NIH Public Access

Author Manuscript
Dev Biol. Author manuscript; available in PMC 2008 June 1.
Published in final edited form as: Dev Biol. 2007 December 1; 312(1): 300311.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Notch signaling regulates regeneration in the avian retina

Susan Hayesa, Branden R. Nelsona, Brian Buckinghamb, and Thomas A. Reha aDepartment of Biological Structure, 357420 Health Science Center, University of Washington, School of Medicine, Seattle, WA 98195, USA, Phone: (206) 543-8043, Fax: (206) 543-1524, e-mail: tomreh@u.washington.edu bMedical Student Training Program, Box 357470, University of Washington, School of Medicine, Seattle, WA 98195, USA

Abstract
The chicken retina is capable of limited regeneration. In response to injury, some Mller glia proliferate and de-differentiate into progenitor cells. However most of these progenitors fail to differentiate into neurons. The Notch pathway is upregulated during retinal regeneration in both fish and amphibians. Since the Notch signaling pathway maintains cells in a progenitor state during development, we hypothesized that a persistently active Notch pathway might prevent a more successful regeneration in the chick retina. We found Notch signaling components are upregulated in the proliferating progenitors. We also found that blocking the Notch pathway while Mller glia are de-differentiating into progenitor cells, prohibits regeneration; conversely, blocking the Notch pathway after the progenitors have been generated from the Mller glia, caused a significant increase in the percentage new neurons. Thus, Notch signaling appears to play two distinct roles during retinal regeneration. Initially, Notch activity is necessary for the de-differentiation/proliferation of Mller glia, while later it inhibits the differentiation of the newly generated progenitor cells.

Keywords retina; regeneration; Notch; Mller glia

INTRODUCTION
In response to damage, Mller glia in the chick and fish retina can re-enter the cell cycle, express progenitor genes and regenerate neurons (Fischer, 2005; Fischer et al., 2002; Fischer and Reh, 2001; Fischer and Reh, 2002; Fischer and Reh, 2003; Raymond et al., 2006; Yurco and Cameron, 2005). In the fish retina, the Mller glial derived progenitors go on to successfully regenerate nearly all the damaged retina (Raymond et al., 2006; Yurco and Cameron, 2005). However, regeneration in the bird is much less successful, and the majority of the progenitor cells derived from Mller glial cell divisions remain undifferentiated (Fischer and Reh, 2001), expressing the markers of progenitor cells, rather than differentiating as either Mller glia or neurons. The failure of the majority of progenitors to differentiate into neurons in the regenerating chick retina suggests that some factors expressed in the regenerating retina may limit neuronal differentiation in these cells. A potential candidate for this block in differentiation is the Notch

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Hayes et al.

Page 2

pathway. During retinal development, the Notch signaling pathway maintains progenitor cells in an undifferentiated state; constitutive activation of the Notch pathway prevents cells from differentiating as neurons, and instead they either differentiate into Mller glia, or remain in a progenitor state (Bao and Cepko, 1997; Dorsky et al., 1997; Henrique et al., 1997; Jadhav et al., 2006). The Notch receptor is activated by the ligands, Delta (Dll1-4) or Serrate 1,2 (known as Jagged 1,2 in mammals). Binding of the Notch receptor to its ligand induces two proteolytic cleavages of Notch. The second cleavage, mediated by a -secretase, cleaves the intracellular domain (ICD), allowing it to translocate to the nucleus where it can activate one or more downstream target genes of the hairy/enhancer of split family (Hes) (Bray, 2006). Hes genes inhibit expression of proneural genes (Chen et al., 1997; Sriuranpong et al., 2002), preventing neuronal differentiation. Inhibition of Notch signaling by a dominant-negative Dll1 or the secretase inhibitor, DAPT, in developing retina promotes neuronal differentiation (Henrique et al., 1997; Nelson et al., 2006; Nelson et al., 2007). Recent studies have implicated the Notch signaling pathway in retinal regeneration. A study in fish retina has shown that after injury, Notch and some of the associated pathway components are expressed in the Mller glia, which are proliferating and de-differentiating into progenitor cells (Raymond et al., 2006; Sullivan et al., 1997). Since the Notch signaling pathway is known to maintain the progenitor state in developing retina, we hypothesized that the Notch pathway might be persistently active during regeneration in the chick retina and thus prevent more successful regeneration. To explore this possibility, we analyzed Notch pathway components following neurotoxic damage and used a small molecule inhibitor of the Notch pathway, DAPT, to test for a requirement for Notch at various times during the regeneration process. In this study, we find that Notch activity has two distinct roles in retinal regeneration. After neurotoxic damage, Notch signaling components are upregulated in the proliferating Mller glia. Activation of the Notch pathway is necessary for the de-differentiation process; inhibiting the Notch pathway soon after neurotoxic damage reduces the percent of Mller glia that reexpress progenitor genes and reduces the overall proliferative response. However, later in the regeneration process we find that Notch activity prevents more successful regeneration: inhibiting Notch signaling after the Mller cells have already de-differentiated causes a significant increase in the extent of neuronal differentiation.

NIH-PA Author Manuscript NIH-PA Author Manuscript

Animals

MATERIALS AND METHODS

The use of animals in this study was in accordance with the guidelines established by the University of Washington, IACUC, and the National Institute of Health. Newly hatched leghorn or hyline brown chickens (Gallus gallus domesticus) were obtained from H&M Highline International (Seattle, WA). Quantitative Polymerase Chain Reaction Analysis Quantative polymerase chain reaction (QPCR) was performed as described (Dorsky et al., 1997; Nelson et al., 2006; Nelson et al., 2007). Intraocular injections of NMDA or saline were given to P1 chicks. Animals were sacrificed and eyes were dissected at the indicated time points. Three pairs of eyes were used per time point. The eyes were bisected, separating the peripheral half from the central half. The central retina halves were frozen, homogenized, and cells were lysed with Trizol (Invitrogen). Genomic DNA was digested by DNAse (Invitrogen) and RNA was purified using an RNEasy column (Qiagen). cDNA was generated by oligo-dT primed reverse transcription reaction with Superscript II reverse transcriptase (Invitrogen); an RT-minus control was included for each sample. Quantative PCR was performed using an Opticon DNA Engine (Bio-Rad). The cDNAs were normalized to GAPDH levels. The

NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 3

following primer sets were used: cGAPDH forward 5 CAT CCA AGG AGT GAG CCA AG, reverse 5 TGG AGG AAG AAA TTG GAG GA; cPCNA forward 5 GATGTGGAGCAGCTT GGA AT, reverse 5 CCAATGTGGCTGAGGTCTCT, Cash1 forward 5 AGGGAACCACGTTTATGCAG, reverse 5 TTATACAGGGCCTGGTGAGC, Notch1 forward 5 TTCCCAGCACAGCTATTCCT; reverse 5 CCCACTGGGTCTCACTTGAA; cHes-5 forward 5 CCAGAGACACCAACCCAACT, reverse 5 CAGAGCTTCTTTGAGGCACC : cHes1 forward 5 GAAGTCCTCCAAACCCATCA, reverse 5 AGGTGCTTCACCGTCATCTC cHey-2 forward 5 TCTCCTTCACCAGCACCTTC, reverse 5 GGCTGGATGAGGCTGACAC; cHey-1 forward 5 CGACTCGTGTCTCACCTCAA, reverse 5 GTGAGGGTGATGTCCAAAGG; cDeltex2 forward 5CAATGAGAAGGGCAGAAAGG, reverse 5 GGTGGATCTCATTCCACACC; cDNER forward 5 TCAGTGGACACGGGATTAGA, reverse 5 CATCAACAAACAACTCAAACCA; cDelta1 forward 5 CACTGACAACCCTGATGGTG, reverse 5 TGGCACTGGCATATGTAGGA; cDll4 forward 5 CAAATTGCCGATTCTGTCCT, reverse 5 TGCTGTCGATGCTTGGTAAGA; cFoxN4 forward 5 GCTGCCATTCATAGGAGCAT, reverse 5CTGGGTCTGGATCTGGTGAT; cSox2 forward 5 AGGCTATGGGATGATGCAAG, reverse 5 GTAGGTAGGCGATCCGTTCA; cPEA3 forward 5 ACCTGTGCAGATTCACCTC, reverse 5 GTACGGGACAGGCACTTCTC; and cGeminin forward 5 TGCATTATTTGACCAGCATGA, reverse 5 TGTTTCTTGGTTGGATTCGTC. In Situ Hybridization In situ hybridization was essentially performed as described (Bermingham-McDonogh et al., 2006; Nelson et al., 2006). Posthatch eyes were dissected in HBSS; the lens and vitreous humor were removed. Sections from stage 25 embryonic heads were also stained in parallel, to serve as controls for the probes. In situ probes were synthesized by in vitro transcription reaction. The DNA template was digested with DNAse and the probe was precipitated with ethanol. The probe was resuspended in 0.25% SDS in TE buffer. Notch1 plasmid used to make probe came from D. Henrique (Henrique et al., 1997) and Hes5 plasmid was described in (Nelson et al., 2006). Intraocular Injections The left eye was injected with 20 uL of 0.1 M NMDA. The right eye was injected with 20 L 0.9% saline. For immunohistochemistry and in situ studies, both eyes were injected with 20 L 0.1 10 mg/mL BrdU. Where indicated, eyes were injected twice (4 hours between injections) with 2.5 uL DMSO or 10 mM DAPT (Sigma). (DAPT (N-[N-(3,5difluorophenacetyl)-L-alanyl]-S-phenylgly cine t-butyl ester)). Immunohistochemistry A standard immunohistochemical staining protocol was performed as described (Fischer and Reh, 2000). Antibodies used included: rat anti-BrdU (1:100, Accurate), mouse anti-Hu (1:100, Monoclonal Antibody Facility, University of Oregon), rabbit anti-Calretinin (1:1000, J.H. Rogers, University of Cambridge), mouse anti-Vimentin (1:50, DSHB), mouse anti-Islet (1:20, DSHB), rabbit anti-Pax6 (1:500, Covance), mouse anti-Visinin (1:2000, DSHB) and goat antiSox2 (1:1000, Santa Cruz). When rat anti-BrdU antibody was used, slides were treated with a 100Kunitz/mL DNAse (Sigma). Alexa-488 and Alexa-568 secondary antibodies (Invitrogen) used at 1:500. Alexa-350 (Invitrogen) secondary antibodies were used at 1:80. Apoptotic cells were detected using terminal deoxynucleotidyl transferase (TdT) (Promega) to transfer Alexa Fluor 546-14-dUTP (Molecular Probes) to strand breaks of cleaved DNA.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 4

Counts on Flatmounts Retinas were flatmounted, fixed and immunolabelled for BrdU. Confocal slice images of retina flatmounts were taken on a Zeiss confocal microscope. ImageJ (Rasband, 1997-2006) including extended depths of field plug-in (Forster et al., 2004) were used to flatten image stacks, threshold and count BrdU positive nuclei per area across the complete retinal depths. A one tailed Mann-Whitney test was used to determine significance of changes in BrdU incorporation between control DMSO and DAPT injected eyes; p < 0.05 was considered significant.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

