POSTGRADUATE COURSEWORK STUDENT COMMUNITY

(BACS80C_5820_POSTGRADUATE_COURSEWORK) > TAKE ASSESSMENT: QUIZ

Take Assessment: Quiz

Name Quiz
Instructions Answer all questions. Final date for completing the quiz is 17 August
2007.
Multiple Attempts Not allowed. This Test can only be taken once.
Force Completion This Test can be saved and resumed later.

Question Completion Status:

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
21 22 23 24 25 26 27
Question 1 1 points Save
Recombinant DNA molecules usually contain the DNA from at least
three genomes. For
insect cells containing baculovirus with a plant defensin gene,
indicate the host, vector, donor and insert.

Baculovirus
A. Vector
Plant
B. Host
Defensin gene C. Insert
Insect cells D. Donor

Question 2 1 points Save

For the human insulin gene in pBR322 growing in E.coli indicate the
host, vector, donor and insert.

Human
A. Host
Insulin gene
B. Vector
pBR322 C. Donor
E. coli D. Insert

Question 3 1 points Save

For E. coli containing a BAC with an insert of yeast genomic DNA
indicate the host, vector, donor and insert.
 E.coli
A. Host
Bacterial Artificial
Chromosome B. Donor
(BAC) C. Vector
Yeast D. Insert
Genomic DNA

Question 4 1 points Save

For pGEX in mouse PC12 cells expressing jelly fish yellow fluorescent
protein indicate the host, vector, donor and insert.

pGEX
A. Host
Mouse
B. Donor
Yellow fluorescent C. Insert
protein gene
D. Vector
Jellyfish

Questi Sav
1 points
on 5 e
Design a forward primer of 20 base pairs to amplify by PCR the 100 base
pair fragment shown in bold in the following DNA sequence.

CTGTGAAAGGGTCATTTGACTCCCAAAAGGGTCACGACCCATTGAGAACAACTGATGTAGA
CAGTGTATGAACATTCT
TGCTAGTACTTGTGTGGTTAATGAGTTTGCTTTGAGCCATTTGAA
TAGCTGTATAATAACAC
ACTGTATAGTCTTAATTGCTATGTTCGTGTCTCATGATACTGAATATTTTTGTGT
GTTTACTTGCCAAGTGTATTTTT
TAAAACTTGTTTTTTTGCCTATTTTCAAGTGAAAATTCATGTTACTGTCCTTTTCATTAAT
AAATAGATGTACACTAA

Questi Sav
2 points
on 6 e
Design a reverse primer of 20 base pairs to amplify by PCR
the 100 base pair fragment shown in large letters in the
following DNA sequence.
CTGTGAAAGGGTCATTTGACTCCCAAAAGGGTCACGACCCATTGAGAACAACTGATGTAGA
CAGTGTATGAACATTCT
TGCTAGTACTTGTGTGGTTAATGAGTTTGCTTTGAGCCATTTGAA
TAGCTGTATAATAACAC
ACTGTATAGTCTTAATTGCTATGTTCGTGTCTCATGATACTGAATATTTTTGTGT
GTTTACTTGCCAAGTGTATTTTT
TAAAACTTGTTTTTTTGCCTATTTTCAAGTGAAAATTCATGTTACTGTCCTTTTCATTAAT
AAATAGATGTACACTAA
Question 7 1 points Save
Adenine is to DNA as lysine is to:

Question 8 1 points Save

Protein is to protease as nucleic acid is to:

Question 9 2 points Save

A 1.5% agarose gel was run in TBE buffer. The table shows the
distance migrated by molecular weight markers and an unknown
sample. Calculate the approximate size (in base pairs, to the nearest 100
base pairs) of the unknown samples.

Size of marker (base pairs) Distance migrated (mm)

21,200 12
5,000 18
3,500 23
1,900 32
1,400 39
900 48
800 51
600 62
Unknown 1 21
Unknown 2 45

Unknown 1: 4400bp Unknown 2: 700bp

Unknown 1: 700bp Unknown 2: 3900bp
Unknown 1: 3900bp Unknown 2: 1100bp
Unknown 1: 1100bp Unknown 2: 3900bp
Question 10 1 points Save
A laboratory procedure requires you to add a reagent to 7nM. You
have a 1uM stock solution available. The final reaction volume is
100uL. What volume of the stock solution should you add?

