Journal of Tics JOE 2010 Issue August

Clinical Research
Biolms and Apical Periodontitis: Study of Prevalence and Association with Clinical and Histopathologic Findings
Domenico Ricucci, MD, DDS,* and Jose F. Siqueira, Jr., DDS, MSc, PhD
Abstract
Introduction: This study evaluated the prevalence of bacterial biolms in untreated and treated root canals of teeth evincing apical periodontitis. The associations of biolms with clinical conditions, radiographic size, and the histopathologic type of apical periodontitis were also investigated. Methods: The material comprised biopsy specimens from 106 (64 untreated and 42 treated) roots of teeth with apical periodontitis. Specimens were obtained by apical surgery or extraction and were processed for histopathologic and histobacteriologic techniques. Results: Bacteria were found in all but one specimen. Overall, intraradicular biolm arrangements were observed in the apical segment of 77% of the root canals (untreated canals: 80%; treated canals: 74%). Biolms were also seen covering the walls of ramications and isthmuses. Bacterial biolms were visualized in 62% and 82% of the root canals of teeth with small and large radiographic lesions, respectively. All canals with very large lesions harbored intraradicular biolms. Biolms were signicantly associated with epithelialized lesions (cysts and epithelialized granulomas or abscesses) (p < 0.001). The overall prevalence of biolms in cysts, abscesses, and granulomas was 95%, 83%, and 69.5%, respectively. No correlation was found between biolms and clinical symptoms or sinus tract presence (p > 0.05). Extraradicular biolms were observed in only 6% of the cases. Conclusions: The overall ndings are consistent with acceptable criteria to include apical periodontitis in the set of biolminduced diseases. Biolm morphologic structure varied from case to case and no unique pattern for endodontic infections was identied. Biolms are more likely to be present in association with longstanding pathologic processes, including large lesions and cysts. (J Endod 2010;36:12771288)
n their natural habitats, microorganisms almost invariably live as members of metabolically integrated communities usually attached to surfaces to form biolms (1). The biolm community lifestyle provides microorganisms with a series of advantages and skills that are not observed for individual cells living in a free-oating (planktonic) state including establishment of a broader habitat range for growth; increased metabolic diversity and efciency; protection against competing microorganisms, host defenses, antimicrobial agents, and environmental stress; and enhanced pathogenicity (2). The study of microbial biolms assumes a great importance in different sectors of industrial, environmental, and medical microbiology. In medical microbiology, biolms have been increasingly studied and estimates indicate that biolm infections comprise 65% to 80% of the human infections in the developed world (3). As for the oral cavity, caries, gingivitis, and marginal periodontitis are examples of diseases caused by bacterial biolms in the form of supragingival or subgingival dental plaque. Mounting evidence indicates that apical periodontitis is also a biolm-induced disease (46). In situ investigations using optical and/or electron microscopy have allowed observations of bacteria colonizing the root canal system in primary or persistent/secondary infections as sessile biolms covering the dentinal walls (7 12). Apical ramications, lateral canals, and isthmuses connecting main root canals have all been shown to harbor bacterial cells, which are also frequently organized in biolm-like structures (1315). In addition, biolms adhered to the apical root surface (extraradicular biolms) have been reported and regarded as a possible cause of posttreatment apical periodontitis (16, 17). Although the concept of apical periodontitis as a biolm-induced disease has been built upon these observations, the prevalence of biolms and their association with clinical and histopathologic ndings have not yet been reported. Before this information becomes available, it may seem somewhat imprecise to generalize and categorize apical periodontitis as a biolm-induced disease. The purpose of the present study was twofold: (1) evaluate the prevalence of intraradicular and extraradicular bacterial biolms in untreated and treated root canals of human teeth evincing apical periodontitis through a histobacteriologic approach and (2) look for associations of biolms with some clinical conditions, radiographic size, and the histopathologic type of apical periodontitis lesions.
Materials and Methods

Clinical Specimens The material for this study consisted of sequential biopsies of roots or root tips together with surrounding apical periodontitis lesions. Specimens were part of the histologic collection of one of the authors (DR). The material comprised 106 roots from 100 human teeth. Of these, 58 were teeth with untreated root canals (6 incisors, 3 canines, 18 premolars, and 31 molars) from 52 patients (25 females, 27 males) aged 18 to 75 years (mean, 42 years). In total, 64 roots from untreated teeth were available, of which 59 were extracted with apical periodontitis lesions attached while in the other
Key Words
Apical periodontitis, bacterial biolm, endodontic infection, endodontic treatment
From *Private Practice, Rome, Italy; and Department of Endodontics, Faculty of Dentistry, Estacio de Sa University, Rio de Janeiro, Brazil. Address requests for reprints to Dr Domenico Ricucci, Piazza Calvario, 7, 87022 Cetraro (CS), Italy. E-mail address: dricucci@libero.it. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.007
JOE Volume 36, Number 8, August 2010
Biolms and Apical Periodontitis
1277
Clinical Research
TABLE 1. Prevalence of Intraradicular Biolms at the Apical Segment and Extraradicular Biolms in Untreated and Root Canaltreated Teeth According to the Histopathologic Type of Apical Periodontitis and Clinical Features
Untreated (%)
Untreated (%)
Tissue Processing Immediately after removal (by periradicular surgery or extraction), the biopsy specimen was immersed in 10% neutral-buffered formalin for at least 48 hours. Demineralization was performed in an aqueous solution consisting of a mixture of 22.5% (vol/vol) formic acid and 10% (wt/vol) sodium citrate for 3 to 4 weeks, with the endpoint being determined radiographically. All specimens were washed in running tap water for 24 to 48 hours, dehydrated in ascending grades of ethanol, cleared in xylene, inltrated, and embedded in parafn (melting point, 56 C) according to standard procedures. To produce sections parallel to the long axis of the root canal, special precautions were taken. Roots in multirooted teeth were dissected free and processed separately. If curved, roots were separated in two pieces, one encompassing the coronal two thirds and the other including the apical one third. These two pieces were embedded separately, but only the apical segment was evaluated in this study. With the microtome set at 4 to 5 mm, meticulous longitudinal serial sections were taken until each specimen was exhausted. For some specimens, cross-cut sections were taken. Every fth slide was stained with hematoxylin-eosin for screening purposes and for assessment of inammation. A modied Brown and Brenn technique for staining bacteria (20) was used for selected slides. The accuracy of the bacterial staining method was tested using the protocol described by Ricucci and Bergenholtz (21). Evaluation Criteria Slides were examined by two evaluators. Evaluations were performed separately, and whenever disagreement occurred, it was resolved by joint discussion. The following aspects were specically looked for in the examination: 1) the presence and location of bacteria in the apical segment of the root canal, including the main canal, lateral canals, apical ramications, and isthmuses (intraradicular infection) or within the body of the apical periodontitis lesion or adhered to the external apical root surface (extraradicular infection). The parameter used for classication of bacterial community structures as biolms followed the biolm denition given by Hall-Stoodley et al (22): Microbial biolms are populations of microorganisms that are concentrated
1278
Ricucci and Siqueira Jr.
Total (untreated + treated) (%)
Intraradicular biolm
Treated (%)
82/106 (77) 31/42 (74) 51/64 (80)
http://endodontic.ws
Overall prevalence Lesion type Granuloma, epithelialized Granuloma, nonepithelialized Cyst, true Cyst, pocket (bay) Cyst, unclassied Abscess, epithelialized Abscess, nonepithelialized Unclassied Sinus tract Symptoms JOE Volume 36, Number 8, August 2010
5/6 (83) 13/20 (65) 10/10 (100) 7/8 (87.5) 2/2 (100) 3/3 (100) 10/14 (71) 1/1 (100) 2/2 (100) 41/50 (82)
1/1 (100) 22/32 (69) 7/7 (100) 1/2 (50) 5/6 (83) 16/19 (84)
6/7 (86) 35/52 (67) 10/10 (100) 7/8 (87.5) 2/2 (100) 3/3 (100) 17/21 (81) 2/3 (67) 7/8 (87.5) 57/69 (83)
0/6 (0) 1/20 (5) 0/10 (0) 2/8 (25) 1/2 (50) 0/3 (0) 0/14 (0) 0/1 (0) 1/2 (50) 4/50 (8)
4/64 (6)
ve specimens lesions had to be removed separately. All untreated teeth had necrotic pulps and gross carious lesions and were extracted because they were judged unrestorable or the patient did not agree to save the tooth. Records were made of any symptoms that the patient experienced or was experiencing in relation to the affected tooth. The presence/absence of a sinus tract was also recorded. For 33 teeth, conventional periapical radiographs were available before extraction, and the largest diameter of the periradicular radiolucency was measured. Teeth with periodontal pockets or longitudinal fractures or cracks involving the root were excluded from analysis. Some of the examined teeth were included in previous studies (18, 19). The 42 biopsies of roots/root tips from root canal-treated teeth were from 42 patients, 24 (12 symptomatic and 12 asymptomatic) of which took part in a recent publication (10) and were re-evaluated in this study for the presence of biolms following the parameters established herein (see later). All 42 cases were categorized as treatment failures on the basis of clinical and/or radiographic follow-ups, after a minimum recall period of 4 years for the asymptomatic cases and 1 year for the symptomatic ones. For 10 of the new cases, the quality of previous endodontic treatment was judged as inadequate. Radiographs were not available for four of the new 18 cases. All patients had given consent for examination of their teeth.
Total (untreated + treated) (%)
Extraradicular biolm
Treated (%)
6/106 (6) 2/42 (5)
0/1 (0) 1/32 (3) 1/7 (14) 0/2 (0) 2/6 (33) 2/19 (10.5)
0/7 (0) 2/52 (4) 0/10 (0) 2/8 (25) 1/2 (50) 0/3 (0) 1/21 (5) 0/3 (0) 3/8 (37.5) 6/69 (9)
Clinical Research
at an interface and typically surrounded by an extracellular polymeric substance matrix. Also, according to these authors, aggregates or coaggregates of bacterial cells not apparently attached to the surface were classied as ocs; and 2) the presence and distribution of acute and chronic inammatory cells and epithelium in the inamed periradicular tissues; lesions were diagnosed histologically as follows: apical abscess (epithelialized or nonepithelialized), granuloma (epithelialized or nonepithelialized), or cyst (true, pocket, or unclassied; the latter diagnosis was made when the lesion showed a cavity lined by epithelium, but the soft tissue did not remain attached to the root tip and had to be removed separately).
Statistical Analysis The Fisher exact test or the chi-square test was used to check for associations of intraradicular biolms with the following parameters: radiographic size of the apical periodontitis lesion (grouped as lesions #5 mm and >5 mm), histopathologic general type of apical periodontitis (granuloma, cysts, and abscesses with no distinction of subtypes), presence and absence of epithelial proliferation (irrespective of the lesion type), sinus tract, and symptoms. Every analysis took into consideration only untreated root canals, only treated canals, and all specimens together. The prevalence of biolms in untreated and treated teeth was also compared by the chi-square test.
Results
Biolm Overall Prevalence Bacteria were found in all specimens, except for one asymptomatic root canaltreated tooth in which disease emerged probably because of a foreign body reaction. This case was reported in a previous study (10). Overall, bacterial arrangements as intraradicular biolms were observed in the apical segment of 82 of 106 (77%) root canals. Of these, 51 of 64 (80%) were from untreated canals and 31 of 42 (74%) from treated canals (Table 1). This difference was not statistically signicant (c2, p = 0.6).
Morphologic Description of Bacterial Colonization Intraradicular bacterial biolms were usually thick and composed of several layers of bacterial cells. At high magnication, three basic bacterial cell morphologies could be recognized in most cases: cocci, rods, and laments (Figs. 1a and b, 2c and d, 3c and d, 4d, and 5c and d). These morphotypes were often present together in varied proportions in the same biolm. However, a single morphotype appeared to dominate each biolm (Figs. 1a and b, 2c and d, 3c, 4d, and 5c and d). In the biolm structure, the proportion between bacterial cells and extracellular matrix was highly variable. In some instances, bacterial cells appeared so clumped that the extracellular component was virtually not visible (Figs. 2d and 5c and d). In other cases, the extracellular matrix was abundant, and less bacterial cells were seen distributed in an uneven pattern (Figs. 1a and b, 2c, 3c, and 4c and d). In many biolms, cells were abundant in the deepest layers (Figs. 1a and 4c). In some other cases, however, they were prevalent in the most supercial layers. In many specimens, multilayered biolms covered uniformly the root canal walls to a long extent. In some cases, opposite root canal walls covered by biolms were faced with necrotic debris or inammatory cells in the canal lumen (Figs. 3b and 5b). In teeth with severe caries destruction and longstanding pulp necrosis, the observation that the entire apical canal was lled by a dense biolm was not uncommon. In some instances, however, although some areas of the canal were completely covered by biolms, others were apparently free from bacterial colonization (Fig. 2g). This pattern was more commonly observed in treated root canals but also seen in a few untreated specimens. In some instances, bacterial colonization was restricted to the root canal wall surface, and no deep dentinal invasion was observed. This was probably because of the reduced number and small diameter or even the lack of dentinal tubules in certain regions of the apical root segment (Figs. 1a and b, 2c and d, and 3c). However, when dentinal tubules were present and abundant, they usually appeared colonized by bacteria spreading from the biolm and penetrating at varying depths (Fig. 6a and b).
Figure 1. Examples of intracanal biolms with different bacterial cell morphologies. (a) The predominance of cocci. Note the high concentration of cells in contact with the root canal wall (Taylors modied Brown and Brenn, original magnication 1,000). (b) Predominance of lamentous forms. Note the irregular distribution of bacterial cells within the extracellular material (original magnication 1,000).
1279
Clinical Research
Figure 2. (a) Mandibular molar with the crown destroyed by a gross carious process and a radiolucency around the mesial root assessed as >5 mm. Several exacerbations developed over the previous months, but the tooth was asymptomatic at the time of extraction. (b) Sections were taken on a mesiodistal plane. The section passing through the apical third of the mesiobuccal canal. The lumen appears partly lled by large fuchsin-stained bodies, likely food remnants (large vegetable cells). More apically the walls appeared covered by a dense bacterial biolm (Taylors modied Brown and Brenn, original magnication 100). (c) High magnication of the area of the root canal wall indicated by the left arrow in b. Rods are the prevailing bacterial morphotype at this level (original magnication 1,000). (d) High magnication of the area of the root canal wall indicated by the right arrow in b. The high bacterial population density seems to obscure the extracellular matrix. Note the polymorphonuclear neutrophils in contact with the biolm surface (original magnication 1,000). (e) Cross-cut section taken at the transition between the apical and the middle third of the mesial root. The low-magnication overview shows that the two mesial canals are connected by a wide isthmus, clogged with bacteria (original magnication 8). (f) Detail of the isthmus. Its lumen is lled by a dense biolm (original magnication 100). (g) Magnication of the left canal in e. The majority of the root canal circumference is covered by a bacterial biolm (original magnication 100).
One of the untreated teeth exhibited an unusual pattern of intracanal bacterial colonization and deserves a more detailed description. It is a maxillary rst premolar from a 58-year-old man. The patient reported several pain episodes, and the tooth, judged nonrestorable because of gross coronal destruction, was extracted. Sections passing through the buccal canal showed that the apical canal lumen was clogged with necrotic debris and bacteria (Fig. 7a). At the center of the main root canal, a large bacterial oc composed of ramifying lamentous bacterial cells was present and surrounded by a distinct layer of an amorphous material (Fig. 7b-d). Bacteria appeared particularly condensed in this structure, and at the periphery they exhibited a starburst appearance 1280
typical of actinomycotic colonies (Fig. 7c and d). Serial sections revealed that this large colony was not contiguous with the root canal walls. Actually, it was apparently free oating in the root canal lumen, enmeshed in the remainder of the canal content. This case has been assessed as showing a biolm, not because of the unusual large oc suspended in the canal, which according to the denition criteria used herein cannot be strictly assessed as a biolm, but rather because the bacterial condensations present more apically were clearly adhered to the root canal walls forming a biolm-like structure (Fig. 7b). Biolms were also seen covering the walls of apical ramications, lateral canals, and isthmuses in both untreated and treated canals. In
http://endodontic.ws
Clinical Research
Figure 3. Grossly carious single-rooted mandibular second molar extracted with the apical periodontitis lesion attached. The radiographic size of the lesion was <5 mm (inset). The tooth was symptomatic. (a) The section passing approximately at the center of the foramen. The overview shows granulomatous tissue ingrowth at the very apical canal (Taylors modied Brown and Brenn, original magnication 16). (b) Detail of the apical foramen region. A biolm is present covering the root canal walls, and a dense bacterial aggregate is evidenced more coronally. Empty spaces are shrinkage artefacts (original magnication 100). (c) Higher magnication of the area demarcated by the rectangle in b. Bacterial lamentous forms prevail, and the extracellular component is abundant at this level (original magnication 400). (d) Higher magnication of the bacterial aggregate indicated by the arrow in b. Different morphotypes are present. Note the concentration of polymorphonuclear neutrophils in contact with the biolm surface (original magnication 400).
some untreated canals, bacteria in the form of biolms or ocs did not reach the apical foramen because vital inamed tissue was observed occupying the very apical canal. In these cases, the front of infection was located some millimeters short of the foramen. Small bacterial ocs and planktonic cells were found in virtually all specimens including those negative for the presence of biolms. Flocs and planktonic cells were usually observed in the lumen of the main canal, ramications, and isthmuses, either apparently oating or more commonly enmeshed in the necrotic pulp tissue.
Association with Diverse Conditions Radiographs available for 71 specimens were used to check for an association between intraradicular biolms and the radiographic size of apical periodontitis. Bacterial biolms were visualized in 23 of 37 (62%) root canals with small lesions (#5 mm), whereas in specimens with large lesions (>5 mm), biolm structures were present in 28 of 34 (82%) (Table 2). Statistical analysis disclosed a p value very close to the level of signicance used (c2, p = 0.059). Specically for untreated canals, the prevalence of intraradicular biolms was 59% and 87.5%
1281
Clinical Research
Figure 4. (a) Maxillary second premolar with a periapical radiolucency whose diameter was measured >5 mm. The tooth was extracted in the presence of clinical symptoms (pain and swelling). (b) The apical periodontitis lesion remained attached to the root tip. Section passing through the main wide apical foramen (Taylors modied Brown and Brenn, original magnication 16). (c) Detail of the foramen area. A biolm is present in the most apical canal, faced with inammatory tissue. Note the resorption of the canal walls (original magnication 100). The inset shows PMNs from the center of the lesion, one of which exhibits a cytoplasm engulfed with several bacterial fragments (original magnication 1,000). (d) Higher magnication of the area from the cementum fragment indicated by the arrow in c. Bacterial lamentous forms are dominant at this level. The biolm is surrounded by PMNs (original magnication 400).
for specimens with small and large lesions, respectively. Biolms in treated teeth were disclosed in 65% and 78% of the canals with small and large lesions, respectively. All ve canals associated with lesions larger than 10 mm harbored intraradicular biolms (Table 2). Regarding the histopathologic diagnosis, intraradicular biolms were signicantly associated with epithelialized lesions (cysts and epithelialized granulomas or abscesses) (Fisher test, p < 0.001). Of the 30 lesions exhibiting epithelial proliferation, 28 (93%) were associated with intraradicular biolms. Although canals associated with epithelialized or nonepithelialized granulomas exhibited intraradicular biolms in 86% and 67%, respectively, this 20% difference did not reach signif1282
icance for the sample size evaluated (Fisher test, p = 0.4). When lesions were grouped as granulomas (epithelialized or not), abscesses (epithelialized or not), and cysts (true, pocket, and unclassied), intraradicular biolms were found signicantly more frequently in cysts than in granulomas (Fisher test, p = 0.03). Actually, only one out of the 20 (5%) cystic lesions was negative for the presence of intraradicular biolms. No other signicant differences were observed for lesion types (p > 0.05). The overall prevalence of biolms in granulomas was 41 of 59 (69.5%), and in abscesses it was 20 of 24 (83%). In general, ndings from separate analysis of untreated canals were similar to the overall ndings. Because cysts were not observed in association with root
Clinical Research
Figure 5. (a) Mandibular second premolar extracted after several pain episodes. The apical periodontitis lesion remained attached to the root tip at extraction. The section passing approximately at the center of the root canal. The overview discloses a severely resorbed root apex. The canal appears lled with tissue, and there are two bacterial masses on the opposite root canal walls (Taylors modied Brown and Brenn, original magnication 16). (b) Higher magnication of the apical canal. The bacterial masses were biolm structures. The canal lumen is lled with inammatory cells (original magnication 100). (c and d) Higher magnication of the left and right biolm structures respectively. Both were apparently exclusively composed of the bacterial lamentous morphotype. A severe inammatory reaction surrounded these bacterial biolms (original magnication 400).
canaltreated teeth, statistical analysis was not performed separately for data from treated canals. Intraradicular biolms were found in seven of the eight (87.5%) specimens associated with a sinus tract and in 57 of 69 (83%) of the symptomatic cases (Table 1). However, despite the high prevalence, these values were not statistically signicant when compared with cases with no sinus tract (75/98, 76.5%) (Fisher test, p = 0.7) and no symptoms (25/37, 68%) (c2, 0.08). No signicance was found for data from untreated canals and treated canals when examined separately (p > 0.05). Extraradicular bacterial biolms were observed in only six specimens (6%), four from untreated canals and two from treated canals. All these specimens were associated with clinical symptoms. Of the eight cases with sinus tracts, extraradicular biolms were detected in three (37.5%). In all but one of the cases, the extraradicular biolm was asso-
ciated with an intraradicular biolm. Two of these extraradicular biolms showed areas of mineralization with a calculus-like appearance (Fig. 8).
Discussion
Determination that a given human infectious disease is caused by biolms is not an easy task. Difculties may be related to several reasons, including the coexistence of biolm and planktonic bacteria in many infections, the absence of a denitive marker for bacteria forming biolms, and the loss of the biolm phenotype when subject to sampling and culturing procedures (23). By taking such difculties into account, Parsek and Singh (23) proposed the following criteria to dene infections caused by biolms: (1) the infecting bacteria are adhered to or associated with a surface (associated with implies 1283
Clinical Research
Figure 6. Maxillary lateral incisor with a large periapical radiolucency (>5 mm) (inset). (a and b) The section taken at the transition between the apical and the middle third showing a bacterial biolm covering the dentinal walls. The dentinal tubules subjacent to the biolm are heavily invaded and colonized to varying depths (Taylors modied Brown and Brenn, original magnication 100 and 400).
that aggregates/coaggregates do not need to be rmly attached); (2) direct examination of infected tissue shows bacteria forming clusters or microcolonies encased in an extracellular matrix, which may be of bacterial or host origin; (3) the infection is generally conned to a particular site, and although dissemination may occur, it is a secondary event; and (4) the infection is difcult or impossible to eradicate with antibiotics despite the fact that the responsible microorganisms are susceptible to killing in the planktonic state. The following criterion was further added by Hall-Stoodley and Stoodley (24): (5) ineffective host clearance evidenced by the location of bacterial colonies in discrete areas in the host tissue associated with host inammatory cells. According to this last criterion, evidence of polymorphonuclear neutrophils (PMNs) and macrophages surrounding bacterial aggregates/ coaggregates in situ considerably increases the suspicion of biolm involvement with disease causation. We propose the following sixth criterion: the elimination or signicant disruption of the biolm structure and ecology leads to remission of the disease process. Although there are recognized limitations to these criteria, it is assumed that they provide general characteristics that allow for considering the role of biolms in the pathogenesis of a certain human disease (24). The present ndings showing biolm structures in the great majority of cases of primary (80%) and posttreatment (74%) apical periodontitis along with the observed morphological features of these biolms seem to fulll four of the six criteria. Although adhesion and strength of adhesion cannot be measured by the methods used in the present study, the bacterial agreggates/coaggregates were observed to at least be associated with the root canal dentin surface (criterion 1). Bacterial colonies were seen in the huge majority of the specimens encased in an amorphous extracellular matrix whose origin was, however, not possible to determine (criterion 2). Endodontic biolms were often conned to the root canal, in a few cases extending to the external root surface, but dissemination through the lesion never occurred (criterion 3). In the great majority of cases, biolms were directly faced by inam1284
matory cells in the very apical canal, in ramications, and in isthmuses (criterion 5). Criterion 4 was not assessed in this study, but it is widely known that intraradicular endodontic infections are not treatable by systemic antibiotics, even though most endodontic bacteria are susceptible to currently used antibiotics (25). The problem with using systemic antibiotics is related to the fact that endodontic infection occurs in an avascular space with restricted access to antibiotics, but the recognition of endodontic infections as biolm infections still strengthens the explanations for antibiotic ineffectiveness. As for criterion 6 proposed in this study, effects of treatment on biolms and how they inuence the treatment outcome were not evaluated herein and await further investigations in a longitudinal experimental design. Nonetheless, the frequent observation of biolms in treated canals with posttreatment disease may at least suggest that there is a potential for fulllment of this criterion. The apical root canal can be regarded as a critical territory for pathogenetic and therapeutic reasons (26). This is because bacteria located at the apical canal of teeth with apical periodontitis are in such a strategic position that they may be regarded as the most important infective agents related to the disease pathogenesis. With this in mind, the present study restricted the investigation of biolm prevalence to the apical root canal system. The very high prevalence of intraradicular biolms may be related to the fact that bacteria in the apical canal compose the advanced front of infection and then directly face an inamed tissue area. Inammatory exudate seeps into the apical canal to create a uid phase and provide bacteria with nutrients in the form of glycoproteins and proteins. This may represent optimal conditions for biolm formation and help explain the many exuberant biolms observed in the apical canal, especially in primary endodontic infections in which the untreated root canal may afford more space for exudate seepage and stagnation into the canal. Overall, intraradicular biolms were 20% more frequent in teeth with large radiographic lesions than in those with small lesions. All root
Clinical Research
Figure 7. (a) Untreated maxillary rst premolar extracted with the apical periodontitis lesion attached to the root tip. The longitudinal section passing approximately through the center of the buccal canal. Ingrowth of granulomatous tissue is evident at the apical foramen (Taylors modied Brown and Brenn, original magnication 16). (b) Detail of the apical root canal showing the bacterial content. A large bacterial oc exhibiting a high bacterial density and surrounded by amorphous material can be distinguished at the center of the canal lumen. Empty spaces are artifacts (original magnication 100). (c and d) Higher magnication of the upper and the lower halves of the oc in b. A great amount of intertwining laments radiating at the periphery and projecting into a distinct extracellular surround is discernible. Note the totally different arrangement of the bacterial populations outside the oc (original magnication 400).
canals associated with very large lesions (>10 mm) were found to harbor intraradicular biolms. Large lesions have been associated with complex intraradicular infections characterized by bacterial communities with increased species richness and high populational density (27, 28). Because it takes time for apical periodontitis to develop and become radiographically visible, it is conceivable to assume that large lesions represent a longstanding pathologic process caused by an even older intraradicular infection. In a longstanding infectious process, involved bacteria may have had enough time and conditions to adapt to the environment and set a mature and organized biolm community. The fact that infected root canals of teeth with large lesions harbor a large number of cells and species almost always organized in biolms may help explain the long-held concept that the treatment outcome may be inuenced by the lesion size (29).
The present study revealed that intraradicular biolms were significantly more frequent in root canals of teeth with epithelialized lesions (cysts and epitheliazed granulomas or abscesses). Ninety-three percent of the lesions exhibiting some level of epithelial proliferation were in
TABLE 2. Prevalence of Intraradicular Biolms at the Apical Segment of Untreated and Treated Canals of Teeth with Apical Periodontitis According to the Lesion Size as Determined Radiographically Lesion size
#5 mm >5 mm $10 mm*
Untreated (%)
10/17 (59) 14/16 (87.5) 2/2 (100)
Treated
13/20 (65) 14/18 (78) 3/3 (100)
Total (untreated + treated)

23/37 (62) 28/34 (82) 5/5 (100)
*These specimens were also included in the group >5 mm.
1285
Clinical Research
association with root canals colonized by bacterial biolms. As for the lesion histopathologic type, intraradicular biolms were signicantly more detected in cases diagnosed as cysts (95% as compared with 69.5% in granulomas and 83% in abscesses). Because apical cysts develop as a result of epithelial proliferation in some granulomas (30), it is reasonable to assume that the older the apical periodontitis lesion, the greater the probability of it becoming a cyst. Similar to teeth with large lesions, the age of the pathologic process may also help explain the higher prevalence of biolms in association with cysts. Extraradicular bacterial biolms were found in only six specimens, and except for one case they were always associated with intraradicular biolms. This low prevalence of extraradicular biolms is in accordance with previous studies (10, 31). These ndings also suggest that extraradicular biolms are usually maintained by intraradicular infection. All cases showing an extraradicular biolm exhibited clinical symptoms, and three of them were associated with sinus tracts. In abscesses, individual bacterial cells were seen within the inamed periradicular tissue and commonly being phagocytosed by PMNs (Fig. 4a). These ndings indicate that extraradicular infections in the form of biolms or planktonic bacteria are not a common occurrence, are usually dependent on the intraradicular infection, and are more frequent in symptomatic teeth. Similar to other studies, bacteria were also seen in the lumen of the main canal, ramications, and isthmuses as ocs and planktonic cells, either intermixed with necrotic pulp tissue or possibly suspended in a uid phase. Bacterial ocs in clinical specimens may have originated
Figure 8. Maxillary premolar with clinically necrotic pulp and a sinus tract buccally. No periodontal pockets were disclosed at probing. The largest diameter of the lesion on the radiograph was >5 mm (inset). (a and b) After extraction, calculus is observed covering exclusively the root apex. The apical periodontitis lesion did not remain attached to the root tip and was removed separately. (c) The section taken on a mesiodistal plane not passing through the main foramen. The apical external surface is covered by a bacterial biolm (Taylors modied Brown and Brenn, original magnication 16). (d) Higher magnication of the area indicated by the upper left arrow in c. Biolm with high bacterial density (original magnication 400). (e) Higher magnication of the area indicated by the lower left arrow in c. A dense biolm with a prevalence of lamentous morphotypes. Note the area apparently free of bacterial cells, which may be likely a focus of calcication (original magnication 1,000). (f) Higher magnication of the area from the external radicular prole indicated by the right arrow in c. The biolm is mineralized with relatively few bacteria (original magnication 1,000).
1286
Clinical Research
from the growth of cell aggregates in a uid or they may have detached from biolms (24). Flocs may exhibit many of the same characteristics as biolms (22) and along with planktonic bacteria have been suggested to play a role in the pathogenesis of acute clinical forms of apical periodontitis (5). The ability of endodontic bacteria to organize themselves in biolm communities is of great therapeutic interest in endodontics. Although bacteria present as ocs and planktonic cells in the main root canal may be easily accessed and eliminated by instruments and substances used during treatment, those organized in biolms attached to the canal walls or located into isthmuses and ramications are denitely more difcult to reach. Many bacteria under the biolm were seen invading dentinal tubules (Fig. 6), which also pose a problem for disinfection. Some biolm-covered walls of the main canal may remain untouched by instruments, which is especially true when the root canal is irregular, attened, or oval in cross-section (3234) (Fig. 2e and f). Biolm remnants were observed on the root canal walls of treated teeth in the present study. This study conrmed that isthmuses, lateral canals, and apical ramications can be clogged with bacteria, including in treated teeth (1315). These areas are not expected to be reached by instruments and antimicrobial irrigants. Even in the event that antimicrobial agents reach the biolm, this is no guarantee of successful antimicrobial activity because bacteria arranged in biolms exhibit increased resistance to antimicrobials (35, 36). Biolms were classied morphologically as described by HallStoodley et al (22) in a comprehensive review on the subject. A very similar denition is provided by Costerton in his biolm primer(1). A biolm is a multicellular community composed of prokaryotic and/ or eukaryotic cells embedded in a matrix composed, at least partially, of material synthesized by the sessile cells in the community. There are obviously some features associated with biolms such as differential genetic expression and the presence of water and nutrient channels in the matrix that could not be evaluated by the method used in this study. However, biolms signicantly differ in structure according to the overall physical, chemical, and biological features of the environment (1, 3739). For instance, in an environment where there is low shear force related to the passage of uid or air, a strong adhesion to the surface is not made necessary. Promoting such adhesion would represent energy waste for the community. Therefore, our morphologic ndings support the inclusion of apical periodontitis in the set of biolm-induced diseases. Further studies are required to compare the main structural and physiologic features of endodontic biolms to other biolms in nature. It is reasonable to surmise that the unique root canal environmental conditions are expected to inuence the biolm structure and function to the point of giving rise to endodontic biolms with typical features. However, although limited in resolution power, our study failed to show any specic morphological pattern for endodontic biolms. Actually, endodontic biolm morphology differed consistently from individual to individual, and the reasons for that deserve further investigations but may be conceivably related to different species composition and resulting interactions, type and availability of nutrients, and time of infection. Although a very high prevalence of biolms was observed in teeth with apical periodontitis, the possibility exists that the gures reported in this study still represent an underestimation. Some root canal contents may have been washed away during histological processing because of the numerous chemical solutions, and gram-negative bacteria may sometimes be overlooked by the method used. Even considering these limitations, the very high prevalence of biolms as reported in this study indicates that when properly and meticulously performed, conventional parafn techniques and so-called old bacterial staining protocols are still valuable tools for studying bacterial colonization of the root canal system. In conclusion, the present study revealed a very high prevalence of bacterial biolms in the apical root canals of both untreated and treated teeth with apical periodontitis. The pattern of bacterial community arrangement in the canal, which adhered to or at least was associated with the dentinal walls with cells encased in an extracellular amorphous matrix and often surrounded by inammatory cells, is consistent with acceptable criteria to include apical periodontitis in the set of biolm-induced disease. Biolm morphologic structure varied from case to case, and no unique pattern for endodontic infections was determined. Bacterial biolms are still more expected to be present in association with longstanding pathologic processes, including large lesions and cysts.
References
1. Costerton JW. The biolm primer. Berlin, Heidelberg: Springer-Verlag; 2007. 2. Marsh PD. Dental plaque: biological signicance of a biolm and community lifestyle. J Clin Periodontol 2005;32(suppl 6):715. 3. Costerton B. Microbial ecology comes of age and joins the general ecology community. Proc Natl Acad Sci U S A 2004;101:169834. 4. Chavez de Paz LE. Redening the persistent infection in root canals: possible role of biolm communities. J Endod 2007;33:65262. 5. Siqueira JF Jr, Rocas IN. Community as the unit of pathogenicity: an emerging concept as to the microbial pathogenesis of apical periodontitis. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2009;107:8708. 6. Svensater G, Bergenholtz G. Biolms in endodontic infections. Endod Topics 2004; 9:2736. 7. Nair PNR. Light and electron microscopic studies of root canal ora and periapical lesions. J Endod 1987;13:2939. 8. Siqueira JF Jr, Rocas IN, Lopes HP. Patterns of microbial colonization in primary root canal infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2002; 93:1748. 9. Molven O, Olsen I, Kerekes K. Scanning electron microscopy of bacteria in the apical part of root canals in permanent teeth with periapical lesions. Endod Dent Traumatol 1991;7:2269. 10. Ricucci D, Siqueira JF Jr, Bate AL, et al. Histologic investigation of root canal-treated teeth with apical periodontitis: a retrospective study from twenty-four patients. J Endod 2009;35:493502. 11. Carr GB, Schwartz RS, Schaudinn C, et al. Ultrastructural examination of failed molar retreatment with secondary apical periodontitis: an examination of endodontic biolms in an endodontic retreatment failure. J Endod 2009;35:13039. 12. Schaudinn C, Carr G, Gorur A, et al. Imaging of endodontic biolms by combined microscopy (FISH/cLSM - SEM). J Microsc 2009;235:1247. 13. Nair PN, Henry S, Cano V, et al. Microbial status of apical root canal system of human mandibular rst molars with primary apical periodontitis after one-visit endodontic treatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005; 99:23152. 14. Ricucci D, Siqueira JF Jr. Apical actinomycosis as a continuum of intraradicular and extraradicular infection: case report and critical review on its involvement with treatment failure. J Endod 2008;34:11249. 15. Ricucci D, Siqueira JF Jr. Fate of the tissue in lateral canals and apical ramications in response to pathologic conditions and treatment procedures. J Endod 2010;36: 115. 16. Tronstad L, Barnett F, Cervone F. Periapical bacterial plaque in teeth refractory to endodontic treatment. Endod Dent Traumatol 1990;6:737. 17. Ferreira FB, Ferreira AL, Gomes BP, et al. Resolution of persistent periapical infection by endodontic surgery. Int Endod J 2004;37:619. 18. Ricucci D, Pascon EA, Pitt Ford TR, et al. Epithelium and bacteria in periapical lesions. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;101:23949. 19. Ricucci D, Mannocci F, Pitt Ford TR. A study of periapical lesions correlating the presence of a radiopaque lamina with histological ndings. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;101:38994. 20. Taylor RD. Modication of the Brown and Brenn Gram stain for the differential staining of gram-positive and gram-negative bacteria in tissue sections. Am J Clin Pathol 1966;46:4726. 21. Ricucci D, Bergenholtz G. Bacterial status in root-lled teeth exposed to the oral environment by loss of restoration and fracture or cariesa histobacteriological study of treated cases. Int Endod J 2003;36:787802. 22. Hall-Stoodley L, Costerton JW, Stoodley P. Bacterial biolms: from the natural environment to infectious diseases. Nat Rev Microbiol 2004;2:95108.
1287
Clinical Research
23. Parsek MR, Singh PK. Bacterial biolms: an emerging link to disease pathogenesis. Annu Rev Microbiol 2003;57:677701. 24. Hall-Stoodley L, Stoodley P. Evolving concepts in biolm infections. Cell Microbiol 2009;11:103443. 25. Baumgartner JC, Xia T. Antibiotic susceptibility of bacteria associated with endodontic abscesses. J Endod 2003;29:447. 26. Siqueira JF Jr. Reaction of periradicular tissues to root canal treatment: benets and drawbacks. Endod Topics 2005;10:12347. 27. Sundqvist G. Bacteriological studies of necrotic dental pulps [Odontological Disser tation no.7]. Umea, Sweden: University of Umea; 1976. 28. Rocas IN, Siqueira JF Jr. Root canal microbiota of teeth with chronic apical periodontitis. J Clin Microbiol 2008;46:3599606. 29. Strindberg LZ. The dependence of the results of pulp therapy on certain factors. Acta Odontol Scand 1956;14(suppl 21):1175. 30. Lin LM, Ricucci D, Lin J, et al. Nonsurgical root canal therapy of large cyst-like inammatory periapical lesions and inammatory apical cysts. J Endod 2009;35: 60715. 31. Siqueira JF Jr, Lopes HP. Bacteria on the apical root surfaces of untreated teeth with periradicular lesions: a scanning electron microscopy study. Int Endod J 2001;34: 21620. 32. Siqueira JF Jr, Araujo MC, Garcia PF, et al. Histological evaluation of the effectiveness of ve instrumentation techniques for cleaning the apical third of root canals. J Endod 1997;23:499502. 33. Wu M-K, van der Sluis LWM, Wesselink PR. The capability of two hand instrumentation techniques to remove the inner layer of dentine in oval canals. Int Endod J 2003;36:21824. 34. Paque F, Balmer M, Attin T, et al. Preparation of oval-shaped root canals in mandibular molars using nickel-titanium rotary instruments: a micro-computed tomography study. J Endod 2010;36:7037. 35. Mah TF, OToole GA. Mechanisms of biolm resistance to antimicrobial agents. Trends Microbiol 2001;9:349. 36. Chavez de Paz LE, Bergenholtz G, Svensater G. The effects of antimicrobials on endodontic biolm bacteria. J Endod 2010;36:707. 37. Stoodley P, Dodds I, Boyle JD, et al. Inuence of hydrodynamics and nutrients on biolm structure. J Appl Microbiol 1999;85:S1928. 38. Purevdorj B, Costerton JW, Stoodley P. Inuence of hydrodynamics and cell signaling on the structure and behavior of Pseudomonas aeruginosa biolms. Appl Environ Microbiol 2002;68:445764. 39. Paramonova E, Kalmykowa OJ, van der Mei HC, et al. Impact of hydrodynamics on oral biolm strength. J Dent Res 2009;88:9226.
1288
Clinical Research
The Operating Microscope Enhances Detection and Negotiation of Accessory Mesial Canals in Mandibular Molars
Meric Karapinar-Kazandag, DDS, PHD,* Bettina R. Basrani, DDS, PhD, and Shimon Friedman, DMD
Abstract
Introduction: Detection and negotiation of accessory mesial canals in mandibular molars was investigated with the aid of magnifying loupes or the operating microscope. Methods: First and second mandibular molars (n = 96) were mounted in mannequins. Three independent investigators (endodontists) prepared access cavities using 4.5 loupes, attempting to detect and negotiate accessory mesial canals with ultrasonic instruments. If detection or negotiation was unsuccessful, the procedure was continued using the microscope. The location of accessory mesial canals was mapped in relation to the main mesial canals, and their pathway shown with inserted les. The mesial roots were cross-sectioned at three levels to inspect for nonnegotiated accessory mesial canals. Results: With the microscope, the number of detected accessory mesial canals increased from 8 (16%) to 9 (18%) in rst molars and from 8 (16%) to 11 (22%) in second molars. Negotiated accessory mesial canals increased from 6 (12%) to 7 (14%) and from 5 (10%) to 9 (18%) in the rst and second molars, respectively. All 20 detected accessory mesial canals were located in the mesial subpulpal groove, closer to the mesiolingual canal (45%), in the middle (30%), or closer to the mesiobuccal canal (25%). All negotiated accessory mesial canals merged with one of the main two canals. Cross-sections of the roots conrmed that no accessory canals were present in addition to those negotiated. Conclusions: Within the limitations of this study, more accessory canals were detected and negotiated when using the microscope compared with loupes. This improvement was more pronounced in second molars than in rst molars. All negotiated accessory canals merged with either one of the main mesial canals. (J Endod 2010;36:12891294)
he recent inux of current technologies intended for endodontic treatment has been focused largely on improving the quality of treatment. The primary example of this trend has been the introduction to endodontics of the operating microscope, widely accepted as a benecial aid in improving clinicians ability to detect root canals (1, 2), particularly in teeth in which accessory canals are present. Several investigations have supported the advantage of the microscope over the use of no magnication (39). When compared with magnifying loupes, the microscope was either comparable (9) or superior (7). For the test model, researchers have used the frequently present but often elusive accessory canal in the mesiobuccal (MB) root of maxillary molars (4, 610). According to Gorduysus et al (6), clinicians did not detect more accessory canals in maxillary molars with the aid of the microscope, but their ability to negotiate the canals improved by over 10% when compared with no magnication. One of the teeth with a complex root canal system is the mandibular molar, as shown in the early work of Hess and Zurcher (11) and in subsequent investigations (5, 1225). The mesial root in mandibular molars is commonly considered to have two canals (1113) with an isthmus in between (14, 16, 21, 24, 2628). Within this system, the presence of an accessory mesial canal has been identied with a prevalence ranging from 0% to 17% (5, 1222, 24, 25) (Table 1). The discrepancy between the studies has been attributed to ethnicity (29), age (28, 30), and sex (23). Although the location of the accessory mesial canal orice has been reported closer to the mesiolingual (ML) canal (5), its pathway converges with either the ML(15) canal or the MB canal (17, 18). When explored with the aid of the operating microscope, an accessory mesial canal was detected in 17% of rst molars and under 5% of second molars compared with 0% when no magnication was used (5). Apart from the prevalence, the ability to negotiate the detected accessory mesial canals, including the troughing depth required to enable negotiation, has not been well characterized. The primary purpose of this study was to assess the ability to detect and negotiate the accessory mesial canals in mandibular rst and second molars, with the aid of magnifying loupes and the microscope. The secondary goal was to characterize the detected canals with regard to prevalence, location, negotiability, and pathway.
Methods
This study methodology was modeled after a previous study on maxillary molars (6). Mandibular rst and second molars were collected from oral surgery clinics in Istanbul, Turkey, and exposed on periapical radiographs in the buccolingual direction. After exclusion of molars with previous endodontic treatment, a decient coronal
Key Words
Accessory canals, magnifying loupes, mandibular molars, operating microscope
From the *Department of Endodontics Faculty of Dentistry, Yeditepe University, Istanbul, Turkey; and Discipline of Endodontics, Faculty of Dentistry, University of Toronto, Toronto, Ontario, Canada. Address requests for reprints to Dr Meric Karapinar-Kazandag, Yeditepe University, Faculty of Dentistry, Department of Endodontics, Bagdat cad No:238 34728, Goztepe/Istanbul/Turkey. E-mail address: mkarapinar@yahoo.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.005
Accessory Mesial Canals in Mandibular Molars
1289
Clinical Research
TABLE 1. Summary of Studies on the Prevalence of Accessory Mesial Canals in Mandibular Molars Number of molars (n) Study
Skidmore & Bjorndal, 1971 Pineda & Kuttler, 1972 Pomeranz et al, 1981 Martinez-Berna, 1983 Vertucci, 1984 Fabra-Campos, 1985 Fabra-Campos, 1989 Goel, 1991 Caliskan et al, 1995 de Carvalho & Zuolo, 2000 Gulabivala et al, 2001 Gulabivala et al, 2002 Sert & Bayirli, 2004 Ahmed et al, 2007 Navarro et al, 2007
Mesial accessory canals (%n) First

0 0 11.4 1.3 1 2.7 2.6 15 3.4 17.2 7.1 5.9 1.5 4 14.8 12
Methodology
Plastic casts Radiography Clinical Clinical Clearing Clinical Clinical Clinical Clearing Extracted teeth Clearing Clearing Clearing Clearing Micro-CT Scanning electron microscope
First
45 300 61 1,418 100 145 760 60 100 93 139 118 200 100 27 25
Second
40 300 39 944 100 0 0 0 100 111 134 60 200 100 0 0
Second
0 0 12.8 0.2 0 1.9 4.5 0 1.7 0 0
structure nonamenable to conventional endodontic access cavity preparation, aberrant anatomy, calcied canals, fused roots, single roots, and C-shaped canals, 48 rst and 48 second molars were selected for the study. They were stored in 0.1% thymol solution until used. The teeth were embedded in dentaforms and mounted in mannequins to simulate clinical conditions as best as possible. Conventional endodontic access cavities were completed in all teeth with the aid of 4.5 magnication loupes. Each of the rst and second molars groups was randomly divided into three subgroups (n = 18). Three endodontists were assigned a subgroup of rst and second molars each. Working independently, they set out to explore the mesial root canals in an attempt to detect accessory mesial canals using a standardized sequence as follows. In the rst stage, only loupes were used for magnication. The access cavity was rened with ultrasonic tips (Buc 1 and Buc 3; Sybron
Endo, Orange, CA) to remove any dentin overhanging the mesial canal orices and the isthmus. The mesial subpulpal groove was explored with sharp endodontic explorers (DG 16; Hu-Friedy, Chicago, IL, and Stewart probe; Premier Dental Products, Norristown, PA), and the number of canal orices detected was recorded. Attempts were then made to negotiate detected accessory mesial canals with size 06 Ktype hand les (Dentsply Maillefer, Balleigue, Switzerland). When negotiation was unsuccessful, the isthmus was troughed apically with the ultrasonic tips to pursue the accessory canal deeper into the root while repeating negotiation attempts. Irrigation with 1% NaOCl and a Stropko air irrigator (Sybron Endo) were used intermittently to optimize visibility. Troughing was continued apically until (1) the accessory mesial canal was negotiated, (2) it was considered too risky to continue troughing further apically, (3) the accessory mesial canal was no longer detectable, or (4) a perforation occurred.
Figure 1. (A-C) Radiographs of mandibular molars exposed from the mesial direction (the distal roots were resected) showing the pathway of the accessory mesial canals. Files were inserted into the MB, ML, and accessory canals. (D) The depth of dentin removal while troughing to negotiate the accessory canal using the pulp chamber oor as a reference.
1290
Karapinar-Kazandag et al.
Clinical Research
In the second stage, the teeth in which no accessory mesial canal was detected and those in which a detected accessory mesial canal could not be negotiated were submitted to further investigation aided with the microscope (Protege, Global Surgical Corp, St Louis, MO). Under the microscope, further dentin was selectively removed along the subpulpal groove with the ultrasonic tips while repeating negotiation attempts. Again, the results were recorded in the same four categories dened previously. In the third stage, a K-type le was negotiated into each of the mesial canals as far apically as possible. The teeth were removed from the dentaforms and then exposed on periapical radiographs from the mesial direction to show the pathways of the mesial canals (Fig. 1). In the fourth stage, the les were removed, and 1% sodium hypochlorite was left in the pulp chambers for 24 hours in order to remove any soft-tissue remnants. The chambers were dried and subsequently photographed with the aid of a stereomicroscope (Nikon, Tokyo, Japan). The number of teeth having 1, 2 (Fig. 2A), or 3 (Fig. 2B and C) canals or an open isthmus (Fig. 2D) was recorded. The location of the accessory mesial canals orices in the photographs was mapped with the aid of Spot Software (Diagnostic Instruments, Sterling Heights, MI). At the fth stage, the distal roots of the teeth were resected, and radiographs of the teeth were exposed from the mesial aspect. These radiographs were digitized (Sony Cyber-shot, DSC-W80, Tokyo, Japan), and the depth of dentin removal was measured with Spot Software using the pulp chamber oor as reference (Fig. 1D). Finally, the mesial roots of all 96 molars were sectioned at three levels: 1 mm, 4 mm, and 8 mm from the apex. The sectioned surfaces at each level were examined under the operating microscope at 30 magnication to detect additional accessory mesial canals beyond those detected during the experimental procedure and to trace the pathway of detected accessory mesial canals relative to the main canals.
Results
Tables 2 and 3 summarize the results of the investigation in the 96 rst and second mandibular molars, regarding the effect of magnication aids on detection and negotiation of accessory mesial canals, the location and pathways of the accessory canals and the depth of troughing required to negotiate or rule out the presence of the accessory canals.
Figure 2. Photographs and a schematic representation of the subpulpal groove observed in mandibular molars with (A) two canals, (B and C) three canals, and (D) an open isthmus.
1291
Clinical Research
TABLE 2. Numbers and Proportion of Detected and Negotiated Accessory Mesial Canals in Mandibular Molars First molars (n = 48) Magnication aid
Loupes (%) Microscope (%)
Second molars (n = 48) Detected

8 (16) 11 (22)
Total (n = 96) Detected

16 (16) 20 (20)
Detected
8 (16) 9 (18)
Negotiated
6 (12) 7 (14)
Negotiated
5 (10) 9 (18)
Negotiated
11 (11) 16 (16)
Loupes were used rst as the magnication aid followed by the use of the operating microscope for teeth where the previous attempts were unsuccessful.
Effect of Magnication Aids The total number of accessory mesial canals detected and negotiated was 4% higher in the second molars than in the rst molars (Table 2). In both tooth types, the use of the microscope improved the results achieved with the loupes. The total number of detected and negotiated accessory mesial canals increased from 16% to 20% and from 11% to 16%, respectively, with 4 of 20 accessory mesial canals (20%) detected but not negotiated. Location of Accessory Mesial Canal Orices All 20 accessory mesial canals were located in the mesial subpulpal groove. The distribution pattern along the groove was rather similar in the rst and second molars, with the highest proportion of accessory mesial canals (45%) located closer to the ML canals, 30% located in the middle between the MB and ML canals, and 25% located closer to the MB canals (Table 3). The mean distance between the MB and ML canals in the rst and second molars was 3.2 0.8 mm and 2.8 0.9 mm, respectively. When the accessory mesial canals were closer to either the ML or MB canals, their distance from the closest main canal was greater in the rst molars (1.0-1.3 mm) than in the second molars (0.8-0.9 mm) (Table 3). Pathways of Negotiated Accessory Mesial Canals All 16 negotiated accessory mesial canals were conuent with the main canals, with none terminating in an independent apical foramen (Table 3). The pathways of the accessory mesial canals differed between the rst and second molars. In the rst molars, the majority (42%) merged with the MB canals, whereas in the second molars 55% merged with the ML canals. Cross-sections of the roots revealed only the negotiated accessory mesial canals at the 8-mm level, suggesting that all accessory mesial canals present were successfully negotiated. None of
the negotiated accessory mesial canals were observed at 4 mm from the apex.
Depth of Troughs Required The mean depth of dentin removed in order to negotiate or rule out the presence of accessory mesial canals in the rst and second molars was 1.1 1.4 mm and 0.7 0.6 mm, respectively (Table 3).
Discussion
One of the challenges facing clinicians when performing endodontic treatment in molars is the complexity of the root canal systems. Although the high-prevalence accessory mesiobuccal canals in maxillary molars have been well characterized (4, 610), the lower-prevalence accessory mesial canals in mandibular molars (1214, 2024) are not well recognized by clinicians. The accessory mesial canals invariably originate within the subpulpal groove or isthmus connecting the two main canals (14, 16, 21, 24, 2628), making their detection very challenging. This study was undertaken to assess the potential to facilitate the detection and negotiation of accessory mesial canals in mandibular molars with the aid of the operating microscope. Teeth were mounted in dentaforms to simulate clinical conditions (6, 8). The detection of accessory mesial canals without magnication aids, which was assessed in several previous studies (5, 6, 8, 9), was not attempted because currently magnication is considered indispensable when performing endodontic treatment (1, 29). Thus, 4.5 loupes were used rst to enhance magnication, followed by the use of the operating microscope (up to 30 power) to assess its potential advantage. The access cavities were rened with ultrasonic tips to allow accurate, controlled removal of dentin along the mesial subpulpal groove in search for accessory mesial canal orices. The mesial dentinal protuberance was removed to afford a direct view of
TABLE 3. Characteristics of Detected and Negotiated Accessory Mesial Canals (AMCs) in Mandibular Molars Observation
Location (%) Closer to MB Closer to ML At middle Distance (mm) MB to ML AMC to MB* AMC to ML* Pathway (%) Merged with MB Merged with ML Merged with both Depth (mm)
First molars
n = 9 detected 2 (22) 4 (44) 3 (33) 3.21 0.76 1.00 0.28 1.30 0.14 n = 7 negotiated 3 (42) 2 (29) 2 (29) 1.10 1.14
Second molars
n = 11 detected 3 (27) 5 (45) 3 (27) 2.80 0.90 0.87 0.39 0.81 0.58 n = 9 negotiated 3 (33) 5 (55) 1(11) 0.66 0.57
Total
n = 20 detected 5 (25) 9 (45) 6 (30) Mean 3.00 0.90 Mean 0.93 0.32 Mean 0.95 0.53 n = 16 negotiated 6 (38) 7 (43) 3 (19) 0.93 0.94
AMC, accessory mesial canals; MB, mesiobuccal; ML, mesiolingual. Location and pathway are related to the main canals in the mesial root, the MB, and the ML. *Teeth where the AMC was closest to either main canal. Relative to the pulp chamber oor.
1292
Clinical Research
the line angle between the mesial wall and the pulp chamber oor (17).The investigators were three endodontists with varying levels of experience to eliminate the individuals skill as a dominant variable. Accessory mesial canals were characterized for proportion of successful detection (5) and negotiation (14), location and depth of the orices (6), and pathway (18). The ndings were conrmed for accuracy by radiographic examination (31) and cross-sectioning of the mesial roots (7, 8, 32). With the aid of the microscope, the number of detected accessory mesial canals increased by 4% overall in all teeth, with a greater improvement in the second molars (6%) than in the rst molars (2%). When the use of the microscope was compared with no magnication in a previous study (5), the number of detected accessory mesial canals increased by 17% in rst molars and by almost 5% in second molars. Also, in maxillary molars, the microscope facilitated the detection of MB2 canals (4, 6, 8, 9). Our ability to negotiate accessory mesial canals with the aid of loupes in 12% and 10% of rst and second molars, respectively, was similar to that reported previously without any magnication (14). Importantly, the nal microscope-aided negotiation of accessory mesial canals in 14% of the rst molars matched the 14.8% observed by computerized tomography (25), which is the ultimate method for investigating root canal morphology. Also, as suggested earlier, crosssections through the roots conrmed that no additional accessory mesial canals were present beyond the negotiated ones. The greater benet of the microscope in the second molar was again apparent, with the 8% increase in negotiated accessory mesial canals, compared with the 2% increase in the rst molars. The second molars have been reported to have accessory mesial canals less frequently (5, 16, 2024) and an isthmus more frequently (21, 22) than the rst molars. However, our combined use of microendodontic instruments (4) and the microscope facilitated exploration of the isthmuses (33), resulting in additional accessory mesial canals negotiated in the second molars. Pomeranz et al (14) classied the accessory mesial canals into three categories: (1) n, allowing free instrument movement between the main and accessory canals (we did not consider such ns as accessory mesial canals); (2) independent, having a separate orice and apical terminus, which is known to be rare (5, 1225) and was not observed in our sample; and (3) conuent, having a separate orice but merging more apically with the MB or ML canals as in all accessory mesial canals observed in our sample (15, 17, 18). Although also relating detected and negotiated accessory mesial canals to this classication, we aimed primarily to map the location of accessory mesial canals in relation to the main mesial canals (MB and ML). The main purpose of such mapping was to provide clinicians with a navigation guide for detection of accessory mesial canals, such as previously reported for maxillary molars (6). All of the accessory mesial canals were located in the mesial subpulpal groove (5, 25, 33). In about 45% of both the rst and second molars, the accessory mesial canals were detected closer to the ML canals, which is in agreement with previous reports (5). The mean distance from the ML orice was longer in the rst molars (1.3 mm) than in the second molars (0.8 mm), reecting the larger buccal-lingual dimension of the pulp chamber in the former. Thus, clinicians should specifically search for accessory mesial canals starting from the ML canal orice and progress systematically along the subpulpal groove towards the MB canal. Frequently, there was the need to explore the mesial subpulpal groove by troughing in the apical direction to allow negotiation of a detected accessory mesial canal with an endodontic instrument. The mean depth of the troughs in the rst molars reached 1.1 mm compared with approximately 0.7 mm in the second molars. Although in several teeth the troughs were as deep as 2.2 mm, we found them less deep than what is occasionally required in maxillary molars when accessory MB canals are negotiated (6). In the maxillary molars, the accessory MB canals depart the chamber at a sharp mesial inclination and then bend again distally, which makes their negotiation challenging (6); the deeper trough helps eliminate the rst angled portion of the canal, allowing insertion of instruments beyond the bend (6). In the mandibular molars, once the mesial dentinal protuberance is eliminated, the accessory mesial canals are not strongly inclined mesially, and they do not bend distally after departing the chamber. Thus, a shallow trough is sufcient to allow insertion of instruments into the accessory mesial canals. All the negotiated accessory mesial canals in this study were conuent with one of the main mesial canals, but the conuence pattern differed between the rst and second molars. In the former, the accessory mesial canals frequently crossed the midline and merged with the MB canals (17, 18), whereas in the latter they more frequently merged with the ML canals (15). The cross-sections through the roots conrmed that all negotiated accessory mesial canals were no longer observed at 4 mm from the apex, having blended with either the isthmus or one of the main canals. This nding supported the argument that the accessory mesial canals are not additional canals but rather an access into the isthmus between the main canals (33). The isthmus is a characteristic feature of the mesial roots of mandibular molars found in 17% to 83% of rst molars, most frequently at the level of 3 to 6 mm from the apical foramen (2628). It has been dened as a lateral interconnection (13), transverse anastomosis (12, 16), or intercanal communication (32, 21). It can be complete, forming a continuous connection between the main canals, or partial, forming an incomplete or narrow communication with one or more patent openings (32). Despite current advances in irrigation delivery, disinfection of the isthmus is an elusive goal (34, 35). The accessory mesial canals, when negotiated and shaped, comprise a pathway into the isthmus (33), which may provide access for irrigation solutions and root lling materials. This appears to be the main clinical signicance of detecting and attempting to negotiate accessory mesial canals in the mandibular molars. In conclusion, within its limitations, this study suggested that use of the operating microscope enhanced both the detection and negotiation of accessory mesial canals in the mandibular rst and second molars beyond what could be achieved with the aid of loupes. This benet was more pronounced in the second molars than in the rst molars, resulting in an 8% increase in the number of negotiated accessory canals. Not all detected accessory canals could be negotiated. Although accessory canals were negotiated in as many as 14% of rst molars and 18% of second molars, all of these canals merged with either one of the main mesial canals. The importance of negotiating the accessory mesial canals in mandibular molars is in the access it provides for irrigation solutions and lling materials into the otherwise inaccessible isthmus.
References
1. Kersten DD, Mines P, Sweet M. Use of the microscope in endodontics: results of a questionnaire. J Endod 2008;34:8047. 2. Lee M, Winkler J, Hartwell G, et al. Current trends in endodontic practice: emergency treatments and technological armamentarium. J Endod 2009;35:359. 3. Saunders WP, Saunders EM. Conventional endodontics and the operating microscope. Dent Clin North Am 1997;41:41528. 4. Stropko JJ. Canal morphology of maxillary molars: clinical observations of canal congurations. J Endod 1999;25:44650. 5. de Carvalho MC, Zuolo ML. Orice locating with a microscope. J Endod 2000;26: 5324.
1293
Clinical Research
6. Gorduysus MO, Gorduysus M, Friedman S. Operating microscope improves negotiation of second mesiobuccal canals in maxillary molars. J Endod 2001;27:6836. 7. Schwarze T, Baethge C, Stecher T, et al. Identication of second canals in the mesiobuccal root of maxillary rst and second molars using magnifying loupes or an operating microscope. Aust Endod J 2002;28:5760. 8. Baldassari-Cruz LA, Lilly JP, Rivera EM. The inuence of dental operating microscope in locating the mesiolingual canal orice. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2002;93:1904. 9. Buhrley LJ, Barrows MJ, BeGole EA, et al. Effect of magnication on locating the MB2 canal in maxillary molars. J Endod 2002;28:3247. 10. Sempira HN, Hartwell GR. Frequency of second mesiobuccal canals in maxillary molars as determined by use of an operating microscope: a clinical study. J Endod 2000;26:6734. 11. Hess W, Zurcher E. The anatomy of the root canals of the teeth of the permanent and deciduous dentitions. New York: William Wood & Co; 1925. 12. Skidmore AE, Bjorndal AM. Root canal morphology of the human mandibular rst molar. Oral Surg Oral Med Oral Pathol 1971;32:77884. 13. Pineda F, Kuttler Y. Mesiodistal and buccolingual roentgenographic investigation of 7,275 root canals. Oral Surg Oral Med Oral Pathol 1972;33:10110. 14. Pomeranz HH, Eidelman DL, Goldberg MG. Treatment considerations of the middle mesial canal of mandibular rst and second molars. J Endod 1981;7:5658. 15. Martinez-Berna A, Badanelli P. Investigacion clinica de molars inferiors con cinco conductos. Boletin de Informacion Dental 1983;43:2741. 16. Vertucci FJ. Root canal anatomy of the human permanent teeth. Oral Surg Oral Med Oral Pathol 1984;58:58999. 17. Fabra-Campos H. Unusual root anatomy of mandibular rst molars. J Endod 1985; 11:56872. 18. Fabra-Campos H. Three canals in the mesial root of mandibular rst permanent molars: a clinical study. Int Endod J 1989;22:3943. 19. Goel N, Gill K, Taneja J. Study of root canals conguration in mandibular rst permanent molar. J Indian Soc Pedod Prev Dent 1991;8:124. 20. Caliskan MK, Pehlivan Y, Sepetcioglu F, et al. Root canal morphology of human permanent teeth in a Turkish population. J Endod 1995;21:2004. 21. Gulabivala K, Aung TH, Alavi A, et al. Root and canal morphology of Burmese mandibular molars. Int Endod J 2001;34:35970. 22. Gulabivala K, Opasanon A, Ng YL, et al. Root and canal morphology of Thai mandibular molars. Int Endod J 2002;35:5662. 23. Sert S, Bayirli GS. Evaluation of the root canal congurations of the mandibular and maxillary permanent teeth by gender in the Turkish population. J Endod 2004;30: 3918. 24. Ahmed HA, Abu-bakr NH, Yahia NA, et al. Root and canal morphology of permanent mandibular molars in a Sudanese population. Int Endod J 2007;40:76671. 25. Navarro LF, Luzi A, Garcia AA, et al. Third canal in the mesial root of permanent mandibular rst molars: review of the literature and presentation of 3 clinical reports and 2 in vitro studies. Med Oral Patol Oral Cir Bucal 2007; 12:E6059. 26. Mannocci F, Peru M, Sherriff M, et al. The isthmuses of the mesial root of mandibular molars: a micro-computed tomographic study. Int Endod J 2005; 38:55863. 27. von Arx T. Frequency and type of canal isthmuses in rst molars detected by endoscopic inspection during periradicular surgery. Int Endod J 2005;38:1608. 28. Gu L, Wei X, Ling J, et al. A microcomputed tomographic study of canal isthmuses in the mesial root of mandibular rst molars in a Chinese population. J Endod 2009; 35:3536. 29. Vertucci F. Root canal morphology and its relationship to endodontic procedures. Endod Topics 2005;10:329. 30. Peiris HR, Pitakotuwage TN, Takahashi M, et al. Root canal morphology of mandibular permanent molars at different ages. Int Endod J 2008;41:82835. 31. Kulild JC, Peters DD. Incidence and conguration of canal systems in the mesiobuccal root of maxillary rst and second molars. J Endod 1990;16:3117. 32. Weller RN, Niemczyk SP, Kim S. Incidence and position of the canal isthmus. Part 1. Mesiobuccal root of the maxillary rst molar. J Endod 1995;21:3803. 33. Mortman RE, Ahn S. Mandibular rst molars with three mesial canals. Gen Dent 2003;51:54951. 34. Burleson A, Nusstein J, Reader A, et al. The in vivo evaluation of hand/rotary/ultrasound instrumentation in necrotic, human mandibular molars. J Endod 2007;33: 7827. 35. Carr GB, Schwartz RS, Schaudinn C, et al. Ultrastructural examination of failed molar retreatment with secondary apical periodontitis: an examination of endodontic biolms in an endodontic retreatment failure. J Endod 2009;35:13039.
1294
Clinical Research
Postoperative Pain after the Application of Two Different Irrigation Devices in a Prospective Randomized Clinical Trial
Eudes Gondim Jr., DDS, MS, PhD,* Frank C. Setzer, DMD, PhD, MS,* Carla Bertelli dos Carmo, DDS, and Syngcuk Kim, DDS, PhD*
Abstract
Introduction: The extrusion of irrigation solutions beyond the apical constriction may result in postoperative pain. Sodium hypochlorite can cause severe tissue irritation and necrosis outside the root canal system if extruded into the periodontal ligament (PDL) space. Different delivery techniques were discussed to reduce this potential risk. The aim of this study was to compare the postoperative level of pain after root canal therapy using either endodontic needle irrigation or a negative apical pressure device. Material and Methods: In a prospective randomized clinical trial, 110 asymptomatic single-rooted anterior and premolar teeth were treated endodontically with two different irrigation techniques. The teeth were randomly assigned to two groups. In the MP group (n = 55), procedures were performed using an endodontic irrigating syringe (Max-i-Probe; Dentsply Rinn, Elgin, IL). The EV group (n = 55) used an irrigation device based on negative apical pressure (EndoVac; Discus Dental, Culver City, CA). Postoperatively, the patients were prescribed ibuprofen 200 mg to take every 8 hours if required. Pain levels were assessed by an analog scale questionnaire after 4, 24, and 48 hours. The amount of ibuprofen taken was recorded at the same time intervals. Results: During the 0- to 4-, 4- to 24-, and 24- to 48-hour intervals after treatment, the pain experience with the negative apical pressure device was signicantly lower than when using the needle irrigation (p < 0.0001 [4, 24, 48 hours]). Between 0 and 4 and 4 and 24 hours, the intake of analgesics was signicantly lower in the group treated by the negative apical pressure device (p < 0.0001 [0-4 hours], p = 0.001 [4-24 hours]). The difference for the 24- to 48-hour period was not statistically different (p = 0.08). The Pearson correlation coefcient revealed a strongly positive and signicant relationship for the MP group (r = 0.851, p < 0.001) and the EV group (r = 0.596, p < 0.0001) between pain intensity and the amount of analgesics. Conclusion: The outcome of this investigation indicates that the use of a negative apical pressure irrigation device can result in a signicant reduction of postoperative pain levels in comparison to conventional needle irrigation. (J Endod 2010;36:12951301)
Key Words
EndoVac, irrigation, negative apical pressure, postoperative pain
ostoperative pain is an unwanted yet unfortunately common sensation after endodontic treatment. The incidence of postoperative pain was reported to range from 3% to 58% (1). Even severe pain may occur within 24 to 48 hours after therapy (2). After the treatment was nished, 12% of patients experienced severe pain within this time interval according to a visual analog scale (VAS) (2). The factors for postoperative pain are many-fold and can include microbial factors, the effects of chemical mediators, phenomena related to the immune system, cyclic nucleotide changes, psychological factors, and changes in the local adaptation and the periapical tissue pressure (3). Irritants to the periapical tissues that can evoke pain sensation include medications or irrigating solutions (3). Antimicrobial debridement is a key step in root canal therapy. Bacteria play a primary role in the development of pulp necrosis, periapical pathosis, and posttreatment disease (4). Mechanical instrumentation alone is not enough to render canals free from microorganisms (5). Several studies have proven the effectiveness of sodium hypochlorite for bacterial reduction in addition to mechanical cleaning and shaping (6). Other irrigants with similar antimicrobial effects include chlorhexidine (7) and MTAD (8). Only sodium hypochlorite, however, has also proven highly effective in tissue dissolution (9) and the removal of bacterial biolm (10). Because tissue dissolution is a prerequisite for antimicrobial action (11), sodium hypochlorite is considered the most important antimicrobial irrigant in root canal therapy (9). Sodium hypochlorite works because of its ability to hydrolyze and oxidize cell proteins, its release of free chlorine, and its pH of 11 to 12 (7). Because of the strong cell toxicity, an associated risk with the use of sodium hypochlorite is the inadvertent injection into the periapical tissues through the apical constriction of the root canal, leading to severe, painful postoperative complications. Sodium hypochlorite accidents have been reported in the literature (12). Teeth with wide open foramina or with apical constrictions damaged by resorptive processes or by iatrogenic errors during instrumentation are at an elevated risk for the extrusion of sodium hypochlorite (13). Moreover, if excessive pressure is used during irrigation or the irrigation needle is bound within the root canal and prevents the safe coronal outow of the solution, large quantities of sodium hypochlorite may be pushed out into the periapical tissues and subsequently lead to tissue necrosis and postoperative pain (13). This causes a dilemma because it is known that a high volume and frequency
From the *Department of Endodontics, School of Dental Medicine, University of Pennsylvania, Philadelphia, PA, USA; and the Sao Paulo Association of Dental Surgeons, Sao Paulo, Brazil. Address requests for reprints to Dr Frank C. Setzer, Department of Endodontics, School of Dental Medicine, University of Pennsylvania, 240 S 40th Street, Philadelphia, PA 19104. E-mail address: fsetzer@dental.upenn.edu. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.012
Post-Operative Pain after Application of Two Irrigation Devices
1295
Clinical Research
of irrigation (14) as well as the ability to reach the apical intraradicular tissues (15) are necessary for effective disinfection. To prevent periapical tissue damage and lessen postoperative pain, a safe irrigation delivery system is desirable. Commonly, hypodermic or endodontic needles are used for irrigation. Recently, a new irrigation system, the EndoVac system (Discus Dental, Culver City, CA), was introduced to endodontics. Conventional irrigation works with positive pressure to ush the disinfecting solution into the root canal and force the irrigant out again coronally by displacement with new volumes of solution. The EndoVac system works with negative pressure. A detailed design and working mechanism have been described before (16). Briey, an irrigation tip is attached to a conventional medical syringe containing the solution. Through this tip, irrigant is released into the pulp chamber. Overow is prevented by a suction tip that is directly attached to the delivery tip and connects to the high-speed suction of the dental unit. A second tube, connected to the high-speed suction, is used for the attachment of cannulas of varying diameter for different levels of irrigation within the root canal. A stainless steel microcannula of size #32 with 12 small, lateral holes is used for the apical 0 to 3 mm. The tip is inserted to the working length and provides a constant ow of new irrigation solution to the apical third by sucking it apically from the fresh reservoir in the pulp chamber and disposing the used solution through the evacuation tube toward the high-speed suction of the dental unit. In three recent in vitro studies, the EndoVac system showed significantly better apical debridement (17) and an equal performance in antimicrobial disinfection (18, 19) in single straight canals when compared with other irrigation techniques. Yet, no literature exists claiming whether the irrigation with a negative apical pressure device provides more or less favorable results in terms of postoperative pain when compared with positive-pressure irrigation protocols. The purpose of this study was to evaluate and compare the postoperative pain after the use of two different irrigation protocols. were informed which irrigation devices were used in general, there was no information for the participant which system was used for the particular treatment.
Randomized Selection of Irrigation Device The goal of the study was 100 patients, with at least 50 procedures in each group. In order to compensate for a possible dropout rate of 10%, the prospective sample size for each group was set at 55. To ensure randomization of the process, 55 red and 55 green chips were placed in a bag at the beginning of the investigation. Before each treatment, a dental assistant of the operator randomly determined the irrigation device by taking out one of the colored chips without replacement until all 110 procedures had been performed. The assistant could not see the color of the chip before it was removed from the bag. Group MP (red) was assigned for treatment with a conventional endodontic needle syringe (Max-i-Probe 30G; Dentsply Rinn, Elgin, IL). Group EV (green) received treatment with the negative-pressure device (EndoVac). Endodontic Protocol All patients received a topical anesthetic (Benzotop; DFL, Rio de Janeiro, Brazil) before inltration. Local anesthesia was achieved by local inltration with 3.6 mL of lidocaine with 1:100,000 epinephrine (Alphacaine, DFL). After anesthesia, a rubber dam was placed and disinfected with 3% hydrogen peroxide, and the tooth was accessed using sterile carbide burs under a dental operating microscope. In cases with deep carious lesions, the main decay was excavated before accessing the pulp to prevent the introduction of microorganisms into the root canal system. A glide path was established with stainless steel hand instruments up to a size #15. The canal was instrumented with Gates Glidden burs #4, #3, and #2 (Dentsply Maillefer, Ballaigues, Switzerland) followed by nickel-titanium rotary instruments (ProTaper; Dentsply Tulsa, Johnson City, TN). Patency was established and veried with #10 les. The working length to the apical constriction was conrmed by an electronic apex locator (Root ZX; Morita, Irvine, CA) and periapical radiographs. The established working length was checked repeatedly throughout the procedure. Depending on the individual tooth, the nal instrumentation size was determined as three sizes larger than the rst le binding at the working length. Final preparation ended either with ProTaper F3, F4, F5, or F5 plus additional apical enlargement with nickel-titanium hand instruments to size #60. A smaller taper #35 ISO nickel-titanium hand instrument was used for the F3 preparations in group EV to verify free access to the full working length for the microcannula. All teeth were obturated in the same session using gutta-percha with warm vertical compaction in the continuous wave technique (System B; Sybron Endo, Orange, CA) and a gutta-percha backll (Obtura II; Obtura Spartan, Earth City, MO). Depending on whether a post placement was planned by the referring dentist, the tooth was either temporized using a sterile cotton pellet and Cavit (3M, St Paul, MN) or a direct adhesive buildup with a composite resin material (P60 Singlebond, 3M). After the treatment, all patients received postoperative instructions and eight tablets of ibuprofen 200 mg with the instructions to take only one tablet if it was needed within the 0- to 4-hour time interval after the treatment and then one every 8 hours in the event of pain. Irrigation Protocols All teeth received the same volume of irrigants. Altogether, 130 mL 2.5% sodium hypochlorite (Formula & Acao, Sao Paulo, Brazil) and 10 mL EDTA 17% (Formula & Acaol) were used. For both groups, the sodium hypochlorite was held in and dispensed from a mechanical syringe pump (Aladdin Pump; World Precision Instruments, Sarasota, FL) providing a constant ow. Twenty milliliters of sodium hypochlorite