RESULTS
The Notch signaling pathway is upregulated during chicken retinal regeneration As noted above, in response to toxins, such as NMDA, some chicken Mller glia cells proliferate and express genes normally only expressed in embryonic progenitors, and approximately 10% of these progenitor cells go on to differentiate into new neurons. To determine whether Notch pathway genes are involved in the regenerative process, we used QPCR to measure changes in expression of Notch signaling components following NMDA treatment in the posthatch chick retina. The left eyes of P1 chicks were injected with NMDA, while the right eyes were injected with saline and served as controls. We define P1 as the day the chicken hatched. NMDA and control retinal mRNA was harvested from P2, P3, P4 and P8 chickens. To confirm that the NMDA injection elicited a regenerative response, we measured changes in proliferating cell nuclear antigen (PCNA) and four additional neural progenitorspecific genes: geminin, Cash1, Pea3 and FoxN4 (Del Bene et al., 2004; Jasoni et al., 1994; Li et al., 2004; McCabe et al., 2006). We also analyzed expression of Sox2, which is known to be in progenitor cells, but is also expressed in Muller glia (Taranova et al., 2006). These genes were all up-regulated in the first few days after NMDA induced damage. Cash1 is normally only expressed in progenitor cells, but was previously shown to be re-expressed in the regenerating retina (Fischer and Reh, 2001). We confirmed that Cash1 increased after damage and was maximally expressed at P4 (Fig. 1H). We found the greatest change in PCNA occurred at P4, which coincides with what was previously determined (Fischer and Reh, 2003) to be the peak of proliferative response (Fig. 1D, Sup Fig. 1). These data show that NMDA induces a pattern of gene expression at least partly similar to that observed during normal embryonic development. The Notch pathway is critical for normal embryonic development (see Introduction), and so we investigated whether the genes in this pathway were also up-regulated in the NMDA damaged retina. We carried out a time course for Notch1 and Hes5 (a critical downstream target of the Notch ICD), and found that both genes reached a peak in expression at P4 (Fig. 1F, 1G). At this same time point, we also analyzed other components of this pathway. We found that other members of the Hes and Hey family of Notch target genes, Hes1, Hey2 and Hey1, were not significantly different in the NMDA treated retinas as compared with the saline treated retinas. We also tested for changes in Deltex, and the Notch ligands: DNER, Dll1, and Dll4, but did not see significant changes in their expression (data not shown). These results show that at least some components of the Notch pathway are up-regulated following NMDA induced retinal damage. Components of the Notch pathway are expressed in the regenerating cells We used in situ hybridization, to determine which cells up-regulate Notch1 and Hes5 during retinal regeneration. The probes were tested in embryonic retina to ensure they gave specific labeling similar to that which has been previously reported (Fischer and Reh, 2001; Henrique et al., 1997; Nelson et al., 2006) (Sup Fig.2). We also performed in situ hybridization with the corresponding sense probes; the sense probe gave a background staining, but not the distinctive
Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 5

staining pattern seen with the anti-sense probe (Sup Fig. 2). In normal posthatch chick eyes (saline-injected), Notch1 was expressed in a small cluster of cells at the ciliary marginal zone (CMZ) (Fig. 2A), similar to that reported in other non-mammalian vertebrates (Perron et al., 1998). In addition, faint Notch staining was observed in the center of the inner nuclear layer (INL; Fig. 2B). The position of the Notch1 positive cells, in the middle of the INL, suggested that they might be Mller glia. Previous studies have described Notch1 expression in mouse Mller glia (Furukawa et al., 2000). To confirm that Notch positive cells were Mller glia, we labeled the sections with an antibody to vimentin, a Mller glial marker, following in situ hybridization. Although the expression levels of Notch mRNA were very low, we found that some of the Notch positive cells were also vimentin positive (Fig. 2C-F, arrow). After NMDA treatment, the in situ hybridization for Notch1 mRNA showed an overall increase in the intensity of labeling (Fig. 2F,G). Co-labeling the in situ hybridizations with antibodies to BrdU and vimentin allowed us to determine whether the Notch expressing cells were Mller glia and/or their progeny. All of the BrdU labeled cells were also labeled with vimentin, confirming previous reports (Fischer and Reh, 2001); in addition, most, if not all, of the Notch1 expressing cells were also labeled with vimentin (Fig. 2G-J, arrow). However, we found examples of cells that expressed Notch1 (Fig. 2G-J. asterisk), but did not label with BrdU, suggesting either that our BrdU pulse was not sufficient to label all of the Mller glial-derived progenitors, or alternatively that Mller glia can up-regulate Notch1 without re-entering the cell cycle. We looked to see if the Notch target gene, Hes5, was also expressed in a similar pattern. In the CMZ of normal eyes, there was a small cluster of Hes5 expressing cells (Fig. 3A), similar to those that express Notch1 (Fig. 2A). We could not detect Hes5 staining in the central region of the normal (saline injected) retina (Fig. 3B). The inability to detect Hes5 staining was not due to a problem with the probe, as the same probe on embryonic control slides detected robust Hes5 expression (Sup Fig. 2). In the NMDA treated eye, scattered cells in the INL expressed Hes5 (Fig. 3C). We found that nearly all of the Hes5 expressing cells were also labeled with BrdU and vimentin (Fig. 3D-G). We did however find a few examples of cells that expressed Hes5 (Fig. 3 D-G, asterisk), but did not label with BrdU, suggesting again that either our BrdU pulse was not sufficient to label all of the Mller glial-derived progenitors, or alternatively that Mller glia can up-regulate Hes5 without re-entering the cell cycle. These data are consistent with the QPCR results, demonstrating that some of the proliferating cells in NMDA treated retinas up-regulate Notch1 and Hes5. The function of these two genes during normal retinal development and their expression during regeneration in fish suggests that this same molecular pathway is re-utilized during retinal regeneration in birds. Notch Signaling is Necessary for Regeneration The up-regulation of Notch signaling components correlates with the proliferation and transition of Mller glia into progenitor cells. To determine whether the Notch pathway is necessary for the proliferation and/or transition of Mller glia to progenitor cells, we blocked the Notch pathway using a small molecule inhibitor of -secretase, DAPT, as outlined in Fig. 4A. Application of DAPT, is a well-established method for inhibiting the Notch pathway. Previous studies have shown that DAPT and inhibitory mutations in the Notch pathway have the same effect on development (Geling et al., 2002;Micchelli et al., 2003;Nelson et al., 2006;Nelson et al., 2007). We injected eyes with NMDA at P1, DAPT or DMSO (vehicle control) at P2 and BrdU at P3. We found that injection of DAPT significantly inhibited the Hes5 up-regulation caused by the NMDA injection (Sup Fig3A). We predicted that if Notch signaling is necessary for Mller glial de-differentiation, we would see a decrease in the number of BrdU labeled cells. We quantified the amount of BrdU staining in flatmount retinas from chickens sacrificed at P8
Dev Biol. Author manuscript; available in PMC 2008 June 1.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Hayes et al.

