes as detection reagent. The visual detection of the Fn-LAMP reaction is faster and easier than the PCR method and may be applied in general clinical laboratories. The FnLAMP method is high sensitive and specific for detection of F. necrophorum from footrot. Its detection limit is 1 cfu/mL of F. necrophorum, and detection limit of the PCR method was 10 cfu/mL of F. necrophorum. The Fn-LAMP method was 10 times more sensitive than PCR method. The Fn-LAMP method is high specific for detection of F. necrophorum from footrot. It had no cross-reaction with enterotoxigenic E. coli, Salmonella, P. multocida, Mycoplasma, C. fetus from cattle. In order to evaluate feasibility of the Fn-LAMP method in fields, a total of 37 decomposed soft tissues of hooves from footrot were simultaneously detected using LAMP and PCR methods. Results demonstrate that compared with PCR method, the Fn-LAMP method has higher sensitivity. Although limited numbers of clinical specimens were analyzed in the present study, it has been shown that the Fn-LAMP method has the potential for use in early diagnosis of cattle footrot caused by F. necrophorum.

ACKNOWLEDGMENTS footrot reaches 8 to 20% in the cowshed. But the incidence rate is able to reach 50% in cold and wet areas (Li, 2000). Early treatment of foot rot is usually successful, This work was supported by a grant from the Innovation Fund of Daqing High-tech Industrial Development Zone

Sun et al.

2621

of Heilongjiang Province (DQGX09YF015), Education Department of Heilongjiang Province (11541250 and 1154G60), and Doctor Start Fund of Heilongjiang Bayi Agricultural University (B2009-4).
REFERENCES Aliyu SH, Marriott RK, Curran MD, Parmar S, Bentley N, Brown NM, Brazier JS, Ludlam H (2004). Real-time PCR investigation into the importance of Fusobacterium necrophorum as a cause of acute pharyngitis in general practice. J. Med. Microbiol., 53: 1029-1035. Baek DH, Kim C, Kook JK (2010). Development of strain-specific PCR primers for the identification of Fusobacterium nucleatum subsp. fusiforme ATCC 51190T and subsp. vincentii ATCC 49256T. Anaerobe, 16: 43-46. Berg JN, Loan RW (1975). Fusobacterium necrophorum and Bacteroides melaninogenicus as etiologic agents of foot rot in cattle. Am. J. Vet. Res., 36: 1115-1122. Guo DH, Sun DB, Wu R, Yang HM, Zheng JS, Fan CL, Sun B, Wang JF (2010). An indirect ELISA for serodiagnosis of cattle footrot caused by Fusobacterium necrophorum. Anaerobe. [Epub ahead of print]. PMID: 20304080. Hara-Kudo Y, Yoshino M, Kojima T, Ikedo M (2005). Loop-mediated isothermal amplification for the rapid detection of Salmonella. FEMS. Microbiol. Lett., 253: 155-161. Li Y (2000). New technologies and experiences of animal footrot disease. In Chinese. Contemporary livestock, 4: 5-26. Misawa Y, Yoshida A, Saito R, Yoshida H, Okuzumi K, Ito N (2007). Application of loop-mediated isothermal amplifi cation technique to rapid and direct detection of methicillin-resistant Staphylococcus aureus (MRSA) in blood cultures. J. Infect. Chemother., 13: 134-140. Nagaraja T, Lechtenberg K (2007). Liver abscesses in feedlot cattle. Vet. Clin. North Am. Food Anim. Pract., 23: 351-369.

Nagaraja TG, Narayanan SK, Stewart GC, Chengappa MM (2005). Fusobacterium necrophorum infections in animals: Pathogenesis and pathogenic mechanisms. Anaerobe, 11: 239-246. Narayanan S, Chengappa M, Stewart G, Nagaraja T (2003). Immunogenicity and protective effects of truncated recombinant leukotoxin proteins of Fusobacterium necrophorum in mice. Vet. Microbiol., 93: 335-347. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Res., 28: E63. Roberts DS, Graham NP, Egerton JR (1968). Infective bulbar necrosis (heel-abscess) of sheep, a mixed infection with Fusiformis necrophorus and Corynebacterium pyogenes. J. Comp. Pathol., 78: 1-8. Saginala S, Nagaraja T, Lechtenberg K, Chengappa M, Kemp K, Hine P (1997). Effect of Fusobacterium necrophorum leukotoxin vaccine on susceptibility to experimentally induced liver abscesses in cattle. J. Anim. Sci., 75: 1160-1166. Smith G, Thornton E (1993). Pathogenicity of Fusobacterium necrophorum strains from man and animals. Epidemiol. Infect., 110: 499-506. Sun DB, Wu R, Li GL, Zheng JS, Liu XP, Lin YC. Guo DH (2009). Identification of three immunodominant regions on leukotoxin protein of Fusobacterium necrophorum. Vet. Res. Commun., 33: 749-755. Tan Z, Nagaraja T, Chengappa M, Smith J (1994). Biological and biochemical characterization of Fusobacterium necrophorum leukotoxin. Am. J. Vet. Res., 55: 515-521.