In this prospective randomized clinical trial, single-visit root canal treatments were performed. A questionnaire was given to the participants to note the amount of analgesics taken postoperatively as well as the intensity of pain. A pain scale frequently used for medical studies, the CR10 Borg list (20), was implemented to quantify the participants individual pain experience.
Patient Selection Eighty volunteer patients with 110 teeth tting the inclusion criteria described later were included in this study. All patients were treated by a single operator in a private practice specializing in endodontics over a period of 25 months. Only single-rooted teeth with one canal were selected for this investigation. Diagnoses were either asymptomatic irreversible pulpitis caused by carious exposures or normal pulp if the patient had been referred for intentional endodontic therapy for prosthetic reasons. The individual diagnosis was conrmed by obtaining the dental history, periradicular radiographs, periodontal evaluation, ` percussion, and cold test (EndoIce; Coltene/Whaledent Inc, Cuyahoga Falls, OH). The diagnostic ndings were veried by comparing them with adjacent sound teeth with vital pulps. Only patients who had a noncontributory medical history and did not take analgesic medication at the initiation of the root canal treatment were asked to participate in the study. The treatment and the study design were explained to the qualifying patients. Patients were informed that participation was voluntary and did not affect the treatment. All patients who agreed to participate in this study signed an informed consent. Although the patients
1296
Gondim Jr. et al.
Clinical Research
were used during access and initial coronal instrumentation for both protocols. Ten milliliters of sodium hypochlorite followed after every use of a rotary instrument. Twenty milliliters were reserved for the nal ush after EDTA application. The remainder of the 130 mL was used up after the nal preparation of the root canal space. In group MP, all irrigation was performed with the 30-G Max-i-Probe needle up to 2 mm short of the nal working length, which was veried by rubber stops. In group EV various tips of the EndoVac system were used following the manufacturers recommendation. An EndoVac Master Delivery Tip was applied for the initial irrigation followed by a macrocannula in a pecking motion during the main instrumentation and a microcannula for the nal irrigation with EDTA and sodium hypochlorite. The insertion of the EndoVac microcannula was to the working length of the prepared root canal space. During the treatment, patients were prevented from seeing the irrigation device. metric Mann-Whitney U test (p = 0.05) and Pearson correlation coefcient (p = 0.05) were used for statistical analysis.
Results
All 110 questionnaires were obtained and evaluated by statistical analysis. The patients age ranged from 16 to 89 years, with a median age of 48 years. Of a total of 80 patients, 46 were female and 34 were male. Table 1 shows the population distribution according to group MP and group EV. There were 15 lateral and central incisors and 40 canines and premolars (of which 21 were in the maxilla and 19 in the mandible) in group MP. Group EV had 17 lateral and central incisors and 38 canines and premolars (with 19 each in maxilla and mandible). In group MP, 22 teeth (40%) were treated for dental decay and 33 teeth (60%) for prosthodontic reasons. Fourteen teeth (25.5%) in group EV were treated because of decay, and 41 teeth (74.5%) were treated intentionally for prosthodontics. The difference in this ratio is explained by the random assignment of teeth. The distribution of nal apical preparation dimensions were ProTaper F3 (n = 10), F4 (n = 25), F5 (n = 13), and F5 plus hand instrument 60, 0.02 (n = 7) for group MP and F3 (n = 15), F4 (n = 28), F5 (n = 9), and F5 plus hand instrument 60, 0.02 (n = 3) for group EV. The difference in the distribution was a result of the random allocation of teeth and the individual root canal morphology. After the 0- to 4-hour interval, two patients reported to have taken two ibuprofen 200 mg instead of one. No patient contacted the ofce to change the analgesic protocol or because of an emergency situation.
Patient Questionnaire All participants received a questionnaire for the evaluation of pain and the frequency of analgesic use for each root canal procedure at 4, 24, and 48 hours after the endodontic treatment was completed. After 48 hours, the participants were called by telephone and asked for the answers to the questionnaire that they had to note on the form. The person calling was blinded to the irrigation device that was used during the treatment of the particular patient. The participants were asked about their general feeling in the area of the root canal, with options for feeling generally ne, slightly uncomfortable, having pain on chewing, or constant severe pain. The second question recorded the number of ibuprofen pills that had been taken by the patient up until this point. Furthermore, after 4, 24, and 48 hours, the pain intensity was also recorded using the CR10 Borg list or Borg scale. The participants labeled the intensity of pain by a numeric and verbal scale. Level 10, extremely strong, represented the strongest pain the participant had ever experienced. The participant then verbally expressed the level of discomfort by choosing a number in comparison to level 10 pain and quantied the pain using the following values: level 0, absolutely nothing; level 1, very weak; level 2, weak (light); level 3, moderate; level 4, somewhat strong; levels 5 and 6, strong (heavy); levels 7 to 9, very strong; and level 10, extremely strong, maximum pain. The participants also had the option to note other sensations. All participants were instructed to immediately contact the ofce or the emergency number in case the analgesics protocol did not provide pain relief or any other emergency occurred. Statistical Analysis Descriptive analysis, means, and standard deviations were calculated using SPSS 15.0 for Windows (SPSS, Chicago, IL). The nonpara-
Pain Levels Table 2 describes the minimum and maximum pain that was experienced by the participants as well as the statistical analysis of the patients pain levels. For both groups, some patients did not experience any pain or did not take any analgesic medication, regardless of the time interval after treatment. In group MP, the maximum pain intensity described by one patient was 7 within the 0- to 4-hour time interval after treatment. For group EV, the maximum pain intensity was 3 consistently for all three time intervals. The maximum pain in group MP decreased over time. For both groups, the maximum pain values became more consistent over time. For group MP, 34.5% of the patients (n = 19) felt no pain during the 0- to 4-hour time interval, 10.9 % (n = 6) felt 1 of 10, 27.3% (n = 15) felt 2 of 10 (weak) pain, and only 9.1% (n = 5) felt strong to very strong pain. In group EV, 94.5% of the patients (n = 52) felt no to weak pain. Only 5.5% (n = 3) reported moderate pain up to 4 hours. Within the 4- to 24-hour time period, the maximum pain intensity in group MP decreased to 5 of 10 (strong) in 3.6% of the patients (n = 2); during the 24- to 48-hour time interval, all patients experienced no pain or only weak pain levels. Between 24 and 48
TABLE 1. Descriptive Analysis of Patient Distribution, Minimum and Maximum Pain Levels, and Number of Analgesic Pills Method
Age Pain 4 h Pain 24 h Pain 48 h Analgesics 4 h Analgesics 24 h Analgesics 48 h Age Pain 4 h Pain 24 h Pain 48 h Analgesics 4 h Analgesics 24 h Analgesics 48 h
Min
16 0 0 0 0 0 0 17 0 0 0 0 0 0
Max
89 7 5 2 2 2 1 87 3 3 3 1 1 0
Median
49.80 1.72 1.45 0.50 0.49 0.38 0.05 46.95 0.39 0.31 0.18 0.09 0.05 0.00
SD
15.65 1.75 1.42 0.68 0.57 0.65 0.22 12.90 0.82 0.66 0.64 0.29 0.22 0.00
Group A Maxi 1 Probe
Group B EndoVac
1297
Clinical Research
hours, respectively, one (1.8%) and two (3.6%) patients in group EV experienced still moderate pain (3/10). Pain intensity and analgesic intake were compared in regard to the time intervals. A normal distribution for pain intensity and analgesic intake was not accepted for statistical analysis; therefore, the Mann Whitney U test for independent samples was applied at a signicance level of 5%. For pain intensity, differences between the MP and EV groups were statistically signicant with p < 0.0001 at all time intervals, with greater pain intensity in the MP group. Independent from the individual time intervals, the overall pain intensity was less in the EV group than in the MP group. The median pain intensity was 1.22 (standard deviation = 1.06) in the MP group and 0.29 (standard deviation = 0.56) in the EV group. The MannWhitney U test revealed a statistically signicant difference between the median pain intensity depending on the irrigation protocol. There was signicantly less overall pain associated with the treatment in the EV group (EndoVac, p < 0.0001).
Cumulative Percent
60.0 89.1 100.0 32.7 58.2 78.2 89.1 96.4 100.0 90.9 3.6 1.8 3.6 78.2 92.7 98.2 100.0
24 - 48 hrs
Frequency Cumulative percent
33 16 6 55 0 1 2 3 55
60.0 29.1 10.9 100.0 50 2 1 2 100.0 p < 0.0001*
Valid Percent
TABLE 2. Pain Intensity Distribution During 0- to 4-, 4- to 24-, and 24- to 48-Hour Time intervals
Pain intensity distribution
p value (Mann-Whitney test)
Analgesic Intake Table 3 gives a detailed overview of the patients intake of analgesics in the number of pills and statistical analysis. The maximum intake of analgesic medication was higher in the MP group than the EV group for all time intervals. In group MP, two patients (3.6%) took two pills within the rst 4 hours after treatment. Both patients had reported 6 of 10 (strong) pain intensity for this time interval. These two participants were not excluded from the statistical analysis. The patients did not change the drug and followed the analgesic protocol in the following two time intervals. Also, it would more likely inuence the validity of the results if patients who recorded pain were excluded from an analysis of occurrence and intensity of pain because they experienced more discomfort than other participants. For both groups, the consumption of analgesics decreased with time. In group MP, a total of 27 pills were taken within the 0- to 4-hour time interval, 21 between 4 and 24 hours, and only 3 between 24 and 48 hours. In the EV group, ve patients took one pill within 4 hours after treatment and three between 4 and 24 hours. No patient in this group required pain medication during the 24- to 48-hour time interval. The Mann Whitney U test for independent samples showed that between 0 and 4 hours the number of pills consumed was signicantly lower in the EV group with p < 0.0001 and p < 0.001 between 4 and 24 hours after treatment. There was no statistically signicant difference in analgesic intake during the 24- to 48-hour interval between both groups (p = 0.08). Independent from the individual time intervals, the overall number of analgesic pills was less in the EV group than in the MP group. The median consumption was 0.30 pills (standard deviation = 0.37) in the MP group and 0.04 pills (standard deviation = 0.13) in the EV group. The Mann-Whitney U test revealed a statistically signicant difference between the median number of pills taken by the participants. The number of analgesics taken was signicantly higher in the MP group (p < 0.0001). Correlation of Median Pain Intensity with the Median Number of Pills Calculation of the Pearson correlation coefcient for the measure of dependence between two variables revealed a strong positive and signicant relationship (r = 0.851, p < 0.001) for pain intensity and the number of pills for the MP group (Fig. 1) and also a positive and signicant correlation (r = 0.596, p < 0.0001) between the variables of pain and analgesics for the EV group (Fig. 2).
Frequency Cumulative percent
Frequency
Intensity
Method
0 1 2 3 4 5 6 7 Total 0 1 2 3 Total
*Statistically signicant.
Maxi 1 Probe
Group A
1298
Gondim Jr. et al.
Group B
Endo Vac
19 6 15 9 1 2 2 1 55 42 7 3 3 55
34.5 10.9 27.3 16.3 1.8 3.6 3.6 1.8 100.0 76.4 12.7 5.5 5.5 100.0 p < 0.0001 *
Valid percent
0-4 h
34.5 45.5 72.7 89.1 90.9 94.5 98.2 100.0
76.4 89.1 94.5 100.0
18 14 11 6 4 2 55 43 8 3 1 55
32.7 25.5 20.0 10.9 7.3 3.6 100.0 78.2 14.5 5.5 1.8 100.0 p < 0.0001*
Valid percent
4-24 h
Clinical Research
Cumulative Percent
Discussion
The purpose of this study was to compare the differences in postoperative pain after endodontic therapy after using two different irrigation techniques. Mild discomfort after root canal treatment is a common experience for patients (21). The reasons for postoperative pain, however, can be many (22). The main causes are mechanical, chemical, or microbial injuries to the periapical tissues that result in acute inammation (23). In a clinical investigation, it is difcult to determine if a single or multiple factors elicit pain. If a root canal system was not cleaned properly, residual infection may cause exacerbation by imbalances in the host-bacteria relationship, synergistic or additive microbial interactions, or the presence of decisively pathogenic bacteria before the initiation of treatment (23). A mechanical reason may be overinstrumentation; chemical factors include the extrusion of medications, lling materials, or irrigants (23). In the present study, great care was taken to rule out avoidable preoperative factors and to minimize any unavoidable causes of postoperative pain. Teeth with apical periodontitis, necrotic teeth, or retreatment cases were not incorporated, and a meticulous aseptic protocol was maintained to reduce the risk of exacerbation by residual microorganisms or the introduction of bacterial contamination. Therefore, only teeth with the diagnosis of irreversible pulpitis or normal pulp were treated. The study was also limited to asymptomatic teeth because preoperative pain is one of the most predictable indicators for postoperative pain (24). Only teeth in which a single canal could be found under the microscope were incorporated to minimize the risk of iatrogenic errors because of missed or complicated root canal anatomy and to make sure the same amount of irrigation solution would pass by each canal. All teeth were instrumented and obturated in one session to eliminate intracanal medication as another possible factor for postoperative areup. Furthermore, only patients without a contributing medical history who did not take analgesic medication recently were included so that no other pain source or drug interaction could interfere with pain resulting from the endodontic therapy. Even with all the precautions taken, one cannot be sure in a clinical study if pain is coming from the single factor under investigation. All possible sources of pain can never be controlled completely. Therefore, under the particular circumstances of our study, postoperative pain may have been related to apical trauma because of overinstrumentation or extrusion of debris, sealer, or gutta-percha rather than sodium hypochlorite. Bacteria may have been introduced from decay, canal anatomy may have been missed, the soft tissues may have been hurt because of the application of the rubberdam or injection, or the patient may have developed unrelated orofacial pain. Taking into consideration that all patients underwent the same treatment protocol, with the only difference being the irrigation technique, the highly statistically signicant outcome and the strong correlation of pain and analgesic intake allow the conclusion that, indeed, the particular irrigation protocol had signicant impact on the level and time of postoperative pain. In general, the pain levels the patients experienced in our investigation were very low, with only 12 of 330 (3.6%) total reports exceeding moderate pain, including one single report of very strong pain. No patient reported any other symptoms or complications like swelling or paresthesia. All these facts underline the level of care that was given to provide an atraumatic treatment protocol. However, when all forms of pain were considered, ranging from level 1 (very weak) to level 5 (strong), 44.5% of all treatment were associated with pain during the 4- to 24-hour time period. Of these, 67.3% were in group MP and 21.8% were associated with group EV. Other studies showed pain levels beween 12 and 24 hours to be between 7.1% and 7.8% for teeth with no preoperative history of pain, respectively, treatment of vital pulps (20).
94.5 100.0 70.9 90.9 100.0 54.5 96.4 100.0 100.0 90.9 100.0 EndoVac p value (Mann-Whitney test) 94.5 100.0
24 - 48 hrs
Frequency Cumulative Percent Frequency TABLE 3. Analgesic Intake Distribution During 0- to 4-, 4- to 24-, and 24- to 48-Hour Time Intervals Cumulative percent Frequency Number of pills Method Analgesic intake distribution Valid percent 0-4 h Valid Percent 4-24 h
0 1 2 Total 0 1 Total
*Statistically signicant.
Group A Maxi I Probe
Group B
30 23 2 55 50 5 55
54.5 41.8 3.6 100.0 90.9 9.1 100.0 p < 0.0001*
39 11 5 55 52 3 55
70.9 20.0 9.1 100.0 94.5 5.5 100.0 p <0.001*
52 3 55 55 55
94.5 5.5 100.0 100.0 100.0 p = 0.08*
Valid Percent
1299
Clinical Research
(levels 7-9) by three levels, which is supposed to address the logarithmic increase of pain sensation (20). The relatively low dose of ibuprofen 200 mg was chosen to allow a better measure of analgesic intake. High doses may have obscured the outcome, especially with the very low pain levels created by our endodontic treatment protocol in general. The results that the irrigation protocol in the EV group resulted in less postoperative pain intensity and analgesic intake may t with other ndings. It was found that the use of the EndoVac system did not (28) or signicantly less (29) result in the apical extrusion of irrigant; hence, chemical irritation of the periapical tissues leading to postoperative pain may not be likely. Because the majority of root canal irrigants are cytotoxic to the periapical tissues, the irrigation solution should be restricted to within the root canal system. In our study, both techniques were either used according to the manufacturers recommendations or, if not available, according to the common protocol (28). To be safe, irrigation with Max-i-Probe was 2 mm from the working length, which is within the range of 1.5 to 3.0 mm used in comparable studies with Max-i-Probe or identical irrigation needles (17, 19, 28, 30, 31), whereas the EndoVac negative apical pressure tip was routinely used all the way to the working length (0 mm), thus fullling the claim for direct irrigation in the apical third (15). In conclusion, the negative apical pressure irrigation system EndoVac resulted in signicantly less postoperative pain and necessity for analgesic medication than a conventional needle irrigation protocol using the Max-i-Probe. From the results of this study, it may be assumed that it is safe to use a negative apical pressure irrigation protocol for antimicrobial debridement up to the full working length.
Figure 1. The correlation of median pain intensity with the median number of pills in the MP group (Max-i-Probe).
The difference here may lie in the use of different pain scales. A frequently used scale for the evaluation of dental pain is the visual analog scale (VAS) (24, 25). The reliability of the VAS as a measure of pain intensity for patients postoperatively with mild to moderate pain has been shown (26). The VAS ranks pain by a visual scale from 0 to 100. Commonly, these values are transfered to four intensity levels for pain: none (level 1), mild (level 2), moderate (level 3), and severe pain (level 4) (26). Although in this investigation the highest reported values were 7 of 10 and 6 of 10 (once and twice out of 110 reports) after 4 hours and 5 of 10 (twice out of 110 reports) after 24 hours according to the Borg scale, 4 of 4 referring to the VAS is a rather frequently reported value in studies on postoperative pain (22, 25). The choice of the Borg scale for the evaluation of pain in our study provided good results for statistical analysis. The Borg scale evaluates pain in 10 full steps yet is theoretically open ended. It was argued that when intermediate levels are too small, differences between groups might be statistically signicant, but the results may not be clinically signicant (27). A benet of the Borg scale, however, is that strong pain (levels 5-6) is covered by two and very strong pain
Acknowledgment
Discus Dental provided the EndoVac kits for clinical use for this study.
References
1. Sathorn C, Parashos P, Messer H. The prevalence of postoperative pain and are-up in single- and multiple-visit endodontic treatment: a systematic review. Int Endod J 2008;41:919. 2. Ng YL, Glennon JP, Setchell DJ, et al. Prevalence of and factors affecting postobturation pain in patients undergoing root canal treatment. Int Endod J 2004; 37:38191. 3. Seltzer S. Pain in endodontics. 1986. J Endod 2004;30:5013. 4. Kakehashi S, Stanley HR, Fitzgerald RJ. The effects of surgical exposures of dental pulps in germfree and conventional laboratory rats. Oral Surg Oral Med Oral Pathol 1965;20:3409. 5. Dalton BC, Orstavik D, Phillips C, et al. Bacterial reduction with nickel-titanium rotary instrumentation. J Endod 1998;24:7637. 6. Shuping GB, Orstavik D, Sigurdsson A, et al. Reduction of intracanal bacteria using nickel-titanium rotary instrumentation and various medications. J Endod 2000;26: 7515. 7. Hauman CH, Love RM. Biocompatibility of dental materials used in contemporary endodontic therapy: a review. Part 1. Intracanal drugs and substances. Int Endod J 2003;36:7585. 8. Torabinejad M, Shabahang S, Aprecio RM, et al. The antimicrobial effect of MTAD: an in vitro investigation. J Endod 2003;29:4003. 9. Naenni N, Thoma K, Zehnder M. Soft tissue dissolution capacity of currently used and potential endodontic irrigants. J Endod 2004;30:7857. 10. Abdullah M, Ng YL, Gulabivala K, et al. Susceptibilties of two Enterococcus faecalis phenotypes to root canal medications. J Endod 2005;31:306. 11. Harrison JW, Hand RE. The effect of dilution and organic matter on the anti-bacterial property of 5.25% sodium hypochlorite. J Endod 1981;7:12832. 12. Kleier DJ, Averbach RE, Mehdipour O. The sodium hypochlorite accident: experience of diplomates of the American Board of Endodontics. J Endod 2008;34: 134650. 13. Hulsmann M, Hahn W. Complications during root canal irrigationliterature review and case reports. Int Endod J 2000;33:18693.
Figure 2. The correlation of median pain intensity with the median number of pills in the EV group.
1300
Gondim Jr. et al.
Clinical Research
14. Siqueira JF Jr, Rocas IN, Favieri A, et al. Chemomechanical reduction of the bacterial population in the root canal after instrumentation and irrigation with 1%, 2.5%, and 5.25% sodium hypochlorite. J Endod 2000;26:3314. 15. Chow TW. Mechanical effectiveness of root canal irrigation. J Endod 1983;9:4759. 16. Schoeffel GJ. The EndoVac method of endodontic irrigation, part 3: system components and their interaction. Dent Today 2008;27(106):10811. 17. Nielsen BA, Baumgartner JC. Comparison of the EndoVac system to needle irrigation of root canals. J Endod 2007;33:6115. 18. Brito PR, Souza LC, Machado de Oliveira JC, et al. Comparison of the effectiveness of three irrigation techniques in reducing intracanal Enterococcus faecalis populations: an in vitro study. J Endod 2009;35:14227. 19. Miller TA, Baumgartner JC. Comparison of the antimicrobial efcacy of irrigation using the EndoVac to endodontic needle delivery. J Endod 2010;36:50911. 20. Borg G, Holmgren A, Lindblad I. Quantitative evaluation of chest pain. Acta Med Scand Suppl 1981;644:435. 21. Harrison JW, Baumgartner JC, Svec TA. Incidence of pain associated with clinical factors during and after root canal therapy. Part 2. Postobturation pain. J Endod 1983;9:4348. 22. Genet JM, Hart AA, Wesselink PR, et al. Preoperative and operative factors associated with pain after the rst endodontic visit. Int Endod J 1987;20:5364. 23. Siqueira JF Jr, Barnett F. Interappointment pain: mechanisms, diagnosis, and treatment. Endod Topics 2004;7:93109. 24. Glennon JP, Ng YL, Setchell DJ, et al. Prevalence of and factors affecting postpreparation pain in patients undergoing two-visit root canal treatment. Int Endod J 2004;37:2937. 25. El Mubarak AH, Abu-bakr NH, Ibrahim YE. Postoperative pain in multiple-visit and single-visit root canal treatment. J Endod 2010;36:369. 26. Myles PS, Troedel S, Boquest M, et al. The pain visual analog scale: Is it linear or nonlinear? Anesth Analg 1999;89:151720. 27. Bodian CA, Freedman G, Hossain S, et al. The visual analog scale for pain: clinical signicance in postoperative patients. Anesthesiology 2001;95:135661. 28. Desai P, Himel V. Comparative safety of various intracanal irrigation systems. J Endod 2009;35:5459. 29. Mitchell RP, Yang SE, Baumgartner JC. Comparison of apical extrusion of NaOCl using the EndoVac or needle irrigation of root canals. J Endod 2010;36:33841. 30. Hockett JL, Dommisch JK, Johnson JD, et al. Antimicrobial efcacy of two irrigation techniques in tapered and nontapered canal preparations: an in vitro study. J Endod 2008;34:13747. 31. Brito PR, Souza LC, Machado de Oliveira JC, et al. Comparison of the effectiveness of three irrigation techniques in reducing intracanal Enterococcus faecalis populations: an in vitro study. J Endod 2009;35:14227.
1301
Clinical Research
Prevalence of Three-rooted Mandibular Permanent First Molars among the Indian Population
Amit Kumar Garg, BDS (Lko), MDS (Lko),* Rajendra K. Tewari, BDS (Lko), MDS (Lko),* Ashok Kumar, BDS (Lko), MDS (Lko),* Sarwat H. Hashmi, BDS (Lko), MDS (Lko), Neha Agrawal, and Surendra K. Mishra, BDS (Lko), MDS (Lko)*
Abstract
Introduction: The aim of this retrospective study was to determine the prevalence of three-rooted mandibular permanent rst molars among the Indian population by using periapical radiographs. Methods: Five hundred eighty-six patients (320 females and 266 males) were selected, with at least 1 mandibular rst molar. A total of 1054 periapical radiographs of mandibular rst molars, comprising 526 right side and 528 left side, were included. The radiographs were taken at 30degree mesial angulation and were evaluated by using the magnifying lens. The incidence, gender, and symmetry of three-rooted mandibular rst molars were recorded and analyzed by using the c2 test. Results: The prevalence of three-rooted mandibular rst molars was 5.97% for all patients and 4.55% for all teeth, respectively. The incidence of bilateral symmetrical distribution was 37.14%. The incidence was 6.88% for female patients and 4.89% for male patients (c2 = 1.02, P > .05) and 4.94% for the right side and 4.17% for the left side, respectively (c2 = 0.36, P > .05). No statistically signicant differences were found between female and male patients and between the right-side and left-side occurrences. Conclusions: Clinicians should be aware of the high racial prevalence of this unusual root morphology in mandibular rst molars among the Indian population before and during the root canal treatment of three-rooted mandibular rst molars. (J Endod 2010;36:13021306)
Key Words
Radix entomolaris, radix paramolaris, supernumerary root, three-rooted mandibular rst molars
From the *Department of Conservative Dentistry and Endodontics and Department of Oral and Maxillofacial Surgery, Dr. Z. A. Dental College, Aligarh Muslim University, Aligarh (U.P.), India; and Department of Preventive and Community Dentistry, M. S. Ramaiah Dental College and Hospital, Bangalore (Karnataka), India. Address requests for reprints to Dr Amit Kumar Garg, Assistant Professor, Department of Conservative Dentistry and Endodontics, Dr. Z. A. Dental College, Aligarh Muslim University, Aligarh 202002 (U.P.), India. E-mail address: amit_kgdu@rediffmail.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.019
he main objective of root canal treatment is thorough mechanical and chemical debridement of all root canals and their complete obturation with an inert lling material and a coronal lling, preventing the ingress of microorganisms (1). One of the main reasons for the failure of root canal treatment is the inadequate removal of pulp tissue and microorganisms from the root canal system. Root canal anatomy and the confounding nature of the human pulpal system pose signicant challenges in rendering endodontic treatment. Therefore, it is imperative that the aberrant anatomy is identied before and during the root canal treatment of three-rooted mandibular rst molars. It is known that mandibular rst molars might display several anatomical variations, because the number of root canals and number of roots might also vary (2). The major variant in this tooth is the presence of a supernumerary root that can be found distolingually. This macrostructure, rst mentioned by Carabelli, is called radix entomolaris (RE) (3). An RE can be found in the rst, second, and third mandibular molars, occurring the least frequently in the second molar (4). An additional root at the mesiobuccal side is called radix paramolaris (RP). The RE mostly has Vertucci type I canal conguration (5). The RE, which in general is smaller than distobuccal and mesial roots, can be separate from or partially fused with these other roots (6, 7). De Moor et al (1) have classied the RE into 3 types according to the buccolingual variations; type I refers to a straight root, type II to an initially curved entrance that continues as a straight root, and type III to an initial curve in the coronal third of the root canal, followed by a second curve beginning in the middle and continuing to the apical third (1). This supernumerary root in the mandibular rst molar is associated with certain ethnic groups as follows: European, 3.4%4.2% (811); African, 3% (12); Eurasian and Indian, less than 5% (13); Europeans, 4.2% (1, 6, 14); Asians, such as Chinese, Eskimo, and American Indians have 5% to more than 30% (1518), and the overall incidence in German patients was 1.35% (19), and among Taiwanese it was about 21% (20) (Table1). Because of its high frequency in mongoloid populations, the RE is considered to be a normal morphologic variant or eumorphic root morphology (6) and can be seen as the Asiatic trait (16). Among Caucasians, RE is not very common (21, 22) and is considered to be an unusual or dysmorphic root morphology. In dysmorphic supernumerary root, its root formation is related to external factors during odontogenesis (6) or is due to penetration of atavistic gene or polygenic system (6, 17). In eumorphic roots, racial genetic factors inuence the profound expression of a particular gene that results in a more profound phenotypic expression (6). Midtb and Halse (23) concluded that X chromosome deciency inuences root formation. To the best of our knowledge few studies such as ours have been undertaken in the context of the Indian population. This retrospective study was done to evaluate the incidence of three-rooted mandibular permanent rst molars, their gender and siderelated differences among the Indian population, by using periapical radiographs. The results should be of interest to clinical dentists, dental morphologists, and dental anthropologists.

A total of 586 patients retrospective periapical radiographs recorded in the Department of Oral Medicine and Radiology, Dr. Z. A. Dental College, Aligarh Muslim
1302
Garg et al.
JOE Volume 36, Number 8, August 2010 Prevalence of Three-rooted Mandibular Permanent First Molars among the Indian Population
TABLE 1. Survey of Available Studies by Extracted Teeth and Periapical Radiographs on the Prevalence of Three-rooted Mandibular First Molars Periapical radiographs No. of teeth/person Authors
Tratman (13)
3% RM1 3% RM1
5.80 8.60 10.9 0.20 4.20 1.20 8.20 15.6 3.20 2.2 17.8 32.0 5.80 27.0 21.7 14.3 13.4 16.0 19.2 14.6 15.0 18.8 7.9 1/1 11.4 2.80 4.20 21.5 26.9 21.09 1.34
Year
1938
Area of origin
Chinese Malay Javanese Indians* Eurasians Japanese Malaysian Canadian Indians European descent White Japanese descent Aleutian Eskimo American Indians Keewatin Eskimo Bafn Eskimo Guam Chinese Malaysian Thai Hong Kong Chinese Hispanic children Hong Kong Chinese Japanese Singaporean Chinese Japanese descent Negro White Chinese Burmese Thai Taiwanese Taiwanese Germans
Sample
1615 475 110 453 262 168 134 250 422 45 233 263 1983 98 69 400 52 149 364 213 156 100 2331 304 105 106 117 179 139 118 332 332 524
Gender(M/F)
Gender(M/F)
Right
Left
Bilateral
Total
Laband (24) Somogyl-Csizmazia and Simons (25) Souza-Freitas et al (9) Skidmore and Bjorndahl (10) Turner (26) Curzon and Curzon (15) Curzon (27) Hochstetter (28) Jones (29) Reichart and Metah (17) Walker and Quackenbush(18) Steelman (11) Walker (30) Harada et al(31) Loh (14) Ferraz and Pecora (22) Yew and Chan (16) Gulabivala (32) Gulabivala (33) Huang et al (34) Tu et al (20) Schafer et al (19)
3% RM1, % of 3-rooted mandibular 1st molars. *Indian subcontinent. Native American Indians.
1941 1971 1971 1971 1971 1971 1974 1975 1980 1981 1985 1986 1988 1989 1990 1992 1993 2001 2002 2007 2007 2009
135/98
1.65/1
9.87
12.88
22.75
2/1
73/83
1.50/1
2.60
0.60
3.20
6.40
79/87 264/260
10.1 13.0 21.7 17.77 0.68
Clinical Research
0.75 1.33
4.22 0.57
2.41 0.76
14.46
1303
Clinical Research
TABLE 2. Number and Percentage of Three-rooted Mandibular First Molars No. of three-rooted mandibular rst molars Right No. of patients and teeth
Female Male Total patients No. of all right rst molars examined No. of all left rst molars examined Total teeth 320 266 586 526 528 1054
Left %
3.13 1.13 2.22 2.47 1.23
Bilateral %
1.88 1.13 1.54 1.71 0.85
Total No.
22 13 35 26 22 48
No.
10 3 13 13 13
No.
6 3 9 9 9
No.
6 7 13 13 13 26
%
1.88 2.63 2.22 2.47 2.46 2.47
%
6.88 4.89 5.97 4.94 4.17 4.55
University, Aligarh, India from December 2008December 2009 were screened and examined. The bilateral eccentric periapical radiographs (30-degree mesial angulation with protractor) of patients who visited the Department of Conservative Dentistry and Endodontics for treatment of either pain or caries in the mandibular molars were obtained. Each of these patients had at least 1 mandibular rst molar and was of Indian origin. Demographic details including age, sex, and race of all these patients were recorded. The x-ray machine used for tooth identication was EndosAC (Villa Sistemi Medicali Spa, Buccinasco, Italy) (70 kV and 8 mA). Periapical radiographs were taken with Kodak Ultraspeed lms (Eastman Kodak
Ultra-speed lm; Kodak, Rochester, NY). A total of 1054 periapical radiographs of mandibular rst molars of 586 patients (320 females and 266 males) were selected for the study. The radiographs were placed on a viewing box, and the light surrounding the radiograph was blocked. Each radiograph was independently studied by 2 authors (G.A. and T.R.) by using magnifying lens (3). Any disagreement in the interpretation of images was discussed by 2 endodontists, and a consensus was reached (19, 20). The criteria for the indication of an extra root were justied by crossing the translucent lines, dening the pulp space and the periodontal ligaments in the mandibular rst molars (1820). The overall incidence of three-rooted mandibular rst
Figure 1. Periapical radiographs of three-rooted mandibular rst molars showing (A) the distolingual root on the right side unilaterally, (B) the distolingual root on the left side unilaterally, (C) the mesiobuccal root on the right side unilaterally, and (D) the mesiobuccal root on the left side unilaterally.
1304
Garg et al.
Clinical Research
molars in the patients and their correlations between female and male patients and between the right-side and left-side occurrences were analyzed by using the c2 test (19, 20). The bilateral incidence of these three-rooted mandibular rst molars was also evaluated. tion (35). In addition, reports correlate signicantly higher probing depths with attachment loss at the distolingual aspect of three-rooted molars (2, 35). According to Walker and Quackenbush (18), normally a third root should readily be evident in about 90% of cases radiographically, but occasionally it might be difcult to see because of its slender dimensions. In addition, a le placed in such a root might give an artifactual appearance of a perforation. In such instances, an angled view (vertically and horizontally) is always benecial (25). With the distolingually located orice of RE, a modication of the classic triangular opening cavity to a trapezoidal form to locate and access the root canal better is essential; the straight line access must be established (1, 6).
Results
Periapical radiographs of 586 patients, 320 females and 266 males, with age range of 1575 years and average age of 30.3 12.5 years, were studied. The periapical radiographs of 35 patients, 22 females and 13 males, had three-rooted mandibular rst molars. A total of 1054 periapical radiographs of mandibular rst molars comprising 526 right and 528 left molars were evaluated (Table 2). Of these three-rooted mandibular rst molars, 26 were found on the right side and 22 on the left side. The prevalence of patients with three-rooted mandibular rst molar was 5.97% (35 of 586 patients), 6.88% (22 of 320) for female patients and 4.89% (13 of 266) for male patients (Table 2). The prevalence of three-rooted mandibular rst molars from all teeth examined was 4.55% (48 of 1054), 4.94% (26 of 526) for the right side and 4.17%(22 of 528) for the left side occurrences (Table 2). There was no statistical signicant difference in the incidence of three-rooted mandibular rst molars between female and male patients (c2 = 1.02, P > .05) and between the right-side and left-side occurrences (c2 = 0.36, P > .05) (Table 2, Fig. 1). The bilateral incidence of symmetrical distribution was 37.14%.
Conclusion
With the frequency of occurrence of 5.97% among the Indian population, every possible effort should be made for locating an extra root in mandibular rst molars because it might be useful for successful endodontic treatment. Clinicians should be aware of the high racial prevalence of this unusual root morphology in mandibular rst molars while treating Indian patients.
Acknowledgments
The authors thank Prof. Aziz Khan (Department of Community Medicine, AMU, Aligarh) and Prof. A. R. Kidwai (Director, UGC Academic Staff College, AMU, Aligarh) for their guidance and the time and effort they devoted to this study.
Discussion
In the present study, the prevalence of three-rooted mandibular rst molars among the Indian population was 5.97% of all patients and 4.55% of all teeth examined (Table 2). This gure is higher than the result of the study by Tratman (13) (0.20%) among Asiatic Indians and similar to the result of the study by Turner (26) (5.8%) among American Indians and less than the study by Somogyl-Csizmazia and Simons (25) among Canadian Indians (15.6%) (Table1). In this study, there was no signicant difference according to gender (P > .05), which is similar to the recent studies (19, 20). There was also no signicant difference according to the side occurrence (right versus left side, P > .05), which was also similar to the recent study (19). However, some studies reported that three-rooted mandibular rst molars occurred more frequently on the right side than on the left side (11, 20), whereas there are also studies showing that these three-rooted mandibular rst molars occurred more frequently on the left side (21, 32). The bilateral occurrence of three-rooted mandibular rst molars was 37.14% (13 of 35), which was more than the recent study (19) among the German population (0%) and lower than several studies on the Asiatic descent population (56.6%67%) (9, 11, 16, 18, 20). These contradictory variations might be explained by marked differences in the sample size, case selection, and the methods used. Thus, further investigations are necessary to clarify the issue. A comparison of the previous reports is presented in Table 1. There have been several studies of extracted permanent mandibular rst molars (1315, 22, 29, 32, 33), but it is impossible to compare the results of these studies related to gender and bilateral occurrences. The present noninvasive study used 2-dimensional images (periapical radiographs) of patients mandibular rst molar as a tool for studies related to gender and side-related differences. The presence of RE has clinical implications in endodontic treatment. An accurate diagnosis of these supernumerary roots can avoid complications or missing a canal during the root canal treatment (34). Apart from complicating the root canal procedure, RE has been found to be a contributing factor to localized periodontal destruc-
References
1. De Moor RJ, Deroose CA, Calberson FL. The radix entomolaris in mandibular rst molars: an endodontic challenge. Int Endod J 2004;37:78999. 2. Schumann C. Endodontic treatment of a mandibular rst molar with radix entomolaris: a case report. ENDO (Lond Engl) 2008;2:3014. 3. Bolk L. Bemerkungen uber Wurzelvariationen am menschlichen unteren Molaren. Zeitschrift fur Morphologie Anthropologie 1915;17:60510. 4. Visser JB. Beitrag zur Kenntnis der menschlichen Zahnwurzelformen. Hilversum, Netherlands: Rotting; 1948. 4972. 5. Segura-Egea JJ, Jimenez-Pinzon A, Rios-Santos JV. Endodontic therapy in a 3-rooted mandibular rst molar: importance of a thorough radiographical examination. J Can Dent Assoc 2002;68:5414. 6. Calberson FL, De Moor RJ, Deroose CA. The radix entomolaris and paramolaris: clinical approach in endodontics. J Endod 2007;33:5863. 7. Carlsen O, Alexandersen V. Radix entomolaris: identication and morphology. Scand J Dent Res 1990;98:36373. 8. Taylor AE. Variations in the human tooth-form as met with in isolated teeth. J Anat Physiol 1899;33:26872. 9. de Souza-Freitas JA, Lopes ES, Casati-Alvares L. Anatomic variations of lower rst permanent molar roots in two ethnic groups. Oral Surg Oral Med Oral Pathol 1971;31:2748. 10. Skidmore AE, Bjorndahl AM. Root canal morphology of the human mandibular rst molar. Oral Surg Oral Med Oral Pathol 1971;32:77884. 11. Steelman R. Incidence of an accessory distal root on mandibular rst permanent molars in Hispanic children. ASDC J Dent Child 1986;53:1223. 12. Sperber GH, Moreau JL. Study of the number of roots and canals in Senegalese rst permanent mandibular molars. Int Endod J 1998;31:11722. 13. Tratman EK. Three-rooted lower molars in man and their racial distribution. Br Dent J 1938;64:26474. 14. Loh HS. Incidence and features of three-rooted permanent mandibular molars. Aust Dent J 1990;35:4347. 15. Curzon MEJ, Curzon JA. Three-rooted mandibular molars in the Keewatin Eskimo. J Can Dent Assoc 1971;37:713. 16. Yew SC, Chan K. A retrospective study of endodontically treated mandibular rst molars in a Chinese population. J Endod 1993;19:4713. 17. Reichart PA, Metah D. Three-rooted permanent mandibular rst molars in the Thai. Community Dent Oral Epidemiol 1981;9:1912. 18. Walker RT, Quackenbush LE. Three-rooted lower rst permanent molars in Hong Kong Chinese. Br Dent J 1985;159:2989. 19. Schafer E, Breuer D, Janzen S. The prevalence of three-rooted mandibular permanent rst molars in a German population. J Endod 2009;35:2025.
Prevalence of Three-rooted Mandibular Permanent First Molars among the Indian Population
1305
Clinical Research
20. Tu MG, Tsai CC, Jou MJ, et al. Prevalence of three-rooted mandibular rst molars among Taiwanese individuals. J Endod 2007;33:11636. 21. Curzon ME. Three-rooted mandibular permanent molars in English Caucasians. J Dent Res 1973;52:181. 22. Ferraz JAB, Pecora JD. Three-rooted mandibular molars in patients of Mongolian, Caucasian and Negro origin. Br Dent J 1992;3:1137. 23. Midtb M, Halse A. Root length, crown height, and root morphology in Turner syndrome. Acta Odontol Scand 1994;52:30314. 24. Laband F. Two years dental school work in British North Borneo: relation of diet to dental caries among natives. J Am Dent Assoc 1941;28:9928. 25. Somogyl-Csizmazia W, Simons AJ. Three-rooted mandibular rst molars in Alberta Indian Children. J Can Dent Assoc 1971;37:1056. 26. Turner CG 2nd. Three-rooted mandibular rst permanent molars and the question of American Indian origins. Am J Phys Anthropol 1971;34:22941. 27. Curzon MEJ. Miscegenation and the prevalence of three-rooted mandibular rst molars in the Bafn Eskimo. Community Dent Oral Epidemiol 1974;2:1301. 28. Hochstetter RL. Incidence of trifurcated mandibular rst permanent molars in the population of Guam. J Dent Res 1975;54:1097. 29. Jones AW. The incidence of the three-rooted lower rst permanent molar in Malay people. Singapore Dent J 1980;5:157. 30. Walker RT. Root form and canal anatomy of mandibular rst molars in a Southern Chinese population. Dent Traumatol 1988;4:1922. 31. Harada Y, Tomino S, Ogawa K, et al. Frequency of three-rooted mandibular rst molars. Shika Kiso Igakkai Zasshi 1989;31:138. 32. Gulabivala K, Aung TH, Alavi A, et al. Root and canal morphology of Burmese mandibular molars. Int Endod J 2001;34:35970. 33. Gulabivala K, Opasanon A, Ng YL, et al. Root and canal morphology of Thai mandibular molars. Int Endod J 2002;35:5662. 34. Bains R, Loomba K, Chandra A, et al. The radix entomolaris: a case report. ENDO (Lond Engl) 2009;3:1215. 35. Huang RY, Lin CD, Lee MS, et al. Mandibular disto-lingual root: a consideration in periodontal therapy. J Periodontol 2007;78:148590.
1306
Garg et al.
Clinical Research
Biologic Markers for Odontogenic Periradicular Periodontitis

Bruna Burgener, DDS,* Angelique R. Ford, DDS,* Hongsa Situ, DDS,* Mohamed I. Fayad, DDS, MS, PhD,* Jian Jun Hao, BDS, MS, PhD, Christopher S. Wenckus, DDS, FICD,* Bradford R. Johnson, DDS, MHPE,* Ellen A. BeGole, PhD,* and Anne George, PhD
Abstract
Introduction: The diagnosis and assessment of apical periodontitis by traditional periapical radiographs can be challenging and might yield false-negative results. The aim of this study was to determine whether interleukin-1beta (IL-1b) and dentin sialoprotein (DSP) in gingival crevicular uid (GCF) can be used as biological markers for apical periodontitis. Methods: Forty healthy patients with teeth diagnosed with apical periodontitis of pulpal origin were included in the study. GCF samples were obtained from the diseased tooth and from a healthy contralateral control tooth. Total protein concentration in each sample was determined by using the Bio-Rad protein assay. Enzyme-linked immunosorbent assay was used to analyze the concentration of IL-1b and DSP in the samples. Results: Protein content of the GCF was statistically signicantly higher in the disease group compared with the control group. The levels of IL-1b and DSP were not statistically different between disease and control groups. Conclusions: Although this study was unable to demonstrate a significantly higher level of IL-1b or DSP in the GCF of teeth with apical periodontitis, the observed presence of a signicantly higher level of total protein in the GCF of diseased teeth suggests the possible role of total protein level as a marker for periapical disease. (J Endod 2010;36:13071310)
Key Words
Apical periodontitis, biological marker, gingival crevicular uid
From the )Department of Endodontics and Department of Oral Biology, University of Illinois at Chicago College of Dentistry, Chicago, Illinois. Address requests for reprints to Dr Bradford R. Johnson, University of Illinois at Chicago College of Dentistry, Department of Endodontics, 801 S Paulina St, Chicago, IL 60612. E-mail address: bjohnson@uic.edu. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.018
he inammatory periapical lesion is a common sequela of infected pulp necrosis and manifests itself as the host defense response to microbial challenge emanating from the pulp canal system. Numerous cell types, including polymorphonuclear leukocytes, T and B lymphocytes, macrophages, and plasma cells, have been identied in periapical lesions (1). These inammatory cells, especially macrophages, mediate the immunologic response seen in apical periodontitis (2). Bone resorption seen in periradicular lesions is mainly caused by the production of interleukin-1beta (IL-1b) by macrophages (3, 4) and tumor necrosis factorb by T lymphocytes (5). Il-1b is commonly found in human periapical lesions (6). Dentin resorption can also occur during the development of apical periodontitis (7). Dentin sialoprotein (DSP) is a dentin non-collagenous protein involved in the mineralization of predentin into dentin. DSP was found in the gingival crevicular uid (GCF) of patients presenting with external apical root resorption caused by orthodontic movement (8). DSP was once thought to be a dentin-specic protein, but its expression was also demonstrated in bone tissue, although in much lower levels than in dentin (9). Therefore, it is possible that DSP detected in GCF is not exclusively from dentin resorption. Currently, the presence or absence of apical periodontitis is determined by clinical and radiographic examination. Because there is a relatively low incidence of clinical signs and symptoms associated with periradicular periodontitis (10), the diagnosis is established primarily by radiographic ndings in association with pulp vitality tests. Clinical symptoms are present in only approximately 18%24% of teeth with radiographic evidence of apical periodontitis (10, 11). The limitations of radiographic examination in detecting the presence of apical periodontitis are well-known and are related to the amount of bone loss caused by the lesion, the spread of bone resorption into the cortical bone, location in the jaw, and operator variability in radiographic interpretation (12, 13). Recent studies demonstrated that cone beam computed tomography (CBCT) is more accurate in detecting apical periodontitis compared with conventional radiographs (1419). Because both the cost of CBCT and radiation exposure continue to decrease, its use for the assessment of periapical healing will likely become more common. Peripheral body uids such as GCF are often used as identity markers of acute and chronic inammation because the composition of these uids might change as a result of their proximity to an inammatory focus. GCF is the inammatory exudate that can be collected at the gingival crevice. Collection of GCF is simple and presents minimal risk to the patient. Biological markers such as inammatory mediators and neuropeptides were detected in the GCF of patients with periodontal disease (20) and root resorption caused by orthodontic treatment (8). Increased levels of substance P, neurokinin A, and IL-8 were found in the GCF of patients with acute irreversible pulpitis (21, 22). In the presence of active disease associated with apical periodontitis, inammatory mediators and dentin proteins that are released in the periapical tissues might diffuse through the periodontal ligament and subsequently into the gingival crevice. The objective of this study was to test the hypothesis that higher levels of IL-1b and DSP would be detected in the GCF of teeth diagnosed with apical periodontitis compared with healthy control teeth in the same patient. The long-term goal is to develop a reliable, inexpensive, and noninvasive test that could be used as an adjunct to currently used diagnostic tools to detect the presence of active periapical inammation.
1307
Clinical Research
TABLE 1. Protein Concentration (mg/mL) in the Control and Disease Groups Group
Disease group Control group
N
40 40
Mean
66.52 36.69
Standard deviation
50.96 34.05
P value
.003
Figure 1. Filter paper strips were inserted 12 mm into the gingival crevice of each tooth for 30 seconds to collect the GCF sample. (This gure is available in color online at www.aae.org/joe/.)

Forty patients were recruited from the pool of patients seeking routine or emergency treatment in the Postgraduate Endodontics Clinic of the University of Illinois at Chicago (UIC). The UIC Institutional Review Board approved the study. Written and verbal informed consent was obtained from each patient. The inclusion/exclusion criteria for this study were as follows. Participants must be 18 years old or older with an unremarkable medical history and radiographically evident apical periodontitis on a restorable single or multirooted tooth. Patients undergoing rst time root canal therapy (RCT), retreatment RCT, and surgical RCT were included. Pulp vitality testing was performed on teeth that had not been previously treated to conrm pulpal necrosis. Patients were not excluded on the basis of previous or current use of antibiotics or analgesics. Patients were excluded if periodontal probing depths were greater than 4.0 mm on the experimental or control tooth or if bleeding on probing was detected. Patients were also excluded if undergoing orthodontic treatment. GCF was collected from the experimental tooth and a healthy contralateral control tooth in each subject immediately before treatment. Contralateral teeth were examined clinically and radiographically, and cold testing was performed to ensure the tooth had normal pulp and periradicular tissues. One investigator (B.B.) collected all samples. Before sample collection, the tooth was washed gently with water, dried, and isolated with cotton rolls. A saliva ejector was also used to prevent saliva contamination. Filter paper strips (Periopaper; Oraow, Plainview, NY) were then inserted 12 mm into the gingival crevice of each tooth or until mild resistance was sensed. The strips were removed from the gingival sulcus after 30 seconds (Fig. 1). Two additional samples were collected from the same tooth at 5-minute intervals. Samples were rejected if contaminated by blood or saliva. A total of 6 strips were collected from each tooth. After removal from the gingival sulcus, all the strips were immediately placed in a microcentrifuge tube containing ice-cold 1X phosphate-buffered saline solution with 0.1 mmol/L phenylmethylsulfonyl uoride. All patients were treated by endodontic residents according to established standard procedures for nonsurgical or surgical RCT. Patients were referred back to their general dentists for nal restoration and were scheduled for a 6-month follow-up appointment in the Postgraduate Endodontics Clinic for assessment of healing and collection of GCF. 1308
The protein concentration of each sample was determined by the Bradford method (Bio-Rad protein assay; Bio-Rad, Hercules, CA) at 4 C to avoid protein degradation. Bovine serum albumin was used as the standard. After dilution of samples to equalize the protein content of each pair of control and experimental teeth, indirect enzymelinked immunosorbent assay (ELISA) was used to detect and quantify the presence of IL-1b and DSP. All samples were assayed in duplicate. Primary antibody dilutions in this assay were 1:200 for IL-1b (Santa Cruz Biotech Co, Santa Cruz, CA) and 1:2000 for DSP (Dr Anne George, Chicago, IL). The secondary anti-rabbit immunoglobulin G antibody was used at a 1:7000 dilution (Sigma-Aldrich, St Louis, MO). The optical density was measured at 405 nm with a microtiter plate reader (Biotek, Winooski, VT). An independent samples t test was used to compare the protein concentration and the levels of IL-1b and DSP in the GCF of experimental and control groups (SPSS, Chicago, IL). The signicance level was set at P <.05.
Results
Forty diseased and 40 control teeth were tested (37 patients, 24 female and 13 male). The Bradford method for protein concentration showed an average of 66.52 50.96 mg/mL in the diseased group and 36.69 34.05 mg/mL in the control group. There was a statistically signicant difference between the 2 groups (t = 3.08; P = .003) (Table 1). The mean absorbance of IL-1b in the GCF in the diseased group was 0.18 0.06, which was not statistically different compared with the control group, 0.16 0.05 (t = 1.62; P = 0.15) (Table 2). The mean absorbance of DSP was 0.34 0.11 in the diseased group and 0.30 0.09 in the control group. There was no statistically signicant difference between groups (t = 1.78; P = .09) (Table 3).
Discussion
The outcome of RCT is inuenced by a number of factors. One of the most important determinants of success is the status of the pulp and periapical tissues before treatment (10). Periapical radiographs are the most commonly used tool for evaluation of healing after RCT. However, the limitations associated with traditional 2-dimensional radiographic imaging to detect periapical pathosis are well-known (18, 23, 24). In addition, even though the majority of periapical lesions will show radiographic evidence of healing 1 year after treatment (2527), healing progresses in a linear manner, and 34 years might be required to truly evaluate healing (28, 29). A noninvasive tool to measure the presence of active periapical inammation could be a useful adjunct to radiographic evaluation, particularly in cases in which the radiographic interpretation is uncertain. Knowing the status of the immune response and not its consequences could be important in cases with apparently slow healing lesions.
TABLE 2. IL-1b Absorbance in Control and Disease Groups Group

N
40 40
Mean
0.18 0.16
Standard deviation
0.06 0.05
P value
.150
Burgener et al.
Clinical Research
TABLE 3. DSP Absorbance in Control and Disease Groups Group
N
40 40
Mean
0.34 0.30
Standard deviation
0.11 0.09
P value
.086
strate a signicant difference in IL-1b and DSP levels between diseased and control teeth, future studies might identify other biochemical markers for active apical periodontitis.
Acknowledgments
This research was funded in part by a grant from the American Association of Endodontists Foundation. The use of GCF as a diagnostic aid in periodontal disease is not a new concept (30, 31). However, use of GCF as a potential tool for diagnosis of periapical lesions of endodontic origin is a relatively novel concept. Belmar et al (32) found signicantly elevated levels of matrix metalloproteinases (MMP-9 and MMP-2) in the GCF of teeth with periapical lesions. Although the study by Belmar et al was not available as a reference when the current study was designed and conducted, the methods were similar. MMPs in GCF might emerge as useful biological markers for monitoring apical periodontitis (32). Other investigators have found elevated levels of inammatory markers in the GCF of teeth with a clinical diagnosis of irreversible pulpitis (21, 22). Specic organic matrix proteins and cytokines (osteopontin, osteoprotegerin, and receptor activator for nuclear factor kappa B ligand) have been found in higher levels in the GCF of teeth with root resorption as a result of orthodontic movement (33). The results of this study demonstrated a higher level of IL-1b and DSP in the diseased group compared with the control group, but the results did not reach statistical signicance. One possible explanation for this nding could be the dynamics of the development of apical periodontitis. This disease process is characterized by 2 distinct phases, an active bone resorption phase and a chronic phase with little lesion expansion (34). It is possible that IL-1b and DSP levels are elevated only during the active phase of the disease, and if this is the case, IL-1b and DSP might not be suitable markers for apical periodontitis. Samples were prepared and diluted for the ELISA test in a way that equalized the amount of total protein in control and disease samples. This step was necessary because IL-1b and DSP are not exclusively seen in cases of apical periodontitis. The same markers were detected in patients with periodontal disease and root resorption. It was important to use a contralateral endodontically healthy tooth as a control in each patient to rule out false positives as a result of other inammatory conditions. Patients taking antibiotics and anti-inammatory drugs were included in this study. The rationale for this decision was that many patients presenting for endodontic procedures are taking one or both of these types of medication. Even though anti-inammatory drugs could decrease the amount of inammatory mediators such as interleukin, these patients were included in the study. Karapanou et al (22) showed an increased level of IL-8 (CXCL8) in the GCF of patients with irreversibly inamed pulps compared with healthy contralateral teeth. An interesting nding in this study was that if samples were collected after the diseased tooth had received local anesthesia, the levels of CXCL8 dropped to levels similar to those found on healthy teeth, which shows the inuence of anesthesia on the levels of CXCL8. We did not take the time of anesthesia into consideration in our study. Even though most of the samples were collected before anesthesia, some patients received anesthesia before collection, which might have inuenced the results. Controlling for the inuence of local anesthesia and concurrent use of antibiotics or anti-inammatory drugs are relevant considerations for future research. The presence of a signicantly higher concentration of nonspecic protein in the GCF of diseased teeth compared with control teeth was an interesting nding and suggests a potential biochemical marker for periapical disease. Although the current study was unable to demon-
References
1. Barkhordar RA, Desouza YG. Human T-lymphocyte subpopulations in periapical lesions. Oral Surg Oral Med Oral Pathol 1988;65:7636. 2. Metzger Z. Macrophages in periapical lesions. Endod Dent Traumatol 2000;16:18. 3. Dinarello CA. Biology of interleukin 1. Faseb J 1988;2:10815. 4. Heath JK, Saklatvala J, Meikle MC, Atkinson SJ, Reynolds JJ. Pig interleukin 1 (catabolin) is a potent stimulator of bone resorption in vitro. Calcif Tissue Int 1985;37:957. 5. Wang CY, Stashenko P. Characterization of bone-resorbing activity in human periapical lesions. J Endod 1993;19:10711. 6. Barkhordar RA, Hussain MZ, Hayashi C. Detection of interleukin-1 beta in human periapical lesions. Oral Surg Oral Med Oral Pathol 1992;73:3346. 7. Malueg LA, Wilcox LR, Johnson W. Examination of external apical root resorption with scanning electron microscopy. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1996;82:8993. 8. Balducci L, Ramachandran A, Hao J, Narayanan K, Evans C, George A. Biological markers for evaluation of root resorption. Arch Oral Biol 2007;52:2038. 9. Qin C, Brunn JC, Cadena E, et al. The expression of dentin sialophosphoprotein gene in bone. J Dent Res 2002;81:3924. 10. Friedman S, Abitbol S, Lawrence HP. Treatment outcome in endodontics: the Toronto Studyphase 1: initial treatment. J Endod 2003;29:78793. 11. Pekruhn RB. The incidence of failure following single-visit endodontic therapy. J Endod 1986;12:6872. 12. Bender IB, Seltzer S. Roentgenographic and direct observation of experimental lesions in bone: I1961. J Endod 2003;29:7026. discussion 701. 13. Bender IB, Seltzer S. Roentgenographic and direct observation of experimental lesions in bone: II1961. J Endod 2003;29:70712. discussion 701. 14. Estrela C, Bueno MR, Leles CR, Azevedo B, Azevedo JR. Accuracy of cone beam computed tomography and panoramic and periapical radiography for detection of apical periodontitis. J Endod 2008;34:2739. 15. Estrela C, Bueno MR, Azevedo BC, Azevedo JR, Pecora JD. A new periapical index based on cone beam computed tomography. J Endod 2008;34:132531. 16. Estrela C, Bueno MR, De Alencar AH, et al. Method to evaluate inammatory root resorption by using cone beam computed tomography. J Endod 2009;35: 14917. 17. Patel S. New dimensions in endodontic imaging: part 2cone beam computed tomography. Int Endod J 2009;42:46375. 18. de Paula-Silva FW, Wu MK, Leonardo MR, da Silva LA, Wesselink PR. Accuracy of periapical radiography and cone-beam computed tomography scans in diagnosing apical periodontitis using histopathological ndings as a gold standard. J Endod 2009;35:100912. 19. Cotton TP, Geisler TM, Holden DT, Schwartz SA, Schindler WG. Endodontic applications of cone-beam volumetric tomography. J Endod 2007;33:112132. 20. Linden GJ, McKinnell J, Shaw C, Lundy FT. Substance P and neurokinin A in gingival crevicular uid in periodontal health and disease. J Clin Periodontol 1997;24: 799803. 21. Awawdeh L, Lundy FT, Shaw C, Lamey PJ, Linden GJ, Kennedy JG. Quantitative analysis of substance P, neurokinin A and calcitonin gene-related peptide in pulp tissue from painful and healthy human teeth. Int Endod J 2002;35:306. 22. Karapanou V, Kempuraj D, Theoharides TC. Interleukin-8 is increased in gingival crevicular uid from patients with acute pulpitis. J Endod 2008;34:14851. 23. Goldman M, Pearson AH, Darzenta N. Endodontic success: whos reading the radiograph? Oral Surg Oral Med Oral Pathol 1972;33:4327. 24. Patel S, Dawood A, Whaites E, Pitt Ford T. New dimensions in endodontic imaging: part 1conventional and alternative radiographic systems. Int Endod J 2009;42: 44762. 25. Trope M, Delano EO, Orstavik D. Endodontic treatment of teeth with apical periodontitis: single vs multivisit treatment. J Endod 1999;25:34550. 26. Waltimo T, Trope M, Haapasalo M, Orstavik D. Clinical efcacy of treatment procedures in endodontic infection control and one year follow-up of periapical healing. J Endod 2005;31:8636. 27. Penesis VA, Fitzgerald PI, Fayad MI, Wenckus CS, BeGole EA, Johnson BR. Outcome of one-visit and two-visit endodontic treatment of necrotic teeth with apical
1309
Clinical Research
periodontitis: a randomized controlled trial with one-year evaluation. J Endod 2008; 34:2517. 28. Peters LB, Wesselink PR. Periapical healing of endodontically treated teeth in one and two visits obturated in the presence or absence of detectable microorganisms. Int Endod J 2002;35:6607. 29. Weiger R, Axmann-Krcmar D, Lost C. Prognosis of conventional root canal treatment reconsidered. Endod Dent Traumatol 1998;14:19. 30. Golub LM, Kleinberg I. Gingival crevicular uid: a new diagnostic aid in managing the periodontal patient. Oral Sci Rev 1976;4961. 31. Lamster IB. Evaluation of components of gingival crevicular uid as diagnostic tests. Ann Periodontol 1997;2:12337. 32. Belmar MJ, Pabst C, Martinez B, Hernandez M. Gelatinolytic activity in gingival crevicular uid from teeth with periapical lesions. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2008;105:8016. 33. George A, Evans CA. Detection of root resorption using dentin and bone markers. Orthod Craniofac Res 2009;12:22935. 34. Stashenko P, Yu SM, Wang CY. Kinetics of immune cell and bone resorptive responses to endodontic infections. J Endod 1992;18:4226.
1310
Burgener et al.
Clinical Research
Clinical and Radiographic Evaluation of a Resin-based Root Canal Sealer: An Eight-year Update
Osvaldo Zmener, DDS, Dr Odont,* and Cornelis H. Pameijer, DMD, MScD, DSc, PhD
Abstract
Introduction: This retrospective clinical and radiographic study evaluated the 8-year outcome of one-visit endodontic treatment of root canals lled with guttapercha and a methacrylate resinbased sealer (EndoREZ). Methods: From an initial sample size of 180 patients, subsequently 145 and 120 patients were evaluated after 1418 months and 5 years, respectively. Of the remaining patient pool of 120 patients evaluated after 5 years, 112 patients with 212 root canals responded to the 8-year recall. The outcome of treatments was assessed on the basis of clinical and radiographic criteria. Endodontic success was rated on the basis of absence of clinical symptoms, the presence of a normal or slightly widened periodontal ligament space, and absence or substantial reduction in size of preexisting periradicular radiolucencies. Teeth that did not meet these criteria were considered endodontic failures. Results: The root canals had been adequately lled to the working length in 90 teeth (80.35%) and were short in 19 instances (16.96%). None of the roots showing apical extrusion of the sealer immediately postoperatively had radiographic evidence of the sealer in the periradicular tissues after 8 years. At recall, all patients were comfortable and free of clinical symptoms. A life table analysis showed a cumulative probability of success of 86.5% after 8 years, with a 95% condence interval of 79.092.0. Conclusions: The results of this retrospective clinical and radiographic study suggest that the tested methacrylate resin based sealer used in conjunction with gutta-percha cones performed similarly to conventional endodontic sealers during a period of up to 8 years. (J Endod 2010;36:13111314)
uccess or failure rates of treatment modalities are an important part of evidencebased practice of endodontics. Numerous studies have been published evaluating endodontic success and failure by using clinical and radiographic examination (15). Well-dened predetermined clinical and radiographic criteria offer a reliable method to evaluate the long-term results of endodontic therapy (24, 68). A preliminary retrospective study on 180 patients (9) evaluated the results of endodontic treatment of 295 root canals lled with laterally condensed gutta-percha cones in conjunction with EndoREZ (Ultradent Products Inc, South Jordan, UT), a methacrylate resinbased endodontic sealer. After 1424 months, 145 patients were evaluated for a follow-up examination. An overall success rate of 91% was reported. In a second follow-up study performed 5 years after initial therapy, 120 of 180 patients were available for follow-up evaluation (10), and an overall success rate of 90% was reported. Because the outcome of endodontic treatment varies over time, the purpose of this retrospective study was to obtain 8-year postoperative data on the same patient pool that was previously evaluated.