Page 6

(compare 4B and 4C), there was a significant decrease in proliferation in the DAPT treated retinas (about 65% less, p < 0.019, Fig. 4D). The decline in BrdU labeled cells in the DAPT treated retina was consistent with the hypothesis that Notch activity is necessary for the transition of Mller glia to proliferating progenitor cells; however, it is possible that DAPT prevented the NMDA-induced damage. To test for this alternative explanation of the result, we labeled the DMSO and DAPT treated retinas with an apoptotic marker. We found NMDA induced apoptotic cells in both treated and control retinas, indicating that the difference in BrdU incorporation was not due to a lack of apoptosis induced by the NMDA in the DAPT treated retinas (Sup Fig.3B-C). To determine if DAPT treatment was inhibiting the dedifferentiation process, we performed a similar experiment and counted the percentage of proliferating cells that also stained with a progenitor marker. We predicted that if Notch signaling is necessary for the de-differentiation of Muller glia into progenitors, fewer cells would co-stain for BrdU and a progenitor marker following DAPT treatment. In the NMDA treated posthatch chick retina, the progenitor cells express Pax6 (Fischer and Reh, 2001). We treated chicks with NMDA at P1, DAPT or DMSO (vehicle control) at P2, BrdU at P3 and sacrificed the animals 4 hours after the BrdU pulse. We sacrificed the animals at this early time-point because most of the de-differentiation occurs 2-3 days after NMDA injection and therefore most of the BrdU positive cells are the new progenitors (Fischer and Reh, 2001). If Notch signaling is necessary for de-differentiation, fewer cells would co-stain for Pax6 and BrdU in the DAPT treated retinas. We found about a 25% decrease in the number of BrdU/Pax6 double-labeled cells (de-differentiating Mller glia) in the DAPT treated retinas compared to DMSO treated retinas (p < 0.0364, Fig. 4E-I). These data support the conclusion that inhibition of the Notch pathway early in the regeneration process inhibits the de-differentiation of Mller glia into retinal progenitors. Downregulation of Notch Signaling Enhances Retinal Regeneration The data from the early treatment with DAPT indicates that activation of the Notch pathway may be necessary for Mller cells to de-differentiate, and become neurons. However, previous studies have also found that once the Mller glia de-differentiate into progenitor cells, only a small percentage of the cells go on to differentiate into neurons, while most of the cells remain in an undifferentiated state. Our time-course data (Fig. 1) shows that the expression of Notch signaling components persists until at least P8. Thus, we hypothesized that the maintained activation of Notch in these cells may prevent more of the progeny of the Mller glia from differentiating into neurons. To test this hypothesis, we injected eyes with NMDA at P1, BrdU at P3, and DAPT or DMSO (vehicle control) at P4, and sacrificed the animals at P8 (Fig 5A). The eyes were analyzed by immunohistochemistry for neuronal markers (Hu, calretinin, and islet) and BrdU. Since normally at this stage, all the retinal cells are postmitotic, we used BrdU to label the newly generated retinal neurons. DAPT treatment at P4, led to an increase in the number of newly generated neurons (Fig. 5). Cells labeled with BrdU and several neuronal markers (Hu (ganglion and amacrine cells), calretinin (ganglion, amacrine, horizontal cells), islet (ganglion, amacrine, bipolar cells) and visinin (cone photoreceptors)) were more commonly observed in the DAPT treated retinas compared to retinas from the group that received DMSO. There were roughly 3.5x more new Hu (Fig. 5B), 2x more new calretinin (Fig. 5C) and 4.7x more islet (Fig. 5D) labeled neurons in the DAPT treated retinas than in the DMSO treated retinas. The number of visinin and BrdU labeled cells was extremely rare (Fig. 5E). Out of seven DMSO treated retinas, we found one retina that had one new visinin cell. Out of eight DAPT treated retinas, we found three retinas that had new visinin cells. The occurrence of new visinin cells was too rare to reach statistical significance. The overall number of BrdU labeled cells was similar between the DAPT treated group and the DMSO control (Sup. Fig 4). Quantification of the number of cells that were

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 7

double-labeled with BrdU and the various neural markers is shown in Fig. 5E. We also looked for any cells that coexpress the neural marker, Hu, and the Muller glia marker, CRALBP, to determine whether the Muller glia undergo an abnormal plasticity. Out of 2,429 Hu positive cells, in 7 NMDA treated birds (4 DAPT treated and 3DMSO treated) we did not find any cells that coexpressed Hu and CRALBP (Sup. Fig 5). These results indicate that inactivation of the Notch pathway led to an increase in the neural differentiation of the Mller glial-derived progenitors. We analyzed the DAPT treated retinas to determine whether there was a concomitant decrease in the number of Mller-glial derived progenitors, when compared to the DMSO-treated control retinas. We identified these dedifferentiated progenitor cells as cells that were triple labeled for BrdU, Sox2 and Pax6. Sox2 labels Mller glia and progenitors (Ellis et al., 2004). Therefore one would predict that dedifferentiated Mller glia would co-express Sox2 and Pax6. We found a significant decline in the number of progenitor cells in the DAPT treated retinas compared to the DMSO treated retinas (about 45% less, p < 0.0317, Fig. 6), consistent with the hypothesis that Notch signaling maintains the progenitors from differentiating in the toxin treated retina. The inhibition of Notch with DAPT thus leads to a shift in the BrdU labeled population from a progenitor state to neuronal differentiation. To determine whether the new neurons persist in the retina, we analyzed some birds after survival periods of up to two weeks following the NMDA treatment (Sup. Fig 4). We found that most of the new neurons do not survive after one week. Two weeks after the NMDA treatment there was a significant decrease in the total number of BrdU labeled cells in both the DMSO and DAPT treated retinas. However among the remaining BrdU labeled cells, we found that a significantly higher percentage co-labeled with BrdU and Hu in the DAPT treated retinas as compared to the DMSO treated retinas (about 1.97-times more BrdU and Hu labeled cells in DAPT compared to DMSO, p < 0.05). Thus, although most of the newly generated neurons do not persist, the effects of DAPT treatment are still present two weeks after the NMDA-induced damage.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