0.7uL
1uL
2uL
7uL
Question 11 1 points Save
A laboratory procedure requires you to add 25pmoles of a reagent.
 You have a stock solution of 1uM available. The final reaction volume
is 100uL. What volume of the stock solution should you add?

0.25uL
1uL
2uL
25uL
Question 12 1 points Save
SDS-PAGE is a technique which is used to

separate protein from nucleic acids.

identify the charge on a protein.
separate protein molecules by size.
assay enzyme activity.
Question 13 1 points Save
Why is RNA more difficult to handle in the laboratory than DNA?

It is usually double stranded which makes it harder to copy.

It is less stable and more likely to be degraded by nucleases.
It contains uracil which cannot be paired with another base.
It is found in long molecules which can never be copied
completely.
Question 14 1 points Save
Primers for PCR are generally supplied as lyophilised powder (ie dried
down under vacuum). You have received 75nmoles of a primer. You
want to add 20pmoles to your reaction of final volume 20uL. Which of
the following procedures would give you the right concentration?

Dissolve the dried primers in 750 uL water and add 2uL to

the reaction.
Dissolve the dried primers in 750uL water then make a 1 in
10 dilution and add 2uL to the reaction.
Dissolve the dried primers in 750uL water and add 7.5uL to
the reaction.
Dissolve the dried primers in 1mL water then make a 1 in 5
dilution and add 7.5 uL to the reaction.
Question 15 1 points Save
DNA sequencing requires
 Deoxynucleotides and Ribonucleotides
Deoxynucleotides and dideoxynucleotides
Ribonucleotides and dideoxynucleotides
Dideoxynucleotides and deoxynucleosides
Question 16 1 points Save
What is the catalytic activity of reverse transcriptase?

It copies ribosomal RNA in the nucleolus.

It makes an RNA copy of a DNA molecule.
It converts RNA primers to DNA during replication.
It makes a DNA copy of an RNA molecule.
Question 17 1 points Save
How is 5-bromo-4-chloro-3-indoyl-beta-D-galactoside (X-gal) used?

It is an inducer of beta-galactosidase which is used to initiate

transcription of the gene, resulting in a blue colour.
It is an essential nutrient which produces blue E.
coli colonies when grown in on agar plates.
It is an enzyme which allows the detection of lactose in the
bacterial medium.
It is a substrate for beta galactosidase which results in a blue
product after cleavage.
Question 18 1 points Save
Why is it important to include a promoter sequence when creating a
reporter plasmid?

The promoter is the DNA sequence where RNA polymerase

binds to initiate transcription.
The promoter is necessary for mRNA attachment to the
ribosome prior to translation.
The promoter is required for correct processing of the RNA
prior to translation.
The promoter synthesises a primer which is needed to initiate
transcription.
Question 19 1 points Save
You have discovered a new protein which appears to be an enzyme.
What would you need to carry out an assay of this enzyme?

DNA, RNA, ribosomes.

amino acids, substrate, detection system.
 product, coloured substrate, cDNA clone.
source of enzyme, substrate, way of measuring product.
Question 20 1 points Save
A plaque assay would be used to detect recombinant virus.

True
False
Question 21 1 points Save
A southern blot is used to detect specific RNA sequences.

True
False
Question 22 1 points Save
When using the expression of the lac gene to detect recombinant
plasmids, colonies containing recombinant plasmids will be blue.

True
False
Question 23 1 points Save
E. coli cells which are competent are those which are blocked from
taking up foreign DNA molecules.

True
False
Question 24 1 points Save
What is a restriction enzyme? Select all correct answers.

An enzyme which copies DNA

A protein which cuts DNA sequences at specific sites.
An endonuclease
A molecule which restricts access to DNA.
Question 25 1 points Save
Select all correct answers. Taq DNA polymerase is:

an enzyme which copies DNA into RNA at high

temperature.
usually found in an organism living at high temperature.
 unable to copy DNA at temperatures under 40C.
a protein which is stable at 95C.
Question 26 1 points Save
Which of the following applications would require a cDNA
library? Select all correct answers

Identifying clones for exons from a gene of interest.

Examining DNA copies of genes expressed in a specific
tissue.
Studying total genomic DNA from an organism.
Cloning DNA sequences involved in regulating transcription.
Question 27 2 points Save
is an enzyme which forms bonds to join a 3' OH
to a 5' phosphate in a strand