Of the original patient pool (age range, 1275 years) treated in private practice, 112 patients (44.64% male and 55.35% female) with 212 root canals were available for an 8year follow-up examination during which they were clinically and radiographically evaluated. Subjects were contacted by mail or telephone or e-mails were sent requesting they come in for a follow-up examination. Preoperative radiographs were taken during the initial treatment, and the status of pulp and periradicular areas was recorded. All treatments had been completed in a single visit. After administration of local anesthesia, rubber dam was placed, and the pulp chamber was accessed. The canals were handinstrumented with a crown-down technique for radicular access combined with a step-back technique for apical preparation. The coronal two thirds were rst ared with #1-3 Gates Glidden drills (Dentsply/Maillefer, Ballaigues, Switzerland), and the working length was established with a #15 le, approximately 1 mm short of the radio graphic apex. Canal preparation was made with K-type and Hedstrom les (Dentsply/ Maillefer) at the apical third to a master apical #30-40 le and coronally to a #60 le. On occasion, the instrumentation sequence was modied because of difculty in negotiating root canals with complex anatomy. Patency was conrmed with a #10 K-le. Irrigation was performed after every change of instrument by using 2.0 mL of 2.5% NaOCl followed by rinsing with 2.0 mL of sterile saline. After instrumentation, a nal copious rinse with saline was performed. The irrigation solutions were administered with sterile plastic syringes and through 30-gauge endodontic irrigation needles. Excess irrigation solution was removed with sterile paper points; however, the canal walls were kept slightly moist to take maximum advantage of the hydrophilic properties of the resin sealer, thus allowing for deep penetration into the dentinal tubules and promoting a better seal. The canals were then lled with lateral condensation of gutta-percha cones and EndoREZ as the sealer. The access cavities were temporarily sealed with IRM (Dentsply/Caulk, Milford, DE), and the patients were instructed to see their referring dentist for denitive restorative care. During the follow-up evaluation, a clinical examination was performed (percussion), and radiographs were made. Postoperative and recall radiographs were made by using the same x-ray unit with a lm-holder attached to beam-guiding XCP instrument (Rinn Corp, Elgin, IL) and Kodak 32 43 mm ultraspeed lms (Eastman Kodak
Key Words
Endodontic therapy, EndoREZ, methacrylate-based sealers, root canal lling
From the *Postgraduate Program for Specialized Endodontics, Faculty of Medicine, School of Dentistry, University of El Salvador Buenos Aires, Republica Argentina; and Professor Emeritus, University of Connecticut School of Dental Medicine, Farmington, Connecticut. Dr. Pameijer is a consultant for Ultradent Products Inc. Address requests for reprints to Dr Cornelis H. Pameijer, Professor Emeritus, University of Connecticut School of Dental Medicine, 10 Highwood, Simsbury, CT 06070. E-mail address: cornelis@pameijer.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.020
Clinical and Radiographic Evaluation of Resin-based Root Canal Sealer
1311
Clinical Research
TABLE 1. Tooth Number and Location in the Maxillary or Mandibular Arch Evaluated 8 Years Postoperatively Maxillary
Central incisor Lateral incisor Canine First premolar Second premolar First molar Second molar Third molar Total 18 9 12 5 9 8 4 65
Mandibular
2 1 5 9 9 10 8 3 47
Total
20 10 17 14 18 18 12 3 112
The clinical and radiographic data recorded by the 2 examiners were analyzed for interexaminer agreement. The correlation of treatment outcomes with respect to age, gender, and specic preoperative and postoperative data were analyzed by the Fisher exact test (P < .05). Taking into consideration the censored data, ie, the total number of patients who did not respond to the previous 14- to 24-month and 5-year recalls (35 and 25, respectively) (9,10), a life table survival analysis was used to determine the cumulative probability of success of the 8-year recall. A corresponding 95% condence interval was determined.
Company, Rochester, NY). The immediate and 8-year postoperative radiographs were compared in a darkened room by using an illuminated x-ray viewer with a magnifying glass. All radiographs were analyzed by 2 independent and calibrated endodontists with more than 25 years of clinical experience. Calibration was carried out by having the evaluators analyze twice a standard set of 110 individual pairs of postoperative and recall radiographs of endodontic treatments that were randomly selected from the les of 2 private and 1 postgraduate endodontic services. To meet the inclusion criteria, the radiographs had to be of high quality and had to clearly exhibit periapical tissues, widened periodontal space, loss of cortical bone, changes in trabecular patterns, or easily discernible periapical radiolucencies. If there was a disagreement between the evaluators, the x-rays were assessed jointly until a consensus was reached. If necessary, additional radiographs were made at different horizontal angulations to improve visualization, thus improving the reliability of the evaluation. The level of the root canal llings in relation to the working length was recorded, and the quality of the llings was judged to be adequate when they were placed to the full working length and no voids were detected, while special attention was focused on the last 5 mm of the root canal. Canals that did not meet these conditions were categorized as lled short or inadequate. Failure of 1 canal in multirooted teeth was considered a complete failure, regardless whether other canals were rated successful. In cases with apical radiolucencies, the size of the lesions was estimated on the radiographs as being <2 or >2 mm. Success or failure of the endodontic treatment was determined on the basis of radiographic ndings and clinical signs and symptoms according to the following criteria. For success, (1) radiographically, the contours and width of the periodontal ligament (PDL) space were within normal limits or slightly widened around an accidental overll, and the patient was free of symptoms. Slight tenderness to percussion for a brief postoperative period was considered acceptable. (2) The size of a preoperative radiolucent area decreased by at least 50% and the patient was free of symptoms, or the contours and width of the PDL space had returned to normal. (3) Absence of preoperative periapical radiolucency remained unchanged over time. For failure, (1) periapical radiolucency was observed in the preoperative radiograph and remained unchanged or increased in size over time or (2) there was a root that, in absence of preoperative periapical pathosis, developed a radiolucency over time.
TABLE 2. Outcome of Treatment by Gender and Age in Root Canals Filled with Gutta-Percha and EndoREZ after 8 Years Factor
Gender Male Female Age (y) 1230 3155 5675
Results
The examiner calibration showed an interexaminer agreement ratio of 92%, revealing a strong interobserver agreement. Therefore, the radiographic interpretation of the results was considered reliable. The recall rate after 8 years was 62.22%. A total of 112 patients with 212 treated root canals presented for follow-up evaluation. All data collected from the 112 patients were tabulated, and the tooth locations were noted. The number and location of teeth that were evaluated are shown in Table 1. Distribution of patients by age and gender is presented in Table 2. Distribution by signicant preoperative and postoperative factors related to treatment results is shown in Tables 3 and 4, respectively. Fig. 1 is representative of the successful treatment of a lower molar. A postoperative glass ionomer restoration was replaced sometimes after 5 years with a bonded resin composite lling because the general practitioner judged the glass ionomer restoration in need of replacement as a result of breakdown. Ninety teeth (80.35%) were evaluated as adequately lled to the working length. In 19 cases (16.96%) the apical limit of the root lling material was found to be short of the working length. Fifteen (13.39%) of these, which were lled ush at the time of endodontic treatment, underwent slight resorption of the sealer within the lumen of the canals. These cases showed that the end of the root ll was located at 2 mm from the radiographic apex. Three cases in which extrusion of the sealer was radiographically established immediately after treatment showed no radiographic evidence of the sealer in the periradicular tissues. Forty-nine teeth (43.75%) with preoperative vital pulps were successful in 46 cases, whereas 63 (56.25%) with preoperative nonvital pulps were successful in 59 cases. Forty-six teeth (41.07%) with preoperative periapical radiolucencies revealed almost total or total healing in 43 cases, whereas 3 of them were evaluated a failure clinically and radiographically. Sixty-six teeth (58.92%) without preoperative periapical radiolucent areas were successful in 62 instances. In 7 of these, a slight widening of the PDL space was noted, but the teeth were asymptomatic and the radiographs showed the presence of well-dened cortical bone. The remaining 4 teeth were considered a failure clinically and radiographically. Overall, after 8 years, all patients were clinically
TABLE 3. Relation of Preoperative Factors to Treatment Results in Root Canals Filled with Gutta-Percha and EndoREZ Factor
Pulp diagnosis Vital Nonvital Periapical radiolucency Present Absent Lesion size <2 mm >2 mm
No. of cases (%)

49 (43.75) 63 (56.25) 46 (41.07) 66 (58.92) 38 (82.60) 8 (17.39)
Success (%)
46 (93.87) 59 (93.65) 43 (93.47) 62 (93.93) 35 (92.10) 4 (50.00)
Failure (%)
3 (6.12) 4 (6.34) 3 (6.52) 4 (6.06) 3 (7.89) 4 (50.0)
No. of cases (%)

50 (44.64) 62 (55.35) 19 (16.96) 61 (54.46) 32 (28.57)
Success (%)
48 (96.00) 57 (91.93) 17 (89.47) 58 (95.08) 30 (93.75)
Failure (%)
4 (8.00) 3 (4.83) 2 (10.52) 3 (4.91) 2 (6.25)
1312
Zmener and Pameijer
Clinical Research
TABLE 4. Relation of Final Restoration to Treatment Results in Root Canals Filled with Gutta-Percha and EndoREZ Restoration
None Post (with or without crown) Coronal lling (amalgam, composite, glass ionomer, etc)
No. of teeth (%)

2 (1.78) 48 (42.85) 62 (55.35)
Success (%)
46 (95.83) 59 (95.16)
Failure (%)
2 (100) 2 (4.16) 3 (4.83)
comfortable. The differences in the outcome of treatments related to age, gender, preoperative pulp or periapical status, the size of periapical lesions, and the type of permanent restorations were not statistically signicant (P > .05). The life table analysis revealed a cumulative probability of success of 86.5% at the 8-year recall, with a 95% condence interval of 79.092.0.
Discussion
This retrospective 8-year clinical and radiographic cohort study of a methacrylate-based endodontic sealer and gutta-percha was considered reliable and demonstrated a stable outcome of treatment as dened per parameters outlined by rstavik (11). Using a method of evaluating consenting patients following a predetermined clinical and radiographic protocol is considered a reliable procedure when evaluating the outcome of endodontic treatment (24, 68, 12), especially because the evaluation criteria are currently being used by clinicians. In this respect, 2 recent histologic investigations (7, 12) demonstrated a good correlation between radiographic success and the histologic status of the periapical tissues in humans. In common with a previous report (10), the current study was designed to show whether EndoREZ can be recommended for routine use in clinical endodontics. The recall rate of 62.22% after 8 years was within the American Dental Association requirements for subject size in clinical trials as reported by Franco et al (13) and met the required standards for evidence levels (14). It was also comparable to that in previous endodontic follow-up studies (15, 11, 15) and is in agreement with the study by rstavik (11) in that the recall rates in follow-up studies were substantially reduced as the recall period increased. The inuence of the recall rates on the results of the current study deserves some discussion. The 8 patients who were not evaluated either could not be located or did not respond to recall request. This might mean that these patients were without symptoms, they had relocated, or they had returned to the referring dentist when problems occurred. When a patient does not respond to a recall, there is always the possibility that one is dealing with an endodontic failure, and therefore, the data that were generated might not be totally representative of the actual results. It should be noted, however, that the results of endodontic treatments in patients who did not return for follow-up (censored data) are not considered representative of a particular treatment result category (5). It should also be pointed out that the 8 patients who could not be evaluated at this recall were seen at the 5-year followup evaluation and categorized as endodontically successful (10). Data related to the type and location of teeth were pooled because it has been shown that these factors did not skew the outcome of endodontic treatment (36). Factors such as gender and age did not negatively affect the results of the study. These observations are in agreement with our previous ndings (10) and with those of others (5, 6, 15, 16). Furthermore, no signicant differences were found between teeth with vital and nonvital pulps, as has been previously reported by Barbakow et al (3) and Sjogren et al (6). The presence of a preoperative apical radiolucent area did not appear to adversely affect the outcome of endodontic treatment. This observation is in support of our previous ndings (9, 10) but disagrees with others (1, 5, 17, 18) who found signicantly lower success rates in teeth
with infected root canals and preexisting periapical pathosis. However, our results are in agreement with Sjogren et al (6) and Peak et al (19), who showed that the prognosis of teeth with nonvital pulps and preexisting periapical radiolucent areas was as good as that for vital teeth. We can hypothesize that factors such as early coronal aring complemented with a careful instrumentation technique in which the incremental removal of the bulk of infected root dentin, thus allowing for a more effective penetration of irrigants, as well as the previously reported tight seal provided by EndoREZ (20), might have contributed to a more favorable condition for periapical healing. Of further interest is that extrusion of EndoREZ, which accidentally occurred in 10 cases at the initiation of the study, did not show an adverse effect on the outcome of treatments. This is in contradiction with some authors who stated that extrusion of root lling material might interfere with the repair process (17, 21, 22). After 8 years,
Figure 1. (A) Preoperative radiograph of mandibular left second molar. (B) Immediate postoperative view of root canal lling. Tooth was restored with glass ionomer cement. (C) Five-year follow-up radiograph showing no abnormalities. (D) Eight-year recall radiograph demonstrating normal periapical condition. Postoperative glass ionomer restoration was replaced sometime after 5 years with bonded resin composite lling because the general practitioner judged the glass ionomer restoration in need of replacement as a result of breakdown.
Clinical and Radiographic Evaluation of Resin-based Root Canal Sealer
1313
Clinical Research
however, all these cases appeared radiographically normal without evidence of sealer in the periapical tissues. These ndings suggest that the lack of adverse effects from the extruded EndoREZ can be attributed to the good tissue compatibility of the sealer, as has been demonstrated in previous animal studies (23, 24). In the current study, all patients were treated in a single visit. Our results tend to support previous evidence that the single-visit endodontic therapy constitutes a reliable procedure (2529), even in cases with infected root canals and preexisting periradicular pathosis. In this respect, more recent evidence provided by Molander et al (30) and a Cochrane systematic review by Figini et al (31) showed that the outcome of treatment was not signicantly inuenced whether endodontic therapy was performed during a single or multiple visit protocol. Previous studies (5, 6) reported that the type of coronal restoration (single coronal restoration, presence or absence of a post in the canal) did not signicantly affect the outcome of endodontic treatment. In this study, 55.35% presented with single metal/ceramic, amalgam, and resin composite or glass ionomer coronal llings, whereas in 42.85%, posts were present. Two cases were classied as failures. These cases did not show periapical radiolucencies at the time of the initial treatment, whereas at the 5year follow-up (10) the patients were asymptomatic, with no radiographic changes in the periapical tissues and with teeth showing adequate coronal llings. Therefore, they were evaluated as successful after 5 years, whereas at the 8-year recall these teeth presented without coronal restoration and radiographically detectable periapical radiolucent areas. Feedback from these patients revealed that the coronal llings were lost, and the root canals were exposed to saliva for a prolonged period of time. This observation suggests that although EndoREZ offers a good adaptation to the root canal walls (32, 3335), treatment failure might occur as a result of coronal bacterial penetration caused by the loss of coronal protection. In conclusion and within the limitations of this clinical and radiographic study, the results suggest that EndoREZ used in conjunction with gutta-percha constitutes an acceptable root canal lling procedure. Patients recalled after 8 years reported being comfortable with the treated teeth, which continued to be functional. The sealer seems to be well-tolerated by periapical tissues even in cases of accidental extrusion beyond the apical foramen. Furthermore, the success rate was comparable to what had been reported previously (4, 5, 19, 3638) with different endodontic sealers.
8. rstavik D, Qvist V, Stolze K. A multivariate analysis of the outcome of endodontic treatment. Eur J Oral Sci 2004;112:22430. 9. Zmener O, Pameijer CH. Clinical and radiographic evaluation of a resin-based root canal sealer. Am J Dent 2004;17:1922. 10. Zmener O, Pameijer CH. Clinical and radiographical evaluation of a resin-based root canal sealer: a 5-year follow-up. J Endod 2007;33:6769. 11. rstavik D. Time-course and risk analyses of the development and healing of chronic apical periodontitis in man. Int Endod J 1996;29:1505. 12. Ricucci D, Lin LM, Spangberg LSW. Wound healing of apical tissues after root canal therapy: a long-term clinical, radiographic and histopathologic observation study. Oral Surg Oral Med Oral Pathol 2009;108:60921. 13. Franco EB, Benetti AR, Ishikiriama SK, et al. 5-year clinical perfomance of resin composite versus resin modied glass ionomer restorative system in non-carious cervical lesions. Oper Dent 2006;31:4038. 14. Friedman S. Expected outcomes in the prevention and treatment of apical periodontitis. In: rstavik D, Pitt Ford T, eds. Essential endodontology: prevention and treatment of apical periodontitis. 2nd ed. Frederiksberg, Denmark: Blackwell Munksgaard Ltd; 2008:40869. 15. Selden HS. Pulpoperiapical disease: diagnosis and healinga clinical endodontic study. Oral Surg Oral Med Oral Pathol 1974;27:27183. 16. Kerekes K, Tronstad L. Long term results of endodontic treatment performed with a standardized technique. J Endod 1979;5:8390. 17. Seltzer S, Bender IB, Turkenkopf S. Factors affecting successful repair after root canal therapy. J Am Dent Assoc 1963;67:65162. 18. Seltzer S, Bender IB, Smith J, Freedman I, Nazimov H. Endodontic failures: an analysis based on clinical, roentgenographic, and histologic ndings. Oral Surg Oral Med Oral Pathol 1967;23:51730. 19. Peak JD, Hayes SJ, Bryant ST, Dummer PMH. The outcome of root canal treatment: a retrospective study within the armed forces (Royal Air Force). Br Dent J 2001;190: 1404. 20. Pameijer CH, Zmener O. Current status of methacrylate-based sealers and obturation techniques. Pract Proced Aesthet Dent 2006;18:6746. 21. Storms JL. Factors that inuence the success of endodontic treatment. J Can Dent Assoc 1969;35:8397. 22. Seltzer S. Long term radiographic and histological observations of endodontically treated teeth. J Endod 1999;25:81822. 23. Louw NP, Pameijer CH, Norval G. Histopathological evaluation of a root canal sealer in subhuman primates (abstract). J Dent Res 2001;79:654. 24. Zmener O, Banegas G, Pameijer CH. Bone tissue response to a methacrylate-based endodontic sealer: a histological and histometric study. J Endod 2005;31:4579. 25. Oliet S. Singlevisit endodontics: a clinical study. J Endod 1983;9:14752. 26. Soltanoff W. A comparative study of the single-visit and the multiple-visit endodontic procedure. J Endod 1978;4:27881. 27. Pekruhn RB. The incidence of failure following single-visit endodontic therapy. J Endod 1986;12:6872. 28. Weiger R, Rosendahl R, Lost C. Inuence of calcium hydroxide intracanal dressing on the prognosis of teeth with endodontically induced periapical lesions. Int Endod J 2000;33:21926. 29. Field JW, Gutmann JL, Solomon ES, Rauskin H. A clinical radiographic retrospective assessment of the success rate of singlevisit root canal treatment. Int Endod J 2004; 37:7082. 30. Molander A, Warfvinge J, Reit C, Kvist T. Clinical and radiographic evaluation of oneand-two visit endodontic treatment of asymptomatic necrotic teeth with apical periodontitis: a randomized clinical trial. J Endod 2007;33:11458. 31. Figini L, Lodi G, Gorni F, Gagliani M. Single versus multiple visits for endodontic treatment of permanent teeth: a Cochrane systematic review. J Endod 2008;34:10417. 32. Zmener O, Pameijer CH, Macri E. Evaluation of the apical seal in root canals prepared with a new rotary system and obturated with a methacrylate-based endodontic sealer: an in vitro study. J Endod 2005;31:3925. 33. Gillespie WT, Loushine RJ, Weller RN, et al. Improving the performance of EndoRez root canal sealer with a dual-cured two-step self-etch adhesive. IIapical and coronal seal. J Endod 2006;32:7715. 34. Zmener O, Pameijer CH, Alvarez Serrano S, Vidueira M, Macchi RL. Signicance of moist root canal dentin with the use of methacrylate-based endodontic sealers: an in vitro coronal dye leakage study. J Endod 2008;34:769. 35. Herbert J, Bruder M, Braunsteiner J, Altenburger MJ, Wrbas K-T. Apical quality and adaptation of Resilon, EndoRez, and Guttaow root canal llings in combination with a noncompaction technique. J Endod 2009;35:2614. 36. rstavik D, Kerekes K, Eriksen HM. Clinical perfomance of three endodontic sealers. Endod Dent Traumatol 1987;3:17886. 37. Augsburger RA, Peters DD. Radiographic evaluation of extruded obturation materials. J Endod 1990;16:4927. 38. Huumonen S, Lenander-Lumikari M, Sigurdsson A, rstavik D. Healing of apical periodontitis after endodontic treatment: a comparison between a silicone-based and zinc oxide-eugenol-based sealer. Int Endod J 2003;36:296301.
Acknowledgments
The authors would like to thank Prof. R. Macchi for his invaluable input in the statistical analysis of the data.
References
1. Grossman LI, Shepard LI, Pearson LA. Roentgenologic and clinical evaluation of endodontically treated teeth. Oral Surg Oral Med Oral Pathol 1964;17:36874. 2. Heling B, Tamshe A. Evaluation of the success of endodontically treated teeth. Oral Surg Oral Med Oral Pathol 1970;30:5336. 3. Barbakow FH, Cleaton-Jones P, Friedman D. An evaluation of 566 cases of root canal therapy in general dental practice: 2postoperative observations. J Endod 1980;6:4859. 4. Swartz DB, Skidmore AE, Grifn JA. Twenty years of endodontic success and failure. J Endod 1983;9:198202. 5. Friedman S, Lost C, Zarrabian M, Trope M. Evaluation of success and failure after endodontic therapy using a glass ionomer cement sealer. J Endod 1995;21:38490. 6. Sjogren U, Hagglund B, Sundqvist G, Wing K. Factors affecting the long-term results of endodontic treatment. J Endod 1990;16:498504. 7. Green TL, Walton RE, Taylor JK, Merrel P. Radiographic and histologic periapical ndings of root canal treated teeth in cadaver. Oral Surg Oral Med Oral Pathol 1997;83:70711.
1314
Zmener and Pameijer
Clinical Research
Inuence of a Passive Sonic Irrigation System on the Elimination of Bacteria from Root Canal Systems: A Clinical Study
S. Kirk Huffaker, DMD, MDS, Kamran Safavi, DMD, MEd, Larz S.W. Spangberg, DDS, PhD, and Blythe Kaufman, DMD, MDS
Abstract
Introduction: The present investigation evaluated the ability of a new passive sonic irrigation (sonic group) system (EndoActivator) to eliminate cultivable bacteria from root canals in vivo and compared it with that of standard syringe irrigation (control group). Methods: Data were obtained by using bacteriologic sampling of root canals treated by endodontic residents. Sampling results from 1 session of treatment were then compared with results obtained after intervisit calcium hydroxide disinfection and a second session of treatment. Results: There was no signicant difference in the ability of sonic group and control group to eliminate cultivable bacteria from root canals (P > .05). A second session and intervisit calcium hydroxide disinfection were able to eliminate cultivable bacteria from signicantly more teeth than a single session of treatment (P < .05). Conclusions: These in vivo results strengthen the case for a multi-visit approach to the treatment of apical periodontitis. (J Endod 2010;36:13151318)
Key Words
Bacteria, culture, EndoActivator, endodontic treatment, sonic irrigation
From the Division of Endodontology, University of Connecticut Health Center, Farmington, Connecticut. Address requests for reprints to Dr Blythe Kaufman, Division of Endodontology, University of Connecticut Health Center, 263 Farmington Ave, Farmington, CT 06030-1715. E-mail address: blythe.kaufman@gmail.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.024
pical periodontitis is the defense mechanism the human body has developed to keep microbial infection of the root canal system from spreading beyond the apical foramen. Studies have shown that periradicular inammation will not occur without invasion of the root canal system by microorganisms (1, 2). The goal of endodontic treatment is, therefore, the elimination of viable bacteria from the root canal system (3). The timing of when to complete nonsurgical root canal treatment of teeth with apical periodontitis is controversial (4, 5). In controlled, clinical settings, it has been shown that treatment in at least 2 visits with calcium hydroxide disinfection results in improved healing rates (6). On the other hand, meta-analysis suggests there is no statistical difference in the healing rates of single-visit and multi-visit treatments (7). Regardless of when treatment is completed, healing of apical periodontitis is more likely to occur if, before obturation, the root canal system has been disinfected to a level in which bacteria can no longer be cultured (8, 9). The quest to completely eliminate bacteria from root canal systems has resulted in some novel treatment modalities (10, 11). The phenomenon of acoustic microstreaming and cavitation inside of irrigant-lled root canals has been investigated (12). When cavitation bubbles are produced by acoustic waves, they eventually collapse, and the energy released is transferred to the root canal wall, liberating any debris found thereon (13). Microstreaming then carries the debris coronally so that it can be removed from the canal (14). Acoustic cavitation has been shown to remove and destroy biolm (15). The EndoActivator (EA) (Dentsply/Tulsa Dental Specialties, Tulsa, OK) is a cordless, battery-powered handpiece with a sonic motor. It has been developed with the hope of safer, better, and faster.debridement and disruption of the smear layer and biolm (16). This statement is based on the proposed ability of EA to produce cavitation and acoustic streaming inside of root canal systems. Clinical, peerreviewed research is warranted to substantiate this claim. The purposes of this study were (1) to evaluate whether the addition of EA to standard chemomechanical instrumentation results in a greater elimination of cultivable bacteria from root canals compared with standard irrigation (control group) and (2) to compare the ability of one-session treatment to eliminate cultivable bacteria with that of a second session with calcium hydroxide disinfection.

Approval for the project was obtained from the Institutional Review Board of the University of Connecticut Health Center. A power analysis (17) before beginning the study resulted in a sample size of 42 for each independent sample (sonic group or control group) for a total patient recruitment of 84. The 2 groups were randomized by using a computer program (www.randomizer.com), and patients were assigned according to the randomization sequence. Patients with any tooth with apical periodontitis, veried with a radiograph and negative cold test, were recruited for the study. Teeth with apical periodontitis previously treated were excluded. Patient consent was obtained before recruitment. All treatment was performed by 1 of 10 endodontic residents. Each tooth was isolated with rubber dam and disinfected with 30% hydrogen peroxide and 5% iodine tincture to eliminate surface contaminants (18). All caries
Inuence of Passive Sonic Irrigation System on Elimination of Bacteria from Root Canal Systems
1315
Clinical Research
and previous restoration were then removed, and the tooth was disinfected again as before. The tooth was then irrigated with 5% sodium thiosulfate to inactivate the iodine, and a bacteriologic sample was taken by using sterile paper cones and liquid thioglycolate broth enriched with vitamin K1 and hemin in culture tubes. All samples were obtained by the same operator (S.K.H.) throughout the duration of the study to standardize the culture technique. Following disinfection protocol, access was gained to the root canal system, and the canals were preared slightly to allow space for paper cones to enter. The canals were then lled with sterile saline. The contents were absorbed into sterile paper cones placed at the most apical extent of the canal until the canal was dry; the saturated cones were deposited into a culture tube. This sample was taken to conrm the presence of bacteria in the system. In cases with multiple canals, each canal was sampled for viable bacteria. Standard clinical instrumentation protocol followed the second bacterial culture. This involves obtaining working length (WL) approximately 1 mm short of the radiographic apex. This was established with an apex locator (Raypex 4, Johnson City, TN) and conrmed by radiograph. Root canals were then chemomechanically instrumented with hand (Kontrolex K-le; Brasseler USA, Savannah, GA) and EndoSequence rotary instruments (Brasseler USA) to WL by using 0.5% sodium hypochlorite (NaOCl). The size of the master apical le (MAF) was determined by each of the 10 clinicians. Needle irrigation was performed with a 27-gauge side-vented monojet needle (Kendall, Manseld MA). When chemomechanical instrumentation was complete, a treatment card with either EndoActivator or Standard Irrigation printed on it was brought to the resident performing treatment. Both the resident and the operator taking the bacteriologic sample were blinded as to which treatment group the tooth would be assigned before this point. If the card indicated EndoActivator, the following protocol was followed. Each canal was lled with NaOCl, and then EA was inserted into the canal and activated for 30 seconds at 10,000 cpm. Time was kept with a timer. After 30 seconds, a fresh solution of NaOCl was introduced into the canals, and EA was again activated for 30 more seconds for a total of 1 minute. This is in accordance with manufacturer recommendation of 1-minute activation per solution per canal. After activation, canals were then ushed with sterile saline and dried with sterile paper cones. If the card indicated Standard Irrigation, the same protocol was followed but without the use of EA in the canal. Each canal was then ushed with 5% sodium thiosulfate, dried with paper cones, and then lled with sterile saline. A hand le equal in size to the MAF was then inserted into the canals and scraped against the canal walls to remove any debris and bacteria from the canal walls (18). The contents of the canal were then absorbed into paper cones and placed into the culture tubes as before. All samples were then incubated for 7 days and observed for growth daily by the study coordinator. No growth was assigned if turbidity was absent on the seventh day. Following this third sample, each canal was lled with a slurry of calcium hydroxide (Henry Schein, Melville, NY) applied with a lentulo spiral or hand le, and the tooth was temporarily restored with a 4-mm layer of Cavit (3M ESPE, St Paul, MN) covered by Fuji IX (GC Company, Tokyo, Japan). The patient was then scheduled for a second appointment at least 2 weeks later. At the second session, a surface disinfection sample was again taken before reaccessing the tooth. The teeth were then reaccessed, and the canals were irrigated copiously along with any additional instrumentation to remove calcium hydroxide and remaining debris. The EA was not used during the second visit in either of the treatment groups. Needle irrigation with NaOCl was the sole means of irrigation. A postmedication bacteriologic sample was then obtained, and the treatment was completed with root llings placed. Six teeth with no signs of radiographic periapical inammation and vital pulps conrmed by the presence of vital tissue on entry into the pulp chamber were used for negative controls. Three teeth were assigned to the sonic group and 3 to the control group. The entire experimental protocol as described above was performed on these 6 teeth. Data were analyzed (SPSS Statistical pack 17.0; SPSS Inc, Chicago, IL) by using independent and paired-sample t tests. Hypotheses were tested at the .05 level of signicance.
Results
A negative culture was obtained for surface disinfection in 96.5% of the samples. All controls tested negative for growth at the end of the rst and second visits. Bacteria were initially present in the root canals of all 84 teeth treated. Ten patients refused to appear for the second session and were excluded from the data comparing one- and two-session treatment. The data comparing sonic group and control group at the rst session are found in Table 1. After activation of NaOCl with EA, 25 teeth (60%) still harbored cultivable bacteria compared with 22 teeth (52%) for the control group. These differences were not signicant (P > .05). The data comparing one- and two-visit treatment are found in Table 2. At the end of the rst session, 47 teeth (56%) still harbored cultivable bacteria. After calcium hydroxide disinfection and a second session of treatment, 20 teeth (27%) still harbored cultivable bacteria. This difference was signicant (P < .05). There was no signicant difference found at the second visit between teeth assigned to sonic group or control group. At the end of the second session, 9 of 36 and 11 of 38 teeth still harbored bacteria in the sonic group and control group, respectively.
Discussion
When dealing with nonsurgical root canal treatment, clinicians are usually faced with 2 situations. The rst is a tooth with a vital pulp in which the tissue found in the root canal is inamed but not completely infected by microorganisms. When these types of cases present themselves, the treatment is relatively straightforward. In vital cases, all of the clinicians effort is spent removing the sterile tissue aseptically and not introducing microorganisms into the root canal. This type of
TABLE 1. Culture Results for EndoActivator (PSI) and Standard Irrigation (SI) Groups Culture result, 1st visit Negative
Protocol PSI SI Total Count % within protocol Count % within protocol Count % within protocol 17 40.5 20 47.6 37 44.0
Positive
25 59.5 22 52.4 47 56.0
Total
42 100.0 42 100.0 84 100.0
1316
Huffaker et al.
Clinical Research
TABLE 2. Culture Results for One- and Two-visit Treatment Groups Culture result Negative
Treatment group One-visit Two-visit Total Count % within visit result Count % within visit result Count % within visit result 37 44.0 54 73.0 91 57.6
Positive
47 56.0 20 27.0 67 42.4
Total
84 100.0 74 100.0 158 100.0
treatment can usually be completed in 1 treatment session (19). The other situation is more complex. When a patient presents with a tooth that has been infected by bacteria causing periapical bone breakdown, the clinician must use all the means he/she has to kill and remove the invading bacteria and their inammatory by-products from the canal system. In recent years, it has been suggested that les attached to ultrasonic handpieces be used to aid in the irrigation and debridement of infected root canals (20, 21). Recently, the EA has been recommended to enhance the cleaning efcacy of irrigation of root canal systems. Its proposed ability to create sonic waves in irrigating solutions deposited inside of the root canal might aid in the killing of bacteria and debridement of necrotic tissue. In the current study it was not shown that EA improved the ability to eliminate cultivable bacteria from root canal systems. Our study found no signicant difference between the number of negative cultures obtained by standard irrigation and the number obtained with use of EA. This is consistent with the results of a recent in vitro study evaluating bacterial removal in simulated canals by using both EA and needle irrigation (22). One reason for this might be that EA produces only sonic waves. Ultrasonic instruments have been shown to enhance the cleaning efciency of irrigation (23, 25). Stamos et al (24) compared the use of sonically and ultrasonically activated instruments and found that the ultrasonically activated instruments removed signicantly more debris than those that were activated sonically. Node production along activated les is an important part of acoustic streaming (12), resulting in a strong current produced along the activated instrument (14). If the instrument touches the canal wall, the node in the immediate vicinity will be diminished (26). Because it is inevitable that the le will touch the canal wall, it is important to create several nodes along the instrument being activated. Ultrasonic energy has the ability to create several nodes along the length of the le (27). Sonic energy only has the power to produce 1 node along the length of the instrument, so any constraint of the instrument will signicantly decrease, if not eliminate, the acoustic streaming necessary to dislodge and carry away necrotic debris (27). EA might not be powerful enough to disrupt bacterial biolms. Ahmad et al (28) showed that ultrasonically activated instruments could not disrupt bacteria but simply dispersed it to other areas of the canal. Even with ultrasonics, Mayer et al (25) found that only the coronal third of the canal was being cleaned. In that study there was no signicant difference between syringe irrigation and ultrasonic irrigation in the apical third of the canal. This might be due to the activated le touching the canal wall in the apical third and not being able to produce the necessary nodes for acoustic streaming and cavitation (14). If ultrasonic instruments with their constant power supply and increased node production cannot effectively clean in the apical third, it is likely that EA with its battery power and sonic engine will have the same problem.
The ability of a second session of instrumentation and irrigation together with an interappointment medication of calcium hydroxide was compared with a single session of instrumentation and irrigation. Studies have shown that when treatment of necrotic pulps is performed in 2 sessions with calcium hydroxide disinfection, there is a reduction in intracanal bacteria and a greater likelihood of obtaining a negative culture (29). Calcium hydroxide raises the pH of the root canal system to a level at which many microorganisms cannot survive (30). It has also been found that when necrotic tissue has been in direct contact with calcium hydroxide, it becomes more soluble and susceptible to dissolution by NaOCl (31). In the present study it was shown that the addition of calcium hydroxide together with another round of instrumentation and irrigation was effective at eliminating cultivable bacteria from significantly more teeth. In the current study, two-visit treatment with calcium hydroxide disinfection was able to eliminate cultivable bacteria from about 75% of teeth exhibiting apical periodontitis. This is comparable with some studies (29) and is a lower number than other studies (32). It is known that some bacteria are more resistant to the high pH of calcium hydroxide (33). Bacteria living in biolms are also more resistant to NaOCl and the alkaline stress of calcium hydroxide, even when directly exposed in vitro (34). A very important factor in the effectiveness of calcium hydroxide is the ability of the operator to place it effectively. It is essential that the calcium hydroxide be placed in the instrumented canal as a thick, moist paste that completely obturates the canal space (30, 35). The manner in which the calcium hydroxide was mixed and placed was not observed or standardized in this study, and this could be a confounder. If a resistant species of bacteria is present, if bacteria have established themselves as a biolm inside of the canal, or if the operator is not careful about his/her placement of calcium hydroxide, the effectiveness of the dressing will be compromised. One of the greatest benets of multi-visit treatment might be the benet of a second or third opportunity to disrupt biolms and irrigate them out of the root canal (36). Calcium hydroxide is not the only benet in a multi-session approach to apical periodontitis. Our study supports the recommendation to render treatment of teeth exhibiting signs and symptoms of apical periodontitis in at least 2 sessions with the use of calcium hydroxide as an interappointment medicament. The EA did not enhance the ability of standard needle irrigation to eliminate cultivable bacteria from root canals in this study. Other in vivo studies comparing the ability of sonic and ultrasonic instruments to eliminate bacteria from root canals are warranted.
References
1. Kakehashi S, Stanley HR, Fitzgerald RJ. The effects of surgical exposures of dental pulps in germ-free and conventional laboratory rats. Oral Surg Oral Med Oral Pathol 1965;20:3409. 2. Sundqvist G. Bacteriological studies of necrotic dental pulps (dissertation). Sweden: Umea University; 1976.
Inuence of Passive Sonic Irrigation System on Elimination of Bacteria from Root Canal Systems
1317
Clinical Research
3. Abbott PV. The periapical space: a dynamic interface. Aust Endod J 2002;28: 96107. 4. Figini L, Lodi G, Gorni F, Gaglianai M. Single versus multiple visits for endodontic treatment of permanent teeth: a Cochrane systematic review. J Endod 2008;34: 10417. 5. Mohammadi Z, Farhad A, Tabrizizadeh M. One-visit versus multiple-visit endodontic therapy: a review. Int Dent J 2006;56:28993. 6. Katebzadeh N, Sigurdsson A, Trope M. Radiographic evaluation of periapical healing after obturation of infected root canals: an in vivo study. Int Endod J 2000;33:606. 7. Ng YL, Mann V, Rahbaran S, Lewsey J, Gulabivala K. Outcome of primary root canal treatment: systematic review of the literature: part 1effects of study characteristics on probability of success. Int Endod J 2007;40:92139. 8. Sjogren U, Figdor D, Persson S, Sunqvist G. Inuence of infection at the time of root lling on the outcome of endodontic treatment of teeth with apical periodontitis. Int Endod J 1997;30:297306. 9. Molander A, Warfvinge J, Reit C, Kvist T. Clinical and radiographic evaluation of oneand two-visit endodontic treatment of asymptomatic necrotic teeth with apical periodontitis: a randomized clinical trial. J Endod 2007;33:11458. 10. Meire MA, De Prijck K, Coenye T, Nelis Hj, De Moor RJ. Effectiveness of different laser systems to kill Enterococcus faecalis in aqueous suspension and in an infected tooth model. Int Endod J 2009;42:3519. 11. Nielsen BA, Baumgartner JC. Comparison of the EndoVac system to needle irrigation of root canals. J Endod 2007;33:6115. 12. Roy RA, Ahmad M, Crum LA. Physical mechanisms governing the hydrodynamic response of an oscillating ultrasonic le. Int Endod J 1994;27:197207. 13. Leighton TG. The acoustic bubble. New York: Academic Press; 1994. chapters 1 and 2. 14. Ahmad M, Pitt Ford TR, Crum LA. Ultrasonic debridement or root canals: acoustic streaming and its possible role. J Endod 1987;14:4909. 15. Ohl CD, Arora M, Ikink R, et al. Sonoporation from jetting cavitation bubbles. Biophys J 2006;91:428595. 16. Advanced Endodontics: Endoactivator System web page. Available at: http://www. endoruddle.com/?name=endoactivatord (2009). Accessed June 22, 2010. 17. Faul F, Erdfelder E, Lang A-G, Buchner A. G)Power 3: a exible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav Res Methods 2007;39:17591. 18. Moller A JR. Microbiological examination of root canals and periapical tissues of human teeth: methodological studies. Odontol Tidsk 1966;74(Suppl):1380. 19. Trope MB, Bergenholtz G. Microbial basis for endodontic treatment: can a maximal outcome be achieved in one visit? Endod Topics 2002;1:40. 20. Weller RN, Brady JM, Berneir WE. Efcacy of ultrasonic cleaning. J Endod 1980;6: 7403. 21. Goodman A, Reader A, Beck M, Mel R, Meyers W. An in vitro comparison of the efcacy of the step-back technique versus a step-back/ultrasonic technique in human mandibular molars. J Endod 1985;11:24956. 22. Townsend C, Maki J. An in vitro comparison of new irrigation and agitation techniques to ultrasonic agitation in removing bacteria from a simulated root canal. J Endod 2009;35:1040. 23. Sjogren U, Sundqvist G. Bacteriologic evaluation of ultrasonic root canal instrumentation. Oral Surg Oral Med Oral Pathol 1987;63:36670. 24. Stamos DE, Sadehi EM, Haasch GC, Gerstein H. An in vitro comparison study to quantitate the debridement ability of hand, sonic, and ultrasonic instrumentation. J Endod 1987;13:43440. 25. Mayer BE, Peters OA, Barbakow F. Effects of rotary instruments and ultrasonic irrigation on debris and smear layer scores: a scanning electron microscopic study. Int Endod J 2002;35:5829. 26. Stock CJR. Current status of the use of ultrasound in endodontics. Int Nat Dent J 1991;41:17582. 27. Lumley PJ, Blunt L, Walmsey AD, Marquis PM. Analysis of the surface cut in sonic les. Endod Dent Traumatol 1996;12:2405. 28. Ahmad M, Pitt Ford TR, Crum LA, Wilson RF. Effectiveness of ultrasonic les in the disruption of root canal bacteria. Oral Surg. Oral Med Oral Pathol 1990;70:32832. 29. Shuping GB, rstavik D, Sigurdsson A, Trope M. Reduction of intracanal bacteria using nickel-titanium rotary instrumentation and various medications. J Endod 2000;26:7515. 30. Teixeira FB, Leving LG, Trope M. Investigation of pH at different dentinal sites after placement of calcium hydroxide dressing by two methods. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005;99:5116. 31. Andersen M, Lund A, Andreasen JO, Andreasen FM. In vitro solubility of human pulp tissue in calcium hydroxide and sodium hypochlorite. Endod Dent Traumatol 1992; 8:1048. 32. Bystrom A, Claesson R, Sundqvist G. The antibacterial effect of camphorated paramonochlorophenol, camphorated phenol and calcium hydroxide in the treatment of infected root canals. Endod Dent Traumatol 1985;1:1705. 33. Figdor D, Davies JK, Sundqvist G. Starvation survival, growth and recovery of Enterococcus faecalis in human serum. Oral Microbiol Immunol 2003;18:2349. 34. Chavez de Paz LE, Bergenholtz G, Dahlen G, Svensater G. Response to alkaline stress by root canal bacteria in biolms. Int Endod J 2007;40:34455. 35. Figdor D, Sundqvist G. A big role for the very small: understanding the endodontic microbial ora. Aust Dent J 2007;52(Suppl):S3851. 36. Nair PN, Henry S, Cano V, Vera J. Microbial status of apical root canal system of human mandibular rst molars with primary apical periodontitis after one-visit endodontic treatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005; 99:23152.
1318
Huffaker et al.
Clinical Research
Root and Canal Morphology of Mandibular Second Molars in an Indian Population

Prasanna Neelakantan, MDS,* Chandana Subbarao, BDS,* Chandragiri Venkata Subbarao, MDS,* and Mithun Ravindranath, MDS
Abstract
Introduction: There are no reports on the root canal anatomy of Indian mandibular second molars. The aim of this study was to investigate the root and canal morphology of Indian mandibular second molars by a canal staining and tooth clearing technique. Methodology: Mandibular second molars (345) were collected for analyzing the morphology of the roots and root canal systems. The teeth were subjected to a canal staining and clearing technique; after which, the following features were examined under magnication: number and morphology of roots, number of root canals, root canal system congurations (Vertuccis classication and Gulabivalas additional classes), number of apical foramina, and intercanal communications. Results: Most of the second molars had two separate roots (87.8%) with three canals. C-shaped canal morphology was observed in 7.5% of the teeth examined. Both the mesial and distal roots of two rooted molars showed wide variations in canal number and conguration. Type IV and type I canal anatomies were most common in the mesial and distal roots of two rooted second molars, respectively. Approximately 54.84% of the teeth showed two apical foramina, and one specimen (3.8%) of the C-shaped roots showed three apical foramina. Conclusion: The most common root morphology in Indian second molars is the two rooted morphology with three canals. Both the mesial and distal roots showed wide variations in canal anatomy with type IV and type I canal conguration predominating in the mesial and distal roots, respectively. (J Endod 2010;36:13191322)
he knowledge of root canal anatomy has a major inuence on the success rate of endodontic treatment. Root canal anatomy and root morphology may have denitive racial inuences, thereby necessitating the identication of root canal morphologies of different races (1). Studies on the root canal anatomy of mandibular rst and second molars have been performed on several populations (25). The Indian race is generally considered to be a hybrid of several races with characteristics of Caucasian, Mongoloid, and Negroid races, which is generally referred to as the Dravidian race (6). An extensive literature search showed us that there is only one study on the root canal morphology of Indian mandibular rst molars (7). There are no reports, however, on the root and canal morphology of Indian mandibular second molars. The aim of this investigation was to study the root and canal morphology of mandibular second molars of an Indian population using a canal staining and clearing technique.