DISCUSSION
The chick retina is capable of limited regeneration following neurotoxic damage. In this study, we have investigated the role of Notch in the regulation of regeneration in the posthatch chick retina. We find that 1.) components of the Notch pathway are up-regulated in Mller glia after retinal damage; 2.) this up-regulation of Notch is important for the de-differentiation process, since inhibition of Notch signaling soon after damage leads to a reduction in the number of progenitors produced by the Mller cells; and 3.) sustained Notch activity limits the process of regeneration, since inhibition of Notch signaling late in the process leads to an increase in the number of new neurons produced by the Mller glial-derived progenitors. Taken together, our results implicate Notch signaling at two key steps in the process of regeneration in the retina, as outlined in Figure 7. Previous studies have shown that Notch pathway components are expressed in adult mammalian brain regions that retain neurogenic and regenerative capability, such as the subventricular zone, dentate gyrus, and the rostral migratory stream (Stump et al., 2002). In addition, in lower vertebrates, Notch and related components of the pathway are expressed in the neurogenic zone of the mature retina, the ciliary marginal zone (Perron et al., 1998; Raymond et al., 2006). The most peripheral region of the chicken retina also contains a CMZ (Fischer and Reh, 2000), similar to that of cold-blooded vertebrates, and the results of our study show that Notch1 and Hes5 are localized to this zone in the posthatch chick retina. Our results also show that Mller glia normally express a low level of Notch1, and that this gene is rapidly up-regulated following damage, reaching a peak three days after the toxin

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 8

treatment, correlating with the peak of progenitor proliferation. During retinal regeneration, we were also able to detect expression of Hes5, a key downstream Notch effector, in the responsive Mller cells. These data are consistent with recent findings in other parts of the nervous system that show an increase in Notch signaling following damage. For example, following a cortical stab wound, the Notch pathway is activated in the subventricular zone (Givogri et al., 2006). In addition, Raymond et al have reported an increase in Notch expression in the regenerating zebrafish retina (Raymond et al., 2006). The Notch pathway was also recently shown to play a role in retinal regeneration in newt. The newt regenerates its retina from the pigment epithelium. The pigment epithelium must first dedifferentiate into retinal progenitor cells, which go on to generate a new retina, and the de-differentiation process is accompanied by an increase in Notch expression (Nakamura and Chiba, 2006). It is interesting that regenerating newt and chick retinas, which have a very different source of regeneration, both require Notch during the regeneration process; this provides further evidence that the Notch pathway regulates differentiation of the progenitor cells, regardless of their source. Although it has been shown previously that Mller glia retain stem cell-like properties and are the source of regenerated retinal neurons in fish and posthatch chickens (Fischer et al., 2002; Fischer and Reh, 2001; Fischer and Reh, 2002; Fischer and Reh, 2003; Raymond et al., 2006), the mechanisms by which Mller glia de-differentiate into neurogenic progenitors is not understood. Our results show that Notch signaling is necessary for the de-differentiation and proliferation of Mller glia, since blocking Notch results in reduction of both proliferation and progenitor gene expression. A recent study in an ischemically injured rat brain, also suggests that Notch signaling may be necessary for progenitor activation after trauma. In this study, administering the ligand, Dll4, activated Notch signaling; as a result, there were more newly generated precursor cells and the rats had improved motor skills (AndroutsellisTheotokis et al., 2006). Attempts to stimulate regeneration from the mammalian retina have shown the response to toxin damage is even more limited than that of the posthatch chick (Ooto et al., 2004), however, recent evidence indicates that activation of the Wnt pathway stimulates proliferation of Mller glia and promotes their de-differentiation into retinal progenitors (Osakada et al., 2007). While it is not known whether Notch signaling is involved in the de-differentiation of mammalian Mller glia, and/or their production of new neurons, another study in the rodent retina has implicated Notch signaling in the response of the mammalian retina to damage. A FACS sorted side population that possesses some progenitor-like qualities can be isolated from the toxin-treated rat retina. When the Notch signaling pathway was inhibited at the same time as the damage was induced, the pool of side population cells was lost (Das et al., 2006). In previous studies of regeneration in the chick retina, it was noted that a majority of the Mller glial-derived progenitors do not differentiate into neurons, but rather remain as undifferentiated progenitors (Fischer and Reh, 2001). We tested whether a persistent activation of the Notch pathway may be preventing these progenitors from completing the regenerative process. Our data are consistent with this hypothesis, since experimentally inhibiting the pathway by treatment with DAPT causes an increase in the percentage of these progenitors that differentiate into neurons. This result begs the question as to which ligands might be activating the Notch receptor in the damaged retina. While we found that Notch1 and Hes5 were upregulated during regeneration, we did not see a significant up-regulation of either the canonical or non-canonical Notch ligands: DNER, Dll1, and Dll4. Nevertheless, we could detect expression of these ligands by QPCR, and so it is possible that one or more of them may be activating the Notch receptor, but that the overall expression levels of these ligands do not change after damage. The Notch pathway has also been implicated in regeneration of other non-retinal tissues, such as the pancreas (Su et al., 2006), bone marrow (Han et al., 2000; Han et al., 2006), skin (Adolphe and Wainwright, 2005), muscle (Luo et al., 2005, Carey et al, 2007) and cochlea (Bermingham-

