Vous êtes sur la page 1sur 6

Exemples de questions (avec corrig) pour le contrle de Biologie 1er semestre (cours dAgns Guillot) : les questions seront

notes en tout ou rien (pas de points ngatifs) Toute non rponse est considre comme une erreur. Question 1 Rpondez VRAI ou FAUX en face de chaque proposition : Soit un extrait dune molcule dARN messager : AUGCCCAAAGGGUUUCUCGUGAUAUAU a) Parmi ces trois propositions, quelle est la suite de nuclotides de lADN qui a t transcrit lors de la synthse ? TACGGGTTTCCCAAACACCACTATATA ATGCCCAAAGGGTTTGTGGTGATATAT ATGCCCAAAGGGTTTCTCGTGATATAT TACGGGTTTCCCAAAGAGCACTATATA AUGCCCAAAGGGUUUCUCGUGAUAUAU UACGGGUUUCCCAAAGAGCACUAUAUA b) Quel est le polypeptide qui a t traduit lors de la synthse ? Met Gly Phe Pro Lys Glu His Cys - Ileu Met Pro Lys Gly Phe Leu Val Ileu Tyr Met Pro Lys Gly Lys Glu His Cys - Ileu Met Gly Phe Pro Phe Leu Val Ileu Cys FAUX VRAI FAUX FAUX FAUX VRAI FAUX

Question 2 - Rpondez VRAI ou FAUX en face de chaque proposition : - une cellule humaine peut avoir 23 molcules dADN VRAI - une cellule humaine peut avoir 46 molcules dADN VRAI - une cellule humaine peut avoir 46 chromosomes VRAI - une cellule humaine peut avoir de la chromatine VRAI Question 3 - Rpondez VRAI ou FAUX en face de chaque proposition : LHomme actuel est un : Protozoaire Htrotrophe Homo sapiens sapiens Invertbr Primate Chord FAUX VRAI VRAI FAUX VRAI VRAI

*1

Question 4 Cochez le numro correct en notant les Vertbrs suivants par ordre chronologique dapparition (le numro 1 tant attribu ceux qui sont apparus le premiers). - Primates - Mammifres - Reptiles - Oiseaux - Agnathes 1 1 1 1 x1 2 2 x2 2 2 x 3 3 3 3 3 x 4 4 4 4 4 x5 5 5 5 5

Question 5 [1]alcool [2]acide amin [3]acide phosphorique [4]aldhyde [5]acide gras [6]base azote Cochez les numros correspondant aux molcules que lon peut trouver dans les substances suivantes : - Dans la constitution dun glucide, on peut trouver x1 2 3 x 4 5 6 - Dans la constitution dun lipide, on peut trouver x1 2 3 4 x5 6 - Dans la constitution de lADN, on peut trouver x1 2 x 3 x 4 5 x6 Question 6 - Rpondez VRAI ou FAUX en face de chaque proposition : Un systme autotrophe : - peut tre un champignon FAUX - utilise directement lnergie solaire VRAI - produit du glucose et de loxygne VRAI - a besoin de substances produites par les animaux VRAI Question 7 - Rpondez VRAI ou FAUX en face de chaque proposition : Le code gntique - est universel VRAI - est diffrent suivant les individus - ne concerne que les animaux - est la correspondance entre 3 nuclotides de lADN et les acides amins - est la correspondance entre 3 nuclotides de lARN messager et les acides amins Question 8 - Rpondez VRAI ou FAUX en face de chaque proposition : Soit le polypeptide suivant : Met Ser Asn Asp Thr Leu - Gly Parmi ces ARN messagers, y en a-t-il qui ont pu participer sa synthse ? AUGAGCAAUGAUAAACUGGAGUGA FAUX AUGUCAAAUGACACCCUUGGGUAA VRAI AUGAGUAACGAUACACUAGGUUAA VRAI AUGUCCAACGACACUCCUACCUAG FAUX
*2

FAUX FAUX FAUX VRAI

Question 9 Notez par ordre chronologique dapparition (1 tant ceux qui sont apparus les premiers) les Hominids suivants: - Homo erectus - Homo habilis - Australopithque - Homme de Cro-Magnon - Homme de Neandertal 1 1 x 1 1 2 x 2 2 2 x 3 3 3 3 4 4 4 4 x 5 5 5 x 5

Question 10 Notez, dans lordre, les niveaux hirarchiques de lorganisation de la matire vivante (1 tant le niveau le plus lmentaire): - Tissu 1 x 3 4 5 - Cellule x 2 3 4 5 - Organisme 1 2 3 4 x - Appareil 1 2 3 x 5 - Organe 1 2 x 4 5

Question 11 - Rpondez VRAI ou FAUX en face de chaque proposition : Au cours de lvolution des espces, les premiers Primates sont apparus : - il y a environ 120 000 ans FAUX - il y a environ 70 millions dannes VRAI - il y a environ 70 milliards dannes FAUX - il y a environ 500 millions dannes FAUX Question 12 - Rpondez VRAI ou FAUX en face de chaque proposition : Une protine peut tre : - une hormone VRAI - une enzyme VRAI - un anticorps VRAI - un phospholipide FAUX Question 13 - Rpondez VRAI ou FAUX en face de chaque proposition : Dans une chane alimentaire : - les plantes sont des producteurs VRAI - les omnivores peuvent manger des herbivores VRAI Question 14 - Rpondez VRAI ou FAUX en face de chaque proposition : Les cellules somatiques humaines - ont 46 molcules dADN VRAI - peuvent tre des gamtes FAUX - peuvent tre des cellules musculaires VRAI - peuvent tre des spermatozodes FAUX
*3

Exemples de questions ouvertes : notes en fonction de la prcision de la rponse

Question a Donnez la dfinition dun cosystme. (page 18 poly) Question b Donnez la dfinition dune espce. (page 25 poly) Question c Quest-ce quune cellule totipotente ? (page 16 poly) Question d Quest-ce quune hormone ? (page 30 poly)

*4

Ce code gntique (sans lgende) sera fourni sur la feuille de contrle.

Cys Tyr
U

*
C A G

* Try

Leu Pro
U C A

A G U C A U C G

G U C A

His Gln
G

Ser
C U

A C U G A

C A

Leu Phe

G A C U G A C U G A C U

U C A G U C A G U C A G

U G
C U

C A
A

Arg

G U C

Gly

Ileu Met

Glu Asp

A U G U G A C A C U G

Thr

Ala

Asn Lys

Val

Arg

Ser

CODE GNTIQUE (applicable tout systme vivant) Correspondance entre les codons de l'ARN-m et les acides amins. Cercle central: premire base du codon; deuxime cercle: deuxime base du codon; troisime cercle: troisime base du codon; quatrime cercle: acides amins. Les trois codons auxquels sont associes des astrisques (*) sont des codons "non-sens", "fin de message"; ils ne correspondent aucun acide amin. Le codon "AUG" est le codon "dbut de message" et correspond l'acide amin Mthionine.
(d'aprs G. Vogel et H. Angermann, Atlas de la Biologie, 1994)

*5

Ce fichier sera complt un peu avant la fin du cours par dautres exemples de questions sur le reste du programme.

*6