Three hundred forty-ve mandibular second molars were collected from dental practitioners across the Indian subcontinent. It was ensured that the teeth belonged to indigenous Indians, and no teeth from other minority ethnicities were included. The process of collection was performed by a team of practitioners who were made to understand the aims of the study, and the collection of every tooth was accompanied by a case record stating and conrming the ethnicity of the patients. The teeth were washed under tap water immediately after extraction and stored in distilled water with thymol iodide crystals (Titan Pharma, Mumbai, India) until the collection was complete. The entire collection process was completed in 2 months. The samples were washed thoroughly under tap water and immersed in 2.5% sodium hypochlorite (Prime Dental Products, Mumbai, India) for 30 minutes to remove adherent soft tissue. The staining and clearing protocol was adopted from a previously described method (8). The teeth were immersed in 2.5% sodium hypochlorite for 24 hours followed by ultrasonication for 30 minutes (Ultrasonic Bath; Condent Dental Systems, Bangalore, India). After drying of the teeth, Indian ink was injected into the root canal systems using a 27-G monoject needle assisted by vacuum suction apically. The teeth were subjected to negative pressure for 2 minutes (24 torr or 3,199 Pa), and a reapplication of negative pressure was performed after 3 minutes. After 12 hours of drying, the teeth were decalcied in 10% nitric acid (Merck Limited, Mumbai, India) for 28 to 30 hours. The acid was changed after 24 hours and was stirred every 8 hours. The endpoint of decalcication was determined by examining the relative loss or decrease of radiopacity of enamel and dentin (by taking periodic radiographs) of ve sample teeth. After thorough washing of the decalcied teeth in running tap water for 4 hours, the samples were dehydrated in ascending concentrations of ethanol (70%, 80%, 95%, and 100%; Star Chem, Chennai, India) for 1 day, and the samples were rendered transparent by immersion in methyl salicylate (Star Chem) for 2 days. Digital images of the samples were taken in mesiodistal and buccolingual dimensions and analyzed under 5 magnication by two calibrated endodontists. The following features were analyzed: the number of root canals per root (based on the number of root canal orices in the pulp chamber); the root canal conguration (Vertuccis classication, Fig. 1) (9); and additional classes based on the number of orices, canals, and apical foramina (Gulabivalas classication, Fig. 2) (4), the presence of intercanal communications (communications within different canals in the same root) and the number of apical foramina.
Key Words
Indian, mandibular, molar, root canal, staining and clearing
From the *Department of Conservative Dentistry and Endodontics, Saveetha Dental College and Hospitals, Saveetha University, Chennai, India; and Private Practice, Cochin, Kerala, India. Address requests for reprints to Dr. Prasanna Neelakantan, Plot 1500, 16th Main Road, Anna Nagar West, Chennai, Tamil Nadu, India. E-mail address: prasu_endo@yahoo.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.001
Morphology of Mandibular Second Molars in an Indian Population
1319
Clinical Research
Figure 1. Vertuccis classication of canal congurations.
Figure 2. Gulabivalas additional classes of canal congurations.
Results
The number of roots, root morphology, root canals, canal conguration, apical foramina, and intercanal communications are summarized later. Unless mentioned, the values are in percentage of the total number of teeth examined. Both the endodontist examiners were consistent in reporting their ndings (100% intrarater and interrater agreement), and a test to evaluate examiner reliability was deemed unnecessary.
conguration in the mesial (M) root (75.6% of two-rooted molars) was type IV, whereas the distal (D) root had predominantly type I canal conguration (77.7% of two-rooted molars). The type I and IV canal systems were identied in 24.2% and 16.1% of the three-rooted molars, respectively. Additional canal types were identied in 4% of the teeth examined.
Number of Roots and Root Morphology The most common morphology was two separate roots (83.4%). C-shaped root morphology was observed in 7.5% of the teeth examined (Table 1). Number of Root Canals and Canal Congurations The mesial roots of two-rooted molars commonly showed two canals (86.1% of two-rooted molars), whereas the distal roots of two-rooted molars (77.7% of two-rooted molars) and all roots of three-rooted molars commonly showed one canal (Tables 1 and 2). In molars with two roots, both the mesial and distal roots showed wide variations in canal conguration. The most commonly found canal
Intercanal Communications The highest incidence of intercanal communications was found in the distal roots (81.1%) of two-rooted molars followed by mesial roots (36.8%) of two-rooted molars.
Apical Foramina All roots exhibiting type IV, V, VII, 3-2, and 4-2 canal conguration showed two separate apical foramina (98.6% of two-rooted second molars, 22.5% of three-rooted second molars, and 46.1% of C-shaped roots). Three apical foramina were identied in 3.8% of the teeth (one specimen) with C shaped roots. The other roots showed only one apical foramen.
TABLE 1. Root Morphology and Number of Roots and Root Canals in Mandibular Second Molars (N = 345) Specimen
Two separate roots Three separate roots C-shaped root
Number of specimens
288 (83.4) 31 (8.98) 26 (7.53)
Root
M D MB ML D
One canal
29 (8.4) 224 (64.9) 28 (8.1) 30 (8.69) 26 (7.5) 10 (2.89)
Two canals
248 (71.8) 62 (17.9) 03 (0.86) 01 (0.28) 05 (1.4) 13 (3.76)
Three canals
11 (3.18) 02 (0.57) 01 (0.28)
Four canals
02 (0.57)
Values indicate number of teeth in which each of the features was identied. Values within parentheses are percentages (% of total number of teeth examined). M, mesial; D, distal; MB, mesiobuccal; ML, mesiolingual.
1320
Neelakantan et al.
Clinical Research
Discussion
Intercanal communications
TABLE 2. The Conguration of Root Canal Systems and Intercanal Communications in Mandibular Second Molars (N = 345)
Values indicate number of teeth in which each of the features was identied. Values within parentheses are percentages (% of total number of teeth examined). M, mesial; D, distal; MB, mesiobuccal; ML, mesiolingual. *Type 3-1 canal system. Type 3-2 canal system. Type 4-2 canal system. Type 2-3 canal system.
The methods used in analyzing the root canal morphology are canal staining and tooth clearing (1012); conventional radiographs (13, 14); alternative radiographic techniques (1517); radiographic assessment enhanced with contrast media (18); and, more recently, computed tomographic techniques (19, 20). The most commonly used technique is canal staining and clearing because of its accuracy (4, 1012, 21). The root canal anatomy of Indian teeth by canal staining and the tooth clearing technique has not been studied to date except for a study on premolars (21). Fine details like intercanal communications could be visualized even without ink penetration in some areas, showing that the quality of clearing is a critical factor to ensure the visualization of intricate details of root canal anatomy. In studies evaluating the root canal anatomy, it is very important to have a sufcient sample size in order to apply the results to the general population (4, 22). Hence, it was ensured that molars were collected from practitioners across the country, ensuring ethnicity of the population from which the teeth was extracted. The most commonly observed root morphology was the two separate rooted mandibular second molars (83.4%), which is higher than the prevalence in the Burmese (58.2%) and Thai (54%) populations (4, 5). These two-rooted second molars had one distal canal and two mesial canals, which either had a separate course (76%) or combined in the middle third of the root (5.54%) or apically (0.69%). Mandibular second molars with three roots were observed in 8.98% of the teeth examined in contrast to the report of Gulabivala et al (4) in which no mandibular second molars with three roots were observed. The prevalence of three-rooted second molars is higher than in Thai population and white populations (5, 23). The position of this third root was lingual, which was in agreement with the ndings of Walker (2) and Gulabivala et al (5) who identied the distolingual root in rst molars and proposed that this should be considered as a genetic trait and not a developmental anomaly. We speculate that this consideration may be applicable to this mesiolingual root of the second molars as well. The presence of this root denitely has clinical importance; it may not be visualized radiographically and may give an artifactual impression of a perforation (5). The distolingual root or radix entomolaris was not identied in the cohort investigated in this study. This nding is in agreement with other reports from Chinese, Korean, and white cohorts (2325). C-shaped canal conguration has been shown to have a high prevalence (14%-52%) in the mandibular second molars of Chinese, Japanese, and Lebanese populations (2529). Our study showed that C-shaped canal morphology was noted in 7.5% of the teeth examined, which was similar to the prevalence in the Mongoloid group (10%) but much less than reported in the Burmese (22.4%) populations (5, 20). The root canal conguration of C-shaped canals has been claimed to be complex by some authors (24, 26). Our investigation showed that 38.4% of the C-shaped roots (10 specimens) had a single canal, which was similar to the observation made in Thai population (5) but higher than in Burmese molars (4). C-shaped roots showed wide variations in canal conguration (types I, III, IV, V, VII, 4-2, and 2-3) in accordance with other reports (4, 5, 2426). The presence of a high incidence of transverse anastomoses, lateral canals, and apical deltas in C-shaped canals makes it difcult to clean and seal the root canal system (30). Most of the C-shaped roots (57.6% of the teeth with C-shaped morphology) showed two separate apical foramina, which was in contrast to the ndings of Gulabivala et al (4). The most commonly observed morphology was the two-rooted morphology, with type IV canals and type I canal systems predominating
Additional canal type
7 (2.02)* 4 (1.15) 2 (0.57) 6 (1.73) 38 (11) 2 (0.57) 16 (4.63) 1 (0.28) 224 (64.9) 28 (8.1) D MB Three separate roots (31) 2 (0.57) 18 (5.2) 218 (63.1) 5 (1.44) 7 (2.02) 29 (8.4) Two separate roots (288) M
280 (81.1) 1 (0.28)
127 (36.8)
Type VIII
Type VII
Type VI
Type V
Type III
Type IV
Type II
Root
Specimen
ML D C shaped root (26)
30 (8.6) 26 (7.5) 10 (2.8)
Type I
1 (0.28)
2 (0.57)
1 (0.28) 2 (0.57) 7 (2.02)
2 (0.57) 1 (0.28)
3 (0.86)
2 (0.57) 1 (0.28)
2 (0.57) 12 (3.47)
Morphology of Mandibular Second Molars in an Indian Population
1321
Clinical Research
in the mesial and distal roots, respectively. This has been reported to be a Mongoloid trait (5).
12. Pineda F, Kuttler Y. Mesiodistal and buccolingual roentgenographic investigation of 7275 root canals. Oral Surg Oral Med Oral Pathol 1972;33:10110. 13. Pattanshetti N, Gaidhane M, Al Kandari AM. Root and canal morphology of the mesiobuccal and distal roots of permanent rst molars in a Kuwait populationa clinical study. Int Endod J 2008;41:75562. 14. Fan W, Fan B, Gutmann JL, et al. Identication of a C-shaped canal system in mandibular second molars. Part III. Anatomic features revealed by digital subtraction radiography. J Endod 2008;34:118790. 15. Patel S, Dawood A, Whaites E, et al. New dimensions in endodontic imaging: part 1. Conventional and alternative radiographic systems. Int Endod J 2009;42: 44762. 16. de Oliveira SH, de Moraes LC, Faig-Leite H, et al. In vitro incidence of root canal bifurcation in mandibular incisors by radiovisiography. J Appl Oral Sci 2009;17: 2349. 17. Scarfe WC, Fana CR, Farman AG. Radiographic detection of accessory/lateral canals: use of RadioVisioGraphy and Hypaque. J Endod 1995;21:18590. 18. Plotino G, Grande NM, Pecci R, et al. Three dimensional imaging using micrcomputed tomography for studying tooth macromorphology. J Am Dent Assoc 2006; 137:155561. 19. Sberna MT, Rizzo G, Zacchi E, et al. A preliminary study of the use of peripheral quantitative computed tomography for investigating root canal anatomy. Int Endod J 2009;42:6675. 20. Ng YL, Aung TH, Alavi A, et al. Root and canal morphology of Burmese maxillary molars. Int Endod J 2001;34:62030. 21. Velmurugan N, Sandhya R. Root canal morphology of mandibular rst premolars in an Indian population: a laboratory study. Int Endod J 2009;42:548. 22. Wasti F, Shearer AC, Wilson NHF. Root canal systems of the mandibular and maxillary rst permanent molar teeth of South Asian Pakistanis. Int Endod J 2001;34:2636. 23. Tratman EK. Three-rooted lower molars in man and their racial distribution. Br Dent J 1939;64:26474. 24. Loh HS. Incidence and features of three-rooted permanent mandibular molars. Aust Dent J 1990;35:4347. 25. Song JS, Choi HJ, Jung IY, et al. The prevalence and morphologic classication of distolingual roots in the mandibular molars in a Korean population. J Endod 2010;36:6537. 26. Vertucci FJ, Williams R. Root canal anatomy of mandibular rst molar. J N J Dent Assoc 1974;45:278. 27. Fan B, Min Y, Lu G, et al. Negotiation of C-shaped canal systems in mandibular second molars. J Endod 2009;35:10038. 28. Haddad GY, Nehme WB, Ounsi HF. Diagnosis, classication, and frequency of Cshaped canals in mandibular second molars in the Lebanese population. J Endod 1999;25:26871. 29. Yang ZP, Yang SF, Lin YC, et al. C-shaped root canals in mandibular second molars in a Chinese population. Endod Dent Traumatol 1988;4:1603. 30. Melton DC, Krell KV, Fuller MW. Anatomical and histological features of C-shaped canals in mandibular second molars. J Endod 1991;17:3848.
Conclusions
The most common morphology in Indian mandibular second molars was the two-rooted teeth with three canals (two mesial and one distal). C-shaped canals were found in 7.5% of the teeth, most of which had single canals. The observations made in this study show that Indian mandibular second molars exhibit both Mongoloid and Caucasian traits.
Acknowledgments
The authors wish to thank the Department of Oral and Maxillofacial Surgery, Saveetha University, and the private practitioners across the country for the collection of teeth for this study.
References
1. Sperber GH. The phylogeny and odontogeny of dental morphology. In: Sperber GH, ed. From Apes to Angels. New York: Wiley-Liss; 1999:2159. 2. Walker RT. Root form and canal anatomy of mandibular second molars in a southern Chinese population. J Endod 1988;14:3259. 3. Salwa AY, Abdullah RA, Mohammad FF. Three-rooted permanent mandibular rst molars of Asian and Black groups in the Middle East. Oral Surg Oral Med Oral Pathol 1990;69:1025. 4. Gulabivala K, Aung TH, Alavi A, et al. Root and canal morphology of Burmese mandibular molars. Int Endod J 2001;34:35970. 5. Gulabivala K, Opasanon A, Ng YL, et al. Root and canal morphology of Thai mandibular molars. Int Endod J 2002;35:5662. 6. Reich D, Thangaraj K, Patterson N, et al. Reconstructing Indian population history. Nature 2009;24:48994. 7. Reuben J, Velmurugan N, Kandaswamy D. The evaluation of root canal morphology of the mandibular rst molar in an Indian population using spiral computed tomography scan: an in vitro study. J Endod 2008;34:2125. 8. Robertson D, Leeb IJ, McKee M, et al. A clearing technique for the study of root canal systems. J Endod 1980;6:4214. 9. Vertucci FJ. Root canal morphology of mandibular premolars. J Am Dent Assoc 1978;97:4750. 10. Alavi AM, Opasanon A, Ng YL, et al. Root and canal morphology of Thai maxillary molars. Int Endod J 2002;35:47885. 11. Awawdeh L, Abdullah H, Al-Qudah A. Root form and canal morphology of Jordanian maxillary rst premolars. J Endod 2008;34:95661.
1322
Neelakantan et al.
Basic ResearchBiology
Periapical Bone Regeneration after Endodontic Microsurgery with Three Different Root-end Filling Materials: Amalgam, SuperEBA, and Mineral Trioxide Aggregate
Seung-Ho Baek, DDS, PhD,* Woo Cheol Lee, DDS, PhD,* Frank C. Setzer, DMD, PhD, MS, and Syngcuk Kim, DDS, PhD
Abstract
Introduction: The purpose of this study was to determine the bone regeneration potential to different rootend lling materials by evaluating the distance between the materials and newly regenerated bone after root-end surgery. Material and Methods: Periapical lesions were induced in premolars and molars of ve female beagle dogs. The teeth were treated endodontically after the development of the lesions. After 1 week, the teeth underwent root-end surgery using modern microsurgical techniques. Three different root-end ling materials were used: amalgam (Tytin; Kerr Mfg Co, Romulus, MI), SuperEBA (Bosworth, Skokie, IL), and mineral trioxide aggregates (MTA; Dentsply, York, PA). After 4 months, the dogs were sacriced, and the jaws were prepared for histological sectioning. The distances from the root-end lling materials to the regenerated bone were determined by the evaluation of microradiographic images of the sections with imaging software (Sigma Scan/Image; Jandel Scientic Software, San Rafael, CA). The results were statistically analyzed with analysis of variance using Sigma Stat software (Jandel Scientic Software, San Rafael, CA). Results: The mean distances from the newly regenerated bone were 0.397 0.278 mm in the MTA group, 0.756 0.581 mm in the SuperEBA group, and 1.290 0.386 mm in the amalgam group. There was a statistically signicant difference between the amalgam and MTA groups (p < 0.05). No signicant differences existed for amalgam versus SuperEBA and SuperEBA versus MTA. Conclusion: MTA showed the most favorable periapical tissue response. The distance from MTA to the regenerated bone was similar to the normal average periodontal ligament thickness in dogs. (J Endod 2010;36:13231325)
Key Words
Amalgam, apical bone regeneration, microradiograph, mineral trioxide aggregate, root-end seal, SuperEBA
any established root-end lling materials are being used, and, in addition, several newer materials are now also used for apical surgery. The ideal root-end lling material should be biocompatible, bacteriocidal, or at least bacteriostatic; should be neutral to neighboring tissues; and should provide excellent sealing. Furthermore, it should promote regeneration of the original tissues (1). Amalgam was considered the root-end lling material of choice until the 1990s. However, in recent years, many have questioned the safety and integrity of amalgam in general and as a root-end lling material in particular because it has many disadvantages including the release of ions, mercury toxicity, corrosion and electrolysis, delayed expansion, marginal leakage, and leaving tissue tattoos (24). SuperEBA (Bosworth, Skokie, IL) cement as a root-end lling material was suggested by Oynick and Oynick (5). SuperEBA, a composition of zinc oxide and aluminum oxide mixed with o-ethoxybenzoic acid and eugenol (2, 5, 6), was shown to be superior than amalgam in terms of sealing ability, apical tissue compatibility, and their regeneration potential (7, 8). In a clinical study, the healing success after root-end surgery was 96.4% after 1 year when SuperEBA was used as a root-end lling material in conjunction with microsurgical techniques (9). Mineral trioxide aggregate (MTA) as a root-end lling material was introduced to endodontics by Torabinejad et al in 1993 (10). MTA was shown to have excellent sealing ability (1114) and promoted osteoblast activity (15, 16). It was less cytotoxic than amalgam, IRM, or SuperEBA (11, 17) and had an antimicrobial effect (18). Results of MTA studies in dogs and monkeys showed that MTA caused signicantly less inammation than amalgam. More importantly, cementum bridges formed directly over the MTA root-end llings conrming the tissue friendliness of this material and its potential cementogenic property (1, 19, 20). Microradiography is the process of producing enlarged images of the interior of thin, usually small specimens by the penetration of low-energy (0.1-10 keV) x-rays. Microradiography has been used since 1950 to study the structures and composition of biological material, mainly bone tissue, and is specically designed for bone evaluation. Because this study is about bone regeneration in response to different root-end lling materials, the microradiograph technique was chosen. Histologic evaluation is less powerful than microradiographic evaluation for bone regeneration. Uneven distribution of one mineral was revealed by this technique, and quantitative information was obtained on the mineral content of different areas of bone (21). This study was conducted to compare the distance from root-end lling materials to regenerated bone in contact with amalgam, SuperEBA, and MTA in dog teeth using microradiography.
From the *Department of Conservative Dentistry, School of Dentistry, Seoul National University, Seoul, Korea; and Department of Endodontics, School of Dental Medicine, University of Pennsylvania, Philadelphia, PA, USA. Address requests for reprints to Dr Syngcuk Kim, Department of Endodontics, School of Dental Medicine, University of Pennsylvania, 240 S 40th Street, Philadelphia, PA 19104-6030. E-mail address: syngcuk@pobox.dental.edu. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.008
Periapical Bone Regeneration after Endodontic Microsurgery with Amalgam, SuperEBA, or MTA
1323
Material and Methods
Five healthy female beagle dogs weighing between 7 and 9 kg were used in this study, which was conducted in accordance with a University of Pennsylvania Institutional Review Boardapproved animal protocol. Each animal was anesthetized with an intramuscular injection of 0.7 mg/ kg of acepromazine (Aveco Co Inc, Fort Dodge, IA) as a preanesthetic and an intravenous injection of 0.7 mg/kg of propofol for short-term anesthesia. Subsequently, the general inhalation anesthetic isourane (2%-3%) was administered via an endotracheal tube throughout the surgical procedures. During the surgical phase, a dose of 2% xylocaine with 1:50,000 epinephrine was injected into the surgical site to achieve maximum hemostasis. After recovery from the general anesthesia, each dog was given 0.3 mg/kg butorphenol tartrate (Fort Dodge Laboratories Inc, Fort Dodge, IA) as an analgesic and was kept in a recovery area for observation.
The Induction of Periapical Lesions The pulp tissues of molars and premolars were removed from the canals, and plaque contaminated paper points were placed into the canals and sealed with IRM (Dentsply, York, PA) for 2 weeks. Periapical lesions formed between 4 to 6 weeks and were veried radiographically. At this point, the teeth were treated by nonsurgical root canal treatment, and the access cavities were restored with IRM. Because of the limited time available during short-term anesthesia, the surgical phase could not be performed in the session. In the surgical stage, 1 week after the verication of the periapical radiolucencies and the nonsurgical root canal therapy, full mucoperiosteal triangular aps were made with vertical incisions at the mesial line angle of the cuspids, and intrasulcular incisions were extended to the mesial of the second molars. The cortical and cancellous bones at the apices were removed with a water-cooled high-speed rotary instrument, creating osseous cavities of about 4 4 mm in diameter. After resection of each root end and removal of the radicular lesion, a 3-mm deep root-end cavity was prepared with an ultrasonic KiS tip (Obtura/Spartan, Fenton, MO). All surgical procedures and root-end preparations were performed under an operating microscope at 8 to 24 magnication. The resected roots of 24 teeth were randomly divided into three groups. In group A root ends were lled with amalgam, in group B the lling material was SuperEBA, and in group C the root-end lling was gray MTA. Four months after the last surgical procedure, the dogs were sacriced with intravenous overdoses of sodium pentobarbital (Nembutal; Abbot Lab, North Chicago, IL); 4 months was selected because a complete regeneration of bone had taken place, as evidenced radiographically. The jaws were perfused with a mixture of 10% buffered formalin and 80% ethanol via the carotid arteries. The jaws were then prepared for histological evaluation using a sawing and grinding technique developed by Donath and Breuner (22) for the examination of normal bone and teeth with attached soft tissue. After xation for 1 month, the demineralized specimens were processed for embedding with methylmethacrylate monomer (No.8060061; Merck, Darmstadt, Germany). After polymerization of the methacrylate, sections were cut from the block with an Isomet low-speed saw (No. 11-1180; Beuhler Ltd, Lake Buff, IL). Subsequent grinding and polishing were performed with sandpaper (silicon carbide or alumina grits of 220, 400, 600, or 1,200 grit, Struers, Cleveland, OH) resulting in approximately 80-mm thickness of each specimen. Subsequently, contact microradiographs were prepared. The distance from root-end llings to the regenerated bone was calculated with image software at three points: the buccal margins, the center, and the lingual margins of the root-end llings (Fig. 1). The distance from lling materials to the regenerated alveolar bone
1324
Baek et al.
Figure 1. An enlarged view of a microradiograph of the MTA lling. The proximity of a root-end lling material to the regenerated bone measured. C, center; L, lingual; B, buccal.
was determined using Sigma Scan/Image software (Jandel Scientic Software, San Rafael, CA), whereas the statistical analysis was performed using Sigma Stat software (Jandel Scientic Software, San Rafael, CA). Statistical values for each group of data were subsequently calculated with analysis of variance.
Results
Of the 24 original specimens, 23 were subjected to the microradiographic evaluation. One specimen had to be excluded from the study because the amalgam root-end lling disassociated from the root-end cavity during the healing period. New bone formation on the rootend lling materials was determined by the distance from lling materials to the regenerated alveolar bone. The distance from the center of the root-end lling materials to regenerated bone was calculated at 0.397 0.278 mm in the MTA group, 0.756 0.581 mm in the SuperEBA group, and 1.290 0.386 mm in the amalgam group (Table 1). The MTA group showed superior bone regeneration to the other two root-end lling materials, and there is a statistically signicant difference between the MTA and amalgam groups (p < 0.05). There is no signicant difference in amalgam versus SuperEBA and SuperEBA versus MTA.
Discussion
The ultimate success of periapical surgery depends on the regeneration of a functional periodontal attachment apparatus (23). Regeneration has been dened as the replacement of tissue components in their appropriate locations in the correct amounts and the correct relationship to each other (24). However, biocompatibility and sealing ability after placement of most root-end lling materials are problematic. At present, there is no material that satises each criterion for the ideal root-end lling material. Amalgam, SuperEBA, and MTA as root-end lling materials were chosen in this study because they are used most frequently by clinicians. Amalgam has been and still is the most widely used root-end lling material. Severe inammatory responses to amalgam llings have been reported in dogs (1, 19, 25). Fibrous tissue capsules were found in close proximity to most amalgam root-end llings by Torabinejad et al (20) and Baek et al (1). These ndings clearly show that amalgam is not biologically suitable as a root-end lling material.
TABLE 1. Distance from Filling Material to Regenerated Bone (mm) (Mean Standard Deviation) Buccal side
Amalgam (n = 5) SuperEBA (n = 9) MTA (n = 9) 1.358 0.135 0.783 0.599 0.241 0.063 3. Shahi S, Rahimi S, Lofti M, et al. A comparative study of the biocompatibility of three root-end lling materials in rat connective tissue. J Endod 2006;32:77680. 4. Friedman S. Retrograde approaches in endodontic therapy. Endod Dent Traumatol 1991;7:97107. 5. Oynick J, Oynick T. A study of a new material for retrograde llings. J Endod 1978;4: 2036. 6. Trope M, Lost C, Schmitz HJ, et al. Healing of apical periodontitis in dogs after apicoectomy and retrolling with various lling materials. Oral Surg Oral Med Oral Pathol 1996;81:2218. 7. Pitt Ford TR, Andreasen JO, Dorn SO, et al. Effect of SuperEBA as a root-end lling on healing after replantation. J Endod 1995;21:135. 8. Torabinejad M, Hong CU, Pitt Ford TR, et al. Tissue reaction to implanted super-EBA and mineral trioxide aggregate in the mandible of guinea pigs: a preliminary report. J Endod 1995;21:56971. 9. Rubinstein RA, Kim S. Short-term observation of the results of endodontic surgery with the use of a surgical operation microscope and Super-EBA as root-end lling material. J Endod 1999;25:438. 10. Torabinejad M, Watson TF, Pitt Ford TR. The sealing ability of a mineral trioxide aggregate as a root end lling material. J Endod 1993;19:5915. 11. Torabinejad M, Smith PW, Kettering JD, et al. Comparative investigation of marginal adaptation of mineral trioxide aggregate and other commonly used rootend lling materials. J Endod 1995;21:2959. 12. Torabinejad M, Higa RK, McKendry DJ, et al. Dye leakage of four root end lling materials: effects of blood contamination. J Endod 1994;20:15963. 13. Torabinejad M, Rastegar AF, Kettering JD, et al. Bacterial leakage of mineral trioxide aggregate as a root-end lling material. J Endod 1995;21:10912. 14. Bates CF, Carnes DL, del Rio CE. Longitudinal sealing ability of mineral trioxide aggregate as a root-end lling material. J Endod 1996;22:5758. 15. Koh ET, McDonald F, Pitt-Ford TR, et al. Cellular response to mineral trioxide aggregate. J Endod 1998;24:5437. 16. Torabinejad M, Pitt-Ford TR, Abedi HR, et al. Tissue reaction to implanted root-end lling materials in the tibia and mandible of guinea pigs. J Endod 1998;24:46871. 17. Keiser K, Johnson C, Tipton D. Cytotoxicity of mineral trioxide aggregated using human periodontal ligament broblasts. J Endod 2000;26:28891. 18. Torabinejad M, Hong CU, McDonald F, et al. Physical and chemical properties of a new root end lling material. J Endod 1995;21:34953. 19. Torabinejad M, Hong CU, Lee SJ, et al. Investigation of mineral trioxide aggregate for root-end lling in dogs. J Endod 1995;21:6038. 20. Torabinejad M, Pitt Ford TR, McKendry D, et al. Histologic assessment of mineral trioxide aggregate as a root-end lling in monkeys. J Endod 1997;23:2258. 21. Boivin G, Munier PJ. The degree of mineralization of bone tissue measured by computerized quantitative contact microradiography. Calcif Tissue Int 2002;70: 50311. 22. Donath K, Breuner G. A method for the study of undecalcied bones and teeth with attached soft tissues. J Oral Pathol 1982;11:31826. 23. Andreasen JO, Rud J. Modes of healing histologically after endodontic surgery in 70 cases. Int J Oral Surg 1972;1:14860. 24. Aukhil I. Biology of tooth-cell adhesion. Dent Clin North Am 1991;35:45967. 25. Kimura JT. A comparative analysis of zinc and non-zinc alloys used in retrograde endodontic surgery. Part 1. Apical seal and tissue reaction. J Endod 1982;8: 35963. 26. Regan JD, Gutmann JL, Witherspoon DE. Comparison of Diaket and MTA when used as root-end lling materials to support regeneration of the periradcular tissues. Int J Endod 2002;35:8407. 27. Kim S, Kratchman S. Modern endodontic surgery concepts and practice: a review. J Endod 2006;32:60123. 28. Koh ET, Torabinejad M, Pitt Ford TR, et al. Mineral trioxide aggregate stimulates a biological response in human osteoblasts. J Biomed Mater Res 1997;5:4329. 29. Holland R, Souza V, Nery MJ, et al. Reaction of rat connective tissue to implanted dentin tubes lled with mineral trioxide aggregate or calcium hydroxide. J Endod 1999;25:1616. 30. Holland R, Souza V, Nery MJ, et al. Reaction of dogs teeth to root canal lling with mineral trioxide aggregate or a glass ionomer sealer. J Endod 1999;25:72830. 31. Tani-Ishii N, Hamada N, Watanabe K, et al. Expression of bone extracellular matrix proteins on osteoblast cells in the presence of mineral trioxide. J Endod 2007;33: 8369. 32. Lindhe J, Erickson I. The inuence of trauma from occlusion on reduced but healthy periodontal tissues in dogs. J Clin Periodontol 1976;11:27989.
Center
1.290 0.385 0.756 0.581 0.397 0.278
Lingual side
0.997 0.227 0.684 0.394 0.376 0.156
SuperEBA was very popular in the 1990s. Oynick and Oynick (5) found collagen bers around the material and actually growing into it, which suggested that the EBA was well tolerated by the tissue. Because both SuperEBA and IRM contain eugenol, concern has been expressed about possible harmful effects on the periapical tissues. On subsequent examinations, the SuperEBA group showed fewer inammatory cell inltrates than the amalgam group but more than the MTA group (1, 7). MTA was a relatively new material that became available in the late 1990s. This material appears to be the most promising to date because it comes closest to being the ideal material for root-end lling and the results of reported studies are indeed impressive (1, 15, 16, 20, 26). It was listed as one of the recommended root-end lling materials for endodontic microsurgery (27). Many studies reported MTA as a biocompatible material that induces osteogenesis and odontogenesis (2830). When MTA directly contacts broblast, cementoblast, and osteoblast cells of the periodontal ligament, MTA was more biocompatible and less toxic than SuperEBA (11, 17, 31). This study was limited to the determination of the space between the lling material and the newly formed bone. The distances from the center of the resected root surface containing the MTA lling to the regenerated bone were measured with the expectation that a biologically acceptable material would have a closer proximity to the newly formed bone. From the center of the resected root surface to the bone, the MTA group had the closest distance with 0.397 mm. This distance was two to three times wider in the amalgam and SuperEBA groups (Table 1). The distance between the regenerated bone and the mineral trioxide aggregate in the MTA group of our study was comparable to published data for the normal average PDL thickness in beagle dogs, which was 0.386 0.025 mm (32).
Conclusion
From the center of the resected root surface to the bone, the MTA group had the closest distance. The periodontal ligament (PDL) thickness in the MTA group of our study could be considered a normal average PDL thickness. The gap between the SuperEBA and the amalgam groups were two times and three times wider, respectively, than in the MTA group, suggesting that MTA promotes bone and PDL regenerative ability.
References
1. Baek SH, Plenk H, Kim S. Periapical tissue responses and cementum regeneration with amalgam, SuperEBA, and MTA as root-end lling materials. J Endod 2005;31: 4449. 2. Dorn SO, Gartner AH. Retrograde lling materials: A retrospective success-failure study of amalgam, EBA and IRM. J Endod 1990;16:3913.
Periapical Bone Regeneration after Endodontic Microsurgery with Amalgam, SuperEBA, or MTA
1325
The Role of Heme Oxygenase-1 in the Proliferation and Odontoblastic Differentiation of Human Dental Pulp Cells
Sun-Ju Kim, PhD,* Kyung-San Min, DDS, PhD, Hyun-Wook Ryu, DDS, MSD, HwaJeong Lee, PhD,* and Eun-Cheol Kim, DDS, PhD*
Abstract
Introduction: It was recently reported that heme oxygenase-1 (HO-1) activity is related to stem cell differentiation; however, the involvement of HO-1 in pulp cell growth and differentiation has not been well explored. The purpose of this study was to investigate the role of HO-1 in the growth and differentiation of human dental pulp cells (HDPCs). Methods: We evaluated cell growth by MTT assay, mineralization by alizarin red staining, and differentiation marker mRNA expression by reverse transcriptase polymerase chain reaction. Results: HO-1 induction by cobaltic protoporphyrin IX (CoPP) in HDPCs increased cell growth and mineralization and up-regulated the messenger RNA expression of such odontoblastic markers as alkaline phosphatase, osteopontin, bone sialoprotein, dentin matrix protein-1, and dentin sialophosphoprotein. Carbon monoxide scavenger, iron chelator, HO-1 inhibitor, and HO-1 small interfering RNA (siRNA) attenuated HDPC growth and differentiation. Conclusions: CoPP treatment results in dental pulp cell proliferation and odontoblast differentiation that appears partly mediated by HO-1. Our results suggest that odontoblastic differentiation and growth are positively regulated by HO-1 induction and negatively regulated by HO-1 inhibition. Thus, pharmacologic HO-1 induction might represent a potent therapeutic approach for pulp capping and the regeneration of HDPCs. (J Endod 2010;36:13261331)
Key Words
Differentiation, growth, heme oxygenase-1, human dental pulp cells
uman dental pulp (HDP) healing and repair are the result of successive and interrelated processes, including the proliferation, chemotaxis, and differentiation of dental pulp cells into odontoblasts leading to reparative dentin formation (1). Thus, differentiated and undifferentiated cells within dental pulp may contribute to the dentinal regeneration process (2). Odontoblasts secrete several collagenous and noncollagenous proteins, including osteonectin, osteopontin (OPN), bone sialoprotein, dentin matrix protein-1 (DMP-1), and dentin sialophosphoprotein (DSPP) (3), which have been used as mineralization markers for the odontoblast-/osteoblast-like differentiation of HDP cells (HDPCs) (4). However, the molecular control mechanism underlying the effect of the inductive signal on odontoblastic growth and differentiation remains to be elucidated (5). Heme oxygenase-1 (HO-1, heat shock protein 32) is the inducible isoform of the rate-limiting enzyme responsible for the breakdown of heme into carbon monoxide (CO), biliverdin, and free iron (6). Previously, we reported that the HO-1 pathway plays a key role in the adaptation of cells to stressful conditions and the recovery of HDPCs and periodontal ligament cells (PDLCs) from injurious events (712). Moreover, several studies have shown that HO-1 expression is related to adipogenesis in human mesenchymal stem cells (MSCs) (13), osteoblastic differentiation in PDLCs (7, 12), and neuronal differentiation in MSCs (14). Cobaltic protoporphyrin IX (CoPP), or hemin, has been shown to strongly induce HO-1 expression both in vivo and in vitro (15). Hemin promotes proliferation and differentiation in endothelial progenitor cells (16) and erythroid differentiation in human myeloid leukemia cells (17). In addition, we previously showed that the induction of HO-1 by hemin enhanced the expression of such osteoblastic differentiation markers as OPN, osteonectin, OCN, and bone sialoprotein on PDLCs (7, 12). However, no information is available regarding the effects of HO-1 induction by CoPP on the odontogenic potential of HDPCs. To elucidate the role of HO-1 in HDPCs, we investigated the effects of CoPP (an HO-1 inducer), tin protoporphyrin (SnPP, an HO-1 inhibitor), HO-1 siRNA, and HO-1 metabolites on the growth and differentiation of HDPCs.

From the Departments of *Oral and Maxillofacial Pathology and Conservative Dentistry, School of Dentistry, Wonkwang University, Iksan, South Korea; and Department of Dental Hygiene, Cheongju University, Cheongju, South Korea. This study was supported by a grant from the Korea Healthcare Technology R&D Project, Ministry for Health, Welfare & Family Affairs, Republic of Korea (A084458). Address requests for reprints to Dr Eun-Cheol Kim, Department of Oral and Maxillofacial Pathology, Dental College, Wonkwang University, Sinyoungdong 344-2, Iksan City, Jeonbuk, 570-749, South Korea. E-mail address: eckwkop@ wonkwang.ac.kr. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.011
Reagents Dulbecco modied Eagle medium, fetal bovine serum, and the other tissue culture reagents were obtained from Gibco BRL (Grand Island, NY). CoPP, SnPP, and hemin were obtained from Porphyrin Products (Logan, UT). Hemoglobin (Hb) and desferrioxamine (DFO) were purchased from Sigma (St Louis, MO).
Cell Culture We used the HDPCs lines immortalized by transfection with the telomerase catalytic subunit hTERT gene (18). Cells were cultured in Dulbecco modied Eagle medium supplemented with 10% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin in a humidied atmosphere of 5 % CO2 at 37 C. For mineralization experiments, cells were cultured in osteogenic media (OM) including 50 mg/mL ascorbic acid, 107 mol/L dexamethasone, and 10 mmol/L b-glycerophosphate as described previously (19).
1326
Kim et al.
TABLE 1. RT-PCR Primers Sequence Gene
Heme oxygenase-1 (HO-1) Alkaline phosphatase (ALP) Osteopontin (OPN) Dentin-matrix protein-1 (DMP-1) Dentin sialophosphoprotein (DSPP)
Sequence (5 -3)
Forward: AAGATTGCCCAGAAAGCCCTGG Reverse: AACTGTCGCCACCAGAAAGCTGAG Forward: ACGTGGCTAAGAATGTCATC Reverse: CTGGTAGGCGATGTCCTTA Forward: CCAAGTAAGTCCAACGAAAG Reverse: GGTGATGTCCTCGTCTGTA Forward: CAGGAGCACAGGAAAAGGAG Reverse: CTGGTGGTATCTTCCCCCAGGAG Forward: CAGGAGCACAGGAAAAGGAG Reverse: CTGATTTGCTGCTGTCTGAC GAPDH Forward: CGGAGTCAACGGATTTGGTCGTAT Reverse: AGCCTTCTCCA TGGTGGTGAAGAC
Size (bp)
399 475 347 213 488 306
Cell Viability Assay After treatment of HDPCs with CoPP or other drugs, 50 mL 3-(4,5dimethylthiazol-2-yl)-2.5 diphenyltetrazolin bromide (MTT, 2 mg/mL) was added to each well, and then the samples were incubated for 4 hours and centrifuged (200 g for 10 minutes). After aspiration of supernatant, the cells were lysed and solubilized by the addition of 50 mL dimethyl sulfoxide (DMSO). The absorbance of each sample was analyzed at 540 nm using the microtiter plate reader. Cytotoxicity (%) was calculated relatively to the control. Semiquantitative Reverse Transcriptase Polymerase Chain Reaction Total RNA was extracted from the cells by using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturers instruc-
tions. Then, 1 mg RNA was reverse transcribed for rst-strand complementary DNA synthesis (Gibco BRL, Rockville, MD). The cDNA was amplied in a nal volume of 20 mL containing 2.5 mmol/L magnesium dicholoride, 1.25 U Ex Taq polymerase (Bioneer, Daejeon, Korea), and 1 mmol/L specic primers. The sequences of the specic primers used in this study are detailed in Table 1. Reverse transcriptase polymerase chain reaction products were electrophoresed on 1.5 % agarose gel with 0.5 mg/mL ethidium bromide. Bands were detected by ultraviolet illumination of ethidium bromidestained gels.
Alizarin Red Stain After 2 weeks of differentiation induction, cells were rinsed with phosphate buffered saline, air dried, and xed in ice-cold 95% ethanol for 30 minutes at 20 C. Subsequently, the cells and the matrix were
Figure 1. The effects of CoPP on (A) growth, (B) mineralized nodule formation, and (C) odontoblastic differentiation in HDPCs. Cells were cultured with CoPP at concentrations ranging from 0 to 40 mmol/L for 3, 7, and 14 days in OM with 10 mmol/L b-glycerophosphate, 107 mol/L dexamethasone, and 50 mg/ml L-ascorbic acid. (A) Cell viability was evaluated by using an MTT assay. (B) Mineralization was analyzed by alizarin red staining. (C) The mRNA expression of HO-1 and such odontoblastic differentiation markers as DMP-1, OPN, and DSPP were assessed by RT-PCR analysis. These data are representative of three independent experiments. )Statistically signicant difference as compared with the control, p < 0.05.
HO-1 in Differentiation of Pulp Cells
1327
stained with 40 mmol/L Alizarin red-S (pH = 4.2) for 1 hour at room temperature, washed extensively ve times with deionized water, and rinsed with PBS (without Mg2+ or Ca2+) for 15 minutes. were observed at 40 mmol/L CoPP on days 3 and 7. However, after exposure to CoPP for 14 days, pulp cells showed no difference in cell viability compared with controls. To investigate the potential of HDPCs for odontoblast-like differentiation after CoPP treatment, we used alizarin red staining and assessed the messenger RNA (mRNA) expression of several differentiation markers. In HDPCs, exposure to 40 mmol/L CoPP for 14 days resulted in the stimulation of extracellular mineral deposition (Fig. 1B). Treatment of cells with control (OM) increased mRNA expression of differentiation markers in a time-dependent fashion, with a maximal increase for 14 days. The effect of CoPP on odontogenic gene (eg, DMP-1 and DSPP) and osteoblastic gene (eg, ALP and OPN) mRNA expression was upregulated in a dose- and time-dependent manner (Fig. 1C).
Transfection of siRNA Cells in 6-well plates at a density of 5 105 cells/well were grown for 16 hours and then transfected with 20 pmol siRNA duplexes (Daejon, South Korea) by using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) according to the manufacturers instructions. Silencer Negative Control siRNA (Invitrogen) was used as a negative control and was introduced into the cells using the same protocol. After transfection, cells were cultured in six-well plates at 37 C until needed. Statistical Analysis Values were calculated as the mean and standard deviation. Statistical signicance was evaluated by one-way analysis of variance using the SPSS (Version 11.0; SPSS, Chicago, IL) computer program.
Results
Effects of HO-1 Induction on the Proliferation and Differentiation of HDPCs We rst evaluated the effects of exogenous CoPP on HDPCs growth by using an MTT assay. As shown in Figure 1A, CoPP stimulated cellular viability in a dose-dependent manner after 3 and 7 days of treatment compared with the control. Signicant growth stimulatory effects
Effects of HO-1 Metabolites and Hemin on HDPC Proliferation Differentiation To determine whether the CO and iron released during heme degradation by HO-1 were responsible for the growth and differentiation, we examined the effects of Hb (a CO scavenger, 80 mmol/L) and desferrioxamine (DFO, an iron chelator, 0.5 mmol/L) on the viability and mRNA expression of various differentiation markers in HDPCs. Hb and DFO were used at noncytotoxic doses and had no significant effect on cellular viability at days 3, 7, and 14 (Fig. 2A). The pretreatment of HDPCs with Hb and DFO inhibited HO-1 and the mRNA expression of several differentiation markers, including ALP, OPN, DMP-1, and DSPP, compared with the control (Fig. 2B). To prove
Figure 2. The effects of a CO scavenger, iron chelator, and HO-1 inducer on the (A) viability and (B) odontoblastic differentiation of HDPCs. Cells were treated with Hb (80 mmol/L), DFO (0.5 mmol/L), hemin (20 mmol/L), and CoPP (20 mmol/L) for 7 and 14 days in OM. The same procedure as that described in the legend to Figure 1 was followed. These data are representative of three independent experiments. )Statistically signicant difference as compared to the control, p < 0.05.
1328
Kim et al.
that the differentiation inductive action of CoPP in HDPCs is relevant to HO-1 activation, we examined whether another HO-1 inducer, hemin, also increases HDPC proliferation and differentiation. Hemin increased cell growth after 7 days (Fig. 2A) and the expression of several odontoblastic differentiation markers (Fig. 2B). suppressed cell viability (Fig. 3A) and mineralized nodule formation (Fig. 3B) and the expression of osteogenic supplement medium induced differentiation mRNAs (Fig. 3C) in a dose-dependent manner. We next used RNA interference to knockdown HO-1 expression and assayed cell growth and differentiation after CoPP treatment. The siRNAinduced knockdown of HO-1 treatment alone was found to be associated with a signicant decrease in cell viability in HDPCs. The treatment of HDPCs with HO-1 siRNA resulted in a 35% decrease in CoPP-induced cell viability (Fig. 3D) and blocked the CoPP-induced up-regulation of ALP, OPN, DMP-1, and DSPP mRNA expression, whereas the
Effects of HO-1 Inhibition by SnPP and siRNA on Growth and Odontoblastic Differentiation in HDPCs The involvement of HO-1 in HDPC growth and differentiation was tested using HO-1 siRNA and the specic HO-1 inhibitor SnPP. SnPP
Figure 3. (A and D) The effects of the HO-1 inhibitor SnPP and HO-1 siRNA on growth, (B) mineralized nodule formation, and (C and E) mRNA expression of odontoblastic differentiation markers in HDPCs. (A-C) Experimental group were treated with OM media. (D and E) Cells were transiently transfected with control vector and HO-1 siRNA for 7 days. )Statistically signicant difference as compared with the control, p < 0.05. #Statistically signicant difference as compared with the OM-treated group, p < 0.05. These data are representative of three independent experiments.
1329
transfection of HDPCs with the same amount of nonspecic siRNA was not effective (Fig. 3E). To our knowledge, this study is the rst to show that growth and odontoblastic differentiation in HDPCs is activated by HO-1 induction and attenuated by HO-1 inhibition. Thus, HO-1 is an important cellular target of HDPCs, with clinical implications for pulp capping materials or the regeneration of human dental tissues for tissue engineering.
Discussion
Predictable pulp capping procedures remain problematic, possibly because of the lack of appropriate stimulatory factors for dentin formation. Recently, we showed that simvastatin (20) and mineral trioxide aggregate plus enamel matrix derivative (21) stimulated odontoblastic differentiation in HDPCs. Thus, the activation of stem cells in human pulp represents a potential cellular approach to pulp capping or dentin regenerative treatment (4, 22). Our hypothesis is that the differentiation of HDPCs into odontoblasts can be accelerated by signaling molecules containing HO-1 as a pulpcapping strategy. The aim of this study was to investigate whether HO1 induction by CoPP or hemin promotes growth and differentiation and whether HO-1 inhibition by SnPP, an HO-1 metabolite, and HO-1 siRNA could suppress cell growth and differentiation. CoPP has been shown to be a potent inducer of HO-1 expression and activity in vivo and in vitro (2325). CoPP treatment has antiinammatory effects in macrophages (23) and immunosuppressive effects in monocyte-derived dendritic cells (24). Recently, the upregulation of HO-1 expression was shown to promote osteoblastic differentiation in MSCs (25) and endothelial progenitor cells (16). Our results show that HO-1 induction by CoPP increases cell growth, calcium nodule formation, and mRNA expression of HO-1 and some odontoblastic markers (Fig. 1). These results are consistent with our previous data from PDLCs (7, 12). Thus, the benecial effect of CoPP results in increased growth of HDPCs and odontoblastic differentiation that may partially involve HO-1. Increasing evidence suggests that HO-1 functions in the modulation of differentiation (13, 14); however, the mechanism has not yet been clearly delineated. Ferrous iron released as a result of HO-1 activity rapidly induces the expression of ferritin, thereby protecting cells under oxidizing conditions by sequestering free cytosolic iron (26). CO acts as an activator of guanylyl cyclase in a manner similar to nitric oxidelike retrograde messenger (27) and carries out an anti-inammatory and cytoprotective function (28). In the present study, we showed that CO scavenger and iron chelator blocked the differentiation-inducing effects in OM-stimulated HDPCs (Fig. 2). These results suggest that the CO and iron derived from heme degradation mediate the differentiation of HDPCs. During the course of the study, there was a variation of the dose zero expression of odontoblast-like mRNA markers in Figure 1. A similar pattern was observed in the control groups of Figures 2 and 3 although this was not signicant. This variation could be caused by the fact that different preparation or populations of cells are present in each experiment (29). More work is needed to understand the basic dynamics and differences of human protein or mRNA levels and its variation in individual cells. To determine whether the proliferation and differentiation of HDPCs afforded by CoPP and hemin are associated with HO-1 expression, we used HO-1 siRNA and SnPP. The down-regulation of HO-1 expression by HO-1 siRNA transfection or the arrest of HO activity by the HO inhibitor SnPP blocked OM-induced HO-1, OPN, ALP, DSPP, and DMP-1 mRNA expression (Fig. 3). These expressions appear to be partially blocked, and this partial blockage suggests that odontoblastic differentiation may be partly mediated by an HO-1 dependent pathway in HDPCs. Furthermore, we were able to show that the siRNA-induced knockdown of HO-1 is associated with growth inhibition in HDPCs cells. These data provide evidence for the functional role of HO-1 as an important survival factor in HDPCs. 1330
References
1. Gronthos S, Brahim J, Li W, et al. Stem cell properties of human dental pulp stem cells. J Dent Res 2002;81:53153. 2. Agata H, Kagami H, Watanabe N, et al. Effect of ischemic culture conditions on the survival and differentiation of porcine dental pulp-derived cells. Differentiation 2008;76:98193. 3. Butler WT, Ritchie H. The nature and functional signicance of dentin extracellular matrix proteins. Int J Dev Biol 1995;39:16979. 4. Gronthos S, Mankani M, Brahim J, et al. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 2000;97:1362530. 5. Nakashima M. Bone morphogenetic proteins in dentin regeneration for potential use in endodontic therapy. Cytokine Growth Factor Rev 2005;163:36976. 6. Choi AM, Alam J. Heme oxygenase-1: function, regulation, and implication of a novel stress-inducible protein in oxidant-induced lung injury. Am J Respir Cell Mol Biol 1996;15:919. 7. Lee SK, Choi HI, Yang YS, et al. Nitric oxide modulates osteoblastic differentiation with heme oxygenase-1 via the mitogen activated protein kinase and nuclear factor-kappaB pathways in human periodontal ligament cells. Biol Pharm Bull 2009;32:132834. 8. Min KS, Hwang YH, Ju HJ, et al. Heme oxygenase-1 mediates cytoprotection against nitric oxide-induced cytotoxicity via the cGMP pathway in human pulp cells. Oral Surg Oal Med Oral Pathol Oral Radol Endod 2006;102:8038. 9. Min KS, Kwon YY, Lee HJ, et al. Effects of proinammatory cytokines on the expression of mineralization markers and heme oxygenase-1 in human pulp cells. J Endod 2006;32:3943. 10. Pi SH, Kim SC, Kim HT, et al. Defense of heme oxygenase-1 against cytotoxic and receptor of NF kappa-B ligand inducing effects of hydrogenin human periodontal ligament cells. J Periodontal Res 2007;42:3319. 11. Lee SK, Pi SH, Kim SH, et al. Substance P regulates macrophage inammatory protein 3a/CCL20 with hemein human periodontal ligament cells. Clin Exp Immunol 2007; 150:56775. 12. Kook YA, Lee SK, Son DH, et al. Effects of substance P on osteoblastic differentiation and heme oxygenase-1 in human periodontal ligament cells. Cell Biol Int 2009;33: 4248. 13. Kim DH, Burgess AP, Li M, et al. Heme oxygenase-mediated increases in adiponectin decrease fat content and inammatory cytokines tumor necrosis factor-alpha and interleukin-6 in Zucker rats and reduce adipogenesis in human mesenchymal stem cells. J Pharmacol Exp Ther 2008;325:83340. 14. Barbagallo I, Tibullo D, Di Rosa M, et al. A cytoprotective role for the heme oxygenase-1/CO pathway during neural differentiation of human mesenchymal stem cells. J Neurosci Res 2008;86:192735. 15. Johns DG, Zelent D, Ao Z, et al. Heme-oxygenase induction inhibits arteriolar thrombosis in vivo: effect of the non-substrate inducer cobalt protoporphyrin. Eur J Pharmacol 2009;606:10914. 16. Wang JY, Lee YT, Chang PF, et al. Hemin promotes proliferation and differentiation of endothelial progenitor cells via activation of AKT and ERK. J Cell Physiol 2009; 219:61725. 17. Chou CC, Hsu CY. Involvement of PKC in TPA-potentiated apoptosis induction during hemin-mediated erythroid differentiation in K562 cells. Naunyn Schmiedebergs Arch Pharmacol 2009;379:19. 18. Kitagawa M, Ueda H, Iizuka S, et al. Immortalization and characterization of human dental pulp cells with odontoblastic differentiation. Arch Oral Biol 2007;52:72731. 19. Yasuda Y, Ogawa M, Arakawa T, et al. The effect of mineral trioxide aggregate on the mineralization ability of rat dental pulp cells: an in vitro study. J Endod 2008;34: 105760. 20. Min KS, Lee YM, Hong SO, et al. Simvastatin promotes odontoblastic differentiation and expression of angiogenic factors via heme oxygenase-1 in primary cultured human dental pulp cells. J Endod 2010;36:44752. 21. Min KS, Yang SH, Kim EC. The combined effect of mineral trioxide aggregate and enamel matrix derivative on odontoblastic differentiation in human dental pulp cells. J Endod 2009;35:84751. 22. Shi S, Bartold PM, Miura M, et al. The efcacy of mesenchymal stem cells to regenerate and repair dental structures. Orthod Craniofac Res 2005;8:1919. 23. Lin HY, Shen SC, Lin CW, et al. Cobalt protoporphyrin inhibition of lipopolysaccharide or lipoteichoic acid-induced nitric oxide production via blocking c-Jun N-terminal kinase activation and nitric oxide enzyme activity. Chem Biol Interact 2009;180:20210.
Kim et al.
24. Listopad J, Asadullah K, Sievers C, et al. Heme oxygenase-1 inhibits T cell-dependent skin inammation and differentiation and function of antigen-presenting cells. Exp Dermatol 2007;16:66170. 25. Vanella L, Kim DH, Asprinio D, et al. HO-1 expression increases mesenchymal stem cell-derived osteoblast but decreases adipocyte lineage. Bone 2010;46:23643. 26. Ward RJ, Kuhn LC, Kaldy P, et al. Control of cellular iron homeostasis by ironresponsive elements in vivo. Eur J Biochem 1994;220:92731. 27. Verma A, Hirsch DJ, Glatt CE, et al. Carbon monoxide: a putative neural messenger. Science 1993;259:3814. 28. Otterbein LE, Bach FH, Alam J, et al. Carbon monoxide has anti-inammatory effects involving the mitogen-activated protein kinase pathway. Nat Med 2000;6: 4228. 29. Raser JM, OShea EK. Noise in gene expression: origins, consequences, and control. Science 2005;309:20103.
1331
Transforming Growth Factor b1Induced Heat Shock Protein 27 Activation Promotes Migration of Mouse Dental Papilladerived MDPC-23 Cells
Seong-Min Kwon, MS,* Soo-A. Kim, PhD, Jung-Hoon Yoon, DDS, PhD,* and Sang-Gun Ahn, PhD*
Abstract
Introduction: Transforming growth factor b1 (TGFb1) regulates cellular functions including cell growth, differentiation, angiogenesis, migration, and metastasis. The TGFb1 signal transduction pathways are mostly undened in mouse dental papilla-derived MDPC-23 cells. In this study, we investigated TGFb1-induced migration focusing on heat shock protein 27 (Hsp27) activation. Methods: Cellular responses mediated by TGFb1 in MDPC-23 cells were measured by Western blot and MTT assays. Cell migration was determined by counting migrated cells using the chemotaxis cell migration assay. Results: TGFb1 induced cell migration and increased the phosphorylation of Hsp27 and p38 MAPK in MDPC-23 cells. However, TGFb1 did not affect Akt/NF-kB signaling to regulate the migration of MDPC23 cells. Inhibiting p38 MAPK with SB203580 blocked TGFb1-induced Hsp27 activation and cell migration. Conclusion: Hsp27 phosphorylation followed by p38 MAPK activation was required for TGFb1-induced migration, and Hsp27 itself contributed to MDPC-23 cell migration. (J Endod 2010;36:13321335)
Key Words
Heat shock protein 27, MDPC-23, p38 MAPK, transforming growth factor b1
ransforming growth factor b (TGFb) is a multifunctional cytokine that regulates a variety of cellular processes such as proliferation, migration, differentiation, apoptosis, and immune responses in numerous cell types (13). Recent studies have suggested that TGFb-induced migration and invasion is mediated by several factors such as phosphatidylinositol 3-kinase (PI3K) and mitogen-activated protein kinases (p38 MAPK and ERK) in cancer and smooth muscle cells (4, 5). Furthermore, TGFb1 induces the secretion of several dentin matrix proteins associated with primary dentinogenesis through smooth muscle actin (SMA)- and mothers against decapentaplegic (MAD)-related protein (SMAD) signaling in dental pulp cells (6, 7). Previously, the expression of heat shock protein 27 (Hsp27) has been reported in odontoblast and ameloblasts during tooth development (8, 9). Hsp27 is an adenosine triphosphate-independent molecular chaperone that protects cells from external stimuli and chemotherapeutic agents (10). Phosphorylation of Hsp27 was shown to be necessary for actin formation, stabilization of focal adhesions, and promotion of cell migration through signal transducer and activator of transcription 3 (STAT3) signaling and focal adhesion kinase signaling (11, 12). Cell migration is critical for a variety of processes, including angiogenesis, inammation, development, wound healing, and tumor metastasis. It has been shown that cell migration is regulated by various signaling pathways, including b1 integrin, Akt, extracellular signal-regulated kinase (ERK), and NF-kBdependent pathways in human cancer cells (5, 13). Although the roles of TGFb1 and Hsp27 in cell migration have been studied in some cancer cell lines, the roles of these proteins in dental pulp and/or papilla cells remain largely unknown. In this study, we investigated whether TGFb1 is involved in the migration of mouse dental papilla derived MDPC-23 cells. We showed that TGFb1 induces the phosphorylation of Hsp27 through p38 MAPK activation, which mediates the migration of MDPC23 cells.
From the *Department of Pathology, School of Dentistry Chosun University, Gwangju, Korea; and Department of Biochemistry, Oriental Medicine Dongguk University, Gyeongju, Korea. Supported by the Korea Science and Engineering Foundation (KOSEF) grant funded by the Korea government (MOST) (no. R13-2008-010-01001-0), the Korean Research Foundation Grant funded by the Korean Government (MOEHRD, Basic Research Promotion Fund) (KRF-2007-331- C00208), and the National R&D Program for Cancer Control, Ministry of Health & Welfare, Republic of Korea (0720430). Address requests for reprints to Dr Sang-Gun Ahn or Dr. Jung-Hoon Yoon, Department of Pathology, School of Dentistry Chosun University, Gwangju 501-759, Korea. E-mail address: ahnsg@chosun.ac.kr or jhyoon@chosun.ac.kr. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.010

Reagents and Antibodies TGFb1 was purchased from R&D System (Minneapolis, MN). The p38 inhibitor SB203580 was purchased from Sigma-Aldrich Corporation (St Louis, MO). The primary antibodies used were mouse anti-p38 MAPK monoclonal antibody, antiphospho-p38MAPK (Thr180/Tyr182) polyclonal antibody, anti-Hsp27 monoclonal antibody, and antiphospho-Hsp27 (Ser82) polyclonal antibody (Santa Cruz, CA). Cell Culture We used an MDPC-23 cell line derived from 18- to 19-day-old CD-1 fetal mouse molar dental papilla (14). The mouse MDPC-23 cells were maintained in Dulbecco modied Eagle medium supplemented with 10% fetal bovine serum, 1 modied Eagle medium nonessential amino acids, 100 U/mL penicillin, and 100 mg/mL streptomycin in a humidied atmosphere containing 5% CO2 and 95% air at 37 C. MTT Assay Briey, cells (1 105 per well) were seeded into 12-well plates. Before testing, 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl-tetrazolium bromide (MTT) solution
1332
Kwon et al.
Figure 1. The effect of TGFb1 on cell proliferation and migration of MDPC-23 cells. (A) MDPC-23 cells were incubated with 1 ng/mL of TGFb1 for 24 or 48 hours. Cell proliferation was analyzed by MTT assay. (B) MDPC-23 cell migration induced by TGF-b1 (1 ng/mL) was measured by a transwell assay. The graph represents the relative number of cells from three separated experiments. A p value <0.001 was regarded as statistically signicant when compared with the control.
(5 mg/mL in PBS) was added, and cells were incubated at 37 C for 3 hours. The culture medium was then aspirated, and acid isopropanol (0.04 mol/L hydrogen chloride (HCl) in isopropanol) was added to dissolve the dark blue crystals. The optical density value of the dissolved solute was then measured using a Microplate Autoreader (Bio-Tek Instruments Inc., Winooski, VT) at a wavelength of 570 nm.
As shown in Figure 1A, TGFb1 did not affect the cell growth. We evaluated the effects of TGFb1 on the migration of MDPC-23 cells. A clearly a number of cells treated with TGFb1 migrated than did the control cells (Fig. 1B).
Cell Migration Assay The cell migration assay was performed using a Chemotaxis Cell Migration Assay kit (CHEMICON, Millipore Corporation, Billerica, MA) according to the manufacturers instructions. The cells (1 104) were allowed to migrate for 24 hours at 37 C in a humidied atmosphere containing 5% CO2. The cells that migrated to the lower surface of the membrane were xed with methanol and stained with hematoxylin for 5 minutes. Images were captured using an Olympus BX41 (Tokyo, Japan) inverted microscope, and migrated cells were counted. The number of migrated cells was counted from three independent experiments. Western Blot Analysis The total protein was extracted from control and TGFb1-treated MDP-C23 cells and then extracted using lysis buffer (1% Triton X-100 (Bio-Rad, Quarry Bay, Hong Kong), 150 mmol/L NaCl, 5 mmol/L EDTA, and protease inhibitors). Equal amounts of protein were electrophoresed on 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a polyvinylidene uoride (PVDF) membrane. All primary antibodies were used at a 1:1,000 dilution. Actin was used as a control. Protein detection was performed using the Super Signal West Femto Maximum Sensitivity Substrate (Pierce, Rockford, IL). Statistical Analysis Statistical analysis was performed with the data obtained from three independent experiments. Data were analyzed and presented as the mean standard error of the mean. A p value <0.05 was regarded as statistically signicant.
TGFb1-Induced Migration Involves p38 MAPK/Hsp27 Activation Because the p38 MAPK/Hsp27 pathway and integrin b1/Akt signaling are involved in migration, we examined the effect of TGFb1 on migration pathway in MDPC-23 cells. As shown in Figure 2A, phosphorylation of p38 MAPK and Hsp27 was induced after 6 hours of TGFb1 treatment and continued for up to 24 hours. We then examined whether TGFb1 also enhances integrin b1/Akt signaling activation. We found that the expression of integrin b1 was not altered by TGFb1. TGFb1 did not affect the pathway up- and down-stream of integrin b1 including focal adhesion kinase, Akt, and IkB (Fig. 2B). TGFb1-Induced Migration Induced Phosphorylation of Hsp27 via p38 MAPK Activation To conrm that the TGFb1-induced migration of MDPC-23 cells was dependent on Hsp27, an Hsp27-specic antibody was used. We found that TGFb1-induced migration was signicantly inhibited by Hsp27 antibody treatment (Fig. 3A and B). The results indicated that
Results
TGFb1-Induced Migration of Mouse Dental Papilladerived MDPC-23 Cells To investigate whether TGFb1 induces cell growth and migration of MDPC-23 cells, the cells were treated with TGFb1 for 24 or 48 hours.
Figure 2. The effect of TGFb1 on the phosphorylation of p38 MAPK and Hsp27 in MDPC-23 cells. Cells were treated with 1 ng/mL of TGFb1 for the indicated time. (A) Western blot analysis of p38MAPK/Hsp27 phosphorylation. (B) Integrin b1/Akt signaling on TGFb1-treated MDPC-23 cells.
TGFb1-Induced Heat Shock Protein 27 Activation Promotes Migration of MDPC-23 Cells
1333
Figure 3. The effect of Hsp27 and p38 MAPK inhibition on TGFb1-induced migration. MDPC-23 cells were incubated with or without TGFb1 (1 ng/mL) and Hsp27 antibody (3 mg/mL) for 24 hours. (A) Migrated cells were counted by a transwell assay. (B) Cell migration was quantied by counting the number of cells that migrated into the inner membrane. The graph represents the relative number of cells from three separated experiments. A p value <0.001 was regarded as statistically signicant. (C) MDPC-23 cells were pretreated with a p38 MAPK inhibitor, SB203580 (10 mmol/L), for 1 hour and then treated TGFb1 (1 ng/mL) for 24 hours. (D) Cell migration was quantied by counting the number of migrated cells. The graph represents the relative number of cells from three separated experiments. A p value <0.01 was regarded as statistically signicant. (This gure is available in color online at www.aae.org/joe/.)
TGF-b1-induced migration was dependent on Hsp27 activation in MDPC-23 cells. To investigate whether the phosphorylation of Hsp27 was dependent on p38MAPK activation, cells were pretreated with a p38MAPK inhibitor, SB203580, before TGFb1 stimulation. Western blot analysis showed that SB203580 inhibited TGFb1-induced p38 MAPK phosphorylation. The phosphorylation of Hsp27 was also inhibited by SB203580 (Fig. 3C). We found that SB203580 signicantly reduced TGFb1induced migration (Fig. 3D). These results indicate that p38MAPK was required for TGFb1-induced Hsp27 phosphorylation and migration of MDPC-23 cells.
Discussion
TGFb is an important mediator of extracellular matrix biosynthesis and is involved in the regulation of cell growth, differentiation, and migration (13). In TGFb signaling, the role of TGFb1 in odontoblast differentiation and dentin mineralization during primary development and dentinogenesis is well established (4, 5). Several recent publications reported that TGFb1 regulates growth and differentiation of pulp cells via MAPK, matrix metalloproteinases, cathepsins, and the Smad2/3 pathway (6, 7, 15, 16). In addition, TGFb2 modulates the pulpal functions at specic stages of differentiation processes via activation of the MEK/ERK1/2 and ALK5/Smad2/3 pathways (17, 18). In this study, we examined the role of TGFb1 in mouse dental papilla-derived MDPC-23 cells. We detected the phosphorylation of p38 MAPK and Hsp27 in response to TGFb1 treatment. Several studies have shown that Hsp27 directly participate in TGF-bregulated physio1334
logical processes. For example, invasive and metastatic characteristics induced by TGFb1 correlate with Hsp27 expression in gastric cancer cells (19). Hatakeyama et al (20) showed that TGFb-stimulated Hsp27 induction is associated with proliferation in osteoblast-like cells. However, until recently, the mechanisms of action of TGFb and Hsp27 have been unknown in dental papilla-derived MDPC-23 cells. We show for the rst time that TGFb1 is involved in the migration of MDPC-23 cells. Furthermore, TGFb1-induced migration was blocked by an Hsp27-specic antibody in MDPC-23 cells. These results suggested that TGFb1-induced Hsp27 phosphorylation was able to promote cell migration in MDPC-23 cells. Previous studies have shown that the expression of Hsp25 (homologous to Hsp27 in the mouse) is suggested to act as a switch between cell proliferation and early-stage differentiation in developing odontoblast- and ameloblast-lineage cells (21). Therefore, our ndings raise the possibility that Hsp27 may play an important role in migration toward the dentin before differentiation. It has been reported that p38 MAPK is involved in the phosphorylation of Hsp27 and the migration of vascular smooth muscle and hepatocellular carcinoma cells (22, 23). In addition, invasion and migration in cancer cells are also involved in integrin b1 signaling (24). We showed that TGFb1 induced Hsp27 phosphorylation via the activation of p38 MAP kinase in MDPC-23 cells. A p38 MAPK-specic inhibitor, SB203580, blocked the phosphorylation of Hsp27 and the migration of MDPC-23 cells. However, there was no signicant change in the activation of intergrin b1/Akt signaling in TGFb1-stimulated cells. Based on these ndings, it is possible that TGFb1-induced p38 MAPK/ Hsp27 pathway signaling may regulate MDPC-23 cell migration (Fig. 4). It is well recognized that Hsp27 acts as a molecular chaperones and improves survival under stressful conditions. It has been shown
Kwon et al.
6. 7. 8. 9. 10. 11. 12. 13. signal-regulated kinases) cascade activity dependent on c-Src activity. Biochem J 2004;379:14150. Hwang YC, Hwang IN, Oh WM, et al. Inuence of TGF-beta1 on the expression of BSP, DSP, TGF-beta 1 receptor I and Smad proteins during reparative dentinogenesis. J Mol Histol 2008;39:15360. He WX, Niub ZY, Zhao SL, et al. TGF-b activated Smad signaling leads to a Smad3mediated down-regulation of DSPP in an odontoblast cell line. Arch Oral Biol 2004; 49:9118. Ohshima H, Ajima H, Kawano Y, et al. Transient expression of heat shock protein (Hsp) 25 in the dental pulp and enamel organ during odontogenesis in the rat incisor. Arch Histol Cytol 2000;63:38195. Ohtsuka Y, Nakakura-Ohshima K, Noda T, et al. Possible role of heat shock protein (Hsp) 25 in the enamel organ during amelogenesis in the rat molar. Arch Histol Cytol 2001;64:36978. Ciocca DR, Oesterreich S, Chamness GC, et al. Biological and clinical implications of heat shock protein 27,000 (Hsp27): a review. J Natl Cancer Inst 1993;85: 155870. Hirano S, Shelden EA, Gilmont RR. HSP27 regulates broblast adhesion, motility, and matrix contraction. Cell Stress Chaperones 2004;9:2937. Lee JW, Kwak HJ, Lee JJ, et al. HSP27 regulates cell adhesion and invasion via modulation of focal adhesion kinase and MMP-2 expression. Eur J Cell Biol 2008;87: 37787. Wei YY, Chen YJ, Hsiao YC, et al. Osteoblasts-derived TGF-beta 1 enhance motility and integrin upregulation through Akt, ERK, and NF-kappaB-dependent pathway in human breast cancer cells. Mol Carcinog 2008;47:52637. Hanks CT, Sun ZL, Fang DN, et al. Cloned 3T6 cell line from CD-1 mouse fetal molar dental papillae. Connect Tissue Res 1998;37:23349. Palosaari H, Wahlgren J, Larmas M, et al. The expression of MMP-8 in human odontoblasts and dental pulp cells is down-regulated by TGF-beta 1. J Dent Res 2000;79: 7784. Tai TF, Chan CP, Lin CC, et al. Transforming growth factor beta 2 regulates growth and differentiation of pulp cells via ALK5/Smad2/3. J Endod 2008;34: 42732. Tersariol IL, Geraldeli S, Minciotti CL, et al. Cysteine cathepsins in human dentinpulp complex. J Endod 2010;36:47581. Tai TF, Chan CP, Lin CC, et al. Transforming growth factor beta2 regulates growth and differentiation of pulp cells via ALK5/Smad2/3. J Endod 2008;34: 42732. Wang K, Li J, Zhen C, et al. Enhanced invasive and metastatic potential induced by transforming growth factor-beta 1 might be correlated with glutathione-Stransferase-pi, colin and heat shock protein 27 in SGC-7901 gastric cancer cells. Acta Biochim Biophys Sin 2007;39:5206. Hatakeyama D, Kozawa O, Niwa M, et al. Upregulation by retinoic acid of transforming growth factor-L-stimulated heat shock protein 27 induction in osteoblasts: involvement of mitogen-activated protein kinases. Biochimica Biophysica Acta 2002;1589:1530. Nakasone N, Yoshie H, Ohshima H. An immunohistochemical study of the expression of heat-shock protein-25 and cell proliferation in the dental pulp and enamel organ during odontogenesis in rat molars. Arch Oral Biol 2006; 51:37886. Chen HF, Xie LD, Xu CS. The signal transduction pathways of heat shock protein 27 phosphorylation in vascular smooth muscle cells. Mol Cell Biochem 2010;333: 4956. Guo K, Liu Y, Zhou H, et al. Involvement of protein kinase C beta-extracellular signalregulating kinase 1/2/p38 mitogen-activated protein kinase-heat shock protein 27 activation in hepatocellular carcinoma cell motility and invasion. Cancer Sci 2008; 99:48696. Mon NN, Ito S, Senga T, et al. FAK signaling in neoplastic disorders: a linkage between inammation and cancer. Ann N Y Acad Sci 2006;1086:199212. Shakoori AR, Oberdorf AM, Owen TA, et al. Expression of heat shock genes during differentiation of mammalian osteoblasts and promyelocytic leukemia cells. J Cell Biochem 1992;48:27787. He WX, Niu ZY, Zhao SL, Smith AJ. Smad protein mediated transforming growth factor beta 1 induction of apoptosis in the MDPC-23 odontoblast-like cell line. Arch Oral Biol 2005;50:92936.
Figure 4. A model of TGFb1-mediated cell migration in mouse dental papilladerived MDPC-23 cells. The regulation of cell migration and phosphorylation of Hsp27 and p38 MAPK by TGFb1. See Discussion section for additional details. (This gure is available in color online at www.aae.org/joe/.)
14. 15. 16. 17. 18. 19.
that Hsps including Hsp70 and Hsp27 are expressed during osteoblasts differentiation (25). In our study, TGFb1 did not affect the level of other Hsps such as Hsp40, Hsp60, Hsp70, Hsp90, and Hsp110 in MDPC-23 cells but did enhance phosphorylation of Hsp27 (data not shown). These ndings lead us to speculate that TGFb1-induced Hsp27 activation may play an important role in MDPC-23 functions. One study has reported the effect of TGFb1 on apoptosis in MDPC23 cells (26). The reasons for the difference of TGFb1-mediated biological effect in MDPC-23 cells are unclear but may be related to individual differences in culture conditions (serum or other additional factors) and differentiation stages of cultured cells. Further investigation of the relationship between Hsp27 and TGFb1 responsive migratory factors, such as matrix metalloproteinases, on cell migration mediated by TGFb1, will better dene the molecular mechanisms of TGFb1 during dentinogenesis.
20.
21.
References
1. Ignotz RA, Massague J. Cell adhesion protein receptors as targets for transforming growth factor-beta action. Cell 1987;51:18997. 2. Brenmoehl J, Miller SN, Hofmann C, et al. Transforming growth factor-beta 1 induces intestinal myobroblast differentiation and modulates their migration. World J Gastroenterol 2009;15:143142. 3. Yoo KS, Nastiuk KL, Krolewski JJ. Transforming growth factor beta 1 induces apoptosis by suppressing FLICE-like inhibitory protein in DU145 prostate epithelial cells. Int J Cancer 2009;124:83442. 4. Yeh YY, Chiao CC, Kuo WY, et al. TGF-beta1 increases motility and alphavbeta3 integrin up-regulation via PI3K, Akt and NF-kappaB-dependent pathway in human chondrosarcoma cells. Biochem Pharmacol 2008;75:1292301. 5. Kim HP, Lee MS, Yu J, et al. TGF-beta 1 (transforming growth factor-beta1)-mediated adhesion of gastric carcinoma cells involves a decrease in Ras/ERKs (extracellular-
22. 23.
24. 25. 26.
TGFb1-Induced Heat Shock Protein 27 Activation Promotes Migration of MDPC-23 Cells
1335
Effects of Cryopreservation of Intact Teeth on the Isolated Dental Pulp Stem Cells
Sheng-Yang Lee, DDS, PhD,* Pao-Chang Chiang, DDS, MS,* Yu-Hui Tsai, PhD, Shih-Ying Tsai, PhD, Jiiang-Huei Jeng, DDS, PhD, Toshitsugu Kawata, DDS, PhD, and Haw-Ming Huang, PhDk
Abstract
Introduction: Human dental pulp stem cells (DPSCs) have been reported to be useful material for future regenerative medicine. Clinically, cryopreservation of intact teeth can successfully preserve the periodontal ligament for future autotransplantation; however, the effects of cryopreservation procedure on the properties of DPSCs are still unclear. The aim of this study was to test whether DPSCs isolated from cryopreserved teeth can express stem cellspecic markers. Methods: In this study, a novel programmable freezer coupled to a magnetic eld was used to perform the cryopreservation experiments. The tested DPSCs were isolated from magnetically cryopreserved and non-cryopreserved fresh teeth with an enzyme digestion procedure. The success rate of isolation, growth curves, morphology, stem cellspecic markers, and the differentiation capacity of the isolated cells were evaluated and compared. Results: The isolation rate of dental pulp cells from magnetically cryopreserved teeth was 73%. After culture for 5 generations, there was no signicant difference in cell viability between cells isolated from magnetically cryopreserved teeth and those isolated from fresh teeth. There were also no visible differences between the 2 groups of dental pulp cells in morphology, expression of stem cell markers, or osteogenic and adipogenic differentiations. Conclusions: The results suggest that cryopreserved whole teeth can be used for autotransplantation and provide a viable source of DPSCs. (J Endod 2010;36:13361340)
everal studies have indicated that postnatal stem cells are present in bone marrow, neural tissue, skin, and retina (1). These cells exhibit capacities for differentiation into various cells and development into diverse tissue. These self-renewal capabilities make stem cells become an effective material for regenerative medicine. Human dental pulp stem cells (DPSCs) were rst reported in 2000 (2). Unlike bone marrowderived stem cells, DPSCs can be isolated with noninvasive procedures. In addition, unlike the use of embryonic stem cells, the use of DPSCs in research and therapy is not considered to be controversial (3). In 2007, Jo et al (1) isolated postnatal stem cells from human dental tissues such as dental pulp, periodontal ligament, periapical follicle, and the surrounding mandibular bone marrow and found that those stem cells were able to differentiate into osteoblasts and adipocytes. Because of their multipotent differentiation ability and immunosuppressive activity, dental stem cells provide an alternative to stem cells from other sources for use in regenerative medicine (4, 5). It is believed that DPSCs will play an important role in regenerative endodontics in the near future (6). Although isolation of DPSCs from fresh teeth is possible (7), contamination and damage during long-term cryostorage might have an effect on the viability of dental pulp stem cells. Cryopreservation on various tissue and cells has been investigated for several decades and has become an important issue for tissue engineering (8, 9). Laureys et al (10) cryopreserved pulpless teeth in liquid nitrogen at 196 for 7 days. Although their experiments demonstrated that pulpless teeth can revascularize after being cryopreserved in a tooth bank for 1 week, DPSC viability and functions were not assessed (10). Recently, recovery of DPSCs from cryopreserved intact teeth was achieved by Woods et al (11). However, stem cellspecic markers CD-44 and STRO-1 were not examined in their study. The aim of this study was to conrm whether DPSCs isolated from cryopreserved teeth would survive and function normally after thawing.