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 9

McDonogh and Rubel, 2003; Stone and Rubel, 1999) and thus some of the mechanisms for regeneration are likely to be conserved across tissue types and species. When muscle cells are stressed, for example through exercise, new muscles cells are generated. The source of this regeneration is an intrinsic stem population, called satellite cells. During this myogenesis, there is increased expression of several Notch signaling components. Coincidently, it was found that older muscles cells, which have less regenerative capabilities, express lower levels of Notch signaling molecules than younger muscles. Interestingly, if older muscles underwent resistance training, the expression levels of Notch signaling components between age groups were indistinguishable (Carey et al., 2007). Thus Notch signaling is necessary for the expansion of the satellite cell population, however later in myogenesis, the Notch pathway is downregulated as the newly differentiated muscle cells emerge. One theme that appears to be emerging in the study of Notch signaling during regeneration, regardless of the tissue type, is that there is a need for tight spatial and temporal regulation of Notch signaling. In summary, there is an increasing body of data that supports the importance of Notch signaling during regeneration. In most of the these cases, Notch signaling functions to maintain stem cell properties in progenitor/stem cell populations while restricting differentiation. We have shown that Notch signaling is transiently upregulated during retinal regeneration in the chick, and that Notch signaling plays a biphasic role during the regeneration. Initially, Notch is necessary for dedifferentiation of Mller glia into progenitor cells, but later in the process the activation of Notch limits successful regeneration in these animals. It is possible that a similar limit occurs in the mammalian retina, and manipulation of the Notch pathway may be critical to promote retinal repair in mammals.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgements We would like to thank Paige Etter, Samuel Reh and Christa Younkins for the assistance with sectioning, Toshinori Hayashi and Byron Hartman for advice on in situ protocol and all the members of the Reh lab, especially Mike Karl and Deepak Lamba, for their constructive comments. This work was supported by NRSA postdoctoral fellowship F32 EY016636 to S.H. and NIH grant EY13475 to T.A. R.

References
Adolphe C, Wainwright B. Pathways to improving skin regeneration. Expert Rev Mol Med 2005;7:1 14. [PubMed: 16179092] Androutsellis-Theotokis A, Leker RR, Soldner F, Hoeppner DJ, Ravin R, Poser SW, Rueger MA, Bae SK, Kittappa R, McKay RD. Notch signalling regulates stem cell numbers in vitro and in vivo. Nature 2006;442:8236. [PubMed: 16799564] Bao ZZ, Cepko CL. The expression and function of Notch pathway genes in the developing rat eye. J Neurosci 1997;17:142534. [PubMed: 9006984] Bermingham-McDonogh O, Oesterle EC, Stone JS, Hume CR, Huynh HM, Hayashi T. Expression of Prox1 during mouse cochlear development. J Comp Neurol 2006;496:17286. [PubMed: 16538679] Bermingham-McDonogh O, Rubel EW. Hair cell regeneration: winging our way towards a sound future. Curr Opin Neurobiol 2003;13:11926. [PubMed: 12593990] Bray SJ. Notch signalling: a simple pathway becomes complex. Nat Rev Mol Cell Biol 2006;7:67889. [PubMed: 16921404] Carey KA, Farnfield MM, Tarquinio SD, Cameron-Smith D. Impaired expression of Notch signaling genes in aged human skeletal muscle. J Gerontol A Biol Sci Med Sci 2007;62:917. [PubMed: 17301032] Chen H, Thiagalingam A, Chopra H, Borges MW, Feder JN, Nelkin BD, Baylin SB, Ball DW. Conservation of the Drosophila lateral inhibition pathway in human lung cancer: a hairy-related protein

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 10

(HES-1) directly represses achaete-scute homolog-1 expression. Proc Natl Acad Sci U S A 1997;94:535560. [PubMed: 9144241] Das AV, Mallya KB, Zhao X, Ahmad F, Bhattacharya S, Thoreson WB, Hegde GV, Ahmad I. Neural stem cell properties of Muller glia in the mammalian retina: regulation by Notch and Wnt signaling. Dev Biol 2006;299:283302. [PubMed: 16949068] Del Bene F, Tessmar-Raible K, Wittbrodt J. Direct interaction of geminin and Six3 in eye development. Nature 2004;427:7459. [PubMed: 14973488] Dorsky RI, Chang WS, Rapaport DH, Harris WA. Regulation of neuronal diversity in the Xenopus retina by Delta signalling. Nature 1997;385:6770. [PubMed: 8985247] Ellis P, Fagan BM, Magness ST, Hutton S, Taranova O, Hayashi S, McMahon A, Rao M, Pevny L. SOX2, a persistent marker for multipotential neural stem cells derived from embryonic stem cells, the embryo or the adult. Dev Neurosci 2004;26:14865. [PubMed: 15711057] Fischer AJ. Neural regeneration in the chick retina. Prog Retin Eye Res 2005;24:16182. [PubMed: 15610972] Fischer AJ, McGuire CR, Dierks BD, Reh TA. Insulin and fibroblast growth factor 2 activate a neurogenic program in Muller glia of the chicken retina. J Neurosci 2002;22:938798. [PubMed: 12417664] Fischer AJ, Reh TA. Identification of a proliferating marginal zone of retinal progenitors in postnatal chickens. Dev Biol 2000;220:197210. [PubMed: 10753510] Fischer AJ, Reh TA. Muller glia are a potential source of neural regeneration in the postnatal chicken retina. Nat Neurosci 2001;4:24752. [PubMed: 11224540] Fischer AJ, Reh TA. Exogenous growth factors stimulate the regeneration of ganglion cells in the chicken retina. Dev Biol 2002;251:36779. [PubMed: 12435364] Fischer AJ, Reh TA. Potential of Muller glia to become neurogenic retinal progenitor cells. Glia 2003;43:706. [PubMed: 12761869] Forster B, Van De Ville D, Berent J, Sage D, Unser M. Complex wavelets for extended depth-of-field: a new method for the fusion of multichannel microscopy images. Microsc Res Tech 2004;65:3342. [PubMed: 15570586] Furukawa T, Mukherjee S, Bao ZZ, Morrow EM, Cepko CL. rax, Hes1, and notch1 promote the formation of Muller glia by postnatal retinal progenitor cells. Neuron 2000;26:38394. [PubMed: 10839357] Geling A, Steiner H, Willem M, Bally-Cuif L, Haass C. A gamma-secretase inhibitor blocks Notch signaling in vivo and causes a severe neurogenic phenotype in zebrafish. EMBO Rep 2002;3:688 94. [PubMed: 12101103] Givogri MI, de Planell M, Galbiati F, Superchi D, Gritti A, Vescovi A, de Vellis J, Bongarzone ER. Notch signaling in astrocytes and neuroblasts of the adult subventricular zone in health and after cortical injury. Dev Neurosci 2006;28:8191. [PubMed: 16508306] Han W, Ye Q, Moore MA. A soluble form of human Delta-like-1 inhibits differentiation of hematopoietic progenitor cells. Blood 2000;95:161625. [PubMed: 10688816] Han W, Yu Y, Liu XY. Local signals in stem cell-based bone marrow regeneration. Cell Res 2006;16:18995. [PubMed: 16474433] Henrique D, Hirsinger E, Adam J, Le Roux I, Pourquie O, Ish-Horowicz D, Lewis J. Maintenance of neuroepithelial progenitor cells by Delta-Notch signalling in the embryonic chick retina. Curr Biol 1997;7:66170. [PubMed: 9285721] Jadhav AP, Cho SH, Cepko CL. Notch activity permits retinal cells to progress through multiple progenitor states and acquire a stem cell property. Proc Natl Acad Sci U S A 2006;103:189989003. [PubMed: 17148603] Jasoni CL, Walker MB, Morris MD, Reh TA. A chicken achaete-scute homolog (CASH-1) is expressed in a temporally and spatially discrete manner in the developing nervous system. Development 1994;120:76983. [PubMed: 7600956] Li S, Mo Z, Yang X, Price SM, Shen MM, Xiang M. Foxn4 controls the genesis of amacrine and horizontal cells by retinal progenitors. Neuron 2004;43:795807. [PubMed: 15363391] Luo D, Renault VM, Rando TA. The regulation of Notch signaling in muscle stem cell activation and postnatal myogenesis. Semin Cell Dev Biol 2005;16:61222. [PubMed: 16087370]