Cryopreservation and Cell Culture Normal human premolars were collected from adults (aged 1830 years) at the Department of Orthodontics, Wan-Fang Medical Center, Taipei Medical University, Taipei, Taiwan. Immediately after extraction, teeth were cleaned with phosphate-buffered saline and stored in cryoprotectant (BAMBANKER, Lymphotec, Tokyo, Japan). The teeth were divided into 2 groups. Teeth in the magnetically cryopreserved group were cryopreserved in a program freezer (ABI, Chiba, Japan) supplied with a slight magnetic eld. Briey, the teeth were transported at 4 C and then placed in a freezer at 5 C. Teeth were maintained at that temperature for 15 minutes and then cooled at a rate of 0.5 C/min until the temperature reached 32 C. After the freezing procedure, the experimental teeth were transferred to a freezer (MDF-11561; Sanyo, Osaka, Japan) and stored at 152 C for 7 days. The time period was chosen according to a previous report that demonstrated no signicant difference in the amount of revascularization between teeth stored in a tooth bank for 7 days and those immediately transplanted without freezing (10). The control group was composed of fresh teeth that had been extracted from the contralateral side of each patient. Those teeth were not subjected to the cryopreservation procedure. Biologic tests performed on the control teeth were done immediately after extraction and cleaning.
Key Words
Cryopreservation, dental pulp stem cells, differentiation
From the *School of Dentistry, Graduate Institute of Medical Sciences, and kGraduate Institute of Biomedical Materials and Engineering, Taipei Medical University, Taipei, Taiwan; School of Dentistry, National Taiwan University, Taipei, Taiwan; and Department of Orthodontics, Hiroshima University, Hiroshima, Japan. Drs Lee and Chiang contributed equally to this work. Address requests for reprints to Dr Haw-Ming Huang, Graduate Institute of Biomedical Materials & Engineering, Taipei Medical University, 250 Wu-Hsing Street, Taipei, Taiwan. E-mail address: hhm@tmu.edu.tw. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.015
1336
Lee et al.
Figure 1. (A) and (B) are inverted microscope images of pulp cells from fresh and cryopreserved teeth, respectively. Cells with broblast-like morphology can be found in both groups. (C) Cell growth viability was assessed by the MTT method. The growth curve shows no statistical difference between fresh and magnetically cryopreserved teeth. (D) One example of ow cytometry histogram demonstrated STRO-1 expression of DPSCs isolated from cryopreservation.
After 7 days of cryopreservation, the teeth were thawed, and dental pulp cells were isolated with a modied enzyme digestion method (2). Briey, minced pulp tissue was digested in an enzyme mixture of 4 mg/ mL collagenase type I (Sigma, St Louis, MO) and 2 mg/mL dispase (Sigma) in a 37 C water bath. Cultures were then incubated at 37 C in a humidied atmosphere of 95% air and 5% CO2. To assess the success rate of culturing pulp cells after cryopreservation, the cell numbers on the 30th day after primary culture were counted. In this study, we dened the average cell number counted from non-cryopreserved teeth on the 30th day as the threshold (6 104 cells/mL). A successful culture was dened as one in which the cell numbers on day 30 were larger than that threshold. In this experiment, at least 8 samples from each experimental group were used. All experimental protocols were approved by the Committee on Human Research, Taipei Medical University. This information was also provided to the patients whose teeth were collected, and an agreement was signed by patients before the experiment.
sulfoxide, and the absorbance at 570 nm/690 nm was measured (n = 4). Student t test was used to analyze the signicance between the 2 groups. The level of signicance was set at .05. Morphologic changes in the cultured cells were assessed when the cells were incubated for 3 days by using an inverted microscope. For each sample, 9 random elds within a sample were examined. To conrm the DPSC population in the cultured dental pulp cells, STRO-1 marker was examined by ow cytometry. Cultured pulp cells of both cryopreserved and non-cryopreserved groups were stained with uorescein isothiocyanate (FITC)conjugated antibody against STRO-1 (sc-47733; Santa Cruz Biotechnology Inc, Santa Cruz, CA) and were analyzed by using a FACSCalibur instrument and CellQuest software (Becton-Dickson, Franklin Lakes, NJ).
Cell Viability and Morphology Examination In the following experiments, 510 passages of cultured dental pulp cells were used. Viability of DPSCs in the magnetically cryopreserved and non-cryopreserved groups was evaluated by a modied 3-(4,5-dimethylthiazo-2-yl)-2,5-diphenyl tetrazolium (MTT) (Sigma) assay. After incubation for 24, 48, 72, 96, and 120 hours, MTT working solution was added. The formazan salt was lysed with dimethyl
Examination of Stem Cellspecic Markers For CD-34 examination, mouse anti-human CD-34 monoclonal immunoglobulin G (sc-7324; Santa Cruz Biotechnology Inc) and FITC-conjugated goat anti-mouse immunoglobulin G (H+L; Jackson Immuno Research Laboratories Inc, West Grove, PA) were used as primary and secondary antibodies, respectively. For CD-44 and STRO-1 double staining, mouse monoclonal antibody against CD-44 (sc-7297; Santa Cruz Biotechnology Inc) and FITC-conjugated antibody against STRO-1 (sc-47733; Santa Cruz Biotechnology Inc) were used. After 48 hours of incubation, the cells of cryopreserved and noncryopreserved groups were xed in 4% paraformaldehyde for 20
Effects of Cryopreservation of Intact Teeth on Isolated DPSCs
1337
Figure 2. Double stains of the DPSCs isolated from fresh (A) and magnetically cryopreserved (D) teeth. Expression of CD44 (B, E) and STRO-1 (C, F) was found in the fresh and magnetically cryopreserved teeth. Expressions of CD44 and STRO-1 were stained as red and green, respectively. (This gure is available in color online at www.aae.org/joe/.)
minutes and then incubated overnight with primary antibodies (1:500 dilutions). The samples were subsequently incubated with secondary antibodies for 1 hour at 37 C. Finally, the samples were examined by confocal microscopy (TCS SP5; Leica Microsystems CMS GmbH, Mannheim, Germany).
Ability of the Multi-lineage Differentiation The medium of cultured cells was changed 2 times a week until conuence was achieved. Then the medium was replaced by differentiation-inducing medium. The differentiation-inducing medium was supplemented with 0.5 mmol/L isobutylmethylxanthine, 60 mmol/L indomethacin, 0.5 mmol/L hydrocortisone, and 10 mg mL insulin to induce adipogenesis and was supplemented with 0.01 mmol/L dexamethasone, 1.8 mmol/L KH2PO4 to induce osteogenesis. The samples were then incubated for another 28 days, with 2 medium changes per week. As a control, the noninduced cells were incubated with inducing chemical-free medium. At the end of the cultivation period, the cells were xed with 4% formaldehyde and then stained with oil-red-O and alizarin-red-S to stain lipid droplets and calcium deposition, respectively.
Results
We found that the culture rate of isolated pulp cells from fresh teeth was 100%, and the culture rate of cells from cryopreserved teeth was 73%. Images taken with an inverted microscope were used to observe the changes in morphology of the cultured cells after cryopres1338
ervation. Cells from fresh and cryopreserved teeth showed broblastlike morphology. There were no visible differences in morphology between the 2 groups (Fig. 1A, B). Fig. 1C demonstrates the growth curves of the cultured pulp cells. After culturing for 5 days, the viability of cells isolated from magnetically cryopreserved teeth had increased by 3.15 times, and that of cells from fresh teeth had increased by 3.31 times. There was no signicant difference in cell viability between the 2 groups. Flow cytometry tests showed that the uorescent intensity of STRO-1 stained dental pulp cells cultured from fresh and cryopreserved teeth is slightly larger than control. Quantied analysis indicated that the population of DPSCs in the cultured pulp cells was 9% (Fig. 1D). Immunostaining of CD34, CD44, and STRO-1 was performed to identify the dental pulp stem cells. Cells from both groups showed negative expression for CD34 (data not shown) but positive expression for CD44 and STRO-1 (Fig. 2). To test the multi-differentiation ability of the cryopreserved DPSCs, adipogenic and osteogenic differentiations were tested. As shown in Fig. 3, DPSCs from both groups were able to differentiate into adipocytes and osteocytes. Adipogenesis was conrmed by the presence of fat droplets (Fig. 3C, D), and osteogenesis was conrmed by the presence of calcium deposition (Fig. 3G, H). Neither adipogenesis (Fig. 3A, B) nor osteogenesis (Fig. 3E, F) was found in the noninduced cells.
Discussion
The aim of this study was to evaluate whether DPSCs could be preserved and then isolated from teeth that had been subjected to
Lee et al.
Figure 3. DPSCs from fresh (C, G) teeth and those from magnetically cryopreserved (D, H) teeth show the ability to differentiate into adipocytes and osteocytes. Adipogenesis (C, D) was conrmed by the presence of fat droplets (black arrow), and osteogenesis (G, H) was conrmed by the presence of calcium deposition (red color). (This gure is available in color online at www.aae.org/joe/.)
a cryopreservation process. Our results showed that the rate of cell culture from cryopreserved teeth was 73%. In addition, the cells isolated from cryopreserved teeth not only maintained their growth potential but also demonstrated a high efciency in osteogenic and adipodenic differentiations (Fig. 3D, H).
In previous studies, the morphology of DPSCs was described as being similar to that of broblast-like cells (2) or bone marrow stem cells with spindle shape (12). In this study, the morphology data showed similar variety of cells in both groups (Fig. 1A, B). Magnetic cryopreservation in this study had no effect on the morphology of the 1339
Effects of Cryopreservation of Intact Teeth on Isolated DPSCs
isolated cells. Postnatal adult stem cells were reported to have great therapeutic potential because of their self-renewal and their potential to differentiate into multiple cell lineages (3), including odontoblasts (13), adipocytes, chondrocytes (14), osteocytes (3), and neuronlike cells (15). However, none of the cells from either group expressed the neuron cellspecic markers GAP43 and CRMP-2 (data not shown). According to Shi et al (16), DPSCs do not express the hematopoietic stem cell marker CD34 but do express CD44 and STRO-1. We found similar ndings in our study, in which DPSCs isolated from magnetically cryopreserved and those from fresh teeth were negative for CD34 but positive for CD44 (Fig. 2B, E) and STRO-1 (Fig. 2C, F). Those data suggest that the surface markers of DPSCs are not inuenced by the cryopreservation procedures used in this study. The results of this study indicate that dental pulp stem cells isolated from cryopreserved teeth maintain their growth potential, surface markers, and, most importantly, their osteogenic and adipogenic differentiation ability. Although a previous report indicated that teeth can revascularize after autotransplantation only when the original tissue is removed at the moment of extraction (10), we found that DPSCs can be isolated from a preserved state after thawing. These results could be a useful reference for expanding the applications of tooth banking from cryopreservation for autotransplantation to storage of DPSCs.
2. Gronthos S, Mankani M, Brahim J, Robey PG, Shi S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 2000;97:1362530. 3. Huang AH, Snyder BR, Cheng PH, Chan AW. Putative dental pulp-derived stem/ stromal cells promote proliferation and differentiation of endogenous neural cells in the hippocampus of mice. Stem Cells 2008;26:265463. 4. Pierdomenico L, Bonsi L, Calvitti M, et al. Multipotent mesenchymal stem cells with immunosuppressive activity can be easily isolated from dental pulp. Transplantation 2005;80:83642. 5. Gebhardt M, Murray PE, Namerow KN, Kuttler S, Garcia-Godoy F. Cell survival within pulp and periodontal constructs. J Endod 2009;35:636. 6. Murray PE, Garcia-Godoy F, Hargreaves KM. Regenerative endodontics: a review of current status and a call for action. J Endod 2007;33:37790. 7. Zhang W, Walboomers XF, Shi S, Fan M, Jansen JA. Multilineage differentiation potential of stem cells derived from human dental pulp after cryopreservation. Tissue Eng 2006;12:281323. 8. Sumida S. Transfusion and transplantation of cryopreserved cells and tissues. Cell Tissue Bank 2006;7:265305. 9. Andreasen JO, Paulsen HU, Yu Z, Bayer T, Schwartz O. A long-term study of 370 autotransplanted premolars: part IItooth survival and pulp healing subsequent to transplantation. Eur J Orthod 1990;12:1424. 10. Laureys W, Beele H, Cornelissen R, Dermaut L. Revascularization after cryopreservation and autotransplantation of immature and mature apicoectomized teeth. Am J Orthod Dentofacial Orthop 2001;119:34652. 11. Woods EJ, Perry BC, Hockema JJ, Larson L, Zhou D, Goebel WS. Optimized cryopreservation method for human dental pulp-derived stem cells and their tissues of origin for banking and clinical use. Cryobiology 2009;59:1507. 12. Huang AH, Chen YK, Lin LM, Shieh TY, Chan AW. Isolation and characterization of dental pulp stem cells from a supernumerary tooth. J Oral Pathol Med 2008;37: 5714. 13. Couble ML, Farges JC, Bleicher F, Perrat-Mabillon B, Boudeulle M, Magloire H. Odontoblast differentiation of human dental pulp cells in explant cultures. Calcif Tissue Int 2000;66:12938. 14. Kawazoe Y, Katoh S, Onodera Y, Kohgo T, Shindoh M, Shiba T. Activation of the FGF signaling pathway and subsequent induction of mesenchymal stem cell differentiation by inorganic polyphosphate. Int J Biol Sci 2008;4:3747. 15. Iohara K, Zheng L, Ito M, Tomokiyo A, Matsushita K, Nakashima M. Side population cells isolated from porcine dental pulp tissue with self-renewal and multipotency for dentinogenesis, chondrogenesis, adipogenesis, and neurogenesis. Stem Cells 2006; 24:2493503. 16. Shi S, Bartold PM, Miura M, Seo BM, Robey PG, Gronthos S. The efcacy of mesenchymal stem cells to regenerate and repair dental structures. Orthod Craniofac Res 2005;8:1919.
Acknowledgments
The authors would like to thank ABI Ltd (Chiba, Japan) and Dr Geroge T.-J Huang (Boston University Henry M. Goldman School of Dental Medicine) for freezing and DPSC isolation technique support, respectively.
References
1. Jo YY, Lee HJ, Kook SY, et al. Isolation and characterization of postnatal stem cells from human dental tissues. Tissue Eng 2007;13:76773.
1340
Lee et al.
Root Canal Morphology of Permanent Three-rooted Mandibular First Molars: Part IIMeasurement of Root Canal Curvatures
Yongchun Gu, DDS, MS, Qun Lu, DDS, MS, PhD, Ping Wang, DDS, MS, PhD, and Longxing Ni, DDS, MS, PhD
Abstract
Introduction: The distolingual (DL) roots of threerooted mandibular molars often challenge clinicians during root canal therapy. This study investigated canal curvatures in permanent three-rooted mandibular rst molars by using microcomputed tomography (microCT) scans. Methods: Twenty three-rooted (group 1) and twenty-ve two-rooted mandibular rst molars (group 2) were scanned by micro-CT. The specimens were reconstructed 3-dimensionally by the software Mimics 10.01 and shown in a parallel projection mode. The images of the root canals in clinical view (CV) and proximal view (PV) were analyzed by the software Image-Pro Plus. Schneider method and a modied Pruett method were used to measure the angles and radius of canal curvatures. Results: In the threerooted molar group in a CV, the average angles of primary curvatures were 24.34 degrees for the mesiobuccal, 22.39 degrees for the mesiolingual, 13.71 degrees for the distobuccal (DB), and 13.81 degrees for the DL canal. In a PV, the average angles were 16.60 degrees for the DB and 36.06 degrees for the DL canal, respectively. Secondary curvatures were frequently seen in a CV (60%) for the DB canals, with an average angle of 26.94 degrees. In a PV, the average central angle of curvature was 59.04 degrees for the DL canal, and the average radius and curve length were 6.17 and 5.73 mm, respectively. In general, no statistically signicant difference was found for canal curvatures in the mesial roots between the three-rooted and two-rooted molar groups (P > .05). Conclusions: A better understanding of the canal curvatures is essential for successful endodontic treatment of three-rooted mandibular rst molars. (J Endod 2010;36:13411346)
Key Words
Distolingual root, micro-computed tomography scan, permanent three-rooted mandibular rst molar, root canal curvature
he presence of the distolingual (DL) root in permanent mandibular rst molars was rst mentioned in the literature by Carabelli in 1844 (1) and later named as radix entomolaris (2). Its frequency is lower than 5% in white and African populations (36). In Asian populations, the prevalence of three-rooted mandibular rst molars lies in the range of 5%40%, and it has been considered as a racial characteristic (710). Recently, this anatomical variation was detected in a Chinese population in Taiwan by using cone beam computed tomography (11). They reported a prevalence of 33.33% (41 of 123 individuals), with a bilateral incidence of a symmetrical distribution of 56.65%. This root variation presents challenges for the clinician. Failure to locate and treat the canal in the third root can result in treatment failure. It is recommended that practitioners modify the traditional triangular opening to a trapezoidal opening to improve identifying and accessing the DL canal (12). Another challenge related to three-rooted mandibular rst molars is the root canal curvature. Conventional canal instrumentation of a curved canal with stiff steel les might produce ledges, zips, elbows, apical transportation, loss of working length, or perforations (13). Nickel-titanium rotary system can reduce the occurrence of these errors, because it is superelastic and more exible in the canal curvature. However, it might undergo unexpected fracture as a result of cyclic fatigue (14). Therefore, accurate assessment of canal curvatures in three-rooted mandibular rst molars has great clinical signicance. The information would be valuable in formulating a treatment plan and determining prognosis. There are many techniques to evaluate the canal curvature. The rst and most common method was reported by Schneider (15) in 1971. The degree of canal curvature was dened as the acute angle between the long axis of the canal and a line from the point of initial curvature to the apical foramen. In 1982, Weine (16) proposed another method that dened the angle of curvature differently. The acute angle between lines passing through the apical and coronal portions was measured. Pruett et al (14) pointed out that the shape of any root canal curvature could be more accurately described by using 2 parameters, angle of curvature and radius of curvature. The radius was dened as the one from a circle that coincides with the path taken by the area of the most abrupt curvature, representing abruptness of curvature. Cunningham and Senia (17) studied canal curvature in mesial roots of mandibular rst and second molars by a radiographic technique. They pointed out that the root canal curvature was 3dimensional, and curvature in proximal view (PV) could not be predicted by examining a clinical view (CV) radiograph. The secondary curvatures were more frequently seen in PV than in CV (30% versus 2.5%). In the literature, the DL root of three-rooted mandibular rst molar is typically described as a conical and small root whose apex swings toward buccal (18). De
From the Department of Operative Dentistry & Endodontics, School of Stomatology, Fourth Military Medical University, Xi0 an, China. Address requests for reprints to Professor Longxing Ni, Department of Operative Dentistry & Endodontics, School of Stomatology, Fourth Military Medical University, 169 Changlexi Road, Xi0 an 710032, China. E-mail address: nilongxing@yahoo.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.025
Measurement of Root Canal Curvatures in Three-rooted Mandibular First Molars
1341
Moor et al (12) classied this DL root into 3 types according to the canal curvature: type I refers to a straight root, type II to an initially curved entrance and then continuation as a straight root, and type III to curvature in the coronal third and buccal curvature from the middle third or apical third of the root. Chen et al (19) recorded the location of the curvature as the coronal one third, the middle one third, or the apical one third according to the location of the point of initial curvature. Nevertheless, few studies have shown quantitative measurements on canal curvatures in three-rooted mandibular rst molars. In recent years, microcomputed tomography (micro-CT) has been used to evaluate the root canal anatomy because of its high resolution and nondestruction of specimens (2022). The 2-dimensional (2D) cross-sectional images and 3D models generated by micro-CT could precisely demonstrate the complex root canal system in different views and magnications. Internal and external anatomy of the teeth can be visualized simultaneously or separately (23). At this time there are several analytical programs available to evaluate these mathematical models efciently and accurately. However, to date, investigation of permanent three-rooted mandibular rst molars by this methodology has not been reported. The purpose of this study was to evaluate the canal curvature in the 3 roots of three-rooted mandibular rst molars, focusing on the DL root. A micro-CT system was used to reconstruct 3D models of the teeth and root canals. The canal curvatures in both views (CV and PV) were measured by Schneider method and a modied Pruett method. with fractured roots or other major defects, 20 three-rooted (group 1) and 25 two-rooted mandibular rst molars (group 2) with intact roots were selected for investigation by using a micro-CT scanner (eXplore Locus SP; GE HealthCare, London, Ontario, Canada). The chosen teeth comprised 8 left and 12 right three-rooted rst molars and 13 left and 12 right two-rooted rst molars. Each specimen was scanned along the teeth axis with voxel sizes of 21 21 21 mm. The data sets (DICOM format) were transferred to Mimics 10.01 (Materialise, Leuven, Belgium) software. The anatomy of the teeth and root canal system was reconstructed 3-dimensionally with a semiautomatic threshold-based segmentation approach combined with manual editing of the slices. By adjusting the transparency of the objects, the root canal systems were made opaque, and the teeth were made transparent. At the interface of Mimics, 3D objects are displayed in a parallel projection mode. Therefore, the principle of imaging is the same as that of radiographic approach. The models of the teeth and root canal systems were viewed in CV and PV, and the screen shots were saved in BMP format. They were then analyzed in software Image-Pro Plus 6.0 (Media Cybernetics, Silver Spring, MD), with a resolution of 1280 770 pixels. The images were calibrated according to the teeth lengths (the length along the axis of the tooth), which were previously measured in Mimics. Then the canal curvatures were measured for both views by using the technique described by Schneider (15) (Fig. 1). Point a was marked at the center of the canal orice. A line was drawn with a straight edge aligned parallel to axis from point a to a point where the long axis deviated from the straight edge, point b. A third point (point c) was made at the apical foramen, and a line was drawn from this point to point b. The acute angle formed by the intersection of the 2 lines is measured to evaluate the canal curvature. The canal curvatures were separated into 3 groups on the basis of the angles: straight (10 degrees or less), moderate (1020 degrees), and severe (20 degrees or more).

A total of 122 permanent mandibular rst molars were collected from a native Chinese population, and any attached soft tissue and calculus were removed before the experiment. From all specimens, a DL root was present in 39 teeth (31.93%). After excluding teeth
Figure 1. Measurements of angles of canal curvatures by Schneider method. a is angle of primary curvature; b is angle of secondary curvature. (A) CV; (B) PV. (This gure is available in color online at www.aae.org/joe/.)
1342
Gu et al.
If the root canal contained more than 1 curve, the primary and secondary curvatures were measured as described by Cunningham and Senia (17) (Fig. 1). The canal curvature in the DL root was further evaluated by modifying the method of Pruett et al (14) (Fig. 2). A straight line was drawn along the long axis of the coronal portion of the canal. A second line was drawn along the long axis of the apical portion of the canal. There is a point on each of these lines at which the canal deviates from the beginning (point b) or the end (point c) of the canal curvature. The curved portion between point b and c is represented by a section of a circle. The radius (r) and central angle (q) of this arc are the 2 parameters that the Pruett method suggests to measure (Fig. 2). According to the Pruett method, angle of curvature is dened as the angle formed by perpendicular lines drawn from the points of deviation (points a and b). They intersect at the center of the circle. The length of these lines is the radius. In this study, by using the software Image-Pro Plus, we were able to measure these parameters more accurately and conveniently. The arc could be dened by 3 mathematical points: points b, c, and the midpoint of the curved portion. Choosing 2 terminal points and a midpoint might guarantee the best coincidence between the dened circle and the canal curvature. The values of the arc length (AL), q, and r were obtained directly. The lengths of the straight portions (coronal line section L1 and apical line section L2) were also measured. All the parameters were measured 3 times, and average values were used for data analysis. Student t test was used to compare the means between groups. A paired t test was used to compare the means between groups. The level of statistical signicance was set at P <.05. In CV, the images of the mesiolingual (ML) canals were frequently overlapped by the mesiobuccal (MB) canal, whereas only 2 DL canals in three-rooted rst molar were totally overlapped by the distobuccal (DB) canal. The mean degrees of curvature in the MB and ML canals were very close (24.34 versus 22.39 degrees in the three-rooted group), although the difference had statistical signicance according to a paired t test (P = .030). Secondary curvature was rare in the mesial root. Only 1 two-rooted rst molar exhibited an S-shaped MB canal, whereas it was frequently seen in the DB roots of three-rooted and distal roots of two-rooted rst molars. The frequency was on 60% (12 of 20) of the DB canals of the three-rooted rst molars, and the location was within 2 mm of the root apex. The mean angle of the second curvature was approximately twice that of the primary one (26.94 versus 13.71 degrees in three-rooted group, P = .000; 30.81 versus 12.54 degrees in two-rooted group, P = .000). In PV, the DL canal in the three-rooted rst molars exhibited the greatest degrees of curvature among the 3 roots. The angle of curvature (by Schneider method) ranged from 1457 degrees, with a mean of 32.06 degrees. Some two-rooted rst molars (7 of 25) also had DL canals. However, the mean angle was 18.48 degrees, signicantly lower than that of the three-rooted rst molars (P < .01). Five of 18 (27.79%) MB or ML canals in the three-rooted molars and 8 of 23 (34.78%) MB or ML canals in the two-rooted molars had a secondary curvature, whereas neither DB nor DL canals in the three-rooted rst molars exhibited this curvature. Only 2 DB canals and 4 DL canals in the tworooted rst molars exhibited a secondary curvature. Table 2 presents measurement results of curvatures in the DL canals of the three-rooted rst molars by using the modied Pruett method. The mean central angle was 59.04 degrees and the mean radius was 6.17 mm in PV versus 26.17 degrees (central angle) and 20.99 mm (radius) in CV. The mean arc length was 5.73 and 6.13 mm in PV and CV, respectively. The lengths of L1 and L2 were frequently
Results
The degrees of primary and secondary canal curvatures measured by Schneider method in both views (CV and PV) are summarized in Table 1 and Fig. 3.
Figure 2. Measurements of radius, central angles, and arc lengths of canal curvatures by modied Pruett method (PV). L1 is coronal straight portion; L2 is apical straight portion; q is central angle; qw is angle of Weine method; r is radius. (A) L1 s 0, L2 s 0; (B) L2 = 0. (This gure is available in color online at www.aae. org/joe/.)
1343
TABLE 1. Angle of canal curvature in CVs and PVs (degrees) (by Schneider method) Three-rooted Canal
Clinical view MB ML DB + D (P) DB + D (S) DL (P) DL (S) Proximal view MB (P) MB (S) ML (P) ML (S) DB DL
Two-rooted Range
12.6137.94 6.8637.94 4.2024.10 15.1842.18 035.72 16.1934.70 044.14 16.9737.86 10.4641.07 12.0227.47 042.20 14.0057.00
t test Range
12.6835.79 7.2837.30 030.52 13.3546.92 026.43 15.2242.84 8.3842.94 8.2928.46 033.86 13.3223.78 030.45 10.0522.14
n
18 18 20 12 20 4 18 5 18 5 20 20
Mean
24.34 22.39 13.71 26.94 13.81 25.32 17.50 26.87 19.22 21.20 16.60 32.06
SD
7.20 8.06 5.34 8.55 9.58 8.33 11.46 7.81 7.89 5.73 9.92 11.20
n
23 23 25 15 7 5 23 8 23 8 7 7
Mean
24.37 21.87 12.54 30.81 11.76 29.12 19.51 17.04 20.87 20.23 7.60 18.48
SD
5.57 7.04 6.55 10.08 8.40 10.87 9.01 6.35 8.79 3.10 10.82 5.17
t
0.015 0.222 0.643 1.06 0.502 0.575 0.629 2.494 0.622 0.399 2.019 3.065
P value
.988 .826 .524 .299 .620 .583 .533 .030* .537 .697 .054 .005
Total of 18 two-rooted rst molars have a single canal in the distal; 2 three-rooted rst molars and 2 two-rooted rst molars have a single canal in the mesial root. CV, clinical view; D, single distal canal in the distal root; DB, distobuccal; DL, distolingual; MB, mesiobuccal; ML, mesiolingual; P, primary curvature; PV, proximal view; S, secondary curvature; SD, standard deviation. *P < .05. P < .01.
below 2 mm and shorter than the arc length. In a few three-rooted rst molars, the length of L1 and/or L2 in the DL canals was zero (Fig. 2B). To verify the method of canal curvature determination, the angles and radius of canal curvatures in both views of the 20 three-rooted rst molars were measured by an independent investigator. The results were found to be within 1.5 degrees for determination of the angle and 1 mm for measurement of the length and radius of the canal curvature.
Discussion
Successful root canal instrumentation requires considerable knowledge of the canal anatomy. The information missed in a CV radiograph could be seen in a PV radiograph (17, 18). By using the software Mimics 10.01, we generated 3D mathematical models of the teeth based on the micro-CT data sets. The isotropic resolution reached as high as 21 mm, and the 3D models could be displayed on the screen with a perfect parallel projection. In the parallel projection mode, the depth coordinate is ignored, and objects are assigned to the screen space according to their actual geometrical size, regardless of their distance to the viewpoint (24). By modifying the transparency of the models, root canal systems can be exhibited completely, and the external contours of the teeth can be kept as an important point of reference. This guaranteed better accuracy of the measurements and better image quality than conventional radiographs, while the physical principle of imaging is the same. The 3D modeling of root canal systems also could be a valuable teaching tool for dental students and clinicians. Most of the studies based on radiographic examination have used les to determine the root canal axis, but here we did not because the les could not remain centered in the canal, and this would introduce measurement errors. Besides this, for certain specimens with more complex root canal systems (eg, tiny canal with ramication, severe apical secondary curvature, or partial calcication), attempting to insert a le to the canal length could result in a failure. The results of the present study indicate that the canal curvatures are distributed differently in the 3 roots of three-rooted mandibular rst molars as shown in the CVs and PVs. In CV, the ML and DL canals might be totally or partially overlapped by the corresponding buccal canals. Therefore, careful reading of multi-angled radiographs is recommended to improve the accuracy of clinical diagnosis (25). The average angles of curvature in the MB and ML canals agree with the results reported by Schafer et al (26). The latter study found that the mean was 25 degrees for MB canals and 22 degrees for ML canals. These values were also close to those of Cunningham and Senia (17). They reported a mean angle of 28.7 and 27.2 degrees for MB and ML canals, respectively, although the permanent mandibular rst and second molars were combined in their sample. The curvature in the mesial root starts immediately after it leaves the canal orice and initially progresses mesially and then distally after curve. In the three-rooted group, 14 of 18 MB canals and 10 of 18
Figure 3. Angles of curvatures in roots of three-rooted rst molars (by Schneider method). P is primary curvature, and S is secondary curvature.
1344
Gu et al.
TABLE 2. Measurement results of curvature in DL root by modied Pruett method (n = 20) PV Parameters
r (mm) AL (mm) L1 (mm) L2 (mm) q (degrees)
CV Range
2.5411.54 3.818.49 03.87 03.53 31.1097.97
Paired t test Range

2.7868.21 2.5810.48 05.98 03.17 6.7253.13
Mean
6.17 5.73 2.09 0.84 59.04
SD
2.51 1.25 1.07 1.10 19.05
Mean
20.99 6.13 1.20 0.40 26.17
SD
19.35 2.22 2.06 0.90 13.30
t
3.422 0.678 1.657 1.276 6.606
P value
.003* .506 .114 .217 .000*
AL, arc length; CV, clinical view; DL, distolingual; L1, coronal line section; L2, apical line section; PV, proximal view; SD, standard deviation. Four DL roots exhibit a second curvature in CV. In these cases, L2 is the distance from ending point of rst curve to starting point of second curve. *P < .01.
ML canals exhibit a severe curve according to the classication by Schneider (15) (Fig. 3). This anatomical feature is closely related to occurrence of strip perforation during canal instrumentation. Adequate coronal aring is advocated to reduce the magnitude of curvature and to achieve a straight access to the apical portion of the canal (17). Preservation of the distal wall of the coronal canal portion is critical to avoid the possible outcome of strip perforation or vertical fracture of the mesial root (13, 17). In PV, 27.79% of MB or ML canals in the three-rooted molars and 34.78% of MB or ML canals in the two-rooted molars have a secondary curvature. No signicant difference was found between average angles of primary and secondary curvature (P > .05). In the mesial root, conuence and divergence of the MB and ML canals can form severe canal curvatures, and the chance of exhibiting a second canal curvature might increase. The present study demonstrates that in all but one mesial root parameter, no statistically signicant difference was found when comparing the three-rooted and two-rooted rst molar groups (P > .05). Only the angle of the secondary curvature of MB canal in PV was an exception (P = .03). Therefore, if only canal curvature is considered, there is little difference in instrumentation of mesial roots between tworooted and three-rooted mandibular rst molars. The present study showed that 12 of 20 DB canals in three-rooted rst molars exhibit secondary curvature in a CV. Fifteen of 20 primary curvatures belong to moderate type, whereas 9 of 12 secondary curvatures belong to severe type (Fig. 3). The latter curve distally and are located at 02 mm from the root apex. Such apical curvatures might greatly increase the risk of instrument separation or procedural error. In PV, only 5 of 20 DB canals in three-rooted rst molars belonged to straight type, and secondary curvature was not observed in this study. Therefore, for DB canals, attention should be focused on the secondary curvature in a CV. The curvature of the DL canal is mostly present in a PV. Fig. 3 shows in a CV most of the DL canals are straight (9 of 20) or have moderate curvatures (7 of 20), whereas in PV all but one (19 of 20) DL canals exhibit severe curvature, and the mean angle of curvature is the greatest among the 3 roots. These ndings were conrmed by Chen et al (19). They analyzed radiographs of 21 extracted permanent three-rooted mandibular rst molars in a Taiwanese population and reported that the mean angle of the DL root was 36.35 degrees in PV versus 9.24 degrees in CV (by Schneider technique). However, Chen et al did not report the radius of the DL canal. To measure the radius of canal curvature, the most curved portion of the canal is always hypothesized to be an arc (14, 26). Pruett et al (14) pointed out that the angle and radius of canal curvature were independent of each other. Canals can have the same angle of curvature while they have different radii. This point of view can best be understood through geometry. In geometry, a length of arc of a circle is proportional to its radius and the corresponding central angle, and any 2 of above 3 parameters can dene an arc and deter-
mine the remaining third parameter; 3 mathematical points can also dene an arc or a circle. Our measurement of curvature used these geometrical principles. The present study showed that the central angle (q) is always larger than the angle of Schneider method (a). For the DL canals in PV, the mean value of q was 59.68 degrees, whereas the mean value of a was as low as 32.05 degrees. Fig. 2A shows the angle of Schneider method (a) where the angle is formed by the tangent line L1 and straight line bd. Therefore, the length of L2 might inuence the value of a. Unlike a, q is independent value of L2 or L1. It only reects the geometrical feature of the curved portion. If L2 increases, a will increase accordingly, while q will not change. If L2 = 0, angle a becomes the tangent chord angle (the angle formed by a tangent to a circle and a chord). In geometry, theorem about tangent chord angle states that an angle formed by a chord and a tangent is equal to the inscribed angle or half the corresponding central angle subtended by the chord. Consequently, equation q = 2a can be derived. In this study, the mean value of L2 was as low as 0.84 mm, which was much lower than that of AL (5.73 mm) and r (6.17 mm). Consequently, the mean value of q was approximately twice that of a (59.68 versus 32.05 degrees). Pruett et al (14) reported that for nickel-titanium, engine-driven rotary instruments, the radius of the canal curvature, the angle of curvature, and instrument size were important for predicting separation. However, few clinicians have realized the important role of the curvature length (AL) in explaining the mechanism of instrument fatigue. The microstructure and surface analysis of unused nickel-titanium rotary instruments demonstrated that there were distortions in the lattice structure of the alloy, machining and milling marks, as well as metal strips and microcracks on their surfaces (27). If the 2 curvatures have the same radius but different central angles, the curvature with a larger angle will have a longer AL. This means a larger portion of the instrument in the canal is under stress, and more microaws and microcracks in the instrument were under repeated or cyclic load. If the stress level exceeds certain threshold, which is known as fatigue limit or endurance limit, the probability of occurrence of instrument separation would increase accordingly. Therefore, we believe that AL is a more direct factor than q in explaining the cyclic fatigue of rotary instruments, and they have equal geometrical and clinical signicance. The angle of Schneider method is not a pure parameter in describing the curved portion. It is, however, used by most investigators because the measurement of this parameter is convenient and simple. This study showed that the curvature in the DL canals of the threerooted rst molars has a more severe angle and smaller radius in the PV, and the length of the curved portion is relatively long. The curvature might distribute over a large or entire portion of the canal. These anatomical variations imply that instrument separation can easily occur at any levels during canal preparation. A CV radiograph will miss considerable information about curvature in buccolingual dimension. Angled radiographic technique has been advocated to increase the accuracy of 1345
clinical diagnosis (18, 28). Clinicians should practice with more care and caution. To gain access to the apical portion, coronal aring is recommended to decrease the angle of curvature. Avoiding instrument fatigue failure and overinstrumentation is extremely important for successful root canal instrumentation of three-rooted rst molars.
13. Peters OA. Current challenges and concepts in the preparation of root canal systems: a review. J Endod 2004;30:55967. 14. Pruett JP, Clement DJ, Carnes DL Jr. Cyclic fatigue testing of nickel-titanium endodontic instruments. J Endod 1997;23:7785. 15. Schneider SW. A comparison of canal preparations in straight and curved root canals. Oral Surg Oral Med Oral Pathol 1971;32:2715. 16. Weine F. Endodontic therapy. 3rd ed. St Louis, MO: CV Mosby; 1982. 256340. 17. Cunningham CJ, Senia ES. A three-dimensional study of canal curvatures in the mesial roots of mandibular molars. J Endod 1992;18:294300. 18. Jerome CE, Hanlon RJ Jr. Dental anatomical anomalies in Asians and Pacic Islanders. J Calif Dent Assoc 2007;35:6316. 19. Chen YC, Lee YY, Pai SF, Yang SF. The morphologic characteristics of the distolingual roots of mandibular rst molars in a Taiwanese population. J Endod 2009;35: 6435. 20. Dowker SE, Davis GR, Elliott JC. X-ray microtomography: nondestructive threedimensional imaging for in vitro endodontic studies. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1997;83:5106. 21. Nielsen RB, Alyassin AM, Peters DD, Carnes DL, Lancaster J. Microcomputed tomography: an advanced system for detailed endodontic research. J Endod 1995;21: 5618. 22. Yu DC, Tam A, Schilder H. Root canal anatomy illustrated by microcomputed tomography and clinical cases. Gen Dent 2006;54:3315. 23. Plotino G, Grande NM, Pecci R, Bedini R, Pameijer CH, Somma F. Three-dimensional imaging using microcomputed tomography for studying tooth macromorphology. J Am Dent Assoc 2006;137:155561. 24. Foley JD, van Dam A, Feiner SK, Hughes JF. Computer graphics: principles and practice. 2nd ed. Reading, MA: Addison-Wesley; 1995. 2316. 25. Slowey RR. Root canal anatomy: road map to successful endodontics. Dent Clin North Am 1979;23:55573. 26. Schafer E, Diez C, Hoppe W, Tepel J. Roentgenographic investigation of frequency and degree of canal curvatures in human permanent teeth. J Endod 2002;28: 2116. 27. Alapati SB, Brantley WA, Svec TA, Powers JM, Mitchell JC. Scanning electron microscope observations of new and used nickel-titanium rotary les. J Endod 2003;29: 6679. 28. Brynolf I. Roentgenologic periapical diagnosis: IIone, two or more roentgenograms? Sven Tandlak Tidskr 1970;63:34550.
References
1. Carabelli G. Systematisches Handbuch der Zahnheilkunde. Wien: Braumuller und Seidel; 1844. 114. 2. Bolk L. Bemerkungen uber Wurzelvariationen am menschlichen unteren Molaren. Zeiting fur Morphologie und Anthropologie 1915;17:60510. 3. Curzon ME. Three-rooted mandibular permanent molars in English Caucasians. J Dent Res 1973;52:181. 4. Schafer E, Breuer D, Janzen S. The prevalence of three-rooted mandibular permanent rst molars in a German population. J Endod 2009;35:2025. 5. Sperber GH, Moreau JL. Study of the number of roots and canals in Senegalese rst permanent mandibular molars. Int Endod J 1998;31:11722. 6. Younes SA, al-Shammery AR, el-Angbawi MF. Three-rooted permanent mandibular rst molars of Asian and black groups in the Middle East. Oral Surg Oral Med Oral Pathol 1990;69:1025. 7. Gulabivala K, Aung TH, Alavi A, Ng YL. Root and canal morphology of Burmese mandibular molars. Int Endod J 2001;34:35970. 8. Loh HS. Incidence and features of three-rooted permanent mandibular molars. Aust Dent J 1990;35:4347. 9. Turner CG 2nd. Three-rooted mandibular rst permanent molars and the question of American Indian origins. Am J Phys Anthropol 1971;34:22941. 10. Curzon ME, Curzon JA. Three-rooted mandibular molars in the Keewatin Eskimo. J Can Dent Assoc (Tor) 1971;37:712. 11. Tu MG, Huang HL, Hsue SS, et al. Detection of permanent three-rooted mandibular rst molars by cone-beam computed tomography imaging in Taiwanese individuals. J Endod 2009;35:5037. 12. De Moor RJ, Deroose CA, Calberson FL. The radix entomolaris in mandibular rst molars: an endodontic challenge. Int Endod J 2004;37:78999.
1346
Gu et al.
HostMineral Trioxide Aggregate Inammatory Molecular Signaling and Biomineralization Ability

Jessie F. Reyes-Carmona, DDS, MS, PhD,* Adair S. Santos, PhD, Claudia P. Figueiredo, PhD, Cristiane H. Baggio, PhD, Mara C. S. Felippe, DDS, MS, PhD,* Wilson T. Felippe, DDS, MS, PhD,* and Mabel M. Cordeiro, DDS, PhD
Abstract
Introduction: The biological processes underlying the ability of mineral trioxide aggregate (MTA) to promote hard-tissue deposition and wound healing remain unclear. To further study these processes, specic signaling molecules related to the inammatory response and the biomineralization process were analyzed to assess host-MTA interactions in vivo. Methods: For cytokine level quantication and immunohistochemical analysis, human dentin tubes were lled with ProRoot MTA (Dentsply, Tulsa Dental, OK) or kept empty and were implanted in subcutaneous tissues in the backs of mice. Dentin tubes were retrieved and subsequently observed using a scanning electron microscope. Results: MTA induced a time-dependent proinammatory cytokine up-regulation up to 3 days. Immunohistochemical analyses showed an upregulated expression of myeloperoxidase, nuclear factor-kappa B, activating protein-1, cyclooxygenase-2, inducible nitric oxide synthase, and vascular endothelial growth factor on day 1. Scanning electron microscopic examination revealed the presence of apatite-like clusters on collagen brils over the surface of tubes containing MTA. With the increase in time after implantation, a more extensive mineralization showing a compact layer of apatite was observed. Conclusion: MTA induced a proinammatory and prowound healing environment. The biomineralization process occurred simultaneously at the biomaterial-dentin-tissue interface, with the acute inammatory response. This promoted the integration of the biomaterial into the environment. (J Endod 2010;36:13471353)
Key Words
Apatite, bioactivity, biomineralization, inammation, mineral trioxide aggregate, wound healing
bioactive material should be capable of stimulating specic biological responses via biochemical and biophysical reactions that result in the formation of an apatite layer (1, 2). The ability to induce the formation of apatite allows the integration of the biomaterial into the environment (2). However, host responses to biomaterials are dependent on the innate and nonspecic immune responses that occur in the surrounding tissues (3). Biomaterials may elicit an inammatory cascade comprising neutrophil and macrophage recruitment and adhesion, foreign body reaction, and brous encapsulation (4). Cytokines and growth factors secreted by inammatory cells are the molecular messengers that promote inammatory events and wound healing (5). Inammatory cytokines such as, interleukin (IL)-1b, tumor necrosis factor a (TNF-a), and prostaglandins play an important role in the development of the inammatory response. The expression of these proteins is controlled by some transcription factors, such as activating protein-1 (AP-1) and nuclear factor-kappa B (NF-kB) (6). NF-kB consists of a group of proteins, including p50, p65, and p105, which are sequestered in the cytoplasm in their resting state. When activated by agents such as cytokines, NF-kB undergoes phosphorylation, leading to its nuclear translocation and binding to specic sequences of DNA, which, in turn, results in gene transcription (7). At the onset of inammation, a cytokine-mediated activation of NF-kB in macrophages results in nitric oxide production by the inducible nitric oxide synthase (iNOS) enzyme (8, 9). Experimental evidence suggests that a relationship exists between nitric oxide and prostaglandin E2 biosynthesis, the production of which is regulated by cyclooxygenase-2 (COX-2) (9, 10). Moreover, myeloperoxidase (MPO), a leukocytederived enzyme that catalyzes the formation of a number of reactive oxidant species, is linked to the acute phase of inammation (11). Vascular endothelial growth factor (VEGF) is a glycoprotein with the ability to increase the permeability of blood vessels, an important vascular change observed during inammation (12). Therefore, VEGF also plays a critical role in angiogenesis and neovascularization by participating in critical biological processes, such as tissue repair (13). Mineral trioxide aggregate (MTA) has been extensively used as a promising biomaterial for stimulating dentinogenesis and cementogenesis. Despite its widespread use in clinical practice, the mechanism by which it induces hard-tissue deposition remains unknown. Previous studies have shown that MTA releases calcium hydroxide, which interacts with a phosphate-containing uid to produce calcium-decient apatite via an amorphous calcium phosphate phase (1416). A preliminary study provided compelling evidence of the biomineralization process promoted by the interaction of
From the *Postgraduate Dentistry Program of the Federal University of Santa Catarina, Florianopolis, SC, Brazil; Department of Restorative Sciences, University of Costa Rica, San Jose, Costa Rica; Department of Physiological Sciences, Federal University of Santa Catarina, Florianopolis, SC, Brazil; and Department of Morpho logical Sciences, Federal University of Santa Catarina, Florianopolis, SC, Brazil. Dr Reyes-Carmona is a fellow of University of Costa Rica. Supported in part by Grants in Aid for Scientic Research from the University of Costa Rica and Federal University of Santa Catarina. Address requests for reprints to Dr Jessie Reyes-Carmona, Department of Endodontics, School of Dentistry, University of Costa Rica, San Jose, Costa Rica. E-mail address: jessreyesc@hotmail.com 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.029
Host-MTA Inammatory Molecular Signaling
1347
MTA and dentin (15). The apatite formed by the MTAphosphatebuffered saline (PBS) system was deposited among collagen brils. This promoted controlled mineral nucleation on dentin, which triggered the formation of an interfacial layer with an intratubular mineralization at the biomaterial-dentin interface (15, 16). Although MTA has been studied in numerous clinical and histological studies, there is little consensus regarding the mechanism involved during the inammatory reaction and its correlation with the repair process and hard tissue formation. Therefore, in this study, we evaluated specic signaling molecules related to the inammatory process and the biomineralization ability of MTA to assess host-biomaterial interactions in vivo. Technology, Beverly, MA), rabbit polyclonal antiphospho-p65 NF-kB (1:50, Cell Signaling Technology), rabbit monoclonal antiphospho-cjun AP-1 (1:50, Cell Signaling Technology), and rabbit polyclonal anti-iNOS (1:100, Cell Signaling Technology). High-temperature antigen retrieval was applied by immersing the slides in a water bath at 95 C to 98 C in 10 mmol/L trisodium citrate buffer (pH = 6.0) for 45 minutes. The nonspecic binding was blocked by incubating sections for 1 hour with goat normal serum diluted with PBS. After overnight incubation with primary antibodies at 4 C, the slides were washed with PBS and incubated with the ready-to-use secondary antibody EnVision Plus (DakoCytomation EnVision Doublestain System, Carpinteria, CA) for 1 hour at room temperature. The sections were washed again in PBS, and visualization was completed using 3,30 -diaminobenzidine (DAB) (DakoCytomation) and counterstained lightly with Harris hematoxylin solution. Both control and experimental samples were placed on the same glass slide and processed under the same conditions. Images of the stained tissue sections were acquired using a digital camera (Canon A620, Lake Success, NY) connected to a light microscope (Axiostar Plus; Carl Zeiss, Oberkochen, Germany). Settings for image acquisition were identical for both control and experimental tissues. Four consecutive images per sample, captured at 40 magnication, were taken of the tissues in contact with the material on the tubes opening or on an empty opening. The threshold optical density was obtained using NIH ImageJ 1.36b imaging software (National Institutes of Health, Bethesda, MD). The total pixel intensity was determined, and data were expressed as optical density.

Ethical Concerns All experimental protocols used in this study were approved by the Animal Ethics Screening Committee and the Ethics Committee for Research with Human Beings of the Federal University of Santa Catarina, Santa Catarina, Brazil. Preparation of Specimens Eighty dentin tubes were prepared from extracted human tooth roots. The crowns and the apical thirds of the roots were removed using a low-speed water-cooled ISOMET diamond saw (Buehler, Lake Bluff, NY). Each root canal was enlarged to obtain 1.3-mm-diameter standardized cavities. Tube length was 5 mm, and their outer walls were abraded with a diamond bur to thin the walls to a 2-mm thickness. The dentin tubes were washed in distilled water and then autoclaved. Before implantation, the tubes were thoroughly irrigated with 17% EDTA followed by a 1% sodium hypochlorite solution, dried, and then lled with tooth-colored ProRoot MTA (Dentsply, Tulsa Dental, OK) or kept empty (negative control). Experimental Protocol Male Swiss mice (35-40 g) were anesthetized with ketamine hydrochloride (Dopalen; Division Vetbrands Animal Health, Jacare, SP, Brazil) and xylazine (Anasedan; Agribrands do Brasil Ltda, Paulnia, SP, Brazil). Four separate 1-cm incisions were made in the backs of mice at a 1-cm interval. The skin was deected to create a pocket by a blunt dissection on one side of each incision. Each mouse received three dentin tubes: two lled with MTA and one empty; no specimen was inserted in the fourth pocket (sham) to ensure a rotation of sites. After 12 hours and 1, 3, and 7 days after implantation, the animals were euthanized, and the tubes together with surrounding tissues were removed. Half of the samples were xed in 4% paraformaldehyde at 4 C for histological and immunohistochemical staining. To determine the protein level expression of IL-1, TNF-a and IL-10, the remaining half of the samples and surrounding tissues were excised and processed for tissue homogenate. Dentin tubes were retrieved and processed for scanning electron microscopic (SEM) analysis. Histological and Immunohistochemical Analyses For hematoxylin-eosin and immunohistochemistry staining, tissues were embedded in parafn, sectioned at a 3-mm thickness, and prepared on conventional glass slides. Tissue sections were deparafnized, and immunohistochemistry was performed using the following primary antibodies and respective dilution ratios: rabbit polyclonal antimyeloperoxidase (MPO, 1:300; Dako Cytomation, Carpinteria, CA), mouse monoclonal anti-VEGF (1:200, C-1; Santa Cruz Biotechnology Inc, Santa Cruz, CA), rabbit polyclonal antiCOX-2 (1:200; Cell Signaling
1348
Reyes-Carmona et al.
Determination of Cytokine Levels Briey, full-thickness tissue samples were homogenized in phosphate buffer containing 0.05% Tween 20, 0.1 mmol/L phenylmethylsulphonyl uoride, 0.1 mmol/L benzethonium chloride, 10 mmol/L EDTA, and 20 KIU aprotinin A. The levels of IL-1b, TNF-a, and IL-10 were evaluated using DuoSet ELISA kits according to the manufacturers recommendations (R&D Systems, Minneapolis, MN). The results were expressed as picogram per milligram (pg/mg) of tissue protein concentration. SEM Analysis After the experimental periods, the retrieved dentin tubes were briey washed in distilled water and sputter coated with gold for SEM observation (Philips SEM XL 30; Philips, Eindhoven, The Netherlands) at an accelerating voltage of 10 kV. Statistical Analysis Data of cytokine measurement (pg/mg) and optical densities of immunohistochemistry staining were expressed as mean standard error of the mean. Two-way analysis of variance followed by a Bonferroni posttest was performed to analyze differences between the groups (p< 0.05).
Results
Inammatory Cytokine Expression Prole Cytokine expression prole is shown in Figure 1. For all groups, the total amount of cytokines expressed decreased after day 3. Although MTA induced a proinammatory cytokine up-regulation during the rst 3 days, there was no apparent material-dependent effect on the classes of cytokines produced. However, a time-dependent manner was observed. In all the experimental groups, the expression of TNFa and IL-1b peaked at 12 and 24 hours, respectively. The expression levels of IL-1b and TNF-a in the MTA group at 12 hours, 1 day, and
Figure 1. Cytokine levels (pg/mg protein) of (A) TNF-a, (B) IL-1b, and (C) IL-10 on tissue homogenates. Each column represents the mean standard error of the mean. )p < 0.05 versus the empty tube group. #p < 0.05 versus the sham group.
3 days were signicantly up-regulated when compared with those in the empty tubes and sham (p < 0.05). By day 7, no signicant differences were found in any group. Meanwhile, IL-10 expression was upregulated between days 1 and 3, and the expression peaked on day 1 in all the experimental groups (Fig. 1C). The MTA group showed a signicant increase in IL-10 expression compared with the empty tube and sham groups at 12 hours, 1 day (p < 0.05), and 3 days (p < 0.01). On day 7, the experimental groups continued to exhibit IL-10 expression. However, the magnitude of IL-10 expression decreased, and no statistically signicant difference was observed between the groups.
(p < 0.001) (Figs. 2 and 3). All experimental groups induced pronounced phosphorylation of NF-kB, which peaked at 12 hours. As expected, MTA signicantly up-regulated NF-kB expression compared with empty tubes and shams (p < 0.01). In all groups, the expression of COX-2 and iNOS peaked at 12 and 24 hours, respectively (Fig. 2). However, MTA caused a signicant increase in the expression of COX-2 and iNOS when compared with the empty tubes and sham (p < 0.01). The expression of VEGF was increased at all time periods (Fig. 2). During the acute phase of inammation, VEGF was mainly expressed in the presence of neutrophils and macrophages (Fig. 3). On day 7, VEGF expression by broblasts was also observed.
Inammatory Response Assessment: Histomorphological and Immunohistochemical Findings After 12 hours, the tissue surrounding all experimental groups contained primarily neutrophils. In all groups, neutrophil recruitment decreased between days 1 and 3, and cellular populations of macrophages and lymphocytes increased and remained elevated from days 3 to 7. On day 7, the inammation intensity had diminished, and a chronic inammatory cell inltration consisting primarily of macrophages, broblasts, lymphocytes, and few giant cells was present in a thin brous capsule. These ndings show the transition from an acute phase to a moderate chronic response. Immunoreactivity analyses for MPO, AP-1, NF-kB, iNOS, COX-2, and VEGF are shown in Figure 2. These analyses revealed the expression of the different proteins in a time-dependent manner. MPO expression peaked at 24 hours in all experimental groups, whereas a signicant increase was observed in tissues in contact with MTA between 12 hours and day 1 when compared with the control groups (p < 0.001). AP-1 expression was slightly elevated in all groups. However, MTA showed a signicant up-regulation of the transcriptional factor on day 1
In Vivo Biomineralization Ability of MTA

SEM examination of dentin tubes showed the presence of apatitelike clusters (Fig. 4). SEM-EDAX indicated that the precipitates mainly contained calcium and phosphorus with Ca/P molar ratios of 1.60 to 1.64 (Fig. 4). It was possible to observe numerous apatite-like clusters deposited on collagen brils all over the surface of dentin tubes containing MTA in as early as 12 hours from implantation. With the increase in the implantation time, a more extensive mineralization was observed; many of these precipitates formed agglomerates. After 7 days, a compact apatite layer was observed all over the surface of the dentin tubes (Fig. 4).
Discussion
Despite the progress made in understanding the molecular biology that controls the mechanism of action of MTA (1719), the exact mechanism of wound healing and the nature of hard-tissue formation remain unclear and, consequently, a matter of extensive research. Therefore, our study focused on the inammatory reaction and its 1349
Figure 2. Immunoreactivity analysis for MPO, AP-1, NF-kB, iNOS, COX-2, and VEGF. Staining intensity and stained area of antibodies immunoreaction are expressed as optical density. Each column represents the mean standard error of the mean. )p < 0.05 versus the empty tube group. #p < 0.05 versus sham.
correlation with the biomineralization process to better understand the mechanisms underlying host responses to MTA. The inammatory reaction is closely related to the healing process (20, 21). The bodys defense reactions involve several regulatory functions and numerous molecular mediators (20). Because repair begins at the onset of inammation, it is necessary to further understand the inammatory process. Initially, during the inammatory response, IL-1b and TNF-a have a proinammatory effect followed by a regulatory effect in the later stages of inammation, reducing immune activity (22, 23). This fact may explain the ndings of our study in which overexpressed cytokine levels in the acute phase tended to decrease over time. Probably, the regulatory effect of these cytokines signaled the resolution of the inammatory reaction during the chronic phase. Additionally, our data suggest that the presence of MTA in the dentin tubes had an effect on the intercellular signaling that occurs at the implantation site. It is interesting to note that there was a simultaneous overexpression of IL-10 in MTA specimens. Because IL-10 has been shown to down-regulate cytokine production, IL-10 up-regulation may have signaled the decrease in cytokine production observed at later time points (20). As suggested in previous studies, our data support the idea that MTA has an anti-inammatory effect (17, 22). MPO immunostaining showed that neutrophils were the predominant cells at the implantation site during the rst day. Neutrophil recruitment decreased from day 1 to day 3; after which, mostly macrophages and lymphocytes migrated into the tissue. As a result, by day 3, the number of inammatory cell numbers was diminished, indicating the beginning of the resolution phase in the inammatory process. This histomorphological change may explain the expected transition 1350
from an acute proinammatory phase to an anti-inammatory and prowound healing chronic environment. Biomaterials might elicit several signaling pathways to trigger the inammatory cascade (3, 24, 25). Therefore, we analyzed the expression of selected NF-kBregulated gene products (iNOS and COX-2), AP-1 and VEGF by immunohistochemical staining. Our results showed that NF-kB was involved in MTA-stimulated signal transduction in the early stages of inammation. Therefore, we suggest that MTA induces phosphorylation of IkBa, which leads to the freeing of NF-kB complexes. Activated NF-kB complexes translocate to the nucleus and stimulate the expression of COX-2. Released prostaglandins, in turn, induce the transcription of iNOS in an autocrine manner (26). Recent evidence shows that the production of prostanoids by COX2 promotes the expression of VEGF and subsequent angiogenesis (11). Moreover, AP-1 may induce VEGF expression. However, we observed that VEGF overexpression remained stable during the various time periods. During the acute phase, VEGF upregulation was attributed to its ability to increase the permeability of blood vessels - an important vascular change observed during the early stages of inammation. On day 7, VEGF was mainly expressed by broblasts, suggesting sustained angiogenesis for the induction of a repair process. Our study provides compelling evidence of the in vivo biomineralization process promoted by MTA. SEM analysis showed the presence of the deposition of apatite-like clusters on collagen brils as early as 12 hours after implantation. SEM-EDAX indicated that the precipitates were mainly composed of calcium and phosphorus. Previously, we showed that the interaction of MTA with dentin in a phosphate-containing uid produces an amorphous calcium phosphate phase, which acts as a precursor during the formation of carbonated apatite (15, 16). It is
Figure 3. Representative images for tissue in contact with MTA at day 1 (40).Scale in 50 mm. (A) Hematoxylin and eosin staining. Immunohistochemical reaction for (B) MPO, (C) AP-1, (D) NF-kB, (E) iNOS, (F) COX-2, and (G) VEGF. (H) Negative control of the immunohistochemical reaction. (This gure is available in color online at www.aae.org/joe/.)
important to highlight that SEM-EDAX analysis showed similar results for precipitates formed by MTA after subcutaneous implantation. Our ndings corroborate those of previous in vitro studies that suggest that calcium ions released by MTA react with phosphate, yielding carbonate apatite precipitates (14, 27). It is well known that the organic matrix possesses properties that can initiate and regulate the formation of mineral crystals. Thus, crystal nucleation and controlled growth are considered to be matrix-mediated or matrix-regulated processes (2729). Type I collagen is the template for the controlled deposition of calcium phosphate, but by itself it does not have the capacity to induce matrix-specic mineralization (27, 30). Noncollagenous proteins present in the mineralized dentin matrix, such
as dentin matrix protein 1, have been implicated as having a regulatory function in dentin formation (27). Recombinant dentin matrix protein 1 molecules have been thought to perform specic molecular recognition in conjunction with the apatite surface in order to guide calcium phosphate clusters through the collagen matrix during recruitment (15, 27). This process has been described as controlled biomineralization (15). To our knowledge, our study is the rst to provide evidence that the biomineralization process occurs simultaneously with the initial acute inammatory response. Therefore, we hypothesize that together with the alkalinity of the material, the precipitation of apatite by MTA during the acute phase of inammation may contribute to the signaling of several unrecognized pathways in different cell types. Apatites may 1351
Figure 4. SEM photomicrographs of the surface of dentin tubes lled with MTA after subcutaneous implantation. (A) Formation of several apatite-like precipitates at 12 hours (3,000). (C) Energy Dispersive X-Ray Analysis (EDAX) spectrum revealing the chemical composition and the Ca/P ratio of the precipitate shown in B (8,000). Observe the deposition of precipitate on the collagen bers (D, 2,500) (E and F, 4,000). Increased deposition of precipitates at day 1 (G, 2,500) (H and I, 5,000), and in areas of higher mineralization, collagen bers exhibited a typical corn-on-the-cob appearance (arrows). Mineralization areas were more extensive as the implantation time increased (J and K, 3,000), forming a compact layer at 7 days after implantation (L, 100). (This gure is available in color online at www.aae.org/joe/.)
induce changes in gene expression and subsequently in cell functional activity. These changes are likely to contribute to repair and biomineralization process. Recent studies showed that MTA induced mineralization and mineralized tissue proteins messenger RNA expression of cementoblasts and bone cells, which play a crucial role in cemental and osseous repair and regeneration (31, 32). Therefore, we suggest that several biological mechanisms in combination with the bioactivity of MTA may explain its ability to induce mineralized tissue deposition. Our data provide scientic background to develop novel biomaterials aimed at exploiting the natural regenerative potential of pulp and bone tissues. In summary, we showed that MTA induces a proinammatory and prowound healing environment. The biomineralization process 1352
occurs simultaneously with the acute inammatory response. We suggest that when MTA is implanted, a series of biochemical and biophysical reactions occurs at the MTA-dentin-tissue interface. Subsequently, this activates cellular and tissue events in the inammatory and biomineralization processes and culminates in the formation of an apatite-like layer that allows the integration of the biomaterial into the environment.
References
1. Zhao W, Wang J, Zhai W, et al. The self-setting properties and in vitro bioactivity of tricalcium silicate. Biomaterials 2005;26:611321. 2. Bohner M, Lemaitre J. Can bioactivity be tested in vitro with SBF solution? Biomaterials 2009;30:21759.
3. Anderson JM. Biological responses to materials. Annu Rev Mater Res 2001;31: 81110. 4. Williams DF. On the mechanisms of biocompatibility. Biomaterials 2008;29: 294153. 5. Schutte RJ, Xie L, Klitzman B, et al. In vivo cytokine-associated responses to biomaterials. Biomaterials 2009;30:1608. 6. Hsiang CY, Chen YS, Ho TY. Nuclear factor-kB bioluminescense imaging-guided transcriptomic analysis for the assessment of host-biomaterial interaction in vivo. Biomaterials 2009;30:30429. 7. Hayden MS, West AP, Ghosh S. NF-kappaB and the immune response. Oncogene 2006;25:675880. 8. Ho TY, Chen YS, Hsiang CY. Noninvasive nuclear factor-kB bioluminescence imaging for the assessment of hostbiomaterial interaction in transgenic mice. Biomaterials 2007;28:43707. 9. De Couto Pita, Borda E, Ganzinelli S, et al. Cholinoceptor modulation on nitric oxide regulates prostaglandin E2 and metalloproteinase-3 production in experimentally induced inammation of rat dental pulp. J Endod 2009;35:52936. 10. Smith WL, DeWitt DL, Garavito RM. Cyclooxygenases: structural, cellular, and molecular biology. Annu Rev Biochem 2000;69:14582. 11. Akarasereenont PC, Techatraisak K, Thaworn A, et al. The expression of COX-2 in VEGF-treated endothelial cells is mediated through protein tyrosine kinase. Mediators Inamm 2002;11:1722. 12. Guven G, Altun C, Gunhan O, et al. Co-expression of cyclooxygenase-2 and vascular endothelial growth factor in inamed human pulp: an immunohistochemical study. J Endod 2007;33:1820. 13. Ferrara N. Molecular and biological properties of vascular endothelial growth factor. J Mol Med 1999;77:52743. 14. Tay FR, Pashley DH, Rueggeberg FA, et al. Calcium phosphate phase transformation produced by the interaction of the Portland cement component of white mineral trioxide aggregate with a phosphate-containing uid. J Endod 2007;33:134751. 15. Reyes-Carmona J, Felippe MS, Felippe WT. Biomineralization ability and interaction of mineral trioxide aggregate and white Portland cement with dentin in a phosphatecontaining uid. J. Endod 2009;35:7316. 16. Reyes-Carmona J, Felippe MS, Felippe WT. The biomineralization ability of mineral trioxide aggregate and Portland cement on dentin enhances the push-out strength. J Endod 2010;36:28691. 17. Huang TH, Yang C, Ding S, et al. Inammatory cytokines reaction elicited by rootend lling materials. J Biomed Mater Res B Appl Biomater 2005;73:1238. 18. Thomson PL, Grover LM, Lumley PJ, et al. Dissolution of bio-active dentine matrix components by mineral trioxide aggregate. J Dent 2007;35:63642. 19. Gomes AC, Gomes-Filho J, Oliveira SH. MTA-induced recruitment: a mechanism dependent on IL-1, MIP-2 and LTB4. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2008;106:4506. 20. Larsen GL, Henson PM. Mediators of inammation. Annu Rev Immunol 1983;1: 33559. 21. Teixeira de Moraes M, De Oliveira SH, Gomes-Filho JE. Mechanims of CH-induced neutrophil migration into air-pouch cavity. Oral Surg Oral Med Oral Pathol 2008; 105:81421. 22. Silva MJ, Vieira LQ, Sobrinho AR. The effects of mineral trioxide aggregate on cytokine production by mouse pulp tissue. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2008;105:706. 23. Zakharova M, Ziegler HK. Paradoxical anti-inammatory actions of TNF-alpha: inhibition of IL-12 and IL-23 via TNF receptor 1 in macrophages and dendritic cells. J Immunol 2005;175:502433. 24. Dayer JM, Isler P, Nicod LP. Adhesion molecules and cytokine production. Am Rev Resp Dis 1993;148:S704. 25. Newton R, Kuitert LM, Bergmann M, et al. Evidence for involvement of NF-kB in the transcriptional control of COX-2 gene expression by IL-1. Biochem Biophys Res Commun 1997;237:2832. 26. Minamikawa H, Deyama Y, Nakamura K, et al. Effect of mineral trioxide aggregate on rat clonal dental pulp cells: expression of cyclooxygenase-2 mRNA and inammationrelated protein via nuclear factor kappa B signaling system. J Endod 2009;35:8436. 27. Tay FR, Pashley DH. Guided tissue remineralisation of partially demineralized human dentine. Biomaterials 2008;29:112737. 28. LeGeros RZ. Calcium phosphates in oral biology and medicine. In: Monographs in oral science 15. Basel, Switzerland: Karger; 1991:466. 29. Tay FR, Pashley DH. Biomimetic remineralization of resin-bonded acid-etched dentin. J Dent Res 2009;88:71924. 30. Hao J, Zou B, Narayanan K, et al. Differential expression patterns of the dentin matrix proteins during mineralized tissue formation. Bone 2004;34:92132. 31. Chen CL, Huang TH, Ding SJ, et al. Comparison of calcium and silicate cement and mineral trioxide aggregate biologic effects and bone markers expression in MG63 cells. J Endod 2009;35:6825. 32. Hakki SS, Bozkurt SB, Hakki EE, et al. Effects of mineral trioxide aggregate on cell survival, gene expression associated with mineralized tissues, and biomineralization of cementoblasts. J Endod 2009;35:5139.
1353
Basic ResearchTechnology
Electropolishing Enhances the Resistance of Nickel-Titanium Rotary Files to CorrosionFatigue Failure in Hypochlorite
Chonrada Praisarnti, DDS, MDS (Endo), AdvDipEndodont, Jeffrey W.W. Chang, BDS, MDS (Endo), and Gary S.P. Cheung, PhD, MDS, MSc, FCDSHK(Endo), FHKAM, FAMS, FRACDS, MRACDS(Endo)
Abstract
Introduction: The aim of this study was to examine the fatigue behavior, especially at the low-cycle fatigue (LCF) region, of an experimentally electropolished FlexMaster and a commercial electropolished nickeltitanium (NiTi) instrument (RaCe) in a corrosive environment. Methods: A total of 90 NiTi rotary instruments were subjected to rotational bending at various degrees of curvatures while immersed in 1.2% sodium hypochlorite solution until broken. The maximum surface strain amplitude, calculated from the curvature of the instrument and the diameter of the cross section at break, was plotted against the LCF life. The results were compared with data for a non-electropolished commercial product tested by using the same methodology. Results: The fatigue life of both instruments generally declined with increasing surface strain amplitude; there was a signicant difference between the 2 instruments. Comparing the surface-treated FlexMaster with its commercially available non-electropolished counterpart, an improved resistance to fatigue breakage as a result of electropolishing was noted (P < .05). Conclusions: The LCF life of a NiTi instrument rotating with a curvature in a corrosive environment is enhanced by electropolishing. The design, both cross-sectional and longitudinal, appears to have an effect on the fatigue behavior of NiTi rotary instruments. (J Endod 2010;36:13541357)
Key Words
Breakage, corrosion fatigue, defects, electropolishing, fracture, low-cycle fatigue, nickel-titanium, surface nish
From the Area of Endodontics, Comprehensive Dental Care, Faculty of Dentistry, University of Hong Kong, Hong Kong. Address requests for reprints to Dr Gary S. P. Cheung, Area of Endodontics, Floor 3A, Prince Philip Dental Hospital, 34 Hospital Road, Saiyingpun, Hong Kong. E-mail address: gspcheung@gmail.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.02.025
ince its introduction in the 1990s, the remarkable mechanical properties have made nickel-titanium (NiTi) rotary instruments increasingly popular among clinicians for root canal instrumentation. Unfortunately, these engine-driven les can fracture in use without undergoing any permanent deformation or other visible warning signs (13). Both exural (cyclic) fatigue and torsional (shear) stresses are acting on a rotary instrument and might both be responsible for the breakage of NiTi rotary les during clinical use (3, 4). The instrument might fail in either or a combination of the 2 mechanisms. On the other hand, many studies have indicated that fatigue seems to be the predominant mechanism for a majority of instrument breakages during clinical use (3, 59). The fatigue process begins with crack initiation at the material surface (4, 10). Given the importance of surface defects (eg, the machining grooves left by the grinding process during manufacture), various treatments to improve the surface smoothness have been introduced for delaying the crack initiation process for an improved fatigue life of the material (10). Electropolishing, which is a method commonly used for surface nishing of many metallic medical appliances (11), has been incorporated for 1 brand of NiTi rotary instrument (RaCe; FKG Dentaire, La Chaux-de-Fonds, Switzerland) by its manufacturer for some time. Some recent additions (eg, EndoSequence; Brasseler, Savannah, GA) have also claimed to have been electropolished by its manufacturer. The process is carried out by immersing the device (usually connected as the anode) together with another electrode in a temperaturecontrolled bath of electrolyte(s) and then passing a DC electric current through them. The metal at the anode (especially at peaks or sharp edges where the current density becomes highest) is dissolved into the solution, whereas a reduction reaction will take place at the cathode. This process alters the surface composition and texture of the work piece (11, 12), renders the surface oxide layer (protective lm) more homogeneous, with less defects and residual surface stress (13), and improves the corrosion resistance of the metal (14). It has been considered to be the best method to improve the surface characteristics of any medical devices made of NiTi alloy (11). The underlying electrochemical process involved is rather complex and might be affected by many parameters (15). For instance, some electrolytic species, such as halogen ions, might become incorporated into the oxide lm, leading to susceptibility of this passive lm to break down and hence initiation of corrosion pits (15). The movement of the charged (electrolyte) ions has been shown to be controllable by an externally applied magnetic eld (16). An improved result of the electropolishing process for the nal surface has been demonstrated (15, 16). However, this magnetoelectropolishing process has not been attempted on dimensionally small NiTi devices that will be subjected to high operating stresses, such as the NiTi root canal instruments. Many authors hold the opinion that electropolishing would bring about an improved resistance to fatigue failure, compared with the non-electropolished counterpart (1719). It has been reported that the RaCe instrument (electropolished by its manufacturer) demonstrates an increased resistance to fatigue failure, compared with ProFile (Dentsply Maillefer, Ballaigues, Switzerland), K3 (SybronEndo, Orange, CA), HERO (Micro-Mega, Besancon, France), and Mtwo (VDW, Munich, Germany) (18). However, these various brands of instruments all have a distinctly different cross-sectional conguration, a factor that can affect the stress and strain acting on the instrument rotating with a curvature (20). Thus, it is difcult to conclude whether
1354
Praisarnti et al.
the improved fatigue resistance has been due to the effect of electropolishing per se. On the other hand, some studies have indicated that electropolishing (performed proprietarily by the manufacturer) did not seem to provide sufcient protection against low-cycle fatigue (LCF) failure (21, 22), especially in the presence of a corrosive environment (22). Thus, the purported advantage of electropolishing in enhancing the fatigue resistance of NiTi instruments remains controversial. Meanwhile, the great majority of laboratory studies of the fatigue behavior of NiTi rotary les have only adopted 1 or, at most, 2 curvature settings in those tests that had been carried out in air (or with some lubricant oil sprayed on the instrument) (2326). Other strain amplitudes have not been examined, and the effect of the environment was not considered. The purpose of this study was to determine the corrosion-fatigue behavior of 2 NiTi engine-les, each having been electropolished with a different regime, subjected to rotational bending in a corrosive environment. (29) and were compared with the magnetoelectropolished ones statistically (ANCOVA). The signicance level was set at P = .05.
Results
The relationship between the total fatigue lifetime and the effective surface strain amplitude was determined for the 2 instruments examined (Fig. 1). The transition (in the slope of the data trend) from high-cycle fatigue (HCF) to LCF was obvious. Failure taking place at about 2000 cycles or lower was deemed to be within the LCF region. A regression line could be tted for the LCF lives on logarithmic scales (Fig. 1B), suggesting that the LCF life declined in a power function dependence on the strain amplitude (P < .05). A signicant difference in the rate of decline (ie, slope of the tted line) of fatigue life was noted between the magnetoelectropolished FlexMaster and the RaCe instrument (P < .05) (Table 1). Similar slope of the tted lines was noted for the magnetoelectropolished and the untreated FlexMaster (Table 1 and Fig. 2), with the former being signicantly more resistant to fatigue fracture than the latter (P < .05). The fatigue life for RaCe instrument was intermediate between the magnetoelectropolished and the untreated FlexMaster at various strain amplitudes (Fig. 2).

A strain-controlled, rotational bending, fatigue test was performed on the commercial RaCe (FKG Dentaire) and a specially treated FlexMaster (VDW, Munich, Germany) rotary instruments. The latter was electropolished under the inuence of a magnetic eld, with a patented method known as magnetoelectropolishing (15), by a company not involved in the manufacture or in this study, whereas RaCe was electropolished by its manufacturer by using a proprietory regime (without magnetic ux). The fatigue testing machine was performed, on the basis of a method described elsewhere (26, 27), in which the instrument was conned by 3 smooth, high-hardness stainless steel pins into a curve (ie, 3-point bending) before setting to rotate at a rate of 250 rpm until broken. The test was carried out with the instrument immersed in a bath of 1.2% hypochlorite solution (Clorox, Oakland, CA); the stainless steel pins were replaced once signs of wear or rusting were discernible. A pre-test digital photograph of the curvature was taken at a xed distance and magnication for measurement of the radius of curvature in software (ImageJ 1.36b; NIH, Bethesda, MD) for each individual instrument (27). The number of revolutions to failure was recorded by using an optical counter. After the test, the broken fragment was measured for length by using a stereomicroscope (Leica DMLB; Leica Microsystems, Wetzlar, Germany) at 25 magnication, and then the fracture surface was examined with a scanning electron microscope (SEM) (XL-30cp; Phillips, Eindhoven, The Netherlands). The experiment was repeated with the instrument set up to rotate at various curvature settings. The diameter of the fracture cross section was determined on the scanning electron photomicrograph for each broken fragment in the same image analyzer software (ImageJ 1.36b). The effective surface strain amplitude, 3a, imposed on the rotating instrument was dened by the unit deformation of the material at its outermost surface (26, 28): 3a d 2R c
Discussion
Corrosion of NiTi on prolonged immersion in hypochlorite has been demonstrated by various authors (30, 31). A negative effect on
A total of 90 instruments (n = 50 for magnetoelectropolished FlexMaster and n = 40 for RaCe) were tested at various curvatures. The number of revolutions or cycles to fatigue (NCF) was plotted against ea in software (SigmaPlot 10.0; Systat Software, San Jose, CA). A regression line was tted to the LCF region, where appropriate, and the data for the 2 instruments were compared by using a two-way analysis of covariance (ANCOVA) (SPSS for Windows 14.0; SPSS, Chicago, IL). Data for the untreated (commercially available) FlexMaster tested by using the same methodology were obtained from a previous study
Figure 1. Relationship between the number of revolutions to failure and the maximum surface strain amplitude of prototype FlexMaster and RaCe instruments on logarithmic scales tested at various curvatures: (A) scatter diagram for all instruments and (B) specimens that failed at the LCF region.
Effect of Electropolishing on Fatigue Failure of NiTI Rotary Files
1355
TABLE 1. Slope of Fitted Line and Y-intercept Derived from the LCF Lives (Nf < 2000) for Each Group Group
FM_E FM_NE RaCe
Instrument
Magnetoelectropolished FlexMaster Commercial FlexMaster RaCe
Total no. tested

50 35 40
No. failed in LCF region

37 29 35
Slope of tted line ( standard error)

1.2346 ( 0.3752) 1.3377 ( 0.4714) 0.7934 ( 0.1401)
Y-intercept
3.18 2.96 3.16
Coefcient of determination (r2)

0.54 0.44 0.12
LCF, low-cycle fatigue.
the fatigue resistance has also been reported for NiTi rotary les that had been immersed for up to 2 hours in 5.25% hypochlorite solution before fatigue testing the instrument in air afterwards (32). The corrosion process involves selective removal of nickel (the more reactive element of the alloy) from the material surface, creating corrosion pits (33). These microstructural defects on the surface can lead to areas of stress concentration and early crack formation on cyclic loading (10, 34). The importance of the environment on the measured fatigue lifetime of NiTi rotary les has been reported (29, 35). Although a control group of instruments fatigued in a bland solution is not included for comparison (for the effect of hypochlorite), it has been demonstrated that a reduction of about 25%30% of the total fatigue lifetime is to be expected for NiTi les rotating in hypochlorite (1.2%) solution, compared with those in water (35). Thus, testing in a noncorrosive environment could result in an overestimation of the fatigue resistance of the NiTi instruments. In this study, sodium hypochlorite was chosen as the medium in which the test was performed to simulate the clinical situation. A concentration of 1.2% was used in this study because this strength is commonly used in clinical practice and, indeed, is adopted in the polyclinic of a teaching hospital (where this study was performed). Higher concentrations (3%6%) were found to be highly corrosive to the stainless steel pins in a pilot study, necessitating very frequent changes of these pins if the test were to be carried out in such condition. A high concentration of hypochlorite is anticipated to have a negative effect on the fatigue behavior as a result of an increased amount of available chlorine that attacks the metal. The fatigue life of both instruments decreased as the strain amplitude increased (Fig. 1), with an elbow in the data trend signifying a transition from HCF to LCF region of the material. This trend would not be revealed if the test had been done at 1 or 2 curvature settings only. Indeed, the elbow might occur at different NCF values, depending on the environment, as a result of corrosion fatigue (34). It has been suggested that the LCF lives of various brands of NiTi instrument are similar to each other, provided that they are expressed
as a function of the imposed surface strain (36). However, that does not seem to apply to the RaCe instrument in this present study, which showed a large scatter in its fatigue life, even for similar strain amplitudes (Fig. 1); the regression line showed a relatively low coefcient of correlation. This might be attributable, at least in part, to the special design of the instrument, with regions of the triangular shaft alternating with regions of a (spiraling) uted part. That might have led to uneven pattern of stress concentration, possibly at the junction between the 2 said regions, and hence a shortened fatigue life with the test methodology in this study (FKG, personal communication). It is possible that this peculiar (longitudinal) design might have confounded the benecial effect of having a smooth surface that should help withstand the fatigue loading. A just comparison between RaCe instrument and other brands (with regularly spaced, spiraling utes) is not feasible because of the peculiar design of the former. Thus, although the plot of LCF lives of RaCe instrument is positioned in between that of the nontreated and magnetoelectropolished FlexMaster instrument (Fig. 2), it is not sure whether the effect had been due to the special surface treatment regime or to the design of the instrument. Despite the potential (theoretical) stress concentration due to the design of the RaCe instrument, this electropolished le has had a better resistance to LCF breakage than a commercial, ground, non-electropolished rotary instrument. Comparing the results for the FlexMaster instruments with and without surface treatment, a promising effect of the magnetoelectropolishing process for improving the fatigue resistance is noted. There is a signicant increase in the LCF lives for the treated versus the commercial (untreated) FlexMaster at all strain amplitudes. This is in direct contrast to the results of a previous study with a similar test methodology (22), which reported a lack of effect as a result of electropolishing for another brand of NiTi rotary le that was electropolished by its manufacturer (HERO Shaper; Micro-Mega). Unfortunately, parameters related to the electropolishing process (eg, strength and composition of the electrolytes, current density, and any other special arrangement for the electrolytic cell) in that study were not revealed by the manufacturer, and thus the underlying mechanism responsible for the difference could not be deduced. There were not any FlexMaster instruments that had been electropolished by an ordinary process available for comparison. On the other hand, the results of this study clearly indicated an improvement in the fatigue resistance of NiTi rotary le that had been treated with magnetoelectropolishing, although more studies are necessary to examine whether such surface treatment would benet instruments of various designs and dimensions and under various test conditions.
Conclusion
Figure 2. Relationship between fatigue lives in LCF region (Nf < 2000) of prototype and a commercial FlexMaster instruments [pooled data from a previous study (12)] and the maximum surface strain amplitude tested at various curvatures. (This gure is available in color online at www.aae.org/joe/.)
The resistance to LCF failure of a NiTi instrument rotating with a curvature in a corrosive environment is enhanced by a magnetoelectropolishing process. The instrument design, both cross-sectional and longitudinal, seems to have an effect on the fatigue behavior of NiTi rotary instruments.
1356
Praisarnti et al.
Acknowledgments
The authors would like to thank Dr May Wong, Associate Professor in Dental Public Health of the Faculty of Dentistry, University of Hong Kong for assistance in the statistical analysis. The free supply of FlexMaster and RaCe instruments by their respective manufacturers and the magnetoelectropolishing treatment by ELECTROBRIGHT, Macungie, PA are gratefully acknowledged. The study was funded in part by a research grant of the University of Hong Kong (account no. 10208970.12058.08008.312.01).
16. Kim J-D, Jin D-X, Choi M-S. Study on the effect of a magnetic eld on an electrolytic nishing process. Int J Med Tools Manufacturing 2008;37:4018. 17. Parashos P, Messer HH. Rotary NiTi instrument fracture and its consequences. J Endod 2006;32:103143. 18. Tripi TR, Bonaccorso A, Condorelli GG. Cyclic fatigue of different nickel-titanium endodontic rotary instruments. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;102:e10614. 19. Anderson ME, Price JW, Parashos P. Fracture resistance of electropolished rotary nickel-titanium endodontic instruments. J Endod 2007;33:12126. 20. Kim HC, Cheung GS, Lee CJ, Kim BM, Park JK, Kang SI. Comparison of forces generated during root canal shaping and residual stresses of three nickel-titanium rotary les by using a three-dimensional nite-element analysis. J Endod 2008;34:7437. 21. Herold KS, Johnson BR, Wenckus CS. A scanning electron microscopy evaluation of microfractures, deformation and separation in EndoSequence and Prole nickeltitanium rotary les using an extracted molar tooth model. J Endod 2007;33:7124. 22. Cheung GSP, Shen Y, Darvell BW. Does electropolishing improve the low-cycle fatigue behavior of a nickel-titanium rotary instrument in hypochlorite? J Endod 2007;33:121721. 23. Pruett JP, Clement DJ, Carnes DL Jr. Cyclic fatigue testing of nickel-titanium endodontic instruments. J Endod 1977;23:7785. 24. Hakel Y, Serfaty R, Bateman G, Senger B, Allemann C. Dynamic and cyclic fatigue of engine-driven rotary nickel-titanium endodontic instruments. J Endod 1999;25: 43440. 25. Peters OA, Kappeler S, Bucher W, Barbakow F. Engine-driven preparation of curved root canals: measuring cyclic fatigue and other physical parameters. Aust Endod J 2002;28:117. 26. Larsen CM, Watanabe I, Glickman GN, He J. Cyclic fatigue analysis of a new generation of nickel titanium rotary instruments. J Endod 2009;35:4013. 27. Cheung GSP, Darvell BW. Fatigue testing of a NiTi rotary instrument: part 1strainlife relationship. Int Endod J 2007;40:6128. 28. Huston RL. Principles of biomechanics. Boca Raton, FL: CRC Press; 2009. 79140. 29. Cheung GSP, Darvell BW. Low-cycle fatigue of rotary NiTi endodontic instruments in hypochlorite solution. Dent Mater 2008;24:7539. 30. Stokes OW, Fiore PM, Barss JT, Koerber A, Gilbert JL, Lautenschlager EP. Corrosion in stainless-steel and nickel-titanium les. J Endod 1999;25:1720. 31. OHoy PY, Messer HH, Palamara JE. The effect of cleaning procedures on fracture properties and corrosion of NiTi les. Int Endod J 2003;36:72432. 32. Peters OA, Roehlike JO, Baumann MA. Effect of immersion in sodium hypochlorite on torque and fatigue resistance of nickel-titanium instruments. J Endod 2007;33: 58993. 33. Sarkar NK, Redmond W, Schwaninger B, Goldberg AJ. The chloride corrosion behaviour of four orthodontic wires. J Oral Rehabil 1983;10:1218. 34. ASM Handbook, vol. 19: fatigue and fracture. Materials Park, OH: ASM International; 1996. 35. Cheung GSP, Shen Y, Darvell BW. Effect of environment on low-cycle fatigue of a nickel-titanium instrument. J Endod 2007;33:14337. 36. Cheung GSP, Darvell BW. Low-cycle fatigue of NiTi rotary instruments of various cross-sectional shapes. Int Endod J 2007;40:62632.
References
1. Sattapan B, Nervo GJ, Palamara J, Messer HH. Defects in nickel titanium endodontic rotary les after clinical usage. J Endod 2000;26:1615. 2. Peng B, Shen Y, Cheung GS, Xia TJ. Defects in ProTaper S1 instruments after clinical use: longitudinal examination. Int Endod J 2005;38:5507. 3. Parashos P, Gordon I, Messer HH. Factors inuencing defects of rotary nickeltitanium endodontic instruments after clinical use. J Endod 2004;30:7225. 4. Cheung GSP. Instrument fracture: mechanisms, removal of fragments, and clinical. Endodontic Topics 2009;16:126. 5. Cheung GS, Peng B, Bian Z, Shen Y, Darvell BW. Defects in ProTaper S1 instruments after clinical use: fractographic examination. Int Endod J 2005;38:8029. 6. Shen Y, Cheung GS, Bian Z, Peng B. Comparison of defects in ProFile and ProTaper systems after clinical use. J Endod 2006;32:615. 7. Spanaki-Voreadi AP, Kerezoudis NP, Zinelis S. Failure mechanism of ProTaper Ni-Ti rotary instruments during clinical use: fractographic analysis. Int Endod J 2006;39: 1718. 8. Cheung GS, Bian Z, Shen Y, Peng B, Darvell BW. Comparison of defects in ProTaper hand-operated and engine-driven instruments after clinical use. Int Endod J 2007; 40:16978. 9. Wei X, Ling J, Jiang J, Huang X, Liu L. Modes of failure of ProTaper nickel-titanium rotary instruments after clinical use. J Endod 2007;33:2769. 10. Suresh S. Fatigue of materials. 2nd ed. Cambridge, UK: Cambridge University Press; 1998. 11. Shabalovskaya S, Anderegg J, Van Humbeeck J. Critical overview of nitinol surfaces and their modications for medical appliances. Acta Biomaterialia 2008;4:44767. 12. Miao W, Mi X, Zhu M, Guo J, Kou Y. Effect of surface preparation on mechanical properties of a NiTi alloy. Mater Sci Forum 2002;394-395:1736. 13. Su Y-Y, Raman V. The quest for Nitinol wire surface quality for medical applications. In: SMST-97: Proceedings of the Second International Conference on Shape Memory and Superelastic Technologies, 1997:389-394 14. Bonaccorso A, Tripi TR, Cantatore G, Condorelli GG. Surface properties of nickeltitanium rotary instruments. Endod Pract Today 2007;1:4552. 15. Rockicki R, Hryniewicz T. Nitinol surface nishing by magnetoelectropolishing. Transaction of the Institute of Metal Finishing 2008;86:2805.
Effect of Electropolishing on Fatigue Failure of NiTI Rotary Files
1357
Comparative Evaluation of the Antimicrobial Efcacy of a 5% Sodium Hypochlorite Subsonic-activated Solution

Damiano Pasqualini, DDS,* Anna Maria Cufni, BSc, PhD, Nicola Scotti, DDS,* Narcisa Mandras, PhD, Daniela Scalas, PhD, Francesco Pera, DDS,* and Elio Berutti, MD, DDS*
Abstract
Introduction: The study evaluated the efcacy of subsonic agitation of sodium hypochlorite (NaOCl) in reducing bacterial load in the root canal. Methods: Root canals of 112 extracted human single-root teeth were preared using K-Flexoles (Dentsply Maillefer, Ballaigues, Switzerland) up to #20 and then shaped using ProTaper S1-S2-F1-F2-F3 (Dentsply Maillefer) at the working length. Irrigation was performed with 33 mL of 5% NaOCl, alternating with 10 mL of 10% EDTA. After ethylene oxide sterilization, the root canals were infected with 30 mL of Enterococcus faecalis culture and randomly assigned to four groups (n = 25) of different irrigation regimens plus positive and negative controls. Irrigation was performed with 2 mL of 5% NaOCl. In the NaOCl 15 group, the irrigant was left in place for 15 seconds, and in the NaOCl 30 group it was left in place for 30 seconds. In the EndoActivator (EA; Dentsply Tulsa Dental Specialties, Tulsa, OK) 15 and EA 30 groups, NaOCl was subsonically agitated with EA for 15 and 30 seconds, respectively. The residual bacterial count was then evaluated. Differences among groups were analyzed with one-way analysis of variance and the post hoc Bonferroni test (p < 0.05). Results: A statistically signicant difference was evidenced among groups (F3 = 9.01, p < 0.001). The standard irrigation groups (NaOCl 15 and 30) showed higher microbial counts than the EA 30 group (p < 0.05). Conclusion: Thirty seconds of NaOCl subsonic agitation with EndoActivator appears to be slightly more effective in reducing bacterial load in the root canal compared with NaOCl irrigation alone. (J Endod 2010;36:1358 1360)
acteria and their byproducts play a relevant role in the onset and perpetuation of pulpal and periradicular disease (1). Root canal treatment aims to eliminate remnants of pulp tissue, bacteria, and microbial toxins from the infected canal system and to prevent reinfection in order to achieve long-term success (24). Clinical studies have shown a more favorable long-term prognosis of specimens that were culture negative before obturation versus culture-positive specimens (94% vs 68%) (5), whereas other studies have failed to show any signicant difference concerning healing (6). However, there is general consensus that successful elimination of the causative agents from the root canal system is the key to health (7). Chemical-mechanical treatment of the root canal system has shown its efcacy in reducing bacterial load (8), even though bacteria may persist despite these efforts (9) because of the complexity of the root canal system (1012). Sodium hypochlorite (NaOCl) has been widely used as an irrigant since its introduction in endodontics by Walker in 1936, and it is still considered an effective disinfectant agent (13). NaOCl used at concentrations ranging from 0.5% to 6% is a potent antimicrobial agent and effectively dissolves organic debris. Numerous irrigation regimens have been proposed to enhance the effectiveness of NaOCl in disinfecting the root canal system, including in combination with sonic and ultrasonic instrumentation (14). Both cavitation and acoustic streaming may help to enhance debridement and disinfection (15) of complex root canal systems (16). However, ultrasonic instrumentation with metal active tips may lead to canal transportation, ledges, zipping, and stripping (17), especially in very curved canals (18). Recently, a device known as the EndoActivator (Dentsply Tulsa Dental Specialties, Tulsa, OK) (19) has been introduced; it is designed to enhance hydrodynamic phenomena by means of the subsonic activation of a passive smooth polymer tip, which is inserted into the root canal full of irrigating solution. The objective of this study was to evaluate the efcacy of subsonic activation of NaOCl in reducing bacterial load in the root canal.

One hundred twelve extracted human single-root teeth with a fully formed apex (upper central incisors and canines with substantially equal canal curvature and morphology) that had not undergone prior endodontic treatment were used. After debriding the root surface, specimens were immersed in a 5% solution of NaOCl (Niclor 5; ` OGNA, Muggio, Italy) for 1 hour and then stored in saline solution until preparation. Each specimen was sectioned to obtain a residual root length of 15 mm. Each root canal was preared using K-Flexoles (Dentsply Maillefer, Ballaigues, Switzerland) up to #20 and then shaped using ProTaper S1-S2-F1-F2-F3 (Dentsply Maillefer) at the working length. The working length was established under microscopic vision (OPMI Pro Ergo; Carl Zeiss, Oberkochen, Germany) at 10 magnication when the tip of the instrument was visible at the apical foramen. Irrigation was performed with a 30-gauge needle syringe using 33 mL of 5% sodium hypochlorite at 50 C (Niclor 5; OGNA, Mug` gio, Italy) and alternating with 10 mL of 10% EDTA (Tubuliclean, OGNA); the total irrigation time was 10 minutes per specimen. After drying with paper points, the roots were inspected under the microscope at 10 magnication to verify the absence of cracks and canal cleanliness. Root surfaces were sealed with varnish and sticky wax; each specimen was xed with cyanoacrylic cement onto an Eppendorf tube, which was placed in a plastic support box. Specimens were placed in envelopes and sterilized with ethylene oxide. This is a volatile gas that does not alter the structure of materials with which it
Key Words
Disinfection, EndoActivator, endodontic sodium hypochlorite, subsonic irrigants,
From the Departments of *Endodontics and Public Health and Microbiology, University of Turin, Turin, Italy. Address requests for reprints to Dr Damiano Pasqualini, via Barrili, 910134 Torino, Italy. E-mail address: dampasq@libero. it. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.03.035
1358
Pasqualini et al.
comes into contact and does not produce a temperature increase. It leaves no residue at the end of the sterilization cycle, even inside the dentin tubules, not inuencing the growth or vitality of bacteria inoculated subsequently (2023). The procedure was as follows: 6 hours at 40 C, 3 hours at 70% to 75% humidity, a 6-hour application of 10% ethylene oxide, and total removal of the gas from the envelope by repeated replacement of the air content. The sterilized roots were placed under a laminar ow biohazard cabinet (CLANLAF VFR 1206; Capriolo, Brescia, Italy). The root canals were infected with a standard volume of 30 mL of a pure culture of Enterococcus faecalis ATCC 29212, which was previously grown in brain-heart infusion (Oxoid, Milan, Italy) medium broth for 24 hours and adjusted spectrophotometrically to an optical density of 0.15 at 620 nm (Genesys 20 Spectrophotometer; Thermo Electron Corporation, Madison, WI) to match the turbidity of 3 107 CFU as conrmed by colony counts in triplicate. Specimens were further incubated aerobically at 37 C for 2 hours to allow penetration of E. faecalis into the root canal dentine. Two additional specimens were used as negative controls and 10 as positive controls. The remaining 100 samples were randomly subdivided into four groups (n = 25) using a random numbers table. one-way analysis of variance test and a post hoc Bonferroni test for multiple comparisons. Differences were considered statistically signicant when p < 0.05. All statistical analyses were performed using the SPSS for Windows 12.0 software package (SPSS Inc, Chicago, IL).
Results
Descriptive statistics of the postirrigation microbe count and the percentage of bacterial load reduction are summarized in Table 1. The inferential analysis revealed a statistically signicant difference among groups (F3 = 9.01, p < 0.001). The multiple comparisons post hoc analysis evidenced a statistically signicant difference between standard NaOCl irrigation groups 15 and 30 and group EA 30 in which the NaOCl was activated with the subsonic device for 30 seconds (p < 0.05). The bacterial load reduction compared with positive controls (mean 1.26 1.05 107 CFU, 61.5% reduction) ranges from 98.6% (NaOCl 15) to 99.6% (EA 30) with slight differences among groups.
Discussion
The need to improve root canal disinfection is increasingly attracting interest because even modern nickel-titanium rotary instrumentation only act on the central portion of the root canal system, leaving potential niches untreated (2124). Thus, in recent decades, endeavors have been made to enhance the efcacy of irrigant solutions through innovative irrigant delivery devices and agitation techniques, both manual and machine assisted (19). Sonic activation has been shown to be an effective method to remove the oral biolm and enhance root canal disinfection (25). However, the performance of subsonic agitation appears to be less effective compared with ultrasonic activation of irrigant solutions (26). This may be attributed to the different acoustic streaming velocity and frequency, which positively inuence debris removal from the qualitative standpoint. However, other studies found no difference between the 2 systems (27) and reported similar penetration of the solution into extracted teeth accessory canals (28), whereas the EA promoted less extrusion of the irrigant over the apex (29). The advantages of sonic agitation of the irrigant solution have been analyzed, reporting signicantly better debridement of the root canal walls compared with manual agitation with endodontic les (27). The EA system has been reported to effectively clean debris from lateral canals, remove the smear layer, and dislodge clumps of simulated biolm within the curved canals of molar teeth (30). Another recent study (31) compared the effects of different ultrasonic tips and the EA system on necrotic pulp dissolution and transportation of the main canal using epoxy resinmodied models with simulated accessory canals and 2.5% NaOCl irrigant. The results showed that ultrasonic activation dissolved more tissue than did sonic activation or passive irrigation; the EA sonic system with passive polymer tip and ultrasonically activated nickel-titanium tips caused no detectable canal transportation. However, these studies did not consider the inuence of the type of irrigation on root canal disinfection.
Irrigation Protocols and Microbe Count Specimens in the NaOCl 15 group (n = 25) were irrigated for 40 seconds with 2 mL of a 5% NaOCl solution at room temperature with a 30-gauge needle syringe 2 mm short of the apex. NaOCl was left in the root canal for 15 seconds before removal with 5 mL of saline solution. Specimens in group NaOCl 30 (n = 25) followed the same procedure, but the NaOCl was left in the root canal for 30 seconds before removal. Specimens in the EndoActivator (EA; Dentsply Tulsa Dental Specialties, Tulsa, OK) 15 group (n = 25) were irrigated for 40 seconds with 2 mL of a 5% NaOCl solution at room temperature with a 30-gauge needle syringe 2 mm short of the apex. NaOCl was left in the root canal and immediately activated subsonically for 15 seconds, inserting the EA 15/.02 polymer tip into the root canal 2 mm short of the apex; the irrigant was then removed with 5 mL of saline solution. The EA driver was set at 10.000 cpm. Specimens in the EA 30 group (n = 25) followed the same procedure, except that the NaOCl was activated with EA for 30 seconds. Positive controls (n = 10) were irrigated for 40 seconds with 2 mL of sterile water. Subsequent to each irrigation treatment, the root canals were dried at working length and sampled with sterile paper points. The paper points were transferred to tubes containing 1 mL of 0.85% saline solution and vortexed for 1 minute. After 10-fold serial dilutions, aliquots of 0.1 mL were plated onto brain-heart infusion medium agar and incubated at 37 C under aerobic conditions for 24 hours. The colony-forming units (CFUs) grown were counted and then transformed into actual counts based on the known dilution factors. Statistical Methods The Kolmogorov-Smirnov test for normality revealed a normal data distribution. Statistical analysis was conducted with a model of
TABLE 1. Descriptive Statistics of the Postirrigation Microbe Count (105CFUs) and Bacterial Load Reduction (%) 95% CI Group
NaOCl-15 NaOCl-30 EA-15 EA-30
N
25 25 25 25
Mean
3.75 3.47 2.34 1.01
STD
3.00 2.17 1.20 0.84
Median
2.2 3.4 2.25 0.67
Min
1.4 0.53 1.12 0.43
Max
8.5 6.2 5.08 3.17
Lower
2.47 2.46 1.83 0.67
Upper
5.04 4.47 2.85 1.35
Bacterial load reduction (%)

98.6 98.7 99.1 99.6
CFU, colony-forming units; CI, condence interval; EA, Endoactivator.
Antimicrobial Efcacy of a 5% NaOCl Subsonic-activated Solution
1359
The test hypothesis of this study was that sonic activation of NaOCl associated with a standard irrigation regimen enhances disinfection. The potential of the system, used in combination with a 5% sodium hypochlorite, to reduce bacterial load in the root canal was investigated. It was tested on clean root canal systems. This was achieved by root canal chemomechanical instrumentation and debridement, exploiting the well-known efcacy of standard irrigation protocols alternating NaOCl and EDTA (20) in removing smear layer and organic debris from the root canal system. It was hoped to suggest a possible improvement of disinfection because otherwise untreated niches may be open to the hydrodynamic action of the activated solution. The bacterial model used E. faecalis to test the efcacy of the irrigation protocols under comparison. E. faecalis is not particularly demanding from the nutritional standpoint, is resistant to extreme challenges, and has frequently been isolated in cases of endodontic failure (32, 33) because it can penetrate the dentine tubules and escape chemomechanical treatment of the root canal system (34). None of the protocols tested in this study completely eradicated microorganisms. The results show a signicant improvement of root canal disinfection in the EA 30 group in which 30 seconds of agitation was applied compared with irrigation alone. For the EA 15 group, in which activation was only for 15 seconds, there was no difference versus irrigation alone. The EndoActivator driver was always used at the maximum power setting of 10,000 cpm; thus, comparative data concerning the efcacy of the device at lower power settings are not available. This point remains to be investigated. A recent study using an E. faecalis infection model (35) investigated the intracanal disinfection performance of three different irrigation techniques: conventional irrigation with NaviTip needles (Ultradent, South Jordan, UT), the EndoActivator system, and the EndoVac system (Discus Dental, Culver City, CA). The importance of chemomechanical preparation in reducing bacterial load was conrmed, but no signicant differences were found in the three techniques, which performed similarly. In conclusion, within the limits of this study, sonic activation for 30 seconds of a 5% NaOCl solution appears to be slightly more efcacious in disinfecting the root canal compared with a standard irrigation regimen with needles and also compared with sonic activation for only 15 seconds. However, in the study conditions, the difference in bacterial load reduction among groups did not appear to be impressive enough to allow clinical extrapolation of the results. In our opinion, the interesting potential of sonic activation systems should be further investigated through clinical studies aimed to establish a correct irrigation protocol.
6. Peters LB, Wesselink PR. Periapical healing of endodontically treated teeth in one and two visits obturated in the presence or absence of detectable microorganisms. Int Endod J 2002;35:6607. 7. Chugal NM, Clive JM, Spangberg LS. A prognostic model for assessment of the outcome of endodontic treatment: effect of biologic and diagnostic variables. Oral Surg Oral Med Oral Pathol 2001;91:34252. 8. Sjogren U, Figdor D, Spangberg LS, et al. The antimicrobial effect of calcium hydroxide as a short-term intracanal dressing. Int Endod J 1991; 24:11925. 9. Peters LB, van Winkelhoff AJ, Buijs JF, et al. Effects of instrumentation, irrigation and dressing with calcium hydroxide on infection in pulpless teeth with periapical bone lesions. Int Endod J 2002;35:1321. 10. Hess W. The anatomy of the root canals of the teeth of the permanent dentition: part I. New York: William Wood & Co; 1925:147. 11. Skidmore AE, Bjorndal AM. Root canal morphology of the human mandibular rst molar. Oral Surg Oral Med Oral Pathol 1971;32:77884. 12. Vertucci FJ. Root canal anatomy of the human permanent teeth. Oral Surg Oral Med Oral Pathol 1984;58:58999. 13. Bergenholtz G, Spangberg L. Controversies in Endodontics. Crit Rev Oral Biol Med 2004;15:99114. 14. Martin H. Ultrasonic disinfection of the root canal. Oral Surg Oral Med Oral Pathol 1976;42:929. 15. Martin H, Cunningham W. Endosonicsthe ultrasonic synergistic system of endodontics. Endod Dent Traumatol 1985;1:2016. 16. Archer R, Reader A, Nist R, et al. An in vivo evaluation of the efcacy of ultrasound after step-back preparation in mandibular molars. J Endod 1992;18: 54952. 17. Calhoun G, Montgomery S. The effect of four instrumentation techniques on root canal shape. J Endod 1988;14:2737. 18. Schulz-Bongert U, Weine FS, Schulz-Bongert J. Preparation of curved canals using a combined hand-ling, ultrasonic technique. Compend Cont Educ Dent 1995; 16:2724. 19. Gu L, Kim JR, Ling J, et al. Review of contemporary irrigant agitation techniques and devices. J Endod 2009;35:791804. 20. Berutti E, Marini R, Angeretti A. Penetration ability of different irrigants into dentinal tubules. J Endod 1997;23:7257. 21. Walton RE. Histologic evaluation of different methods of enlarging the pulp canal space. J Endod 1976;2:30411. 22. Peters OA. Current challenges and concepts in the preparation of root canal system. J Endod 2004;30:55967. 23. Wu MK, Wesselink PR. A primary observation on the preparation and obturation of oval canals. Int Endod J 2001;34:13741. 24. Schafer E, Zapke K. A comparative scanning electron microscopic investigation of the efcacy of manual and automated instrumentation of root canals. J Endod 2000;26:65864. 25. Pitt WG. Removal of oral biolm by sonic phenomena. Am J Dent 2005;18: 34552. 26. Sabins RA, Johnson JD, Hellstein JW. A comparison of the cleaning efcacy of shortterm sonic and ultrasonic passive irrigation after hand instrumentation in molar root canals. J Endod 2003;29:6748. 27. Jensen S, Walker T, Hutter J, et al. Comparison of the cleaning efcacy of passive sonic activation and passive ultrasonic activation after hand instrumentation in molar root canals. J Endod 1999;25:7358. 28. De Gregorio C, Estevez R, Cisneros R, et al. Effect of EDTA, sonic and ultrasonic activation on the penetration of sodium hypochlorite into simulated lateral canals: an in vitro study. J Endod 2009;35:8915. 29. Desai P, Himel V. Comparative safety of various intracanal irrigation systems. J Endod 2009;35:5459. 30. Caron G. Cleaning efciency of the apical millimeters of curved canals using three different modalities of irrigant activation: an SEM study [masters thesis]. Paris: Paris VII University; 2007. ` 31. Al-Jadaa A, Paque F, Attin T, et al. Acoustic hypochlorite activation in simulated curved canals. J Endod 2009;35:140811. 32. Siren EK, Haapasalo MP, Ranta K, et al. Microbiological ndings and clinical treatment procedures in endodontic cases selected for microbiological investigation. Int Endod J 1997;30:915. 33. Kajaoglu G, rstavik D. Virulence factors of Enterococcus faecalis: relationship to endodontic disease. Crit Rev Oral Biol Med 2004;15:30820. 34. Waltimo TMT, rstavik D, Siren EK, et al. In vitro yeast infection of human dentine. J Endod 2000;26:2079. 35. Brito PRR, Souza LC, Machado de Oliveira JC, et al. Comparison of the effectiveness of three irrigation techniques in reducing intracanal Enterococcus faecalis populations: an in vitro study. J Endod 2009;35:14227.
Acknowledgments
The authors gratefully thank Mario Alovisi and Francesco Coero Borga for their valuable support.
References
1. Kakehashi S, Stanley HR, Fitzgerald RJ. The effects of surgical exposures of dental pulps in germ-free and conventionally laboratory rats. Oral Surg Oral Med Oral Pathol 1965;20:3408. 2. Siqueira JF, Rocas IN. Clinical implications and microbiology of bacterial persistence after treatment procedures. J Endod 2008;34:1291301. 3. Wong R. Conventional endodontic failure and retreatment. Dent Clin North Am 2004;48:26589. 4. Basmadijan-Charles CL, Farge P, Bourgeois DM, et al. Factors inuencing the long-term results of endodontic treatment: a review of the literature. Int Dent J 2002;52:816. 5. Sjogren U, Figdor D, Persson S, et al. Inuence of infection at the time of root lling on the outcome of endodontic treatment of teeth with apical periodontitis. Int Endod J 1997;30:297306.
1360
Pasqualini et al.
Effectiveness of Different Final Irrigant Activation Protocols on Smear Layer Removal in Curved Canals
Gregory Caron, DDS,* Khan Nham, DDS, Francois Bronnec, DDS,* and Pierre Machtou, DDS*
Abstract
Introduction: A nal ush with chelating agents and antiseptic irrigating solutions is needed to remove the smear layer. The improvement of these protocols is possible by using specic delivery and agitation techniques. This study examined the effect of different nal irrigation regimens and methods of activation on smear layer removal in curved canals after root canal instrumentation. Methodology: Mesial root canals of 50 extracted mandibular molars were prepared using ProTaper rotary les (Dentsply Maillefer, Ballaigues, Switzerland) and 3% NaOCl. Teeth were then allocated to two control groups and four experimental groups (n = 10) for nal irrigation as follows: no-activation group (nal rinse with a 27-gauge needle and 17% EDTA/3% NaOCl), manual-dynamic activation group (nal rinse 17% EDTA/3% NaOCl + gutta-percha agitation), automated-dynamic activation group (nal rinse 17% EDTA/3% NaOCl + RinsEndo [Durr Dental GmbH & Co KG, Bietigheim-Bissingen, Germany]), and sonicactivation group (nal rinse 17% EDTA/3% NaOCl + Endoactivator [Advanced Endodontics, Santa Barbara, CA]). All mesial roots were split with a new approach to allow visualization of every third of the canal, particularly the apical third. The samples were prepared for scanning electron microscopic observation to assess the smear layer removal. Blind scoring was performed by two calibrated observers using a ve-score scale. The differences in smear layer scores between the experimental groups were analyzed with the Kruskal-Wallis test and the Mann-Whitney U test. The level of signicance was set at p = 0.05. Results: Very high levels of root canal cleanliness (#score 3) were found for each test group with activation. For the middle and apical third, the no-activation group was signicantly less effective than the three other activation groups (p < 0.05). The manual-dynamic activation group (nal rinse 17%EDTA/3%NaOCl + gutta-percha agitation) and the sonic-activation group (nal rinse 17%EDTA/ 3%NaOCl + Endoactivator) showed signicantly better smear layer removal (p < 0.05) in comparison with the other test groups in the apical third. Conclusion: Root canal cleanliness benets from solutions activation (especially sonic activation and manual-dynamic activation) in comparison with no activation during the nal irrigation regimen. (J Endod 2010;36:13611366)
Key Words
Automated-dynamic activation, nal irrigation, manual-dynamic activation, smear layer, sonic activation
he ultimate goal of endodontic treatment is to control the microbial factor in complex root canal anatomy, especially in the apical one third (1). This objective is achieved by combining instrument-based preparation (manual or mechanical) with antiseptic irrigating solutions followed by three-dimensional obturation of the root canal system. The gold standard irrigant is still sodium hypochlorite, which can be associated with EDTA to offer bactericidal, solvent, and chelating actions all in one. This combination offsets the drawbacks of the instrument-based preparation, particularly the creation of debris (2) and the smear layer (3). The smear layer is potentially infected, and its removal allows more efcient penetration of intracanal medications into the dentinal tubules and a better interface between the lling material and the root canal walls (4). The literature reports generally show that regardless of the instrumentation and irrigation techniques, the effectiveness of irrigating solutions remains limited in the apical one third of a prepared canal. This is particularly true for curved root canals (5, 6) and even on single-rooted teeth (7, 8). Therefore, the improvement of irrigating protocols is essential during root canal treatment in order to achieve better cleaning efciency especially in the very complex apical area. Currently, several techniques and systems are available and reported to improve nal irrigation before obturation (9). Among these protocols passive ultrasonic irrigation has shown promising results on debris (10) and smear layer removal (11). However, there are little published scientic data comparing the new and emerging devices and methods for disinfection with a conventional syringe irrigation. First, a fully tapered and apically trimmed nonstandardized gutta-percha master cone could be used in a well-prepared canal as a cost-effective mechanical agitator. A gentle pumping with short vertical strokes has been shown to promote disinfection (12, 13). Another recently released device, the RinsEndo irrigation system (Durr Dental GmbH & Co KG, Bietigheim-Bissingen, Germany), delivers solutions at a ush-through rate of 6.2 mL/min using pressure-suction technology for intracanal activation (1.6 Hz). This device generates a mechanical action that is able to produce a hydrodynamic exchange circuit (13, 14). Finally, the Endoactivator system (Advanced Endodontics, Santa Barbara, CA) has been purported to improve disinfection. This device uses
From the )Department of Endodontics and Restorative Dentistry, School of Dentistry, University, Paris, France; and Department of Surface Physico-Chemistry, ENSCP, Paris, France. Supported in part by the Association de formation en Endodontie Appliquee. Address requests for reprints to Dr Gregory Caron, 5 rue Garanciere 75006 Paris , France. E-mail address: greg.hypomoclion@gmail.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.03.037
Final Irrigant Activation Protocols for Smear Layer Removal in Curved Canals
1361
a cordless sonic handpiece to activate strong, highly exible polymer tips. Noncutting tips have tapers and terminal diameters that closely match the dimensions of the nal root canal preparation (15). Mechanical oscillations are produced mainly at the tip of the activator with a frequency ranging from 1 to 10 kHz. The purpose of this study was to assess smear layer removal efciency after using gutta-percha master cone or RinsEndo or the Endoactivator in comparison to conventional nal irrigation using a 27-gauge needle. The null hypothesis was that there is no difference in smear layer removal between nal irrigation with no activation and nal irrigation with activation. The frequency of activation used was 100 push-pull strokes per minute (12). The canals were then ushed with 3 mL of a 3% solution of sodium hypochlorite. This solution was then activated for 30 seconds per canal using the pumping master cone method. Automated-dynamic Activation Group. After optimally preparing the canal, surplus NaOCl was suctioned away with the 27-gauge needle. Following the manufacturers instructions, each canal was ushed with 1 mL of 17% EDTA using the RinsEndo system for 1 minute per canal. Each canal was then ushed with 3 mL of a 3% solution of sodium hypochlorite delivered via the RinsEndo system for 30 seconds in each canal. Sonic-activation Group. After optimally preparing the canal, surplus NaOCl was suctioned away with the 27-gauge needle. Each canal was then irrigated with 1 mL of 17% EDTA using the 27-gauge needle. This intracanal solution was activated with either a red (25/04) or blue (35/04) EndoActivator tip at a speed of 10 kHz for 1 minute per canal. Each canal was then ushed with 3 mL of 3% sodium hypochlorite. This solution was then activated using either the red or blue EndoActivator tip for 30 seconds per canal. After activation, the action of the sodium hypochlorite was stopped by syringing in 3 mL of physiologic saline solution per canal (ie, 6 mL for each tooth in the four test groups). All the samples were then placed in a solution of physiologic saline and stored at 4 C until proceeding with the sectioning protocol.

The study was conducted on 50 freshly extracted mature human mandibular molar teeth with two separate mesial canals. None of the teeth had received restorative or endodontic treatment before extraction. After extraction, the teeth were conserved in a solution of physiologic saline to avoid damaging the pulp tissue and then stored at 4 C (16). Each individual tooth was then photographed and x-rayed to visualize the root canal anatomy and conrm that each canal curved at more than 20 (17). After cutting a four-wall access cavity, the full lengths of the mesiobuccal and mesiolingual canals were determined when a #08 K-type le could be visualized at the apical foramen. Both the mesial and distal roots were sealed with melted wax to close the apical foramen (18). The aim was to prevent the irrigants from escaping through the apex in order to simulate in vivo conditions (19). The two mesial root canals were prepared using the Protaper Universal rotary les system (Dentsply Maillefer, Ballaigues, Switzerland) following the protocol described by Machtou and Ruddle (20) in which the apical one-third taper of the nished preparation is approximately 10%. All the canals were prepared so that the nished size of each apical foramen ranged between 0.20 mm and 0.30 mm in diameter. A medium nonstandardized gutta-percha master cone (Henry Schein, Melville, NY) was tted in each canal to the full working length, and then the tooth was x-rayed. After each instrument, the expending preparation was ooded by passively irrigating 0.5 mL of 3% sodium hypochlorite (Parcan; Septodont, Saint-Maur-des-Fosses, France) into the canal using a 27-gauge needle (Monoject; Tyco Kendall, Hampshire, UK) loosely inserted as far as possible without binding. A #10 K-type patency le was used to maintain apical patency and move debris into suspension followed by ushing the canal again with 0.5 mL of fresh irrigant. All procedures were performed by the same operator (GC). The teeth were randomly divided into four experimental groups (n = 10) and two control groups. The negative controls (n = 5) received no nal irrigation regimen after tting of the master cone. The positive controls (n = 5) were immersed for 5 minutes in a bath of 17% EDTA followed by an immersion for 5 minutes in a bath of 3% NaOCl after the splitting process.
Sectioning of the Teeth and Preparation for SEM The teeth were sectioned in two halves; only the mesial root was kept for further study. Two horizontal grooves were made using a Frios diamond-cutting disk (Microsaw; Dentsply Friadent, Mannheim, Germany) mounted on a surgical dental handpiece to separate the mesial root into thirds (the apical third, the middle third, and the coronal third). This step was performed using a surgical microscope. Colored gutta-percha cones were tted and used as markers to best gauge groove depth. The objective was to avoid any intrusion of the cutting disc into the canals, which would pollute the samples by splattering cutting debris into the root canal system. To avoid any contamination, coronal thirds were discarded because there was a bigger gap between the gutta-percha markers and the prepared walls of the canal. This gap compromised vision and increased the possibility of the cutting disc inadvertently introducing debris into this region of the canal. The apical and middle one thirds of the canal were then sectioned in the longitudinal plane with a precision diamond bur (889 Model; Komet, Paris, France). A continuous supply of air was delivered to improve vision and cutting precision, which eliminated the potential of introducing debris into this region of the canal. Each third was vertically split by applying slight pressure to an enamel chisel into the longitudinal groove. Each sample was dehydrated in graded series of ethanol solutions, critical point dried, coated with gold, and viewed with a scanning electron microscope (Hitachi S2500,Verrieres-le-buisson, France) at 15 kV (Fig. 1). SEM Evaluation and Statistical Analysis Each fragment was rst viewed at low magnication (30) by the operator (GC) and another trained dentist with SEM studies (KN) in order to gain an overview of the sample. Image acquisition on the most typical zones of the sample was performed at a magnication of 1,000 to assess the presence of smear layer. The images were blindly assessed by two practitioners with no inside knowledge of the operative procedures and who were fully conversant with qualitative analysis on root canal images produced by scanning electron microscopy (PM, FB). Analysis began using the scale described in Hulsmann et al
Final Irrigation Protocols No-activation Group. After suctioning away the intracanal surplus of NaOCl with the 27-gauge needle, 1 mL of 17% EDTA (Largal Ultra; Septodont, Saint-Maur-des-Fosses, France) was ushed into each canal and was left in place for 1 minute per canal. All canals were then ushed with 3 mL of 3% sodium hypochlorite, which was left in place for 30 seconds per canal. Manual-dynamic Activation Group. After suctioning away the intracanal surplus of NaOCl with the 27-gauge needle, 1 mL of 17% EDTA was ushed into each canal. This solution was activated by using a gutta-percha cone as previously described for 1 minute in each canal.
1362
Caron et al.
Figure 1. Four different apical sample fragments highlighting the reproducibility and preservation of the apical one-third samples using our experimental protocol. Magnication: 30.
(21), but the signicant lack of sensitivity in the best scores prompted us to rene the system, as follows (Fig. 2): score 1: no smear layer and dentinal tubules open, score 2: small amounts of scattered smear layers and dentinal tubules open, score 3: thin smear layer and dentinal tubules partially open (characteristic image of crescent), score 4: partial covering with a thick smear layer, and score 5: total covering with a thick smear layer. First, the full set of samples was independently evaluated by two observers (PM and FB). If there were conicting results between these two observers, then a nal evaluation was made with the lower score chosen every time. Nonparametric data were analyzed by using the Kruskal-Wallis test and the Mann-Whitney rank sum test for pairwise comparisons. The signicance level for all statistical analyses was set
at a = 0.05. All statistical analyses were performed with the SPSS for Windows 12.0 software package (SPSS Inc, Chicago, IL).
Results
After consensus was reached for each group, mean scores for smear layer removal in the apical third and the middle third were listed (Table 1). The full set of negative control samples scored a 5 with a complete covering of a thick smear layer. All the positive control samples scored a 1 with no visible smear layer. In the middle third, comparisons between each group showed a statistically signicant difference (p < 0.005). When comparing each test group, only the no-activation group scored a 3 with a thin smear layer and showed 1363
Figure 2. A new ne-tuned scale used to evaluate sample cleanliness. Magnication: 1,000.
a statistical difference with the three other activation groups (p < 0.05) in which smear layer scores were always inferior to 3. Comparisons between each group showed a statistically signicant difference (p < 0.005) in the apical third. When comparing each test 1364
group, the sonic group (nal irrigation + Endoactivator) showed a statistical difference compared with all the test groups (p < 0.05). The exception was the manual-dynamic activation group (nal irrigation + gutta-percha agitation) in which no statistical diffence was
Caron et al.
TABLE 1. Mean Score Standard Deviation Comparing the Smear Layer among the Four Final Irrigation Regimens in the Apical and Middle Thirds Group
Final irrigation without activation Final irrigation + Master cone Final irrigation + Rinsendo Final irrigation + Endoactivator
N
10 10 10 10
Apical third
3.16 0.958 2.21 1.032 3 1.414 1.75 0.55
Middle third
3.470.874 2.05 1.05 2.5 1 1.88 0.857
detected. However, only the Endoactivator group showed smear layer removal lower than a score 2, which equates to a high level of cleanliness in all apical one-third samples.
Discussion
The endodontic community is now unanimous concerning the positive benet of irrigation during the root canal preparation phase (22). The chemomechanical preparation should ideally result in a fully cleansed and disinfected root canal system. Literature has shown that apical enlargement and deeper positioning of the irrigation needle are required to clean the apical third (5, 23, 24). However, very little data exist regarding smear layer removal, especially in molar teeth exhibiting curved canals where emphasis was placed on preparing a fully tapered and well-shaped canal with narrow apical diameters. Only one recent SEM study by Khademi et al (25) has shown the importance of the canal taper in curved canals. When the root canal taper was 0.06 mm/mm, there was comparable smear layer removal when the apical diameters were between 0.30 mm and 0.40 mm. It has been shown that for more narrow apical diameters the taper needs to be increased to 0.10 mm/mm in order to eliminate a maximum amount of debris (26, 27). A recent study on curved roots has shown a correlation between creating sufcient taper and propagation improvement of irrigants in root canal during the shaping process (28). In the present study, all the shaping procedures complied with the criteria of tapered canals and maintaining apical foramen as small as practical. In funnelshaped canals, both the tapered gutta-percha master cones and the tapered EndoActivator tips, when activated, provided cleaner results than syringe delivery systems (nal irrigation with no activation and RinsEndo). In this study, the four-wall access cavity provided a strategic reservoir to hold a more effective volume of irrigant for exchange during activation. This is in direct contrast with many studies in which the crown had been removed from the samples. Desirably, the irrigating solutions are apically exchanged each time the activator system is inserted into the canal. When the activator tip moves toward length, the reagent is displaced. When the activator is partially withdrawn, there is an effective exchange of solution into the apical one third of the canal. The efciency of this hydrodynamic circuit is further enhanced when combined with sonic oscillating movements. A pumping action synergistically combined with mechanical agitation explains the better results achieved with the EndoActivator. Recently, Uroz-Torres et al (29) found no difference in smear layer removal between the Endoactivator and conventional Max-I-Probe (Dentsply Rinn, Elgin, IL) irrigation using NaOCl and EDTA. The difference in results is attributed to differences in the activation protocols used. In our present study, a second activation was performed after the nal ush with NaOCl, and all apical onethird samples were shaped to 10% to enhance irrigation exchange and efciency (30).
So far, activation of irrigants without concomitant instrumentation of the root canal walls has been dened as passive ultrasonic irrigation (PUI) (9). PUI has been shown to be effective in removing debris (10) and smear layer in straight canals (31). Nevertheless, there are conicting results about the performance of PUI in terms of smear layer elimination (9, 32). Even when ultrasonically driven metal canula or instruments are precurved, there are obvious considerations and limitations using these devices in curved canals and to length (9, 33). There is always a risk of touching the walls, which would automatically trigger the formation of a new undesirable smear layer. Of greater concern, contacting a dentinal wall with an activated ultrasonic instrument invites iatrogenic events. This should be contrasted with the nonmetal surfaces of the activation systems used in this study (gutta-percha or polymer), which cannot generate a smear layer, internal ledge, or external transportation of the foramen. It should be noted that all of the samples tested by manual-dynamic irrigation or by sonic activation yielded very little smear layer. This level of cleanliness is an important nding because it was achieved on curved canals using activation systems other than metal ultrasonic les. Although these systems generate lower frequencies compared with the ultrasonically driven les (25-30 kHz), the vertical-stroke pumping motion used as part of the protocol promotes dynamic coronoapical circulation of the irrigating solutions. The benet of irrigant renewal and activation needs to be researched in greater detail, comparing this irrigation dynamic with the streaming pattern observed with PUI. Our experimental model used nal irrigation times (34) and nal irrigation volumes that proved effective and efcient (35) while at the same time avoiding peritubular and intertubular erosion. However, the timeframe given in the protocol may not be long enough for a system such as RinsEndo, which may require more time to achieve the same scores as the other activation systems. During the shaping procedures, the volume of 1 mL of irrigant dispensed after the use of each le was sufcient to get a clear solution inside the pulp chamber without visible debris. The data gathered through this experiment are transposable to clinical practice because the experimental model proposed closely mirrors the actual conditions encountered in routine molar treatment, but results should be interpreted with precaution because of the large standard deviation observed. One possible explanation could be the challenge of standardizing activation procedures in complex anatomy of mandibular molars where the two mesial canals commonly communicate along their lengths.
Conclusion
The experimental design implemented in this study prompted the following observations: the activation of irrigating solutions yielded cleaner canals compared with no activation, and a tapered activator that closely adapts to the dimensions of a shaped canal is the most effective (ie, the master gutta-percha cone and Endoactivator). Further investigations will be required to conrm this preliminary data, particularly in terms of biolm removal and apical disinfection results.
Acknowledgments
rr The authors are grateful to Du Dental for loaning the RinsEndo device used in this experiment. The authors thank Dr C. Ruddle and Advanced Endodontics for loaning the Endoactivator device used in this experiment. The authors also thank Septodont for providing the irrigating solutions Parcan and Largal Ultra used in this experiment.
1365
References
1. Nair PNR, Henry S, Cano V, et al. Microbial status of apical root canal system of human mandibular rst molars with primary apical periodontitis after one-visit endodontic treatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005; 99:23152. 2. Guppy DR, Curtis RV, Pitt Ford TR. Dentine chips produced by nickel-titanium rotary instruments. Endod Dent Traumatol 2000;16:25864. 3. Jeon IS, Spangberg LSW, Yoon TC, et al. Smear layer production by 3 rotary reamers with different cutting blade designs in straight root canals: a scanning electron microscopic study. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2003;96: 6017. 4. Torabinejad M, Handysides R, Khademi AA, et al. Clinical implications of the smear layer in endodontics: a review. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2002;94:65866. 5. Sedgley CM, Nagel AC, Hall D, et al. Inuence of irrigant needle depth in removing bioluminescent bacteria inoculated into instrumented root canals using real-time imaging in vitro. Int Endod J 2005;38:97104. 6. Senia ES, Marshall FJ, Rosen S. The solvent action of sodium hypochlorite on pulp tissue of extracted teeth. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1971; 31:96103. 7. Gambarini G, Laszkiewicz. A scanning electron microscopic study of debris and smear layer remaining following use of GT rotary instruments. Int Endod J 2002; 35:4227. 8. Yamada RS, Armas A, Goldman M, et al. A scanning electron microscopic comparison of a high volume nal ush with several irrigating solutions: part 3. J Endod 1983;9:13742. 9. Gu LS, Kim JR, Ling J, et al. Review of contemporary irrigant agitation techniques and devices. J Endod 2009;35:791804. 10. Jiang LM, Verhaagen B, Versluis M, et al. Evaluation of a sonic device designed to activate irrigant in the root canal. J Endod 2010;36:1436. 11. Paragliola R, Franco V, Fabiani C, et al. Final rinse optimization: inuence of different agitation protocols. J Endod 2010;36:2825. 12. Huang T-Y, Gulabivala K, Ng YL. A bio-molecular lm ex-vivo model to evaluate the inuence of canal dimensions and irrigation variables on the efcacy of irrigation. Int Endod J 2008;41:6071. 13. McGill S, Gulabivala K, Mordan N, et al. The efcacy of dynamic irrigation using a commercially available system (RinsEndo) determined by removal of a collagen biomolecular lm from an ex vivo model. Int Endod J 2008;42:6028. 14. Hauser V, Braun A, Frentzen M. Penetration depth of a dye marker into dentine using a novel hydrodynamic system (RinsEndo). Int Endod J 2007;40. 66452. 15. Ruddle CJ. Endodontic disinfection: tsunami irrigation. Endod Pract 2008;11:715. 16. Gambarini G. Shaping and cleaning the root canal system: a scanning electron microscopic evaluation of a new instrumentation and irrigation technique. J Endod 1999;25:8003. 17. Schneider SW. A comparison of canal preparations in straight and curved canals. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1971;32:2715. 18. Tay FR, Gu LS, Schoeffel GJ, et al. Effect of vapor lock on root canal debridement by using a side-vented needle for positive-pressure irrigant delivery. J Endod 2010;36: 74550. 19. Schoeffel GJ. The EndoVac method of endodontic irrigation: safety rst. Dent Today 2007;26:926. 20. Machtou P, Ruddle CJ. Advancements in the design of endodontic instruments for root canal preparation. Alpha Omegan 2004;97:815. 21. Hulsmann M, Rummelin C, Schafers F. Root canal cleanliness after preparation with different endodontic handpieces and hand instruments: a comparative SEM. J Endod 1997;23:3016. 22. Bystrom A, Sundqvist G. Bacteriologic evaluation of the effect of 0.5 percent sodium hypochlorite in endodontic therapy. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1983;55:30712. 23. Chow TW. Mechanical effectiveness of root canal irrigation. J Endod 1983;9: 4759. 24. Falk KW, Sedgley CM. The inuence of preparation size on the mechanical efcacy of root canal irrigation in vitro. J Endod 2005;31:7425. 25. Khademi A, Yazdizadeh M, Feizianfard M. Determination of the minimum instrumentation size for penetration of irrigants to the apical third of root canal systems. J Endod 2006;32:41720. 26. Abou-Rass M, Piccinino MV. The effectiveness of four clinical irrigation methods on the removal of root canal debris. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1982;54:3238. 27. Albrecht LJ, Baumgartner JC, Marshall JD. Evaluation of apical debris removal using various sizes and tapers of ProFile GT Files. J Endod 2004;30:4258. 28. Bronnec F, Bouillaguet S, Machtou P. Ex vivo assessment of irrigant penetration and renewal during the cleaning and shaping of root canals: a digital subtraction radiographic study. Int Endod J 2010;43:27582. 29. Uroz-Torres D, Gonzales-Rodriguez MP, Ferre-Luque CM. Effectiveness of the Endoactivator system in removing the smear layer after root canal instrumentation. J Endod 2010;36:30811. 30. Yana Y. An in vivo comparative study of the penetration of sodium hypochlorite in root canal systems during cleaning and shaping procedures using the B.U. technique and sonic instrumentation [masters thesis]. Boston, MA: Boston University; 1989. 31. Kuah HG, Lui JN, Tseng PS, et al. The effect of EDTA with and without ultrasonics on removal of the smear layer. J Endod 2009;35:3936. 32. Mayer BE, Peters OA, Barbakow F. Effects of rotary instruments and ultrasonicirrigation on debris and smear layer scores: a scanning electron microscopic study. Int Endod J 2002;35:5829. 33. Ahmad M, Pitt Ford TR, Crum LA. Ultrasonic debridement of root canals: acoustic streaming and its possible role. J Endod 1992;13:4909. 34. Saito K, Webb TD, Imamura GM, et al. Effect of shortened irrigation times with 17% ethylene diamine tetra-acetic acid on smear layer removal after rotary canal instrumentation. J Endod 2008;34:10114. 35. Crumpton BJ, Goodell GG, McClanahan SB. Effects on smear layer and debris removal with varying volumes of 17% REDTA after rotary instrumentation. J Endod 2005;31:5368.
1366
Caron et al.
In Vitro Comparisons of Debris Removal of the EndoActivatorTM System, the F FileTM, Ultrasonic Irrigation, and NaOCl Irrigation Alone after Hand-rotary Instrumentation in Human Mandibular Molars
Steven L. Klyn, DDS,* Timothy C. Kirkpatrick, DDS, and Richard E. Rutledge, DDS
Abstract
Introduction: The purpose of this in vitro study was to compare the debris removal efcacy of the EndoActivatorTM system, the F leTM, ultrasonic irrigation, or 6% NaOCl irrigation alone in human mandibular molars after hand-rotary instrumentation. Methods: A custom brass cube (K-Kube) was used to create a sealed canal system, allowing each tooth to serve as its own control. Forty extracted mandibular molars were randomly divided into 4 equal experimental groups. Each tooth was mounted, sectioned at 1, 3, and 5 mm from the working length, and then reassembled into the KKube, and the mesial roots were similarly prepared by using hand-rotary instrumentation. For nal debridement, group 1 used F le for 30 seconds, group 2 used EndoActivator system for 30 seconds, group 3 used ultrasonic irrigation for 30 seconds, and group 4 used irrigation with 6% NaOCl within 1 mm of working length. All groups received a nal irrigation with 6% NaOCl in each canal. Specimens were evaluated at 1, 3, and 5 mm from the working length for cleanliness by capturing a digital image with a stereomicroscope. All specimens had the percent cleanliness for each canal and isthmus calculated both before and after nal debridement. Statistical analysis was completed by using a repeated-measures analysis of variance with Tukey post hoc tests. Results and Conclusions: The results showed no statistically signicant difference in canal or isthmus cleanliness among the 4 groups, but there was a statistically signicant difference (P < .001) in canal cleanliness between the 1-mm level versus the 3-mm and 5-mm levels for all of the groups. (J Endod 2010;36:13671371)
Key Words
EndoActivator, F le, irrigation, K-Kube, ultrasonics
he prevention or treatment of apical periodontitis is the ultimate goal of endodontic therapy (1). Complete debridement of the root canal system is complicated by the presence of a complex system of isthmuses, accessory canals, ns, and deltas that can provide ideal locations for harboring debris (2). The residual debris within the canal system can be composed of bacteria, other microorganisms and their by-products, vital and necrotic pulp tissue, smear layer, and biolm. Although mechanical instrumentation and the use of irrigants within the canal have shown effectiveness, complete cleanliness of these inaccessible areas is difcult to achieve (36). Studies have shown that incomplete canal debridement can lead to a decrease in endodontic success (7, 8). To aid in the removal of debris and the disinfection of the canal system, the use of various intracanal irrigants and techniques has been advocated (9, 10). No single solution or technique has been found to achieve complete canal debridement, but the use of ultrasonics as an adjunct to cleaning and shaping has shown increased canal cleanliness. Archer et al (11) compared step-back instrumentation alone with step-back instrumentation followed by ultrasonic irrigation and showed signicantly cleaner canals and isthmuses at 1, 2, and 3 mm from the apex with the use of ultrasonics. Other studies have conrmed the effectiveness of ultrasonic irrigation on the removal of debris from within the canals and isthmuses (1216). Ultrasonic irrigation has the potential for continued prepping or cutting of the canal walls during its use after cleaning and shaping. Canal deviation, apical zipping, and even root perforations can occur while using an ultrasonically activated le within a curved canal during irrigation. These potential problems have led researchers to the development of new techniques based on ultrasonic technology. By using a modied ultrasonically charged irrigation needle, Burleson et al (17) showed a signicant improvement in canal cleanliness at the apex and within the isthmuses of the mesial roots of mandibular molars without undue canal deviation. Two systems to aid in the debridement of the canal system were recently introduced, the EndoActivator System (Advanced Endodontics, Santa Barbara, CA) and the F le (Plastic Endo, Buffalo Grove, IL). Both systems use noncutting plastic or polymer tips to enhance root canal debridement after instrumentation. The tips do not actively engage the dentin walls, thus preventing further enlargement of the canals. The purpose of this in vitro study was to compare the effectiveness of the F le, the EndoActivator System, ultrasonic irrigation, and 6% NaOCl irrigation alone in removing canal and isthmus debris in human mandibular molars.
From the *Department of Endodontics, 10th Dental Squadron, United States Air Force Academy, Colorado; and Department of Endodontics, Wilford Hall Medical Center, Lackland Air Force Base, Texas. Address requests for reprints to Timothy C. Kirkpatrick, DDS, Program Director, Endodontics Residency, Wilford Hall Medical Center, 59th Dental Training Squadron/ SGDTN, 2450 Pepperrell St, Lackland AFB, TX 78236. E-mail address: timothy.kirkpatrick@us.af.mil. 0099-2399/$0 - see front matter Copyright 2010 Published by Elsevier Inc. on behalf of the American Association of Endodontists. doi:10.1016/j.joen.2010.03.022
Comparison of Debris Removal by 4 Different Systems
1367
Specimen Preparation Forty extracted human mandibular molars with mesial root curvatures less than 25 degrees were selected and stored in 0.5% chloramine-T before use. The buccal and lingual cusps were attened to provide a reproducible reference point during instrumentation (Fig. 1C). After standard access openings were made, working length (WL) was determined by inserting a #10 Flex-R le (Miltex, York, PA) until the tip of the le was visible at the apical foramen and subtracting 1 mm. Each mesial canal was instrumented until a Prole GT #20/.06 le (Dentsply-Tulsa Dental, York, PA) could be inserted to the WL. Irrigation was with saline only. The access opening was sealed with a moist cotton pellet and Cavit (3M ESPE, St Paul, MN), making sure the Cavit extended into the orice of the distal canal. The distal root was amputated, and Triad gel (Dentsply Trubyte, York, PA) was used to seal the apical foramina on the mesial roots and the distal root orice to prevent mounting resin from entering these areas. To allow more precise visualization of the root apex during sectioning, the apical 2 mm of the mesial roots was dipped in methylene blue. The teeth were then embedded into a custom-made metal cube (KKube) at the level of the cementoenamel junction by using VariKleer resin (Buehler, Lake Bluff, IL) (Fig. 1A, B, E, F). Each specimen was cured by using a pressure pot of warm water at 20 psi for 30 minutes. After the resin had set, the embedded specimens were removed from the cube and stored in 100% humidity. Specimen Sectioning The mounted specimens were sectioned at 2, 4, and 6 mm from the apex (Fig. 1D) of the root by using an Isomet low-speed saw with a 0.30-mm-thick diamond blade (Buehler). The blade was irrigated with Isocut Plus Fluid (Buehler) and water according to the manufacturers recommendations.
Three 2-mm-thick sections were used for evaluation and scoring: section 1, apex to 1 mm coronal to WL; section 2, 13 mm coronal to WL; and section 3, 35 mm coronal to WL.
Canal Preparation After sectioning, the specimens were reassembled into the K-Kube, and all external hex bolts were rmly tightened. The Cavit and cotton pellet were removed, and a hand le was used to verify WL and proper assembly. Following coronal aring with Gates Glidden drills (Dentsply, York, PA), the canals were prepared with ProFile 0.04 rotary les (Dentsply-Tulsa Dental) using a crown-down technique to a master apical le size #40. Between each rotary le, 0.5 mL of 6% NaOCl was used to irrigate each canal by using a 30-gauge Max-i-ProbeTM (Dentsply). The Max-i-Probe was inserted until resistance was felt and then backed up approximately 0.5 mm. After nal instrumentation, each canal was irrigated with 2 mL of 6% NaOCl and dried with a capillary tip (Ultradent, South Jordan, UT) and paper points. Each canal was then irrigated with 2 mL of 17% ethylenediaminetetraacetic acid and dried before nal irrigation with 2 mL 6% NaOCl. All canals were then dried and the access was sealed with a moist cotton pellet and Cavit. Method of Evaluation Each specimen was then disassembled and images of the coronal aspect of each section were made by using a digital camera (Olympus DP71; Olympus, Tokyo, Japan) attached to a stereomicroscope (Olympus SZX16) at the highest magnication to allow complete view of the canals and isthmus. The full color images were viewed on a Cintiq 21 UX (Wacom Co Ltd, Saitama, Japan) monitor, and an interactive pen was used to trace the outline of the root canal, isthmuses, and remaining debris (Fig. 2). Debris was dened as any material present on the canal walls and in the canal lumen or isthmus. The software program Image J (National Institutes of Health, v1.39a) was used to calculate the area of the root canals, isthmuses, and amount of debris present. In order to
Figure 1. Specimen preparation. (A) K-Kube disassembled; (B) K-Kube assembled; (C) specimen preparation; (D) specimen mounted in resin and 2-mm sections measured; (E) sectioned specimen partially reassembled in K-Kube; (F) specimen fully mounted in K-Kube with access for instrumentation. (This gure is available in color online at www.aae.org/joe/.)
1368
Klyn et al.
Figure 2. Digital images of a specimen section at the 5-mm level demonstrating canal and isthmus debris. (A) Initial canal access only; (B) post cleaning and shaping; (C) post experimental treatment. An interactive pen was used to trace the outline of the canals, isthmuses, and remaining debris as shown in (D). Image J software was used to compute the canal cleanliness. (This gure is available in color online at www.aae.org/joe/.)
calculate the canal cleanliness, the area of remaining debris was divided by the total area of the canal or isthmus to yield a percentage. The percentage of canal debris present was subtracted from 1 to determine the percent of canal cleanliness.
Final Debridement The specimen sections were reassembled into the K-Kube, and each tooth was randomly assigned to 1 of 4 experimental groups. Each group was treated according to the manufacturers directions and then dried with a capillary tip. In group 1, the canals and chamber were lled with 2 mL of 6% NaOCl, and the F le (size #20/0.04 taper) was passively inserted into the canal with an electric slow-speed handpiece set at 600 rpm and a torque of 132 g/cm. The le was circumferentially worked along the dentinal walls with a cyclic axial motion (up and down) for 30 seconds. In group 2, the canals and chamber were lled with 2 mL of 6% NaOCl before treatment. The EndoActivator sonic handpiece was set at 10,000 cpm, and a size #15/0.02 taper activator tip was passively inserted to within 2 mm of the WL and used in a pumping action to move the EndoActivator tip in short, 23 mm vertical strokes for 30 seconds. In group 3, the canals and chamber were lled with 2 mL of 6% NaOCl, and a 30K PEC Endosonic size #20 le (Dentsply) was passively inserted into the canals. The le was circumferentially worked along the dentinal walls with a cyclic axial motion (up and down) for 30 seconds using an ultrasonic unit set at a consistent low power and water irrigation. In group 4, each specimen had a Max-i-Probe inserted to within 1 mm of WL, and both the canals and chamber were lled and irrigated with 2 mL (1 mL in each canal) of 6% NaOCl.
All groups received a nal irrigation with 2 mL 6% NaOCl in each canal. After drying with a capillary tip and paper points, the specimens were removed from the K-Kube, disassembled, and evaluated as before for debris. Percent cleanliness was calculated for each canal and isthmus immediately after instrumentation and after using the experimental nal debridement technique. The percent change in debris was statistically analyzed by using a repeated-measures analysis of variance with Tukey post hoc tests (signicance level, P < .05).
Results
A comparison of canal and isthmus cleanliness is shown in Fig. 3. There was no statistically signicant difference in canal or isthmus cleanliness with the F le, EndoActivator, or ultrasonics when used as an adjunct to aid in canal debridement compared with irrigation alone with NaOCl. All 4 treatment groups demonstrated a statistically signicant difference (P < .001) in canal cleanliness at 3 and 5 mm from the WL (>99.4%) than at 1 mm from the WL (>97.3%).
Discussion
This study introduced the custom-designed K-Kube (Fig. 1A, B), which was based on the technique of Bramante et al (18) with the addition of a compression component. Compressing the parallel sections within each specimen effectively eliminated the 0.3-mm kerf created by each saw blade cut. The K-Kube allows a tooth to be sectioned and then reassembled to recreate an intact root canal system. This affords the opportunity to evaluate not only canal and isthmus anatomy but also the effect of irrigation on residual debris while using each tooth as its own control. Thus, the K-Kube enabled the evaluation of experimental irrigation adjuncts in a sectioned tooth for the rst time. 1369
A
105.0% 103.0% 101.0% 99.0% 97.0% 95.0% 93.0% 91.0% 89.0% 87.0% 85.0% 1 mm 3 mm 5 mm 1 mm 3 mm 5 mm
Mean Percentage of Canal Cleanliness Comparing Experimental Groups (+1 SD)
B
* *
Mean Percentage of Canal Cleanliness Comparing Levels (+1 SD)
105.0% 100.0% 95.0% 90.0% 85.0%
* * *
* *
1 mm 3 mm 5 mm 1 mm 3 mm 5 mm 1 mm 3 mm 5 mm 1 mm 3 mm 5 mm
Post Clean & Shape