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 11

McCabe KL, McGuire C, Reh TA. Pea3 expression is regulated by FGF signaling in developing retina. Dev Dyn 2006;235:32735. [PubMed: 16273524] Micchelli CA, Esler WP, Kimberly WT, Jack C, Berezovska O, Kornilova A, Hyman BT, Perrimon N, Wolfe MS. Gamma-secretase/presenilin inhibitors for Alzheimers disease phenocopy Notch mutations in Drosophila. Faseb J 2003;17:7981. [PubMed: 12424225] Nakamura K, Chiba C. Evidence for Notch signaling involvement in retinal regeneration of adult newt. Brain Res. 2006 Nelson BR, Gumuscu B, Hartman BH, Reh TA. Notch activity is downregulated just prior to retinal ganglion cell differentiation. Dev Neurosci 2006;28:12841. [PubMed: 16508310] Nelson BR, Hartman BH, Georgi SA, Lan MS, Reh TA. Transient inactivation of Notch signaling synchronizes differentiation of neural progenitor cells. Dev Biol. 2007 Ooto S, Akagi T, Kageyama R, Akita J, Mandai M, Honda Y, Takahashi M. Potential for neural regeneration after neurotoxic injury in the adult mammalian retina. Proc Natl Acad Sci U S A 2004;101:136549. [PubMed: 15353594] Osakada F, Ooto S, Akagi T, Mandai M, Akaike A, Takahashi M. Wnt signaling promotes regeneration in the retina of adult mammals. J Neurosci 2007;27:42109. [PubMed: 17428999] Perron M, Kanekar S, Vetter ML, Harris WA. The genetic sequence of retinal development in the ciliary margin of the Xenopus eye. Dev Biol 1998;199:185200. [PubMed: 9698439] Rasband, W. Image J. National Institute of Health; Bethesda: 19972006. Raymond PA, Barthel LK, Bernardos RL, Perkowski JJ. Molecular characterization of retinal stem cells and their niches in adult zebrafish. BMC Dev Biol 2006;6:36. [PubMed: 16872490] Sriuranpong V, Borges MW, Strock CL, Nakakura EK, Watkins DN, Blaumueller CM, Nelkin BD, Ball DW. Notch signaling induces rapid degradation of achaete-scute homolog 1. Mol Cell Biol 2002;22:312939. [PubMed: 11940670] Stone JS, Rubel EW. Delta1 expression during avian hair cell regeneration. Development 1999;126:961 73. [PubMed: 9927597] Stump G, Durrer A, Klein AL, Lutolf S, Suter U, Taylor V. Notch1 and its ligands Delta-like and Jagged are expressed and active in distinct cell populations in the postnatal mouse brain. Mech Dev 2002;114:1539. [PubMed: 12175503] Su Y, Buchler P, Gazdhar A, Giese N, Reber HA, Hines OJ, Giese T, Buchler MW, Friess H. Pancreatic regeneration in chronic pancreatitis requires activation of the notch signaling pathway. J Gastrointest Surg 2006;10:123041. [PubMed: 17114010]discussion 1242 Sullivan SA, Barthel LK, Largent BL, Raymond PA. A goldfish Notch-3 homologue is expressed in neurogenic regions of embryonic, adult, and regenerating brain and retina. Dev Genet 1997;20:208 23. [PubMed: 9216061] Taranova OV, Magness ST, Fagan BM, Wu Y, Surzenko N, Hutton SR, Pevny LH. SOX2 is a dosedependent regulator of retinal neural progenitor competence. Genes Dev 2006;20:1187202. [PubMed: 16651659] Yurco P, Cameron DA. Responses of Muller glia to retinal injury in adult zebrafish. Vision Res 2005;45:9911002. [PubMed: 15695184]

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 12

NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 1.

QPCR of central retina shows Notch signaling pathway components are upregulated after NMDA treatment. (A) Geminin (progenitor specific marker) increases after damage. (B) Sox2 increases after damage. (C) Pea3 (progenitor specific marker) increases after damage. (D) PCNA (a measure of cell proliferation) increases after NMDA damage (P3 p < 0.07, P4 p < 0.08). (E) FoxN4 (progenitor specific marker) increases after damage. (F) Notch1 and (G) Hes5 are upregulated after NMDA damage. (B) Cash1 (a positive control for de-differentiation (Fischer and Reh, 2001) is upregulated after NMDA treatment. (Error bars represent s.d., n = 3 pairs per timepoint, * p < 0.05 t-test). (I) Summary of data shown in A-H, indicates that the peak of proliferation and upregulation of Notch components is at P4.

NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 13

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Fig. 2.

Notch1 is expressed in the de-differentiating, proliferating Mller glia. Intraocular injections of saline (A-E) or NMDA (F-J) were made at P1, BrdU at P3 and birds were sacrificed on P4. Sections were treated by in situ hybridization with a probe against Notch1. (A) Peripheral region of control (saline injected) retina. Arrow points to Notch1 expressing cells in the CMZ. (B) Central region of control (saline injected retina). (C-E) Enlargement of boxed area shown in B. Many Mller glia. express Notch1. Arrow points to a cell stained positive for Notch, and vimentin (red, labels Mller glia). (F) Central region of NMDA injected retina. (G-J) Enlargement of boxed area shown in F. Many de-differentiating, proliferating Mller glia express Notch1. Arrow point to a cell stained positive for BrdU (green), Notch, and vimentin (red). Asterisk points to cells stained positive for Notch1 but not BrdU.

Hayes et al.

Page 14

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Fig. 3.

Hes5 is expressed in the de-differentiating, proliferating Mller glia. Intraocular injections of saline (A, B) or NMDA (C-G) were made at P1, BrdU was injected at P3 and birds were sacrificed at P4. Sections were treated by in situ hybridization with a probe against Hes5. (A) Peripheral region of control (saline injected) retina. Arrows point to Hes5 expressing cells in the CMZ. (B) Central region of control (saline injected). Hes5 expression is not detected in the central retina of saline injected eyes. (C) Central region of NMDA injected retina. (D-G) Enlargement of boxed area shown in C. Several de-differentiating, proliferating Mller glia express Hes5. Arrows point to cells stained positive for BrdU (green), Notch, and vimentin (red). Asterisk marks a cell stained positive for Hes5 but not BrdU.

Hayes et al.

Page 15

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 4.

Mller glia proliferation and de-differentiation decrease when intraocular injections of DAPT are made early in the regeneration process. (A) Schematic diagram of injections made during experiment. (B-C) Retinal flatmounts stained with BrdU from chicks treated as shown in panel A, with either DMSO (B) or DAPT (C) at P2. Chicks were sacrificed on P8. Notice there is extensive proliferation in the DMSO injected retina, which has been decreased in the DAPT injected retina. (D) Quantification of proliferation. BrdU was quantitated from flattened confocal stacks from 3 different regions of 3 different birds using ImageJ software. (Error bars represent s.e.m., n = 3, *p = 0.05, one tail Mann-Whitney test). (E-I) Birds were treated as shown in A, with DMSO (E, F) or DAPT (G, H) at P2 and sacrificed 4 hours after BrdU
Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 16

injection. The percentage of BrdU positive cells that costain with Pax6 and BrdU is less in DAPT treated retinas than in DMSO treated retinas, indicating that DAPT treatment inhibits de-differentiation. Pax6 labeling is shown in green, BrdU in red. The arrows indicate Pax6, BrdU double-positive cells. In the DMSO treated retina, most BrdU positive cells were pax6 positive. The asterisks indicate BrdU positive cells that are not Pax6 positive. (I) Quantification of de-differentiation. Data graphed is the percent of BrdU and Pax6 double-labeled cells out of the BrdU labeled cells that are in the INL, OPL and ONL. (regions where de-differentiating Mller glia reside.) (Error bars represent s.e.m., n = 7, *p = 0.0364, one tail Mann-Whitney test)

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 17

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 5.

The number of newly generated neurons increases if DAPT is injected after Mller glia have de-differentiated. (A) Schematic diagram of injections made during experiment. Animals were sacrificed at P8. Sections were stained for (B) Hu (C) calretinin (D) islet (E) visinin and BrdU (B, C, D, E). Merged images (B, C, D, E) of neural markers and BrdU are shown. (F) Quantification of neurogenesis. DAPT treatment leads to more new neurons. Data graphed are the percent of BrdU and neural marker double-labeled cells out of BrdU labeled cells. (Error bars represent s.e.m., n = minimum 3, Hu *p = 0.0048, calretinin *p = 0.0333, islet *p = 0.0095, one tail Mann-Whitney test).

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Hayes et al.

Page 18

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Dev Biol. Author manuscript; available in PMC 2008 June 1.

Fig. 6.

The number of persisting progenitor-like cells decrease if DAPT is injected after Mller glia have de-differentiated. (A-H) Retinas were stained for Sox2 (red), BrdU (blue) and Pax6 (green). In the DMSO treated retinas (A-D), there are many Pax6, Sox2, and BrdU triple labeled cells. Arrows indicate examples of triple-labeled cell. In the DAPT treated retinas (E-H), there are less triple labeled cells. The asterisks indicate BrdU labeled cells that only stained for Sox2 but not Pax6. (I) Quantification of remaining progenitor-like cells. Data graphed is the percent of BrdU, Pax6, Sox2 triple-labeled cells out of BrdU labeled cells. (Error bars represent s.e.m., n = minimum of 4, *p = 0.0317, one tail Mann-Whitney test.)

Hayes et al.

Page 19

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 7.

DAPT can affect the regenerative process at two distinct phases. (A) Timecourse of regeneration. (B) Schematic of regeneration. A toxin, such as NMDA, causes Mller glia (black cells) to respond by proliferating (green cells) and de-differentiating in progenitor cells (pink cell). A subset of the progenitor cells differentiates into new neurons. (C) If DAPT is injected early, as Mller cells are dedifferentiating into progenitor cells, there is less dedifferentiation and proliferation, indicating that Notch signaling promotes this transition. (D) If DAPT is injected later, after Mller cells have dedifferentiated into progenitor cells, there are more newly generated neurons, indicating that Notch signaling may normally prohibits this transition.
Dev Biol. Author manuscript; available in PMC 2008 June 1.