F File EndoActivator Ultrasonics
Post Experimental
F File
EndoActivator
Post Clean & Shape
Ultrasonics
Post Experimental
Max-i-Probe
Max-i-Probe
Mean Percentage of Isthmus Cleanliness Comparing Experimental Groups (+1 SD)
Mean Percentage of Isthmus Cleanliness Comparing Levels (+1 SD)
110.0% 100.0% 90.0% 80.0% 70.0% 60.0% 1 mm 3 mm 5 mm 1 mm 3 mm 5 mm
110.0% 100.0% 90.0% 80.0% 70.0% 60.0% 1 mm 3 mm 5 mm 1 mm 3 mm 5 mm 1 mm 3 mm 5 mm 1 mm 3 mm 5 mm
Post Clean & Shape

F File EndoActivator
Post Experimental
Ultrasonics Max-i-Probe
F File
EndoActivator
Ultrasonics
Max-i-Probe
Post Clean & Shape
Post Experimental
Figure 3. Comparison of canal and isthmus cleanliness post cleaning and shaping versus post experimental treatment. (A) Percentage of canal cleanliness of each experimental group at the 1-, 3-, and 5-mm levels. (B) Percentage of canal cleanliness of all 4 experimental groups individually at the 1-, 3-, and 5-mm levels. (C) Percentage of isthmus cleanliness of each experimental group at the 1-, 3-, and 5-mm levels. (D) Percentage of isthmus cleanliness of all 4 experimental groups individually at the 1-, 3-, and 5-mm levels. *Statistically signicant differences between levels (P < .001).
In this study, conventional cleaning and shaping alone resulted in greater than 94% canal cleanliness and greater than 74% isthmus cleanliness. The addition of an irrigation adjunct resulted in improved canal and isthmus cleanliness at all levels, regardless of the technique used. Most of the remaining debris was found in the apical 1 mm of the canal or isthmus. These results were consistent with previous studies in regards to canal cleanliness but were better than previous studies in regards to isthmus cleanliness after conventional cleaning and shaping alone (1113, 15, 17, 19). There was a higher overall standard deviation concerning isthmus cleanliness as compared with canal cleanliness. This was probably due to the variation in isthmus width not only within each tooth but also between 2 different samples. The narrow isthmuses consistently demonstrated the most residual debris both after cleaning and shaping and after treatment with the experimental irrigation adjuncts. Recent studies with various ultrasonic, sonic, and passive ultrasonic irrigation devices and techniques have shown improved tissue removal (20), more vigorous irrigation of lateral canals (21), and additional removal of canal bacteria (22). Other recent studies have also shown that the use of various irrigating solutions not only improves smear layer removal (23), but alters the physicochemical properties of dentin that inuence the adherence and biolm formation of Enterococcus faecalis to dentin (24). In this study, there was no statistically 1370
Klyn et al.
signicant difference in canal or isthmus cleanliness with the F le, EndoActivator, or ultrasonics when used as an adjunct to aid in canal debridement compared with irrigation alone with NaOCl. The additional irrigation with NaOCl produced the same statistical improvement in canal and isthmus cleanliness and might best be explained by the fact that a 30-gauge Max-i-Probe can be inserted to WL when the canal is prepared to an ISO size 40 (25). This needle deep irrigation was more important in improving canal and isthmus cleanliness than the use of any of the adjunct devices tested (2529). Although this study evaluated debris removal and not the actual removal of bacteria, improved debris removal should correlate with improved bacterial control. In conclusion, the present in vitro study demonstrated that needle deep irrigation with NaOCl was as effective as 3 irrigation adjuncts in canal and isthmus cleanliness utilizing the K-Kube technique. Clinical trials to investigate a correlation between irrigation adjunct devices and improved clinical outcomes are needed to validate the use of these devices (30).
Acknowledgments
The authors gratefully acknowledge Dr Anneke Bush for her statistical support and interpretation and Grifn M. Perry for his
technical expertise. This article is the work of the United States government and may be reprinted without permission. Opinions expressed herein, unless otherwise specically indicated, are those of the authors. They do not represent the views of the Department of the Air Force or any other department or agency of the United States government.
14. Jensen SA, Walker TL, Hutter JW, Nicoll BK. Comparison of the cleaning efcacy of passive sonic activation and passive ultrasonic activation after hand instrumentation in molar root canals. J Endod 1999;25:7358. 15. Lev R, Reader A, Beck M, Meyers W. An in vitro comparison of the step-back technique versus a step-back/ultrasonic technique for 1 and 3 minutes. J Endod 1987; 13:52330. 16. Metzler RS, Montgomery S. Effectiveness of ultrasonics and calcium hydroxide for the debridement of human mandibular molars. J Endod 1989;15:3738. 17. Burleson A, Nusstein J, Reader A, Beck M. The in vivo evaluation of hand/rotary/ ultrasound instrumentation in necrotic, human mandibular molars. J Endod 2007;33:7827. 18. Bramante CM, Berbert A, Borges RP. A methodology for evaluation of root canal instrumentation. J Endod 1987;13:2435. 19. Gutarts R, Nusstein J, Reader A, Beck M. In vivo debridement efcacy of ultrasonic irrigation following hand-rotary instrumentation in human mandibular molars. J Endod 2005;31:16670. 20. Al-Jadaa A, Paque F, Attin T, Zehnder M. Acoustic hypochlorite activation in simulated curved canals. J Endod 2009;35:140811. 21. de Gregorio C, Estevez R, Cisneros R, Heilborn C, Cohenca N. Effect of EDTA, sonic, and ultrasonic activation on the penetration of sodium hypochlorite into simulated lateral canals: an in vitro study. J Endod 2009;35:8915. 22. Townsend C, Maki J. An in vitro comparison of new irrigation and agitation techniques to ultrasonic agitation in removing bacteria from a simulated root canal. J Endod 2009;35:10403. 23. Gu XH, Mao CY, Kern M. Effect of different irrigation on smear layer removal after post space preparation. J Endod 2009;35:5836. 24. Kishen A, Sum CP, Mathew S, Lim CT. Inuence of irrigation regimens on the adherence of Enterococcus faecalis to root canal dentin. J Endod 2008;34:8504. 25. Zehnder M. Root canal irrigants. J Endod 2006;32:38998. 26. Ram Z. Effectiveness of root canal irrigation. Oral Surg Oral Med Oral Pathol 1977; 44:30612. 27. Kahn FH, Rosenberg PA, Gliksberg J. An in vitro evaluation of the irrigating characteristics of ultrasonic and subsonic handpieces and irrigating needles and probes. J Endod 1995;21:27780. 28. Sedgley CM, Nagel AC, Hall D, Applegate B. Inuence of irrigant needle depth in removing bioluminescent bacteria inoculated into instrumented root canals using real-time imaging in vitro. Int Endod J 2005;38:97104. 29. Zmener O, Pameijer CH, Serrano SA, Palo RM, Iglesias EF. Efcacy of the NaviTip FX irrigation needle in removing post instrumentation canal smear layer and debris in curved canals. J Endod 2009;35:12703. 30. Gu LS, Kim JR, Ling J, Choi KK, Pashley DH, Tay FR. Review of contemporary irrigant agitation techniques and devices. J Endod 2009;35:781804.
References
1. rstavik D, Pitt Ford T. Essential endodontology: prevention and treatment of apical periodontitis. 2nd ed. Ames, IA: Blackwell Munksgaard Ltd; 2008:1. 2. Vertucci FJ. Root canal anatomy of the human permanent teeth. Oral Surg Oral Med Oral Pathol 1984;58:58999. 3. Gulabivala K, Patel B, Evans G, Ng YL. Effects of mechanical and chemical procedures on root canal surfaces. Endodontic Topics 2005;10:10322. 4. Williamson AE, Sandor AJ, Justman BC. A comparison of three nickel titanium rotary systems Endosequence, ProTaper universal, and Prole GT for canal-cleaning ability. J Endod 2009;35:1079. 5. Mandel E, Machtor P, Friedman S. Scanning electron microscope observation of canal cleanliness. J Endod 1990;16:27983. 6. Zmener O, Pameijer CH, Banegas G. Effectiveness in cleaning oval-shaped root canals using anatomic endodontic technology, ProFile and manual instrumentation: a scanning electron microscopic study. Int Endod J 2005;38:35663. 7. Gutmann JL. Clinical, radiographic, and histologic perspectives on success and failure in endodontics. Dent Clin North Am 1992;36:37992. 8. Siqueira JF Jr. Aetiology of root canal treatment failure: why well-treated teeth can fail. Int Endod J 2001;34:110. 9. Card SJ, Sigurdsson A, Orstavik D, Trope M. The effectiveness of increased apical enlargement in reducing intracanal bacteria. J Endod 2002;28:77983. 10. Siqueira JF Jr, Rocas IN, Santos SR, Lima KC, Magalhaes FA, de Uzeda M. Efcacy of instrumentation techniques and irrigation regimens in reducing the bacterial population within root canals. J Endod 2002;28:1814. 11. Archer R, Reader A, Nist R, Beck M, Meyers WJ. An in vivo evaluation of the efcacy of ultrasound after step-back preparation in mandibular molars. J Endod 1992;18: 54952. 12. Goodman A, Reader A, Beck M, Mel R, Meyers W. An in vitro comparison of the efcacy of the step-back technique versus a step-back/ultrasonic technique in human mandibular molars. J Endod 1985;11:24956. 13. Haidet J, Reader A, Beck M, Meyers W. An in vivo comparison of the step-back technique versus a step-back/ultrasonic technique in human mandibular molars. J Endod 1989;15:1959.
1371
Inuence of the Oscillation Direction of an Ultrasonic File on the Cleaning Efcacy of Passive Ultrasonic Irrigation
Lei-Meng Jiang, DMD,* Bram Verhaagen, MSc, Michel Versluis, PhD, and Lucas W.M. van der Sluis, DDS, PhD*
Abstract
Introduction: The cleaning mechanisms and characteristics of passive ultrasonic irrigation (PUI) are not yet completely understood. The aim of this study was to investigate whether the oscillatory direction of the ultrasonically driven le had an inuence on dentin debris removal from articially made grooves in standardized root canals. Methods: Each of 20 ex vivo root canal models with a standard groove in the apical portion of one canal wall lled with dentin debris received PUI repeatedly, either with le oscillation toward the groove or with le oscillation perpendicular to the groove. After each irrigation procedure, the amount of dentin debris in the groove was evaluated by photographs of the groove and by scoring. The oscillations of the ultrasonic le were also visualized in vitro by using high-speed imaging at a time scale relevant to the cleaning process, order 10 microseconds. Results: A nonparametric analysis showed signicantly more dentin debris reduction when the le oscillated toward the groove (P = .002). High-speed imaging showed that the oscillation of the le is in a single plane, resulting in high-velocity jets emanating from the le tip in the direction of the oscillations. Conclusions: Oscillation of the ultrasonically driven le toward the groove is more effective in removing dentin debris from the groove than oscillation perpendicular to the groove, which can be related to the fact that there is a high-velocity jet from the le tip in a single direction following the le oscillation and a relatively slow inow in the perpendicular direction. (J Endod 2010;36:13721376)
ecause instruments used for root canal preparation can merely touch a small part of the canal, mechanical preparation by instruments obviously does not sufce for the debridement of the complex root canal system (1, 2). Irrigation has therefore been gaining increasing attention to improve the cleanliness of root canal systems after root canal instrumentation. Passive ultrasonic irrigation (PUI) has been suggested to be used to disinfect the areas beyond instruments by acoustically activating the irrigant (35). Acoustic streaming has been shown to be useful in cleaning the root canal system (6). Ultrasonically powered handpieces are normally attached with an oscillating instrument and operated at a certain frequency domain of 2040 kHz. Previous in vitro investigations have shown that oscillation of the le perpendicular to the dentin surface had a greater inuence on dentin removal than an oscillation parallel to the surface (7, 8), indicating that the energy was distributed nonuniformly around the oscillating le. Lumley et al (9) have demonstrated a 3-dimensional streaming pattern around the ultrasonically activated les, while streaming occurred mainly in front of and behind the le parallel to the handpiece. In another study, Lumley et al (10) found that a le oscillation directed toward oval recesses left less debris than a perpendicular oscillation. Despite these previous studies, a detailed description and understanding of the oscillation characteristics of ultrasonically driven les are still missing. The aims of this study were therefore (1) to investigate whether the orientation of the ultrasonically activated le had an inuence on the increase of dentin debris removal from articially made grooves simulating uninstrumented canal extensions in standardized root canals and (2) to investigate the streaming pattern around an ultrasonically oscillating le by using visualization techniques.

Dentin Debris Removal Model Straight roots from 20 extracted human maxillary canines were decapitated to obtain uniform root sections of 15 mm. The roots were embedded in self-curing resin (GC Ostron 100; GC Europe, Leuven, Belgium) and then bisected longitudinally through the canal in mesiodistal direction with a saw microtome (Leica Microsystems SP1600, Wetzlar, Germany). The surfaces of both halves were ground successively with 240-, P400-, and 600-grit sandpaper, resulting in smooth surfaces on which only little of the original root canal lumen was left. Four holes were drilled in the resin part, and the 2 halves were reassembled by 4 self-tapping bolts through the holes (Fig. 1A). The root canal space of the model was ensured as a closed system. New root canals were prepared by K-les #15/.02 (Dentsply Maillefer, Ballaigues, Switzerland) and HERO 642 (MicroMega, Besancon, France) nickel-titanium rotary
Key Words
Dentin debris, oscillation, passive ultrasonic irrigation
From the *Department of Endodontology, Academic Centre of Dentistry Amsterdam (ACTA), University of Amsterdam and VU University, Amsterdam, The Netherlands; and Physics of Fluids Group, Faculty of Science and Technology, University of Twente, and Research Institute for Biomedical Technology and Technical Medicine MIRA, University of Twente, Enschede, The Netherlands. Address requests for reprints to Dr Lei-Meng Jiang, University of Amsterdam and VU University, Academic Centre of Dentistry Amsterdam (ACTA), Department of Endodontology, Louwesweg 1, 1066EA Amsterdam, the Netherlands. E-mail address: l.jiang@acta.nl. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.03.019
1372
Jiang et al.
Figure 1. (A) Schematic representations of the standardized root canal model, its groove (B1) and cross section (B2). (C1) Drawing of the optical setup, showing the le inserted into the hole in the aluminum plate (details in C2), which is in turn inserted into a large water tank. The camera is positioned on the left, looking toward the hole. (This gure is available in color online at www.aae.org/joe/.)
instruments to a working length (WL) of 15 mm, ISO size 30 and taper 0.06, resulting in standardized root canals. During preparation, the canals were rinsed with 1 mL of 2% NaOCl after each le, delivered by a 10-mL syringe (Terumo, Leuven, Belgium) and a 30-gauge needle (Navitip; Ultradent, South Jordan, UT). A standard groove of 4 mm in length, 0.5 mm deep, and 0.2 mm wide, situated at 26 mm from WL (11), was cut in the wall of one half of each root canal with a customized ultrasonic tip (Fig.1B). A periodontal probe with an adapted 0.2-mm-wide tip was used to verify the dimension of each groove during and after preparation. The dimension of the groove is comparable to an apical oval root canal (12). Each groove was lled with dentin debris, which was mixed with 2% NaOCl for 5 minutes, to simulate a situation in which dentin debris accumulates in uninstrumented canal extensions (11). This model was introduced to standardize the root canal space and the amount of dentin debris present in the root canal before the irrigation procedure to increase the reliability of the dentin debris removal evaluation. The methodology is sensitive, and the data are reproducible (13, 14). A pilot study has shown that a single model could be reused up to at least 8 times without any visible defect on the surface of the canal wall. Therefore, the 20 models were used repeatedly in the 3 experimental groups, which are shown in Table 1.
#20/.00 le (IrriSafe; Acteon, Merignac, France) driven by an ultrasonic device (Suprasson PMax Newtron; Acteon) at power setting blue 4. Every attempt was made to keep the le centered in the canal to minimize contact with the canal walls to do passive ultrasonic activation. Group 3 acted as the control group, in which the ultrasonic le was inserted but not activated. All the experimental specimens received 2 mL irrigant, which was delivered again by a syringe as nal ush.
Irrigation Procedure Specimens in all the experimental groups were rinsed with 2 mL irrigant (2% NaOCl) by using 10-mL syringes with 30-gauge needles placed 1 mm from WL. Then the irrigant was passively activated by an ultrasonic le for 10 seconds, with the oscillation perpendicular to the groove (group 1; Fig. 2C1) or toward the groove (group 2; Fig. 2C2). The ultrasonic activation was performed with a stainless steel
Image Evaluation and Statistical Analyses Before and after each irrigation procedure, the root halves were separated, and the grooves were viewed through a stereomicroscope (Stemi SV6; Carl Zeiss, Gottingen, Germany) by using a cold light source (KL 2500 LCD; Carl Zeiss). Controls veried that no debris had fallen out of the groove during the assembly or disassembly process. Pictures were taken with a digital camera (Axio Cam; Carl Zeiss). The debris left in the groove after irrigation was scored independently by 3 calibrated dentists by using the following score system: 0, the groove is empty; 1, less than half of the groove is lled with debris; 2, more than half of the groove is lled with debris; and 3, the complete groove is lled with debris (11, 14). The percentage of interagreement should be more than 95%; if this percentage was lower than 95%, a consensus had to be reached. The differences in debris scores between the groups were analyzed by means of the Kruskal-Wallis test and the Mann-Whitney test. The level of signicance was set at a = 0.05. High-speed Imaging Experiments An optical setup was constructed to visualize the oscillation of the same ultrasonically driven le used in the ex vivo study. To simulate the
Inuence of Oscillation Direction of Ultrasonic File on Cleaning Efcacy of PUI
1373
TABLE 1. Experimental Groups and the Number of Specimens at Each Score Rank after Irrigation Procedure Score Group (N = 20)
1 2 3 (control)
Orientation of le oscillation
Perpendicular to the groove Toward the groove N/A
Irrigant
NaOCl NaOCl NaOCL
Intensity
Blue 4 Blue 4 0
Total duration (sec)

10 10 10
0
10 (50%) 19 (95%) 0 (0%)
1
9 (45%) 1 (5%) 0 (%)
2
1 (5%) 0 (0%) 0 (0%)
3
0 (0%) 0 (0%) 20 (100%)
Score 0, the groove is empty; score 1, less than half of the groove is lled with debris; score 2, more than half of the groove is lled with debris; score 3, the complete groove is lled with debris.
connement of apical section of the root canal, a 1-mm-thick aluminum plate with a hole (F = 0.4 mm) and a 4-mm-thick plate with a hole (F = 0.4 mm) plus a groove with the same dimensions as the ex vivo model were used. The plate was positioned in a water tank (dimensions, 75 64 60 mm), and the ultrasonic le was centered in the hole (Fig. 1C). Tracer particles (hollow glass spheres, F = 11 mm, r = 1.1$103 kg/m3; Sphericel; Potters Industries, South Yorkshire, UK) were added to the water for ow visualization. The ow around the oscillating le was imaged through a microscope (BX-FM; Olympus, Tokyo, Japan) with a magnication of 1.25 20. Illumination was performed in bright-eld by a continuous wave light source (ILP-1; Olympus, Tokyo, Japan). Recordings were made with a high-speed camera (HPV-1; Shimadzu Corp, Kyoto, Japan) at a frame rate of 125,000 frames per second, starting 2 seconds after initiation of le oscillation to be able to avoid transient le motion at startup. Recordings were analyzed by using a Particle Image Velocimetry (PIV) code developed in-house.
Results
The results of the ex vivo experiments are presented in Table 1. There is a statistically signicant difference between each of the experimental groups (P < .0001). When the irrigant was activated, signicantly more dentin debris was removed than in the control group (no activation). Oscillation of the le toward the groove had a signicantly greater inuence on dentin debris removal than oscillation perpendicular to the groove (P = .002). The time-averaged ow pattern caused by an oscillating le in a large water tank is shown in Fig. 2A. The steady part of the ow depicted here consists of 2 jets in the direction of oscillation of the le. There is an inow toward the le from the direction perpendicular to the oscillation direction. We observe an unsteady ow that is located within a distance of approximately 1 diameter of the le. Fig. 2B1 shows a close-up of the instantaneous ow pattern, while the le is moving in the direction indicated by the white arrow. In Fig. 2B2 we show the instantaneous ow pattern when the connement of the root canal is included; Fig. 2C1 and C2 show the average ow pattern when the groove is also included. Flow velocities in the groove when the le oscillation is toward the groove are 35 times higher than when the le is oscillating perpendicular to the groove.
Discussion
The results showed that debris was reduced signicantly more by PUI when the le oscillation was directed toward the groove than when the le oscillation was perpendicular to the groove, indicating that the oscillation direction of the ultrasonic le has a great inuence. The ultrasonically driven le oscillates mainly in the direction equal to the axis of the handpiece and a minor transverse vibration at right angles to the main one (9). Lumley et al (10) have shown more effective cleaning of an oval extension in the root canal when the oscillation of the le is directed toward the oval extension. They 1374
proposed 2 explanations: (1) the streaming forces are more intense toward the oval recess, and (2) the le was less likely to be constrained when it oscillated toward the recess. However, in the study by Lumley et al, the ultrasonic le was used for root canal instrumentation; in other words, the le was intentionally in contact with the root canal wall. Therefore, the le was unable to vibrate freely; acoustic microstreaming would consequently be less intense, although it would not stop completely (15). It could be hypothesized that when oscillating toward the groove, the le could vibrate somewhat more freely, despite intentional contact with the root canal wall, resulting in more intense streaming forces toward the groove. PUI was performed in the current study, and the experimental setup was such that contact of the le with the root canal wall was prevented for both oscillation directions. Moreover, the oscillation amplitude of the le is approximately 28 mm according to the manufacturer, which is smaller than the dimension of the root canal in the current study; thus, the le could vibrate freely whether its orientation was toward or perpendicular to the groove. Therefore, the only explanation for the different efciency by the 2 ways of irrigation should be the difference in streaming of the irrigant around the oscillating le, consisting of both the streaming orientation and strength. This streaming has been visualized with high-speed imaging. The results showed a high-velocity jet from the le tip in one dimension and a slow inow in the perpendicular direction, which could well explain the consequences for the cleaning efcacy. Streaming has been held responsible for cleaning (6), in which the direction and the velocity of the ow might be the key factors. The ow pattern as shown in Fig. 2A and B1 is qualitatively similar to the ow as described theoretically by Riley (16) and Stuart (17) and conrmed experimentally by Bertelsen (18). The ow pattern with connement, as shown in Fig. 2B2, is qualitatively similar to the ow as described theoretically by Duck and Smith (19). All authors reported a boundary layer close to the oscillating object, which consisted of an oscillatory and a steady component. Outside this boundary layer, only the steady component remains, visible as jets in Fig. 2A and C2. In Fig. 2B1 and B2 it can be observed that the boundary layer is approximately 0.3 mm thick; therefore, in the apical area (when the groove is still lled with debris) the ow is dominated by the oscillatory component, which causes a shear stress circumferentially. In addition to the shear stress, it is expected that there is a push-pull mechanism by which removal of debris in the oscillation direction will be enhanced. This push-pull effect is induced by the oscillation of the le. Once (the entrance of) the groove is starting to be emptied by removal of debris, there will be space available for the jet (steady streaming component) to form when the le is oscillating toward the groove. Shear stresses developed by this jet can enhance the removal of the debris in the groove. When the le oscillates perpendicular to the groove, the jet has no space to develop; therefore, the ow is again dominated by the oscillatory component and its push-pull effect. The uid in the groove will contribute to the inow toward the le; however, ow velocities inside the groove are smaller than when the le oscillates
Jiang et al.
Figure 2. Direction (solid arrows) and magnitude (colors) of the ow caused by an ultrasonically oscillating le. White arrows in the black circles indicate the direction of oscillation. (A) Steady part of the ow when oscillating in a large water tank, averaged over 100 frames (0.8 ms). (B1) Unsteady part of the ow, single frame only; (B2) unsteady part of the ow in the connement of a root canal, single frame only. (C) Sketch of the cross section of the root canal indicating the direction of oscillation with respect to the groove and the ow around the oscillating le; (C1) oscillation perpendicular to the groove, (C2) oscillation toward the groove. (Black bar is 0.2 mm.) (This gure is available in color online at www.aae.org/joe/.)
toward the groove and are unlikely to contribute much to the removal of debris from the groove. In the studies by Riley (16), Stuart (17), Bertelsen (18), and Duck and Smith (19), a cylindrical le was considered, whereas the Irrisafe le used in this study has a square cross section, twisted along the length of the le. This difference in cross section might explain the increased divergence of the measured jet compared with the theoretical solution by Duck and Smith. Experiments performed by Kim and Troesch (20) and Tatsuno (21) by using square cylinders showed a ow pattern more similar to the ow pattern observed in this study. The ex vivo dentin debris removal model used in this study is a closed system. The 2 halves of the root embedded in the resin matched perfectly and were xed by the 4 bolts well to prevent any irrigant ow apically or laterally (Fig. 1A). Because the apical uid movement mechanisms can be quite different between a closed and an open system (22), it is better to use a closed system like the model used in this study, which is more clinically relevant.
References
1. Peters OA, Schonenberger K, Laib A. Effects of four Ni-Ti preparation techniques on root canal geometry assessed by micro computed tomography. Int Endod J 2001;34: 22130. 2. Wu MK, van der Sluis LWM, Wesselink PR. The capability of two hand instrumentation techniques to remove the inner layer of dentin in oval canals. Int Endod J 2003;36:21824. 3. Sabins RA, Johnson JD, Hellstein JW. A comparison of the cleaning efcacy of shortterm sonic and ultrasonic passive irrigation after hand instrumentation in molar root canals. J Endod 2003;29:6748. 4. Burleson A, Nusstein J, Reader A, Beck M. The in vivo evaluation of hand/rotary/ ultrasound instrumentation in necrotic, human mandibular molars. J Endod 2007;33:7827. 5. van der Sluis LW, Versluis M, Wu MK, Wesselink PR. Passive ultrasonic irrigation of the root canal: a review of the literature. Int Endod J 2007;40:41526. 6. Ahmad M, Pitt Ford TJ, Crum LA. Ultrasonic debridement of root canals: acoustic streaming and its possible role. J Endod 1987;13:4909. 7. Briggs PF, Gulabivala K, Stock CJ, Setchell DJ. Dentin-removing characteristics of an ultrasonically energized K-le. Int Endod J 1989;22:25968. 8. Gulabivala K, Briggs PF, Setchell DJ. A comparison of the dentin-removing characteristics of two endosonic units. Int Endod J 1993;26:2636.
Inuence of Oscillation Direction of Ultrasonic File on Cleaning Efcacy of PUI
1375
9. Lumley PJ, Walmsley AD, Laird WR. Streaming patterns produced around endosonic les. Int Endod J 1991;24:2907. 10. Lumley PJ, Walmsley AD, Walton RE, Rippin JW. Cleaning of oval canals using ultrasonic or sonic instrumentation. J Endod 1993;19:4537. 11. Lee SJ, Wu MK, Wesselink PR. The effectiveness of syringe irrigation and ultrasonics to remove debris from simulated irregularities within prepared root canal walls. Int Endod J 2004;37:6728. 12. Wu MK, ROris A, Barkis D, Wesselink PR. Prevalence and extent of long oval canals in the apical third. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2000;89: 73943. 13. van der Sluis LWM, Wu MK, Wesselink PR. The evaluation of removal of calcium hydroxide paste from an articial standardized groove in the apical root canal using different irrigation methodologies. Int Endod J 2007;40:527. 14. Jiang L-M, Verhaagen B, Michel V, van der Sluis LWM. Evaluation of a sonic device designed to activate irrigant in the root canal. J Endod 2010;36: 1436. 15. Lee SJ, Wu MK, Wesselink PR. The efcacy of ultrasonic irrigation to remove articially placed dentin debris from different-sized simulated plastic root canals. Int Endod J 2004;37:60712. 16. Riley N. Unsteady laminar boundary layers. SIAM Rev 1975;17:27497. 17. Stuart JT. Double boundary layers in oscillatory ow. J Fluid Mech 1966;24:67387. 18. Bertelsen AF. An experimental investigation of high Reynolds number steady streaming generated by oscillating cylinders. J Fluid Mech 1974;64:58997. 19. Duck PW, Smith FT. Steady streaming induced between oscillating cylinders. J Fluid Mech 1979;91:93110. 20. Kim SK, Troesch AW. Streaming ows generated by high frequency small amplitude oscillations of arbitrarily shaped cylinders. Phys Fluids A 1989;1:97585. 21. Tatsuno M. Circulatory streaming in the vicinity of an oscillating square cylinder. J Phys Soc Japan 2004;36:118591. 22. Tay FR, Gu LS, Schoeffel GJ, et al. Effect of vapor lock on root canal debridement by using a side-vented needle for positive-pressure irrigant delivery. J Endod 2010;36:74550.
1376
Jiang et al.
Effect of Varying Water-to-Powder Ratios on the Setting Expansion of White and Gray Mineral Trioxide Aggregate
Michael Hawley, DDS, MS, Terry D. Webb, DDS, MS, and Gary G. Goodell, DDS, MS, MA
Abstract
Introduction: Clinicians commonly mix mineral trioxide aggregate (MTA) to a desired consistency rather than use the recommended amounts of powder and water. The purpose of this in vitro study was to evaluate how varying the water-to-powder (WP) ratio affects the setting expansion of white MTA (WMTA) and gray MTA (GMTA). Methods: Eight combinations (n = 5) of WMTA and GMTA were mixed using varying WP ratios. Randomized samples were placed in a linear variable displacement transformer and submerged under Hanks balanced salt solution for 25 hours. Expansion was compared using a 2-way analysis of variance (a = 0.05). Results: Mean percent expansions ranged from 0.058%0.093% for WMTA and 2.15%2.56% for GMTA. GMTA expanded signicantly more than WMTA at p = .001. No differences in expansion were found between WP ratios (p = .218). No signicant interaction was found between the WP ratio and material type (p = .228). Conclusions: GMTA expanded signicantly more than WMTA; however, varying the WP ratio did not affect the setting expansion. (J Endod 2010;36:13771379)
Key Words
Expansion, MTA, setting, water to powder ratio
From the Naval Postgraduate Dental School, Bethesda, Maryland. Address requests for reprints to Dr Terry D. Webb, 4 Boxberry Court, Gaithersburg, MD 20879. E-mail address: reddsquid@aol.com. 0099-2399/$0 - see front matter Published by Elsevier Inc. on behalf of the American Association of Endodontists. doi:10.1016/j.joen.2010.03.010
urrent rationale for endodontic therapy is based on the removal of tissue and bacteria from the pulp space and sealing of that cleaned space from the external environment. In 1974, Schilder (1) listed the biologic objectives of endodontic therapy. They included cleaning and shaping procedures to remove pulp tissue, bacteria, and their endotoxins from the root canal system. To achieve predictable success, the root canal system must be cleaned of organic remnants and shaped to receive a 3dimensional hermetic lling of the entire root canal space. Much research and development has been devoted to creating the ideal root canal obturating material. In 1998, Dentsply Tulsa Dental (now Tulsa Dental Specialties, Tulsa, OK) released a new endodontic material called ProRoot MTA. Since that time, a signicant amount of research has been published regarding the biomechanical properties of this material. Torabinejad and Chivian (2) initially outlined the uses for mineral trioxide aggregate (MTA) as a restorative material for pulp capping with reversible pulpitis, apexication, repair of root perforations, both nonsurgically and surgically, as well as its use as a root-end lling material. In 1993, Lee et al (3) demonstrated that MTA could seal experimentally induced root perforations. de Leimburg et al (4) demonstrated similar resistance to leakage with obturations of varying thickness of MTA in pulpless teeth with open apices. White ProRoot MTA (WMTA) (Tulsa Dental Specialties) was introduced in 2002 for use in esthetic areas. The original formulation, now called gray MTA (GMTA), could cause a gray line or show through tooth structure, which was noticeable in esthetic areas. It was soon observed that the minor differences in chemical composition between the two might result in differences in biomechanical properties. Matt et al (5) found that this original version of WMTA demonstrated signicantly more leakage than GMTA in immediate apical barriers. The authors hypothesized that perhaps slight volumetric shrinkage occurred with the WMTA that accounted for its increased leakage. As early as 1998, Fischer et al (6) suggested that the success of MTA was due to its expansion on setting, but this aspect was not investigated. The manufacturer reformulated the product with reduced particle size in 2003 to address the differences in biomechanical properties. A more recent in vitro dye leakage study by Hamad et al (7) with the reformulation demonstrated no leakage differences between WMTA and GMTA in furcation perforation repair. Fridland and Rosado (8) investigated the solubility and porosity of GMTA using different water-to-powder (WP) ratios. They discovered that porosity and solubility increased with increasing WP ratio and that a WP ratio higher than 0.33 was not viscous enough for use, and a 0.26 WP ratio was the minimum that allowed a mix of putty consistency to be manipulated. Using a linear variable displacement transformer (LVDT) dilatometer, Storm et al (9) compared the setting expansion of GMTA, WMTA, and Portland cement. Using the manufacturers recommended WP ratio of 0.35 for mixing all materials and allowing them to set in liquid medium, they found a signicantly greater expansion for GMTA than for either WMTA or Portland cement. With the exception of bismuth oxide and gypsum content, MTA has a composition very similar to Portland cement (10). Bentz (11) found that Portland cement shrinks (0.1% volumetrically) as it undergoes setting in an unsaturated (dry) environment as a result of chemical shrinkage after hydration. However, in a saturated environment, cement hydration is often accompanied by overall expansion because of crystal growth and possible swelling of gel hydration products (12). Thus in a saturated clinical environment, setting of GMTA, WMTA, and Portland cement would also be expected to exhibit slight linear expansion.
Effect of Varying WP Ratios on Setting Expansion of WMTA and GMTA
1377
The manufacturer of MTA recommends a WP ratio of 0.35 g water to 1 g powder supplied in one packet. This unit dose mixture results in a great deal of waste because very little material is actually used clinically. Because there is an ample amount of material in each packet for several uses, clinicians commonly estimate the amounts of water and powder chairside, thus deviating from the manufacturers guidelines and using an unknown WP ratio. This variation from the recommended guidelines could have an effect on the expansion of setting MTA in a clinical setting. Therefore, the purpose of this in vitro study was to evaluate how varying the WP ratio affects the linear setting expansion of WMTA and GMTA.
TABLE 1. Percent Expansion of MTA WP ratio
0.26 0.28 0.30 0.35
WMTA
0.084% 0.012% 0.058% 0.044% 0.093% 0.013% .086% 0.029%
GMTA
2.42% 0.324% 2.38% 0.034% 2.56% 0.393% 2.15% 0.337%
WP, water-to-powder ratio; WMTA, white mineral trioxide aggregate; GMTA, gray mineral trioxide aggregate.

WMTA and GMTA were mixed using WP ratios of 0.26, 0.28, 0.30, and 0.35. Each group (8 total) contained 5 samples (n = 5). Each sample was assigned a number (140), and random numbers were generated to determine the testing sequence. Each sample contained 1.00 g of MTA powder measured on an analytic balance. Using micropipettes, an appropriate amount of sterile water at room temperature was added to each sample to achieve the proper WP ratio. Each sample was hand-mixed on a nonabsorbent pad in a standardized fashion. As used by Storm et al (9), an LVDT dilatometer was used to measure setting expansion. After mixing, each MTA sample was gently vibrated into a cylindrical polyvinyl siloxane mold (10 mm height, 6 mm diameter, sample mass ~0.60 g) to reduce the inclusion of air bubbles. The mold was constrained so that any displacement caused by linear change in the sample could only occur at one end of the mold. Because MTA is often used with a moist cotton pellet or in a surgical environment in contact with body uids, the samples and mold were covered with Hanks balanced salt solution (HBSS). A nylon piston attached to the LVDT was placed on the surface of the setting cement to record volumetric changes. Setting occurred at room temperature, and piston movement was recorded every 6 seconds for 25 hours using the American Dental Association Health Foundation Dilatometer (ADAHF) Serial Program for Windows version 2.10.0.1, which measures the percent of sample volumetric change. WMTA and GMTA samples mixed with a WP ratio of 0.35 were considered the positive controls. The negative control was the testing apparatus run without a test sample. Data comparing WMTA and GMTA were analyzed using a two-way analysis of variance. To further determine whether there was any relationship between WP ratio and expansion, regression analysis was also used. The level of signicance was set at a = 0.05.
the ndings of Storm et al (9), who reported that GMTA expands significantly more than WMTA and suggested the effect might be due to differences in the material composition. Although the 2 studies found a virtually identical expansion rate for WMTA, the present study found a nearly 4 times greater expansion rate for GMTA. The reason for this difference is unclear. The methodology and instrumentation used were identical. The only difference noted was that the studies tested different lot numbers of GMTA. This suggests possible differences between GMTA lot numbers in physical and chemical composition or manufacture. In an x-ray diffraction analysis, Song et al (15) found that the crystalline structure and chemical composition of GMTA and WMTA were similar except for the presence of iron in GMTA. Asgary et al (16) reported higher levels of aluminum oxide (+122%), magnesium oxide (+130%), and iron oxide (+1000%) in GMTA than in WMTA. The differences in expansion noted between WMTA and GMTA might be explained by the setting chemistries of the 2 different powders. Camilleri (17) found a difference in the crystal forms of set WMTA when compared with ordinary Portland cement, noting low presence of ettringite and monosulfate phases in the hydrated WMTA. Long, slender ettringite crystals are a common member in the setting Portland cement crystal population. As the hydration mechanism proceeds, these crystals form needle-like structures and contribute to the majority of expansion seen in Portland cement. In addition, it is the aluminate and ferrite components of Portland cement that form the ettringite crystals. Thus, if WMTA is lacking this component, less ettringite will be produced, and less expansion should result. This expansion probably contributes to MTAs sealing ability. Most dental materials have a tendency to shrink away from their interfacial margins, exposing a gap through which contaminating elements can transfer. MTA expands
Results
Linear expansion was noted in all WMTA and GMTA samples. The average expansions for WMTA and GMTA with the 0.26, 0.28, 0.30, and 0.35 WP ratios are listed in Table 1. When evaluated by two-way analysis of variance, there was no signicant difference in linear expansion between the WP ratios within each group at p = .218. However, there was a signicant difference in the expansion between WMTA and GMTA at p = .001. No signicant interaction was found between the WP ratio and material type at p = .228. Regression analysis further showed no correlation between WP ratios and expansion (Fig. 1).
Discussion
Type I Portland cement and MTA have complex setting characteristics. Most dental materials contract as a result of polymerization or chemical shrinkage. However, as previously mentioned, Portland cements and MTA set by a different mechanism (12), expanding slightly when setting in a saturated environment (9, 13, 14). This study supports 1378
Figure 1. Percent expansion of MTA. (This gure is available in color online at www.aae.org/joe/.)
Hawley et al.
against its conning margins, thus enhancing the seal and minimizing leakage. In an article concerning the set of Portland cement in an unsaturated environment, Bentz and Aitcin (18) discussed the effects of WP (also called w/c) ratios on the physical properties of Portland cements. They stated that w/c has a hidden meaning: it is directly linked to the spacing between cement particles in the cement paste (the smaller the w/c the tighter the spacing of particles and the shorter the setting time). Additionally, the smaller this spacing..the larger the stresses, generating autogenous shrinkage. The environment in the current study was saturated with HBSS, so a slight chemical expansion rather than shrinkage would be expected. This discussion highlights the importance of clinical placement of a moist (wet) cotton pellet adjacent to the setting MTA when applicable. A dry environment could contribute to autogenous shrinkage, resulting in an interfacial gap at the MTAdentin margin. In a clinical setting, MTA is usually mixed using estimated proportions of water and powder on the basis of a desired consistency. Under the conditions of this in vitro study, the linear setting expansion of GMTA was signicantly greater than that of WMTA. However, no significant differences were found between differing WP ratios and their respective expansions for both WMTA and GMTA, demonstrating that deviating from the manufacturers recommended WP mixing ratio in a saturated environment would likely not affect the expansion of MTA. It is not known whether varying the WP ratio affects physical properties such as compressive strength. Future studies of MTA expansion could investigate possible introduction of latent stresses or microfractures in dentin or the effect on expansion of any MTA modications intended to improve its physical properties.
Acknowledgments
The authors would like to thank Anthony Guisepetti, American Dental Association Foundation Paffenbarger Research Center, National Institute of Standards and Technology, Gaithersburg, Maryland.
References
1. Schilder H. Cleaning and shaping the root canal. Dent Clin North Am 1974;18. 69-9. 2. Torabinejad M, Chivian N. Clinical applications of mineral trioxide aggregate for repair of lateral root perforations. J Endod 1999;25:197205. 3. Lee SJ, Monsef M, Torabinejad M. Sealing ability of a mineral trioxide aggregate for repair of lateral root perforations. J Endod 1993;19:5414. 4. de Leimburg ML, Angeretti A, Ceruti P, Lendini M, Pasqualini D, Berutti E. MTA obturation of pulpless teeth with open apices: bacterial leakage as detected by polymerase chain reaction assay. J Endod 2004;30:8836. 5. Matt GD, Thorpe JR, Strother JM, McClanahan SB. Comparative study of white and gray mineral trioxide aggregate (MTA) simulating a one- or two-step apical barrier technique. J Endod 2004;30:8769. 6. Fischer EJ, Arens DE, Miller CH. Bacterial leakage of mineral trioxide aggregate as compared with zinc-free amalgam, intermediate restorative material, and super-EBA as a root-end lling material. J Endod 1998;24:1769. 7. Hamad HA, Tordik PA, McClanahan SB. Furcation perforation repair comparing gray and white MTA: a dye extraction study. J Endod 2006;32:33740. 8. Fridland M, Rosado R. Mineral trioxide aggregate (MTA) solubility and porosity with different water-to-powder ratios. J Endod 2003;29:8147. 9. Storm B, Eichmiller FC, Tordik PA, Goodell GG. Setting expansion of gray and white MTA and Portland cement. J Endod 2008;34:802. 10. Material safety data sheet (MSDS): ProRoot MTA (mineral trioxide aggregate) root canal repair material. Tulsa, OK: Dentsply Tulsa Dental; 2002. 11. Bentz D. Three dimensional computer simulation of Portland cement hydration and microstructure development. J Am Ceram Soc 1997;80:321. 12. Bentz DP, Jensen OM, Hansen KK, Olesen JF, Stang H, Haecker CJ. Inuence of cement particle-size distribution on early age autogenous strains and stresses in cement-based materials. J Am Ceram Soc 2001;84:12935. 13. Chng HK, Islam I, Yap AU. Properties of a new root-end lling material. J Endod 2005;31:6658. 14. Islam I, Chng HK, Yap AU. Comparison of the physical and mechanical properties of MTA and Portland cement. J Endod 2006;32:1937. 15. Song JS, Mante FK, Romanow WJ, Kim S. Chemical analysis of powder and set forms of Portland cement, gray ProRoot MTA, white ProRoot MTA, and gray MTA-Angelus. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;102:80915. 16. Asgary S, Parirokh M, Eghbal MJ, Brink F. Chemical differences between white and gray mineral trioxide aggregate. J Endod 2005;31:1013. 17. Camilleri J. Hydration mechanisms of mineral trioxide aggregate. Int Endod J 2007; 40:46270. 18. Bentz DP, Aitcin PC. The hidden meaning of water-cement ratio. Concrete International 2008. May:514.
Disclaimer
The opinions or assertions expressed in this article are those of the authors and are not to be construed as ofcial policy or position of the Department of the Navy, Department of Defense or the U.S. Government. Certain commercial materials and equipment are identied in this paper to specify the experimental procedure. In no instance does such identication imply recommendation or endorsement by the U.S. Navy, or that the material or the equipment identied is necessarily the best available for the purpose.
Effect of Varying WP Ratios on Setting Expansion of WMTA and GMTA
1379
A Comparative Computational Analysis of the Mechanical Behavior of Two Nickel-Titanium Rotary Endodontic Instruments
Silvia Necchi, MEng,* Lorenza Petrini, MEng, PhD,* Silvio Taschieri, MD, and Francesco Migliavacca, MEng, PhD*
Abstract
Introduction: A nite element model of two nickeltitanium (Ni-Ti) rotary endodontic instruments (ProTaper and SystemGT; Dentsply-Maillefer, Ballaigues, Switzerland) was developed to investigate the mechanical behavior of these devices and to identify the benets/limitations of different geometries during instrumentation in various root canals. Methods: Instrument shape, curved root canal geometry, and Ni-Ti alloy pseudo-elastic behavior were investigated in this study using computational techniques. Two different operating conditions were simulated: (1) the le insertion-removal cycle which resembles the standard working condition and (2) the le subjected to a torque in the counter-clockwise direction, which mimics the auto-reverse movement of the instrument when the tip is locked in the canal wall. Results: The simulations of standard and auto-reverse conditions produced bending and torsion loading conditions in the les, respectively. In the standard situation in which different canal shapes were considered, the strains in the SystemGT were generally lower than the strains in the ProTaper and always in the pseudo-elastic range; in only 1 case did the ProTaper overcame the pseudo-elastic range limit. In the auto-reverse situation, a better behavior of the ProTaper was detected. Conclusions: The two simulated conditions highlighted the different mechanical properties of the les; the SystemGT showed slightly better performances under exural solicitation, whereas the Protaper presented better behavior under torsion solicitations. (J Endod 2010;36:13801384)
he introduction of rotary nickel-titanium (Ni-Ti) endodontic instruments (also called les) into clinical practice has improved the effects of endodontic practice in terms of procedural time, accuracy, and risk reduction (13) compared with the previously used, manual, stainless steel les. However, selecting the most appropriate Ni-Ti le remains difcult for clinicians because of the large number of Ni-Ti rotary instruments available nowadays on the market. In the last 10 years, many publications were devoted to study the factors inuencing the fracture of Ni-Ti instruments (49) and to compare cyclic fatigue resistance (1015), ease of use (1618), and canal shaping/cleaning ability (1921) of different Ni-Ti les using in vitro experiments. Although these experiments are an essential tool to investigate le performance, computational studies may add important information and support the clinical decision process. Indeed, numeric analyses allow us to quantify parameters responsible for the instruments failure as, for example, maximum strain and stress, which are difcult to measure in vivo and in vitro, and to easily compare different working conditions by simply changing the model boundaries and removing the operator dependency factor. In this study, a nite element analysis (FEA) of two les was performed with the aim of identifying potential benets and/or limitations of various device geometries during instrumentation in different types of root canals. In particular, the analyses focused on the evaluation of the instruments resistance to bending and torque as a result of standard and auto-reverse working conditions, respectively.

Two commercially endodontic instruments, both manufactured by DentsplyMaillefer (Ballaigues, Switzerland) and usually used in the nal step of the shaping sequence, were considered: the ProTaper nisher F1 (convex triangular cross section, variable taper from 7% to 5.5%, 1.2-mm shaft diameter) and the SystemGT series .06 (U-shaped utes cross section, 6% constant taper, 1-mm shaft diameter). The instrument geometries, built using data retrieved by microscopy images of the products (Fig. 1A) and 8 different geometries of curved root canals (Table 1), were modeled and implemented into the commercial computational code ` SIMULIA (Dassault Systemes, Providence, RI) as previously described by Necchi et al (22), together with the characteristic pseudo-elastic behavior of the Ni-Ti alloy. The alloy behavior was described using an ad hocdeveloped constitutive model (23); average properties from the literature were considered to dene the instrument material parameters (Fig. 1B).
Key Words
Finite element analysis, nickel-titanium alloy, ProTaper, rotary endodontic les, SystemGT
From the *Laboratory of Biological Structure Mechanics, Department of Structural Engineering, Politecnico di Milano, Milan, Italy; and Department of Health ` Tecnologies, Universita degli Studi di Milano and IRCCS Galeazzi, Milan, Italy. Supported by the MIUR within the project Shape memory alloy active microactuators and devices for biomedical applications. Address requests for reprints to Dr Lorenza Petrini, Laboratory of Biological Structure Mechanics, Department of Structural Engineering, Politecnico di Milano, Piazza Leonardo da Vinci, 32 20133 Milan, Italy. E-mail address: lorenza.petrini@polimi.it. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.03.026
1380
Necchi et al.
Figure 1. (A) Main geometric features of the studied les. (B) Stress-strain diagram of the Ni-Ti alloy and characteristic mechanical parameter values used in the numeric analyses.
Two operating conditions, standard and auto-reverse, were studied. In the former, the standard clinical procedure, which consists of numerous cycles of insertion and removal of the rotating le in the canal, was simulated for each instrument imposing ad hoc boundary and constraint conditions (22). In the latter, the le was subjected to a torque in the counter-clockwise direction, which resembled the auto-reverse movement of the instrument once the tip is locked in the canal wall. The instrument was inserted into the canal up to 1 mm from the apex, and a counter-clockwise torque (Mz=2 N $ mm) was imposed to the shaft once the tip was blocked. The following model simplications were adopted: (1) the accumulation of plastic deformation consequent to cyclic loading in the pseudo-elastic range was neglected, (2) the shear strains induced in the le during the standard procedure as a consequence of friction and cutting actions of the instrument blade into the canal wall were neglected, and (3) a reduced rotational speed (uz = 25 rpm) was imposed. The instruments performance was studied by analyzing the strain values reached during the phases of le insertion and removal into and out of the canals. The following variables were considered: the instantaneous equivalent strain hoarded in the transformation plateau (eeq ) tr and the logarithmic maximum principal strain (etot ) experienced by the instruments, calculated as the sum of the elastic and the transformation component. The scalar values were compared with the selected material strain limits (Fig. 1b): eL 7%, which is the strain limit of the austenite to martensite transformation, and eM 7:7%, which is y the yielding strain of the martensite. The undeformed shape recovery condition after the removal step was considered reached if eeq\eL . tr In the limit case of eeq eL (ie, completed austenite to martensite tr transformation), the additional condition etot #ln1 eM 7:4% y was required to avoid plastic strain accumulation. Moreover, the strain distribution was evaluated.
Results
Table 1 (upper part) shows the results when simulating both the standard and auto-reverse conditions for the two instruments. The highest strain levels were reached at the end of the insertion step in the former condition and at the end of the sticking step in the latter. In the simulation of the standard clinical procedure, the most demanding (in terms of strain) working condition was related to canal type IV (2-mm radius, 30 angle, middle curvature) for both instruments. The ProTaper reached, only in this case, critical strain levels (eeq eL 7% and etot 8:4%$7:4%), whereas the SystemGT tr always remained slightly below the eL threshold. The less demanding working condition was canal type I (5-mm radius, 30 angle, apical curvature) for SystemGT. ProTaper performed slightly better in canal type V (5-mm radius, 45 angle, apical curvature) than in canal type I. Higher levels of strains were recorded for the ProTaper, except for canals III and VII (small radius of curvature in the apical position). Considering the percentage of variation in the strain values (etot and eeq ) as a function of the canal geometry parameters (Table 1), tr in the same condition of angle and curvature position, a lowering of the radius produced a stronger increment of strains at the end of the insertion step; in the same condition of radius and curvature position, an increased angle generally produced small increments in strains. Only for the ProTaper operating in canals having a curvature in the apical position with a 5-mm radius, the change in the angle from 30 (type I canal) to 45 (type V canal) produced a small decrement of strain; in the same condition of radius and angle, a repositioning of the curvature from apical to middle location produced signicant increments of strain for canals with radius equal to 5 mm (II vs I and VI vs V) and small increments for canals with a 2-mm radius (IV vs III). The behavior of the instruments in the auto-reverse condition was studied by simulating the tip locking at the end of the insertion step. Canal type I was selected for these analyses because it presented the 1381
Mechanical Behavior of Two NiTi Rotary Instruments
TABLE 1. Percentage Values Obtained for the Specic Variables (Logarithmic Maximum Principal Strain etot and Equivalent Transformation Strain eeq ) at the End of tr the Insertion (standard condition) and Sticking (auto-reverse condition) Steps (upper part). Percentage of Variation of the Strain Specic Variables as a Function of the Curvature Parameters (lower part). The Canal Parameters Refers to the Radius (R) (2 or 5 mm), Angle A (30 or 45 ), and Position (P) (a = apical and m = medial) of the Curvature. PT, Protaper; GT = SystemGT. Canal type
I II III IV V VI VII I Radius: 2 vs 5 mm R 5 5 2 2 5 5 2 5 Canal III vs I IV vs II VII vs V Canal V vs I VI vs II VII vs III Canal II vs I IV vs III VI vs V
Canal parameters
a 30 30 30 30 45 45 45 30 p Apical Middle Apical r 5 5 2 r 5 2 5 P A M A M A M A A a 30 30 45 Mean P Apical Middle Apical Mean A 30 30 45 Mean etot [%] 4.0 6.6 7.2 8.4* 3.8 6.8 7.4 11.4 etot +80% +27% +95% +67% etot -3% +2% +3% +1% etot +65% +17% +72% +51%
PT
eeq [%] tr 3.2 5.8 6.4 7.0* 3.1 5.9 6.6 6.6 eeq tr +100% +21% +113% +78% eeq tr -3% +2% +3% +1% eeq tr +81% +9% +90% +60% etot [%] 3.2 5.8 7.5 8.2 3.4 5.8 7.5 11.0 etot +134% +41% +121% +99% etot +6% +0% +0% +2% etot +81% +9% +71% +54%
GT
eeq [%] tr 2.7 5.0 6.5 6.9 3.0 5.6 6.6 6.8 eeq tr +141% +38% +120% +100% eeq tr +11% +12% +2% +8% eeq tr +85% +6% +87% +59%
step
Insertion end
Sticking end Insertion end
Angle: 45 vs 30
Insertion end
Position: middle vs apical
Insertion end
*Indicates that both strain limit of the austenite to martensite transformation and yielding strain of the martensite are reached.
lowest strains in the standard working condition simulation. This allowed us to highlight the effects of the block; at the end of the locking step, the SystemGT showed a lower total strain etot (11.0% vs 11.4%) than the ProTaper instrument but a higher equivalent transformation strain eeq (6.8% vs 6.6%). However, in both the cases the transformatr tion strain threshold (eL) was not overcome. In Figure 2, the strain distributions during the standard (upper part) and auto-reverse (lower part) working conditions are depicted for the les inserted in canal type I.
Discussion
The present study compared the mechanical behavior of two NiTi les during instrumentation in various root canals using FEA. FEA may add useful information to in vivo and in vitro studies, allowing us to calculate quantities that are not measurable during experiments and to easily compare many models with different geometries, materials, boundary, and loading conditions. However, the accuracy and validity of the results are strictly dependent on the adopted computational model, and it is therefore important to recognize the potential limitations and simplications of the described models. In this article, instrument geometry (multiple tapers along the cutting portion of the instruments), boundary conditions (curved canals), and material constitutive law were accurately described. However, approximations were adopted for the device material properties (no data from the company or from experimental tests were available) and in the model restrictions discussed in the Material and Methods section. Accordingly, the results previously described should not be considered in absolute terms, but they are important in the comparison between different conditions. During the standard working condition, normal stresses and strains arose because of the exure induced by the canal shape. In all studied cases, the exural deformation was lower and more uniformly distributed along 1382
a smaller length of the blade for SystemGT (Fig. 2, upper part) than for ProTaper. The highest values were found in the canal with a sharp curvature in the medial portion. In this case, the ProTaper strain level overcame the transformation strain limit. Therefore, the ProTaper seemed to be more prone to accumulate plastic deformation and hence not to recover the original shape after removal from the canal. For both instruments, a stronger increase in the strain levels was found as a consequence of a decrease of the curvature radius; a slightly lower increment was found by shifting the curvature position from the middle to the apical zone. A raise in the curvature angle seemed not to affect the strain levels (Table 1). Accordingly, the criticality of the operation in standard conditions is dictated primarily by the canal curvature radius, secondarily by the position, and only at last by the curvature angle. During the auto-reverse condition, shear stresses and strains arose because of the torsion induced by the le rotation in the counter-clockwise direction. The imposed contrarotational cycle tended to unroll the les, straightening the tract immediately close to the blocked tip. In this case, the strains increased radially outward from the section center (Fig. 2, lower part) reaching high values if compared with the strains induced by cycles of insertion and removal in the same canal (shown in the upper part of Fig. 2) but without overcoming the strain limits. In the case of the SystemGT, high strain values developed over a wide area, whereas in the ProTaper the deformations quickly decreased moving away from the tip as a consequence of an increase in the torsion resistance because of the les cross-sections enlargement. This is because of the higher torsion stiffness of the ProTaper with respect to the SystemGT. It is interesting that in in vivo conditions shear strains (and hence stresses) are also present during the standard working condition. Indeed, friction caused by the le cutting action (not taken into account in our simulations) produces
Necchi et al.
Figure 2. Logarithmic maximum principal strain levels reached in the ProTaper (PT) and SystemGT (GT) at the end of the insertion and sticking steps (canal type I; section A and B at 3.7 and 2.4 mm from the apex in the z direction). (This gure is available in color online at www.aae.org/joe/.)
torsion solicitations along the blade. Accordingly, strains caused by the sum of torsion and exural action should be limited in a le. This suggests that ProTaper should be preferred because of its geometry, which is more suitable for undergoing both shear and normal strains/stresses. These results partially disagree with those presented by Berutti et al (24) and Xu and Zheng (25). The rst study compared the torsion and bending behavior of the ProTaper and ProFile instruments, whereas the second work investigated the inuence of the cross-section prole on
the mechanical performance of different commercial Ni-Ti instruments, including the ProTaper and the ProFile. The ProFile is very similar to the SystemGT in the concave cross-section. Therefore, these two les can be considered similar in the evaluation of mechanical response. In both articles, the results were presented in terms of Von Mises stresses, whereas in our work strain variables were preferred considering that along the pseudo-elastic plateau small stress variations corresponded to big strain changes. However, qualitative comparison between the outputs can be assessed. The results of Berutti et al showed that under 1383
Mechanical Behavior of Two NiTi Rotary Instruments
both bending or torsion actions, ProTaper had Von Mises stresses lower and more uniformly distributed over the surface than Prole. Moreover, ProTaper worked in the pseudo-elastic range in many load conditions, whereas ProFile operated frequently out of this range. These results agree with the outcomes from Xu and Zheng that show how ProTaper (convex cross-section) exhibits the lowest Von Mises stress intensity, and models with convex and triple helix sections are more torque resistant. The behavior under exural deformation of the les with concave or convex cross-section (ie, ProFile/SystemGT or ProTaper) described in Berutti et al. (24) and Xu & Zheng (25) is clearly different from our results. As highlighted before, FEA accuracy is strictly related to the hypothesis of the mathematical model, and, in this case, there are some important differences in the computational models adopted in these three studies. In particular, Berutti et al (24) ignored the tapering of the les, blocked the model at one end, applied a concentrated torsion moment (0-2.5 N/mm) or a bending moment (0-4.5 N/mm) at the free end, thus omitting le insertion-removal movement into and from the canal. Xu and Zheng (25) considered a xed tapering for all the instruments and constrained the tip face while applying a 2.5-N/mm torque to the free end. In conclusion, our results suggested a slightly better performance of the SystemGT compared with the ProTaper under bending solicitations. Conversely, according to literature, a better behavior of the ProTaper under torsion solicitations was highlighted.
7. Shen Y, Cheung GS, Bian Z, et al. Comparison of defects in ProFile and ProTaper systems after clinical use. J Endod 2006;32:615. 8. Spanaki-Voreadi AP, Kerezoudis NP, Zinelis S. Failure mechanism of ProTaper Ni-Ti rotary instruments during clinical use: fractographic analysis. Int Endod J 2006;39: 1718. 9. Zinelis S, Darabara M, Takase T, et al. The effect of thermal treatment on the resistance of nickel-titanium rotary les in cyclic fatigue. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2007;103:8437. 10. Bahia MGA, Melo MCC, Buono VTL. Inuence of cyclic torsional loading on the fatigue resistance of K3 instruments. Int Endod J 2008;41:88391. 11. Fife D, Gambarini G, Britto LR. Cyclic fatigue testing of ProTaper NiTi rotary instruments after clinical use. Oral Surg. Oral Med. Oral Pathol Oral Radiol Endod 2004; 97:2516. 12. Grande NM, Plotino G, Pecci R, et al. Cyclic fatigue resistance and three-dimensional analysis of instruments from two nickel-titanium rotary systems. Int Endod J 2006; 39:75563. 13. Kramkowski TR, Bahcall J. An in vitro comparison of torsional stress and cyclic fatigue resistance of ProFile GT and ProFile GT Series X rotary nickel-titanium les. J Endod 2009;35:4047. 14. Lopes HP, Moreira EJ, Elias CN, et al. Cyclic fatigue of ProTaper instruments. J Endod 2007;33:557. 15. Yared G. In vitro study of the torsional properties of new and used ProFile nickel titanium rotary les. J Endod 2004;30:4102. 16. Gekelman D, Ramamurthy R, Mirfarsi S, et al. Rotary nickel-titanium GT and ProTaper les for root canal shaping by novice operators: a radiographic and micro-computed tomography evaluation. J Endod 2009;35:15848. 17. Peru M, Peru C, Mannocci F, et al. Hand and nickel-titanium root canal instrumentation performed by dental students: a micro-computed tomographic study. Euro J Dent Edu 2006;10:529. 18. Pettiette MT, Delano EO, Trope M. Evaluation of success rate of endodontic treatment performed by students with stainless-steel K-les and nickel-titanium hand les. J Endod 2001;27:1247. 19. Ayar LR, Love RM. Shaping ability of ProFile and K3 rotary Ni-Ti instruments when used in a variable tip sequence in simulated curved root canals. Int Endod J 2004; 37:593601. 20. Hulsmann M, Herbs U, Schafers F. Comparative study of root-canal preparation using Lightspeed and Quantec SC rotary NiTi instruments. Int Endod J 2003;36: 74856. 21. Williamson AE, Sandor AJ, Justman BC. A comparison of three nickel titanium rotary systems, EndoSequence, ProTaper universal, and prole GT, for canal-cleaning ability. J Endod 2009;35:1079. 22. Necchi S, Taschieri S, Petrini L, et al. Mechanical behavior of Ni-Ti rotary endodontic les in simulated clinical conditions: a computational study. Int Endod J 2008;41: 93949. 23. Auricchio F, Petrini L. A three-dimensional model describing stress-temperature induced solid phase transformations: solution algorithm and boundary value problems. Int J Numer Methods Eng 2004;61:71637. 24. Berutti E, Chiandussi G, Gaviglio I, et al. Comparative analysis of torsional and bending stresses in two mathematical models of nickel-titanium rotary instruments: ProTaper versus ProFile. J Endod 2003;29:159. 25. Xu X, Zheng Y. Comparative study of torsional and bending properties for six models of nickel-titanium root canal instruments with different cross-sections. J Endod 2006;32:3725.
Acknowledgments
The authors thank Daniele Aspesi, MEng, for his contribution to the numerical analyses.
References
1. Parashos P, Messer HH. The diffusion of innovation in dentistry: a review using rotary nickel-titanium technology as an example. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;101:395401. 2. Taschieri S, Necchi S, Rosano G, et al. Advantages and limits of nickel-titanium instruments for root canal preparation. A review of the current literature. Schweiz Monatsschr Zahnmed 2005;115:10005. 3. Walia H, Brantley WA, Gerstein H. An initial investigation of the bending and torsional properties of nitinol root canal les. J Endod 1988;14:34651. 4. Martn B, Zelada G, Varela P, et al. Factors inuencing the fracture of nickel-titanium rotary instruments. Int Endod J 2003;36:2626. 5. Parashos P, Gordon I, Messer HH. Factors inuencing defects of rotary nickeltitanium endodontic instruments after clinical use. J Endod 2004;30:7225. 6. Shen Y, Coil JM, McLean AG, et al. Defects in nickel-titanium instruments after clinical use. Part 5: single use from endodontic specialty practices. J Endod 2009;35: 13637.
1384
Necchi et al.
Evaluation of the Effect of Maleic Acid and Ethylenediaminetetraacetic Acid on the Microhardness and Surface Roughness of Human Root Canal Dentin
Nidambur Vasudev Ballal, MDS, Kundabala Mala, MDS, and Kadengodlu Seetharama Bhat, MDS
Abstract
Introduction: The aim of this in vitro study was to evaluate the effect of 7% maleic acid and 17% EDTA solutions on the microhardness and the surface roughness of human root canal dentin. Methods: Forty-ve extracted human maxillary central incisors were sectioned longitudinally into a total of 90 segments, were embedded in auto polymerizing acrylic resin, and were grounded at with silicon carbide abrasive papers. Based on the test solutions used, samples were divided randomly into three groups: (1) the EDTA group, 1 mL of 17% EDTA for 1 minute (n = 30), (2) the maleic acid group, 1 mL of 7% maleic acid for 1 minute (n = 30), and (3) the control group, 1 mL of 0.9% saline for 1 minute (n = 30). Every group was then divided into two subgroups of 15 specimens each. In group 1a, 2a, and 3a, specimens were used to determine the microhardness of the root canal dentine in the coronal, middle, and apical third using Vickers hardness tester. In groups 1b, 2b, and 3b, specimens were used for the determination of surface roughness of the root canal dentine using a roughness tester (Surtronic, Leicester, England). The data were statistically analyzed using the Kruskall Wallis and Mann Whitney U tests. Results: There was no signicant difference between EDTA and maleic acid in the reduction of microhardness. The increase in roughness was signicantly greater with maleic acid when compared with EDTA. Conclusion: Maleic acid reduced the microhardness of root dentin similar to EDTA but increased the surface roughness signicantly more than EDTA. (J Endod 2010;36:1385 1388)
Key Words
EDTA, maleic acid, microhardness, roughness
he success of root canal therapy depends on the technique and the quality of instrumentation, irrigation, disinfection, and three-dimensional obturation of the root canal system. Mechanical instrumentation of the root canal either using manual or rotary instruments produces a smear layer that covers the dentinal tubules (1). There is a controversy over whether to remove or maintain the smear layer, but a recent systematic review and meta-analysis of leakage studies concluded that the removal of the smear layer improves the uid tight seal of the root canal system (2). The smear layer can be removed using various chelating agents like EDTA, citric acid, and a mixture of tetracycline isomer (doxycycline), an acid (citric acid) and a detergent (Tween 80) (35), but the combination of EDTA and sodium hypochlorite is used most often for smear layer removal (6). Chelation is a physicochemical process that prompts the uptake of multivalent positive ions by specic chemical substances. In radicular dentine, the agent reacts with the calcium ions of hydroxyapatite crystals. This process can cause changes in the microstructure of the dentine and changes in the calcium to phosphorus ratio. Changes in the mineral content ratio may alter the original proportion of organic and inorganic components, which in turn reduces the microhardness, increases the permeability and solubility of the root canal dentin, and inhibits resistance to bacterial ingress and permitting coronal leakage (7). It has been indicated that microhardness determination can provide indirect evidence of mineral loss or gain in dental hard tissues (8). Changes in the mineral content of root canal dentine may also adversely affect the sealing ability and adhesion of dental materials such as resin-based cements and root canal sealers (7). Several studies have shown that EDTA is capable of decreasing the microhardness of root canal dentine (911). Since microhardness is sensitive to composition and surface changes of tooth structure (12), the following effects of several solutions on dentine hardness were previously evaluated: sodium perborate (13), EDTA and a combination of hydrogen peroxide and sodium hypochlorite (14), EDTAC, cyclohexane-1,2-diamine-tetra acetic acid and ethylene glycol-bis-(betamino-ethyl ether) N,N,N,N-tetra acetic acid (15), and the combination of sodium hypochlorite and EDTA (16, 17). Recently, 7% maleic acid in combination with 2.5% sodium hypochlorite has been found to be signicantly better than EDTA in the removal of the smear layer from the root canal system (18). To date, there are no studies evaluating the effect of maleic acid on the microhardness of root canal dentine. The purpose of this in vitro study was to evaluate the effect of 7% maleic acid and 17% EDTA solutions on the microhardness and the surface roughness of human root canal dentine.
From the Manipal College of Dental Sciences, Manipal, Karnataka, India Address requests for reprints to Dr Nidambur Vasudev Ballal, Manipal College of Dental Sciences, Manipal 576 104, Karnataka, India. E-mail address: drballal@yahoo.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.002

Forty-ve extracted human maxillary central incisors were selected. The selection of teeth was based on their relative dimensions and similarity in morphology. Ethical clearance was obtained from the Ethical Committee of Manipal University, Manipal, Karnataka, India. Supercial soft tissues were removed with a brush, and the teeth were stored in 0.2% sodium azide (Sigma Chemical Co, St Louis, MO) at 4 C. The teeth with caries, cracks, and dilacerations were excluded. The teeth were decoronated at the cementoenamel junction using a high-speed diamond point (Diatec, Coltene AG, Switzerland) under water cooling, after which the pulp tissue was removed by using a barbed broach (Mani Inc-Tochigi Ken, Utsunomiya-shi, Japan). Each root was then sectioned longitudinally by starting from the cervical to the apical area with
Effect of Maleic Acid and EDTA on Human Root Canal Dentin
1385
a low-speed diamond disc (Horico, Berlin, Germany), separating each root into buccal and lingual segments and making a total of 90 segments. The root segments were then horizontally embedded in auto polymerizing acrylic resin, leaving their dentine exposed to facilitate manipulation and improve metallographic preparation. Then, the dentine surfaces of the mounted specimens were grounded at and smooth on a circular grinding machine with a series of ascending grades of Silicon carbide abrasive papers (500, 800, 1,000, and 1,200 grit) under distilled water to remove any surface scratches and nally polished with 0.1-mm alumina suspension (Ultra-Sol R; Eminess Tec Inc, Monroe, NC) on a rotary felt disk. Ninety specimens were then divided into three groups (n = 30) and were prepared as follows: (1) the EDTA group, the specimens were treated with 1 mL of 17% EDTA (Merck, Dermstadt, Germany) for 1 minute; (2) the maleic acid group, the specimens were treated with 1 mL of 7% maleic acid (KMC Pharmacy, Karnataka, India) for 1 minute; and (3) the control group, the specimens were treated with 1 mL of 0.9% saline for 1 minute. Every group was then divided into two subgroups of 15 specimens each. In group 1a, 2a, and 3a specimens were used to determine the microhardness of the root canal dentine using a Vickers hardness tester (Matsuzawa Seiki Co Ltd, Tokyo, Japan). The indentations were made with a Vickers diamond indenter at three different locations. The locations were chosen at the 0.5-mm level to the root canal wall in the coronal, middle, and apical third of the roots. The indentations were made on each specimen using a 200-g load and a 20-second dwell time. The diamond- shaped indentations were carefully observed in an optical microscope with a digital camera and image analysis software, allowing the accurate digital measurement of their diagonals (Fig. 1). The average length of the two diagonals was used to calculate the microhardness value. The representative hardness value for each specimen was obtained as the average of the results of the three indentations. These measurements were then converted into Vickers numbers. In groups 1b, 2b, 3b specimens were used for the determination of surface roughness (Ra, mm) of the root canal dentine using a roughness tester (Surtronic, Leicester, England). Three tracings at different locations on each specimen were made. The mean Ra and standard deviations were determined. The Ra parameter describes the overall roughness of a surface and can be dened as the arithmetical value of all absolute distances of the roughness prole from the centerline within the measuring length. The microhardness and surface roughness values were statistically analyzed using the Kruskall Wallis and Mann-Whitney U test.
Results
Figure 2 shows the mean microhardness among the different experimental groups at the coronal, middle, and apical third of the root canal system. The control group (saline) reduced the microhardness the least as compared with EDTA and maleic acid in the coronal, middle, and apical third, which was statistically signicant (p < 0.001). A comparison between EDTA and maleic acid showed that there was no statistical signicant difference in the reduction of the microhardness at the coronal, middle, and apical third of the root canal system (p = 0.520, p = 0.901, p = 0.089). Figure 3 shows the mean surface roughness among the different experimental groups. When the results of the surface roughness were analyzed, the difference between all three experimental groups was found to be statistically signicant (p < 0.001). When comparing the change in the dentin surface roughness after using the test agents, the increase in the dentin surface roughness was signicantly greater with maleic acid when compared with EDTA (p = 0.014) and saline (p < 0.001). The control group (saline) showed the least roughness.
Discussion
Current concepts of chemomechanical preparation imply that chelating solutions should be applied on instrumented root canal surfaces in order to remove the smear layer (19). Such procedures may induce considerable changes in the surface morphology of dentin, which may also exert changes in its mechanical and physical properties (20, 21). In the present study, chelating solutions were applied on the root canal dentine, and the surface microhardness and roughness tests were conducted to determine the changes on dentin surface. Panighi and GSell (22) reported a positive corelationship between microhardness and the mineral content of the tooth. Thus, the determination of microhardness can provide valuable evidence of mineral loss or gain in the dental hard tissue (8). Results of the present study indicated that there was no signicant difference in the reduction of the microhardness between 17% EDTA and 7% maleic acid solutions in the coronal, middle, and the apical third of the root canal system. This nding corroborates with previous studies that have shown that EDTA signicantly decreases the root canal dentin microhardness (911). The degree of mineral content and the amount of hydroxyapatite in the intertubular substance are considerable factors in determining the intrinsic hardness prole of dentin structure (12). The chelating action of EDTA solution induces an adverse softening potential on the calcied components of dentin, and, subsequently, a reduction in microhardness was expected. Maleic acid is a mild organic acid used as an acid conditioner in adhesive dentistry (23). It has been found to posses the smear layerremoving quality when used as an acid etchant in restorative dentistry (24). Recently, 7% maleic acid proved to be signicantly better than EDTA in removing the smear layer from the apical third of the root canal system (18); 7% maleic acid is highly acidic with a pH of 1.05. This acidic pH might have caused demineralization of the root canal dentin and subsequent reduction in the microhardness. There is no statistical signicant difference between 7% maleic acid and 17% EDTA, which suggests that maleic acid can be used in place of EDTA. Saline, which was used as a control, was found to have no effect on the microhardness of root canal dentin compared with that of EDTA and maleic acid. This may be because saline does not have any chelating or dimenaralizing effect on the root dentin. Previous investigations have shown that the suitability and practicality of the Vickers microhardness test for evaluating surface changes of dental hard tissues treated with chemical agents (25, 26). Although Knoop hardness test was used for evaluating surface changes of dental hard tissues in other studies (27, 28), the Vickers microhardness test
Figure 1. Photomicrograph of the diamond-shaped indentation on the root canal surface. (This gure is available in color online at www.aae.org/joe/.)
1386
Ballal et al.
Figure 2. Mean microhardness scores observed among experimental groups.
was preferred in this study because of suitability of the method. In the present study, to measure the Vickers hardness values for dentin, indentations were made from the coronal, middle, and apical thirds of the root canal and were done at the 0.5-mm level from the root canal walls for standardization, and their means for each sample were calculated. Dentin hardness is related to location, and its value decreases as the indentation tested are made closer to the pulp (29). Pashly et al (29) reported that the microhardness of dentin declined when dentin was tested from supercial to deep regions. They also reported an inverse correlation between dentin microhardness and tubular density. In addition to tubular density, the contact time of the irrigation solution needs to be considered as another determinant in the posttreatment microhardness values of dentin. Currently, there is no consensus on the optimal time a chelating agent must be in contact within the root canal to adequately remove
the smear layer. However, we opted for a 1-minute time interval, which is in accordance with various other studies (18, 30). The relative softening effect on the dentinal walls exerted by these chemicals irrigants could be of clinical benet because it permits rapid preparation and facilitates the negotiation of tight small root canals (31). These alterations may also affect the sealing ability and the adhesion of sealers and adhesives to the root dentin (32). For the surface roughness, results of the present study indicated that maleic acid produced maximum rough surface of the root canal dentin compared with that of EDTA. This could be because of the better smear layer removal capacity and the demineralizing ability of maleic acid compared with EDTA. In maleic acid samples, the dentinal tubules became patent, and the surface roughness increased. This nding is in accordance with the previous study (18), which has shown that maleic acid removes the smear layer signicantly better than EDTA. An increase
Figure 3. Mean surface roughness scores observed among experimental groups.
Effect of Maleic Acid and EDTA on Human Root Canal Dentin
1387
in the surface roughness could be of clinical benet in restorative dentistry/endodontics because of micromechanical bonding of adhesive restorative materials/root canal resin sealers that requires the presence of irregularities on the surface of the adherent into which the adhesive can penetrate. Further studies need to be conducted to check for the effect of 7% maleic acid on the microhardness and surface roughness of root dentin at different time intervals and also the fracture resistance of roots after treatment with 17% EDTA and 7% maleic acid solutions.
13. Chang HK, Palamara JE, Messer HH. Effect of hydrogen peroxide and sodium perborate on biomechanical properties of human dentine. J Endod 2002;28: 627. 14. Saleh A, Ettman W. Effect of endodontic irrigation solutions on microhardness of root canal dentine. J Dent 1999;27:436. 15. Cruz- Filho AM, Sousa-Neto MD, Saquy PC, et al. Evaluation of the effect of EDTAC, CTDA and EGTA on radicular dentine microhardness. J Endod 2001;27:1834. 16. Zhang K, Kim YK, Cadenaro M, et al. Effects of different exposure times and concentrations of sodium hypochlorite/ethylenediaminetetraacetic acid on the structural integrity of mineralized dentin. J Endod 2010;36:1059. 17. Moreira DM, Almeida JFA, Ferraz CCR, Gomes BPFA, Line SRP, Zaia AA. Structural analysis of bovine root dentin after use of different endodontics auxiliary chemical substances. J Endod 2009;35:10237. 18. Ballal NV, Kandian S, Mala K, et al. Comparison of the efcacy of maleic acid and ethylenediaminetetraacetic acid in smear layer removal from instrumented human root canal: a scanning electron microscopic study. J Endod 2009;35:15736. 19. Torabinejad M, Handysides R, Khademi AA, et al. Clinical implications of the smear layer in endodontics: a review. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2002;94:65866. 20. Dogan H, Calt S. Effect of chelating agents and sodium hypochlorite on mineral content of root dentin. J Endod 2001;27:57880. 21. Ari H, Erdemir A. Effects of endodontic irrigation solutions on mineral content of root canal dentin using ICP-AES technique. J Endod 2005;31:1879. 22. Panighi M, GSell C. Effect of the tooth microstrucutre on the shear bond strength of a dental composite. J Biomed Mater Res 1993;27:97581. 23. Wieczowski G, Davis EL, Joynt RB. Microleakage in various bonding agent composite resin systems. Oper Dent 1992;5(suppl):627. 24. Erickson RL. Surface interactions of dentin adhesive materials. Oper Dent (supplement) 1992;5(suppl):8194. 25. Tulga F, Ozok R, Gurbuz A, Ozkan P. Effect of different types of vital bleaching agents on microhardness of human enamel. Balkan J Stomatol 2000;4:1646. 26. Kuramoto Junior M, Matson E, Turbino ML, et al. Microhardness of Nd:YAG laser irradiated enamel surfaces. Braz Dent J 2001;12:313. 27. Meredith N, Sherriff M, Setchell DJ, et al. Measurement of the microhardness and Youngs modulus of human enamel and dentin using an indentation technique. Arch Oral Biol 1996;41:53945. 28. Hosoya Y, Marshall SJ, Watanabe LG, et al. Microhardness of carious deciduous dentin. Oper Dent 2000;25:819. 29. Pashley D, Okabe A, Parham P. The relationship between dentin microhardness and tubule density. Endod Dent Traumatol 1985;1:1769. 30. Yamada RS, Armas A, Goldman M, et al. A scanning electron microscopic comparison of a high volume nal ush with several irrigating solutions: part 3. J Endod 1983;9:13742. 31. Cruz-Filho AM, Paula EA, Pecora JD, et al. Effect of different EGTA concentrations on dentin microhardness. Braz Dent J 2002;13:18890. 32. Garcia-Godoy F, Loushine RJ, Itthagarun A, et al. Application of biologically oriented dentin bonding principles to the use of endodontic irrigants. Am J Dent 2005;18: 28190.
Conclusion
Based on the results obtained and experimental conditions of the present study, there was no signicant difference between 17% EDTA and 7% maleic acid solutions in the reduction of microhardness. However, maleic acid produced maximum surface roughness compared with that of EDTA. Saline that was used as a control did not alter the radicular dentin microhardness and surface roughness.
References
1. Sen BH, Wesselink PR, Turkun M. The smear layer: a phenomenon in root canal therapy. Int Endod J 1995;28:1418. 2. Shahravan A, Haghdoost A, Adl A, et al. Effect of smear layer on sealing ability of canal obturation: a systematic review and meta-analysis. J Endod 2007;33:96105. 3. Torabinejad M, Khademi AA, Babagoli J, et al. A new solution for the removal of the smear layer. J Endod 2003;29:1705. 4. Scelza MFZ, Antoniazzi JH, Scelza P. Efcacy of nal irrigation- a scanning electron microscopic evaluation. J Endod 2000;26:3558. 5. Calt S, Serper A. Smear layer removal by EGTA. J Endod 2000;26:45961. 6. Zehnder M. Root canal irrigants. J Endod 2006;32:38998. 7. Rotstein I, Dankner E, Goldman A, et al. Histochemical analysis of dental hard tissues following bleaching. J Endod 1996;22:236. 8. Arends J, ten Boscj JJ. Demineralization and remineralization evaluation techniques. J Dent Res 1992;71:9248. 9. Ari H, Erdemir A, Belli S. Evaluation of the effect of endodontic irrigation solutions on the microhardness and the roughness of root canal dentin. J Endod 2004;30: 7925. 10. De-Deus G, Paciornik S, Mauricio MHP. Evaluation of the effect of EDTA, EDTAC and citric acid on the microhardness of root dentine. Int J Endod 2006;39:4017. 11. Yu Qing, Akita Y, Kawano S, et al. Cleaning efcacy and dentin microhardness after root canal irrigation with a strong acid electrolytic water. J Endod 2006;32:11026. 12. Panighi M, GSell C. Inuence of calcium concentration on the dentine wettability by an adhesive. J Biomed Mater Res 1992;26:10819.
1388
Ballal et al.
Antimicrobial Effects of Calcium Hydroxide and Chlorhexidine on Enterococcus faecalis

Ronan J.R. Delgado, DDS, MSc,* Thas H. Gasparoto, DDS, MSc, PhD,* Carla R. Sipert, DDS, MSc,* Claudia R. Pinheiro, DDS, MSc,* Ivaldo G. Moraes, DDS, MSc, PhD, Roberto B. Garcia, DDS, MSc, PhD, Clovis M. Bramante, DDS, MSc, PhD, Ana P. Campanelli, MSc, PhD,* and Norberti Bernardineli, DDS, MSc, PhD
Abstract
Introduction: Endodontic treatment is commonly based on nonspecic elimination of intraradicular microorganisms. Although some authors prefer single-visit root canal operations for endodontic treatment, several studies have shown the importance of intracanal medication between sessions to kill microorganisms that biomechanical preparations alone cannot achieve. The purpose of this study was to evaluate the efcacy of calcium hydroxide Ca(OH)2 and chlorhexidine gel on the elimination of intratubular Enterococcus faecalis. Methods: Human uniradicular teeth contaminated with E. faecalis were treated with Ca(OH)2, 2% chlorhexidine gel, Ca(OH)2 plus 2% chlorhexidine gel, or saline (0.9% NaCl) as a negative control. Samples obtained at a depth of 0 to 100 mm and 100 to 200 mm from these root canal preparations were analyzed for bacterial load by counting the number of colonyforming units (CFUs) and bacterial viability using uorescence microscopy. Results: A signicant decrease in the number of CFUs and the percentage of viable E. faecalis was observed after treatment with either Ca(OH)2 or chlorhexidine when compared with the control group. Additionally, chlorhexidine gel had a signicantly higher antimicrobial efcacy as measured by the number of CFUs and the percentage of viable cells than Ca(OH)2. No differences were observed between the antimicrobial properties of chlorhexidine gel with and without the addition of Ca(OH)2. Conclusion: Both Ca(OH)2 and chlorhexidine have antimicrobial effects on E. faecalis. Chlorhexidine had increased antimicrobial activity when compared with Ca(OH)2. Ca(OH)2 combined with chlorhexidine showed similar antimicrobial activity to chlorhexidine alone. (J Endod 2010;36:13891393)
acterial invasion of the root canal system is crucial for the onset and maintenance of periapical diseases; thus, one goal of endodontic treatment is to kill microorganisms in the root canal system (1). Although biomechanical preparation and root canal shaping effectively reduce microbiota, these procedures do not completely eliminate bacteria in the lateral and accessory root canals, isthmi, and apical deltas (2). Thus, intracanal medication between appointments is recommended to further reduce bacteria in the root canal system, and multiple visits may be required even in cases in which biological concerns are not an issue (3). Calcium hydroxide (Ca[OH]2) is one of the most commonly used substances in endodontics, and its antibacterial property stems from its ability to increase a solutions pH (4). Chlorhexidine has emerged as an intracanal medication because of its wide antimicrobial spectrum, its ability to maintain its antibacterial action for a prolonged duration when adhered to anionic substrates, and its slow release as its concentration decreases (5, 6). The use of Ca(OH)2 and chlorhexidine combined has shown better antimicrobial properties than Ca(OH)2 alone, presenting biocompatibility without affecting the sealing ability of root canal obturation (79). Enterococcus faecalis is a gram-positive bacterium often isolated in persistent root canal infections. Furthermore, it can penetrate deeply into dentinal tubules and resist bactericidal substances commonly used in endodontic procedures (10, 11). E. faecalis was the rst gram-positive bacterium referred to as able to enter into a viable but nonculturable state (12, 13). Clinical procedures normally considered to be bactericidal, as used during endodontic treatment, may allow bacteria to be in this metabolic state where they cease to grow on bacteriologic culture media but remain alive. When favorable conditions return, E. faecalis can then return to a fully culturable state (12, 13). Therefore, the purpose of this study was to test, through both culture growth method and viability count, whether chlorhexidine alone or in combination with Ca(OH)2 could completely eliminate E. faecalis.

Teeth Preparation Sixty extracted single-rooted teeth were cleaned and stored in 10% formaldehyde. Fifteen teeth served as a negative control, and 45 teeth were used in the experimental groups. Specimens were prepared according to methods previously described by Haapasalo and Orstavik (11). Briey, crowns (2-3 mm from the cement-enamel junction) and 3 to 5 mm of the apical portion of the root were removed, and specimens (roots of 8 mm) were stored in saline until experimental procedures were performed.
Key Words
Calcium hydroxide, chlorhexidine, endodontic infection, Enterococcus faecalis, intracanal dressings
From the Departments of *Biological Sciences and Endodontics, Bauru School of Dentistry, University of Sao Paulo, Bauru, SP, Brazil. Address requests for reprints to Dr Ronan J.R. Delgado, Department of Biological Sciences, Bauru School of Dentistry, University of Sao Paulo, Alameda Dr Octavio Pinheiro Brisolla, 9-75, Bauru, Sao Paulo 17012-901, Brazil. E-mail address: ronanjacques@hotmail.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.013
Antimicrobial Effects of Ca(OH)2 and CHX on E. faecalis
1389
Bacterial Growth E. faecalis (American Type Culture Collection 29212) was cultured in brain heart infusion (BHI) broth. Bacterial morphology was conrmed using the Gram method and a stereomicroscope (Wild Heerbrugg, Gais, Switzerland). Bacterial concentrations used in experiments were determined by MacFarland Standards. Experimental Root Canal Infection Root canals were infected by inoculating the upper chambers with 6.3 108 colony-forming units (CFUs) per mL of E. faecalis diluted in 4 mL of BHI, keeping the bacterial suspension in contact with the lled roots. Fresh BHI broth was supplemented in the upper chamber weekly to ensure viability of bacteria. All specimens were incubated aerobically at 37 C. For 21 days, specimens were veried daily, and the turbidity of the E. faecalis was recorded for each specimen. After this period, each sample had each root canal irrigated with sterile saline, dried with sterile paper points, and divided into four groups (n = 15). Intracanal Dressings Teeth samples were submitted to the following intracanal dress ings: Ca(OH)2 (Calen, S.S. WHITE Artigos Dentarios Ltd, Rio de Janeiro, Brazil), 2% chlorhexidine gel, Ca(OH)2 combined with 2% chlorhexidine gel, and a negative control group with sterile saline. Each dressing was applied under sterile conditions via a syringe and needle until the dressing was extravasated. After the excess material was removed, coronal and apical orices were sealed with temporary restorative cement (Cimpat; Septodont, Saint-Maur-des-Fosses, France). Then, specimens were placed into Petri dishes and covered with humid sterile gauzes and incubated at 37 C for 14 days. Dentinal Fragment Samples At the end of the incubation period, the restorative cement was removed, and the root canal was washed with 5 mL of sterile saline. Subsequently, root canals were irrigated with neutralizing solution according to the following antimicrobial agents: 0.5% citric acid for Ca(OH)2, 0.5% Tween 80 (Sigma-Aldrich; Saint Louis, MO) in 0.07% soy lecithin for 2% chlorhexidine gel, and 2% chlorhexidine gel combined with Ca(OH)2. A last irrigation with sterile saline was then performed, and, lastly, root canals were dried with sterile paper points. Dentinal fragment samples were collected using Gates Glidden burs #5 for the depth of 0 to 100 mm and #6 for the depth of 100 to 200 mm (500 rpm, 1 N, electric motor Endo Plus, Driller; Sao Paulo, Brazil) and maintained in a microcentrifuge tube containing 1 mL of BHI broth. Each bur was used three times throughout the whole extension of the root canal. Assessment of Antibacterial Activity Immediately after the collection, dentine samples were mixed for 1 minute; aliquots of 25 mL were seeded on BHI blood agar and incubated at 37 C for 48 hours. After incubation, CFUs were counted using a colony counter CP600 (Quimis; Diadema, Brazil). Bacterial purity was conrmed by colony morphology and Gram staining. For uorescence microscopy analysis, dentin suspensions were mixed for 30 seconds, centrifuged at 600 g/5 min, and washed with phosphate buffered saline three times. The pellet was suspended in 25 mL of phosphate buffered saline followed by vigorous agitation. Samples were stained with 2.5 mL of calcein-acetoxymethylester (calcein-AM) (viable bacteria stained green in color) and 1 mL of propidium iodide (nonviable bacteria stained red in color) at 37 C for 15 minutes and analyzed using confocal microscopy (TCS model SPE; Le1390
Delgado et al.
ica, Mannheim, Germany). Bacteria viability was expressed as the mean percentage of viable E. faecalis over the total number of microorganisms by randomly counting of three elds.
Data Analysis Results are expressed as the mean one standard deviation. Statistical analysis was performed using the nonparametric KruskalWallis one-way analysis of variance test. The Miller test was used to establish individual differences. Values of p < 0.05 were considered statistically signicant.
Results
Antimicrobial Activity of Chlorhexidine and Ca(OH)2 Against E. faecalis The effectiveness of removing the smear layer was analyzed (Fig. 1A). Twenty-one days after smear layer removal, bacterial contamination of all dentinal tubules was conrmed as shown by scanning electron microscopy (Fig. 1B). The antimicrobial activity of Ca(OH)2 and 2% chlorhexidine gel was evaluated by counting the CFUs. After 14 days of intracanal medication, our results showed that treatment with saline solution did not inuence the bacteria viability within the dentinal tubules (Fig. 1C). The use of Ca(OH)2 and 2% chlorhexidine reduced the number of CFUs of E. faecalis recovered at depths of 0 to 100 mm and 100 to 200 mm when compared with control treatment (saline). The treatment with chlorhexidine presented the least number of CFUs. No signicant differences in the bacteria CFU (0- to 100-mm depth or 100- to 200-mm depth) were observed between chlorhexidine with and without Ca(OH)2 (Fig. 1C). Bacterial viability was evaluated through confocal scanning electron microscopy (Fig. 2). The intracanal dressings used signicantly reduced the number of E. faecalis when compared with the controls (p < 0.001) (Fig. 2A). Chlorhexidine signicantly eliminated more E. faecalis (p < 0.001) when compared with Ca(OH)2 because viable E. faecalis was decreased (6.9% 5.25%) compared with Ca(OH)2 (25% 10.9%) (Fig. 2A, C, and D). There were no differences between the antimicrobial activity of chlorhexidine with or without Ca(OH)2 (Fig. 2A and E).
Discussion
Endodontic therapy can be based on nonspecic elimination of intraradicular microorganisms. Furthermore, some authors prefer a single-visit root canal treatment (14, 15) although many studies have shown the importance of intracanal medication between sessions in order to kill microorganisms that biomechanical preparations miss. Intracanal medication act beyond the root canal lumen, inside dentinal tubules and apical resorptions (13). E. faecalis high resistance to antibacterial substances is widely documented, and this bacterium can enter in a viable but nonculturable state during environmental stress (12, 13). Therefore, this investigation analyzed the inuence of chlorhexidine and Ca(OH)2 on the survival of intratubular E. faecalis. The methodology performed in this study has several advantages over other methods (16). Moreover, the interaction between dentine and E. faecalis may also result in bacterium resistance (17). The method used in this study allowed the recovery of bacteria within biolms inside dentinal tubules instead of planktonic microorganisms suspended at the lumen of the root canal (17, 18) and also resulted in similar outcomes to those obtained in daily practice because the microorganisms were grown in liquid medium containing opened teeth allowing the penetration of bacteria into dentinal tubules.
Figure 1. Antimicrobial activity of intracanal dressings against intratubular E. faecalis. Sixty extracted single-rooted teeth were infected with E. faecalis, and after 21 days, bacterial contamination of dentinal tubules was conrmed. Ca(OH)2 and 2% chlorhexidine gel with and without Ca(OH)2 were applied to these teeth, and after 14 days, dentine samples obtained at depths of 0 to 100 mm and 100 to 200 mm through the root canal preparation were analyzed by counting the CFUs. (A) Scanning electron microscopy showing smear layer removal. (B) Scanning electron microscopy showing E. faecalis in human dentinal tubules 21 days after infection. (C) The bars show the number of CFUs of E. faecalis recovered after Ca(OH)2 and chlorhexidine treatment. Results represent the mean standard deviation of two independent experiments. The data were analyzed by the Kruskal-Wallis and Miller post tests. )p < 0.05 compared with control group; #p < 0.05 compared with Ca(OH)2.
The present investigation evaluated the ability of E. faecalis to survive certain intracanal dressings while considering their metabolic state and cultivable response. Typically, a bacteriums physiological state infecting the root canal system is close to a starvation condition. Despite the effectiveness of Ca(OH)2 in eliminating a wide range of microorganisms, our results corroborate others ndings showing E. faecalis resistance to Ca(OH)2 (1921). Furthermore, E. faecalis has also been shown to be more susceptible to solutions containing chlorhexidine (7, 2224) but not Ca(OH)2 (16, 25, 26). Because starvation may be one of the major factors that impacts the resistance of E. faecalis (27), the metabolic state of this microorganism when subjected to intracanal dressings during the endodontic treatment must be considered. The antibacterial properties of Ca(OH)2 are attributed to its alkalinity and its ability to destroy the cytoplasmic membrane, denature bacterial proteins, and damage bacterial DNA (4). Chlorhexidine penetrates into bacteria and exerts toxic effects through disturbance in their membrane charges (28). Both hydroxide ions and chlorhexidine exert their bactericidal activity by disintegrating membranes (29). Additionally, chlorhexidine may induce reactive oxygen species production in the alkaline environment. The production of reactive oxygen species may inhibit E. faecalis growth because of the destruction of the cell wall and the plasma membrane mediated by nitric oxide (30). On
the other hand, studies have reported that the antimicrobial activity of chlorhexidine is reduced when it is associated with Ca(OH)2 (31). However, this nding was not observed in our study. Rather, we observed a similar antimicrobial activity for chlorhexidine combined with Ca(OH)2 when compared with chlorhexidine alone against E. faecalis when using an agar diffusion tests. This observation is corroborated by Zerella et al (7). The combination of chlorhexidine with Ca(OH)2 paste could remain in the root canal system as a barrier for longer periods, eliminating large amounts of persistent microorganisms (32, 33). This study evaluated the antimicrobial activity of Ca(OH)2 and chlorhexidine with and without Ca(OH)2 and found that all of these treatments were effective against E. faecalis. More specically, Ca(OH)2 alone was signicantly less effective than the other treatments with chlorhexidine. Therefore, chlorhexidine may be effective for endodontic therapy. However, viable E. faecalis was detected after 14 days from the treatment indicating persistence of this pathogen to remain in a viable but nonculturable state.
Acknowledgments
We thank Dr Daniel Thomas Brozoski for his critical reading of rcia Graeff and AndreLuis da Silva from the the manuscript and Ma
1391
Figure 2. The viability of E. faecalis. After 14 days of intracanal medication, the antimicrobial activity of Ca(OH)2 and 2% chlorhexidine gel was analyzed by uorescence microscopy. Dentin samples were obtained at 0 to 100 mm and 100 to 200 mm, and bacteria were stained with calcein-AM and propidium iodide. (A) The bars show the total number of viable bacteria. The data were analyzed by the Kruskal-Wallis and Miller post tests. )p < 0.05 compared with the control group; #p < 0.05 compared with Ca(OH)2. (B) E. faecalis viability after treatment with saline solution, (C) calcium hydroxide, (D) 2% chlorhexidine gel and, (E) Ca(OH)2 combined with 2% chlorhexidine gel. (This gure is available in color online at www.aae.org/joe/.)
Department of Biological Sciences, Bauru School of Dentistry, for their technical assistance.
References
1. Vianna ME, Horz HP, Conrads G, et al. Effect of root canal procedures on endotoxins and endodontic pathogens. Oral Microbiol Immunol 2007;22:4118. 2. Vianna ME, Gomes BP. Efcacy of sodium hypochlorite combined with chlorhexidine against Enterococcus faecalis in vitro. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2009;107:5859. 3. Sathorn C, Parashos P, Messer H. Australian endodontists perceptions of single and multiple visit root canal treatment. Int Endod J 2009;42:8118.
4. Siqueira JF Jr, Lopes HP. Mechanisms of antimicrobial activity of calcium hydroxide: a critical review. Int Endod J 1999;32:3619. 5. Tervit C, Paquette L, Torneck CD, et al. Proportion of healed teeth with apical periodontitis medicated with two percent chlorhexidine gluconate liquid: a case-series study. J Endod 2009;35:11825. 6. Lee Y, Han SH, Hong SH, et al. Antimicrobial efcacy of a polymeric chlorhexidine release device using in vitro model of Enterococcus faecalis dentinal tubule infection. J Endod 2008;34:8558. 7. Zerella JA, Fouad AF, Spangberg LS. Effectiveness of a calcium hydroxide and chlorhexidine digluconate mixture as disinfectant during retreatment of failed endodontic cases. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005;100: 75661.
1392
Delgado et al.
8. Kontakiotis EG, Tsatsoulis IN, Papanakou SI, et al. Effect of 2% chlorhexidine gel mixed with calcium hydroxide as an intracanal medication on sealing ability of permanent root canal lling: a 6-month follow-up. J Endod 2008;34:86670. 9. da Silva RA, Leonardo MR, da Silva LA, et al. Effects of the association between a calcium hydroxide paste and 0.4% chlorhexidine on the development of the osteogenic phenotype in vitro. J Endod 2008;34:14859. 10. Williams JM, Trope M, Caplan DJ, et al. Detection and quantitation of E. faecalis by real-time PCR (qPCR), reverse transcription-PCR (RT-PCR), and cultivation during endodontic treatment. J Endod 2006;32:71521. 11. Haapasalo M, Orstavik D. In vitro infection and disinfection of dentinal tubules. J Dent Res 1987;66:13759. 12. Oliver JD. The viable but nonculturable state in bacteria. J Microbiol 2005;43: 93100. ` 13. Signoretto C, Lleo MM, Ta MC, et al. Cell wall chemical composition of Enterococcus faecalis in the viable but nonculturable state. Appl Environ Microbiol 2000;66:19539. 14. Sathorn C, Parashos P, Messer HH. Effectiveness of single-versus multiple-visit endodontic treatment of teeth with apical periodontitis: a systematic review and meta-analysis. Int Endod J 2005;38:34755. 15. Malkhassian G, Manzur AJ, Legner M, et al. Antibacterial efcacy of MTAD nal rinse and two percent chlorhexidine gel medication in teeth with apical periodontitis: a randomized double-blinded clinical trial. J Endod 2009;35:148390. 16. Siqueira JF Jr, de Uzeda M. Intracanal medicaments: evaluation of the antibacterial effects of chlorhexidine, metronidazole, and calcium hydroxide associated with three vehicles. J Endod 1997;23:1679. 17. Kayaoglu G, Erten H, Bodrumlu E, et al. The resistance of collagen-associated, planktonic cells of Enterococcus faecalis to calcium hydroxide. J Endod 2009; 35:469. 18. Ercan E, Dalli M, Duulgergil CT, et al. Effect of intracanal medication with calcium hydroxide and 1% chlorhexidine in endodontic retreatment cases with periapical lesion: an in vivo study. J Formos Med Assoc 2007;106:21724. 19. Evans M, Davies JK, Sundqvist G, et al. Mechanisms involved in the resistance of Enterococcus faecalis to calcium hydroxide. Int Endod J 2002;35:2218. 20. Gomes BP, Ferraz CC, Vianna ME, et al. In vitro antimicrobial activity of several concentrations of sodium hypochlorite and chlorhexidine gluconate in the elimination of Enterococcus faecalis. Int Endod J 2001;34:4248. 21. Sukawat C, Srisuwan T. A comparison of the antimicrobial efcacy of three calcium hydroxide formulations on human dentin infected with Enterococcus faecalis. J Endod 2002;28:1024. 22. Basrani B, Tjaderhane L, Santos JM, et al. Efcacy of chlorhexidine-and calcium hydroxide-containing medicaments against Enterococcus faecalis in vitro. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2003;96:61824. 23. Gomes BP, Vianna ME, Sena NT, et al. In vitro evaluation of the antimicrobial activity of calcium hydroxide combined with chlorhexidine gel used as intracanal medicament. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;102:54450. 24. Turk BT, Sen BH, Ozturk T. In vitro antimicrobial activity of calcium hydroxide mixed with different vehicles against Enterococcus faecalis and Candida albicans. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2009;108:297301. 25. Barbosa CA, Goncalves RB, Siqueira JF Jr, et al. Evaluation of the antibacterial activities of calcium hydroxide, chlorhexidine, and camphorated paramonochlorophenol as intracanal medicament. A clinical and laboratory study. J Endod 1997;23:297300. 26. Komorowski R, Grad H, Wu XY, et al. Antimicrobial substantivity of chlorhexidinetreated bovine root dentin. J Endod 2000;26:3157. 27. Portenier I, Waltimo T, Orstavik D, et al. The susceptibility of starved, stationary phase, and growing cells of Enterococcus faecalis to endodontic medicaments. J Endod 2005;31:3806. 28. Lindskog S, Pierce AM, Blomlof L. Chlorhexidine as a root canal medicament for treating inammatory lesions in the periodontal space. Endod Dent Traumatol 1998;14:18690. 29. McDonnell G, Russell AD. Antiseptics and disinfectants: activity, action, and resistance. Clin Microbiol Rev 1999;12:14779. 30. Nishikawa T, Sato E, Choudhury T, et al. Effect of nitric oxide on the oxygen metabolism and growth of E. faecalis. J Clin Biochem Nutr 2009;44:17884. 31. de Souza-Filho FJ, Soares Ade J, Vianna ME, et al. Antimicrobial effect and pH of chlorhexidine gel and calcium hydroxide alone and associated with other materials. Braz Dent J 2008;19:2833. 32. Gomes BP, Souza SF, Ferraz CC, et al. Effectiveness of 2% chlorhexidine gel and calcium hydroxide against Enterococcus faecalis in bovine root dentine in vitro. Int Endod J 2003;36:26775. 33. Lin S, Kr A, Laviv A, et al. The in vitro antibacterial effect of iodine-potassium iodide and calcium hydroxide in infected dentinal tubules at different time intervals. J Contemp Dent Pract 2009;10:5966.
1393
Inuence of Cross-sectional Design and Dimension on Mechanical Behavior of Nickel-Titanium Instruments under Torsion and Bending: A Numerical Analysis
En-Wei Zhang, PhD,* Gary S.P. Cheung, MSc, MDS, PhD, and Yu-Feng Zheng, PhD*
Abstract
Introduction: The aim of this study was to examine the inuence of the cross-sectional conguration and dimensions (size and taper) on the torsional and bending behavior of nickel-titanium rotary instruments, taking into account the nonlinear mechanical properties of material. Methods: Ten cross-sectional congurations, square, triangular, U-type, S-type (large and small), convex-triangle, and 4 proprietary ones (Mani NRT and RT2, Quantec, and Mtwo), were analyzed under torsion or bending by using a 3-dimensional nite element method. The von Mises stresses were correlated with the critical values for various phases of the nickel-titanium material. Results: Different loading conditions led to unequal patterns of stress distribution. Increasing the applied torque or bending angle resulted in a rise in the corresponding stresses in the instrument. Favorable stress distribution without dangerous stress concentration was observed if the material was undergoing superelastic transformation at that applied load. The ultimate strength of the material was not exceeded when the instrument was bent up to a 50-degree curvature. On the other hand, when a torsional moment of greater than 1.0 Nmm was applied, the maximum stresses developed in some designs would exceed the ultimate strength of the material. Little variation in the von Mises stresses was observed for instruments of different nominal sizes and tapers on bending to similar extent. Conclusions: The cross-sectional design has a greater impact than taper or size of the instrument on the stresses developed in the instrument under either torsion or bending. Certain cross-sectional congurations are prone to fracture by excess torsional stresses. (J Endod 2010;36:13941398)
he need to cut dentin and to conform to the anatomical form (curvature) of the root canal dictates that nickel-titanium (NiTi) rotary instruments are subject to both torsional and bending moments in use. Various studies have reported that the method of use and its dimension relative to the canal have a direct impact on the (torsional) stress developed in the instrument (1, 2). On bending, the imposed strain (hence stresses) on the instrument is determined by the ratio of the radius of instrument to that of the canal curvature (3, 4). Finite element analysis (FEA) has been used to analyze the behavior of the instruments in the dental literature (5, 6), but it was not until the report of Berutti and Chiandussi (7) when the nonlinear behavior of NiTi material was considered for the rst time. This latter report indicated a difference in the stresses between instruments of different cross sections (7). The result was supported by Xu et al (8), who simulated the application of a 2.5 Nmm torque on 6 commercial brands of NiTi rotary les in an FEA software. However, other torque values were not examined, and neither were other parameters such as the size and taper of the instrument. The fact that stress-induced martensitic (SIM) transformation and its reverse transformation could alter the local stress value at different regions of the cross section, as well as along the length of the instrument, should be considered in any form of simulation of the superelastic material to allow a better understanding of the behavior of NiTi rotary instruments subjected to various forms of applied stress. The purpose of this study was to examine the stresses developed in NiTi les of various cross sections, taking into account the nonlinear mechanical behavior of the material as well as the dimension of the instrument.

Finite element models were constructed for instruments of 10 distinctly different cross-sectional designs by expressing all boundary conditions and geometric conguration numerically (Fig. 1A). The cross-sectional conguration (for several brands) was obtained by serial grinding of an embedded instrument and capturing the shape with an image measuring device (VCAD-1010; HLEO, Beijing, China). Then an idealized shape was established in CAD software (SolidWorks; Dassault Systemes, Velizy-Villacoublay, France). A smart sweep meshing method, which was optimized with sufcient number of elements with acceptable calculation time, was used to best-t a mesh on each instrument in FEA software (ANSYS, Canonsburg, PA); the number of nodes might not be the same for all designs of instrument. Data were entered into the software package (ANSYS), together with the nonlinear mechanical properties of the NiTi material. Critical values for the start and end point of SIM transformation and the ultimate strength of the material were obtained from published data for SE508 alloy from which NiTi rotary les are made (9, 10). Multilinear interpolation was made to estimate the
Key Words
Finite element analysis, nickel-titanium, root canal instrument, rotary les, superelastic, three-dimensional model
From the *State Key Laboratory for Turbulence and Complex System and Department of Advanced Materials and Nanotechnology, College of Engineering, Peking University, Beijing, China; and Area of Endodontics, Comprehensive Dental Care, Faculty of Dentistry, the University of Hong Kong, HKSAR. Address requests for reprints to Prof. Yu-Feng Zheng, Department of Advanced Materials and Nanotechnology, College of Engineering, Peking University, Beijing 100871, China. E-mail address: yfzheng@pku.edu.cn. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.017
1394
Zhang et al.
Figure 1. (A) Example of an instrument of a small S-type cross section (apical 10-mm segment only, taper 0.04 and size 30) meshed for the 3-dimensional analysis; the nite element model had 44,423 nodes and 9,720 elements. (B) Contour map showing the von Mises stress distribution for this instrument of different sizes and tapers loaded to a 30-degree curvature. (This gure is available in color online at www.aae.org/joe/.)
intermediate values for the different phases of NiTi material (Table 1). A stress value exceeding 1400 MPa (the ultimate tensile strength of NiTi) was deemed to result in breakage of the instrument. Two modes of loading were simulated. Either a torsional or bending moment was applied to the tip of instrument, with the other end (shank) xed. For the torsional analysis, different torque values (0.25, 0.5, 1.0, 1.5, and 2.0 Nmm) were applied to the 10 crosssectional congurations at their tip. The radius of the circle circumscribing each cross section was xed at 0.15 mm (ie, size 30). For the bending analysis, all groups (simulated size 30, with a 0.04 taper) were curved to a maximum of 50 degrees at 10-degree intervals, with the length of the curved (arc) portion conned to 10 mm (Fig. 1B). The degree of curvature was determined by controlling the tip displacement, akin to the method described by Schneider (11). The bending test was repeated with instruments of a different size or taper.
Results
Fig. 2 depicts the distribution of von Mises stresses in the torsion test; the (pseudo)colors corresponded to the range of stress values on a nonlinear scale (Table 1), corresponding to the transformation between phases of the NiTi material. Generally, the maximum stress occurred at the periphery (or border) of the cross section and often was located near the base or bottom of the ute. When the applied torque was small (0.25 or 0.5 Nmm), most instruments were still in their austenitic phase, ie, within the linear elastic range of the austenitic material (blue and cyan regions in Fig. 2). As the torsional moment increased to 1.0 Nmm, there was only a small rise in this maximum
TABLE 1. Properties of various phases of NiTi (SE 508) material Phase
Austenite phase (A) Transformation phase (A + M) Martensitic phase (M)
reaction stress for the NRT, both dimensions of S-type, Mtwo, convex-triangular, and the square cross section, indicating that these instruments were within their superelastic range, that is, the material was transforming with both austenite and stress-induced martensite being present (green region in Fig. 2). For the U-type, Quantec, RT2, and the triangular cross section, the maximum stress developed was greater than 1200 MPa, which indicated that these instruments had gone beyond the superelastic plateau stage. No obvious stress concentration (ie, spotty areas with high stresses) was observed for some but present in other congurations (Fig. 2). Increasing the torsional moment (to 1.5 Nmm or higher) led to increasing amount of stressinduced martensitic phase, followed by elastic and then plastic deformation of the martensite; high von Mises stresses were observed. Breakage was anticipated for some designs: U-type triangular (1.5 Nmm), Quantec (1.5 Nmm), Mtwo (2.0 Nmm), and RT2 (2.0 Nmm) (Fig. 2). Convex-triangle and the (large) S-type showed the highest resistance (with a lower stress value and with a more even stress distribution) to torsional failure among the 10 cross-sectional congurations (Fig. 2). The U-type Quantec and triangular cross section showed the greatest susceptibility to torsional failure, according to the maximum stress values that would develop in the instrument (Fig. 3A). In the case of bending, there existed a neutral plane where the stress was approximately zero (blue region in Fig. 1B, which was color-coded according to values in Table 1). The maximum stresses occurred on the surface of the instrument at a site furthest away from this neutral plane. There was no signicant stress concentration in the ute for all cross sections examined. When the angle of curvature
Stress (MPa)
0160 160320 320480 480530 530580 580760 7601160 11601400
Strain (%)
00.8 0.81.4 1.42.1 2.16.3 6.37.7 7.79.8 9.812.6 Linear elasticity
Stage
Color coding*
Blue Sky-blue Cyan Green Kelly Yellow Red
Superelasticity (stress-induced martensitic transformation) End of SIM transformation, and elastic range of the martensite Plastic deoration of martensite
*Pseudocolors applied to the stress contour map in FEA models.
Inuence of Cross-sectional Design and Dimension on Mechanical Behavior of NiTi Instruments
1395
Figure 2. Contour map showing the distribution of von Mises stresses for 10 instruments of different cross sections, with each (pseudo)color corresponding to the stress range described in Table 1. (This gure is available in color online at www.aae.org/joe/.)
1396
Zhang et al.
Figure 3. (A and B) Maximum values of von Mises stress developed in a size 30, 0.04 tapered instrument under torsion and bending, respectively. Those values were also determined for the 10 instruments (C) of the same size of #30 but different tapers and (D) of the same 0.04 taper but different sizes, all bent to a 30degree curvature.
was increased, the stress value rose rapidly at rst. The rate of increase in stress then slowed down at curvatures between 20 and 40 degrees, before it rose again on further bending (Fig. 3B). At a curvature of 50 degrees, several instruments (Quantec, NRT, Mtwo, RT2, and ProFile in that order) demonstrated a much higher stress than the others (Fig. 3B). When the taper or size of the instrument was altered, little inuence on the maximum stress developed for various amounts of bending was observed. The maximum von Mises stress increased slightly when the instrument size and taper increased (Fig. 3C, D), with the area undergoing SIM transformation increased in size (green region in Fig. 1B). The superelastic property of the material appeared to have maintained the stress within a safe range on bending; no signicant difference in the von Mises stresses for the various cross-sectional congurations could be found for instruments of the same size but different tapers (Fig. 3C) or of the same taper but different sizes (Fig. 3D).
Discussion
The force acting on the endodontic les in use might be resolved into 2 components, torsion and bending. It has been suggested than the load-deection behavior for combined torsion and bending might be resolved into these 2 pure modes for analysis (12). Results from the present numerical analysis indicated that the NiTi instrument is more likely to succumb to (a single application of) excess torsion than excess bending. For instance, a curvature of 50 degrees would only give rise to a stress of about 700800 MPa on the outermost bers of the instrument, which value is just into the martensitic phase but much lower than the materials ultimate tensile strength (1400 MPa). However, a torsional moment greater than 1.0 Nmm would cause some instruments of certain designs to develop local stresses to a rather high level. Torque of this value might easily be attained if the endodontic le is
locked during canal preparation. In other words, the excess torsion is more dangerous than bending moment (although repeated bending would undoubtedly lead to fatigue breakage). That justies the use of torque-controlled motors to avoid shear fracture of the rotary instruments, especially for some vulnerable designs. The result also indicates that rotary instruments seldom fail as a result of a single episode of excessive bending (ie, in canal with a small radius of curvature) but rather as a result of fatigue failure. Even if the instrument might be loaded to beyond the SIM transformation, that bending stress is insufcient to cause immediate fracture (Fig. 3B). Continuous rotation, however, will lead to failure due to low-cycle fatigue (3, 13), with the periphery of the instrument strained well into and sometimes beyond the superelastic range in the curved canal. U-le, Quantec, and le of a triangular cross section showed the least resistance to torsional breakage than the other instruments examined. Indeed, 2 commercial products both of a triangular cross section have been shown to be less resistant to repeated torsional loads, compared with those of a convex-triangular cross section (14). This might be related to the deep utes cut into these cross sections, resulting in a small inner core diameter (15). Because the principle of mechanics dictates that the stress at any point in a structure is inversely proportional to its radial distance to the centroid of the cross section (16), any instrument with a small core diameter would be prone to torsional overload, an observation that was noted for NiTi rotary instruments that were discarded after clinical use (16). It seems that instruments of a cross-sectional design that distributes the torsional stress well would be most suited for use in constricted canals, in which situation a high reaction stress in the material is likely (2). Those possessing high exibility with relatively low reaction stresses on bending would be more suitable for preparing the more severely curved canals, on the basis of mechanical considerations. In the clinical situation, the cutting efciency of the design would also be a consideration. 1397
Inuence of Cross-sectional Design and Dimension on Mechanical Behavior of NiTi Instruments
It is widely accepted that instruments of a smaller diameter are able to withstand a higher number of cycles of exural fatigue loading (rotational bending) than those larger instruments of the same design (1719). However, the dimensions (tip size or taper) seem to have little effect on the maximum von Mises stress when instrument was bent to a similar angle (eg, 30 degrees) of curvature; only a small effect on the maximum reaction stresses could be noticed. The material apparently was deforming within its superelastic range. Thus, the stress value stayed at about the SIM transformation threshold, despite the increased amount of deformation (strain) for those les of somewhat larger size or taper. Obviously, if one were to examine the fatigue behavior of NiTi rotary les, the surface strain should be considered rather than the stress value for the low-cycle fatigue behavior (3, 13). When the maximum stress developed in the material is concerned, our results indicated that the cross-sectional conguration is the main determinant of the stresses developed in the instrument. In other FEA studies that simulated the use of NiTi instruments of various designs in a curved root canal, the stresses developed in the material were also found to differ signicantly for different crosssectional congurations (20, 21). This is probably due to the fact that stress concentration is governed by the geometry of the part rather than the material property (16). It is alarming that some instruments that developed high von Mises stresses on bending (Quartec, NRT, and MTwo; Fig. 3B) were also susceptible to torsional failure. This underlines the importance of design on durability and safety of an instrument. In summary, from this numerical analysis, it might be concluded that certain cross-sectional congurations are more prone to failure by torsional overload than others. The cross-sectional design of the instrument has a signicant impact on the bending stresses developed in the NiTi rotary instrument, more so than the size and taper.
3. Cheung GSP, Darvell BW. Fatigue testing of a NiTi rotary instrument: part 1strainlife relationship. Int Endod J 2007;40:6128. 4. Huston RL. Principles of biomechanics. Boca Raton, FL: CRC Press; 2009:79140. 5. Turpin YL, Chagneau F, Vulcain JM. Impact of two theoretical cross-sections on torsional and bending stresses of nickel-titanium root canal instrument models. J Endod 2000;26:4147. 6. Turpin YL, Chagneau F, Bartier O, Cathelineau G, Vulcain JM. Impact of torsional and bending inertia on root canal instruments. J Endod 2001;27:3336. 7. Berutti E, Chiandussi G. Comparative analysis of torsional and bending stresses in two mathematical model of nickel-titanium rotary instruments: Protaper versus Prole. J Endod 2003;29:159. 8. Xu X, Eng M, Zheng Y, Eng D. Comparative study of torsional and bending properties for six models of nickel-titanium root canal instruments with different crosssections. J Endod 2006;32:3725. 9. Nitinol devices and components. Materials data sheet. Available at: http://www. nitinol.com/nitinol-university/material-properties. Accessed October 15, 2009. 10. Wang GZ. A nite element analysis of evolution of stress-strain and martensite transformation in front of a notch in shape memory alloy NiTi. Mater Sci Engng A 2007;38391. 11. Schneider SW. A comparison of canal preparations in straight and curved canals. Oral Surg 1971;32:2715. 12. McNaney JM, Imbeni V, Jung U, Papadopoulos P, Ritchie RO. An experimental study of the superelastic effect in a shape-memory Nitinol alloy under biaxial loading. Mech Mater 2003;35:96986. 13. Cheung GSP, Darvell BW. Low-cycle fatigue of NiTi rotary instruments of various cross-sectional shapes. Int Endod J 2007;40:62632. 14. Park S-Y, Cheung GSP, Yum J, Hur B, Park J-K, Kim H-C. Dynamic torsional resistance of nickel-titanium rotary instruments [published online ahead of print March 19, 2010]. J Endod doi:10.1016/j.joen.2010.02.016 15. Harty FJ, Pitt Ford TR. Hartys endodontics in clinical practice. 5th ed. Edinburgh: Wright; 2004:62. 16. Gere JM. Mechanics of materials. 5th ed. Pacic Grove, CA: Brooks/Cole; 2001: 81539. 17. Shen Y, Coil JM. Defects in nickel-titanium instruments after clinical use: part 3 a 4-year retrospective study from an undergraduate clinic. J Endod 2009;35:1936. 18. Pruett JP, Clement DJ, Carnes DL. Cyclic fatigue testing of nickel titanium endodontic instruments. J Endod 1997;23:7785. 19. Bergmans L, Van Cleynenbreugel J, Wevers M, Lambrechts P. Mechanical root canal preparation with NiTi rotary instruments: rationale, performance and safetystatus report for the American Journal of Dentistry. Am J Dent 2001;14:32433. 20. Kim HC, Cheung GS, Lee CJ, Kim BM, Park JK, Kang SI. Comparison of forces generated during root canal shaping and residual stresses of three nickeltitanium rotary les by using a three-dimensional nite-element analysis. J Endod 2008;34:7437. 21. Kim HC, Kim HJ, Lee CJ, Kim BM, Park JK, Versluis A. Mechanical response of nickjel-titanium instruments with different cross-sectional designs during shaping of simulated curved canals. Int Endod J 2009;42:593602.
References
1. Blum JY, Cohen A, Machtou P, Micallef JP. Analysis of forces developed during mechanical preparation of extracted teeth using ProFile NiTi rotary instruments. Int Endod J 1999;32:2431. 2. Peters OA, Peters CI, Schoneberger, Barbakow F. ProTaper rotary root canal preparation: assessment of torque and force in relation to canal anatomy. Int Endod J 2003;36:939.
1398
Zhang et al.
Investigation of Apex Locators and Related Morphological Factors

Jiangfeng Ding, DDS,* James L. Gutmann, DDS, PhD, FACD, FICD, FADI, Bing Fan, DDS, MSc, PhD,* Yao Lu, DDS,* and Hao Chen, DDS*
Abstract
Introduction: The purpose of this study was to investigate the ability of three electronic apex locators (EALs) to detect the minor foramen and morphological inuencing factors relative to working length determination. Methods: Three hundred fty-six extracted teeth were decoronated, and the coronal portion of the canal was ared. The distance between the major foramen and the le tips (DMFF) was determined by different EALs. The relationship between the DMFFs determined by the EAL and the morphological features of the root apex was analyzed by linear regression analysis. Results: The average DMFFs were 0.261mm, 0.376 mm, and 0.383 mm for the Root ZX (J. Morita, Kyoto, Japan), Raypex 5 (VDW, Munich, Germany), and Elements Apex Locator (SybronEndo, Anaheim, CA), respectively. The le tips determined by EALs were much closer to the major foramen in teeth with a lateral major foramen (p < 0.001). The area and diameters of the minor foramen were signicantly related to the variation of the DMFFs determined by EALs. Conclusion: When the minor foramen reading was given, the le tip connected to the Root ZX was much closer to the major foramen than the other two EALs. The minor foramens morphology and the major foramens location were both important inuencing factors on the performance of EALs. (J Endod 2010;36:13991403)
Key Words
Electronic apex locator, Root ZX, Raypex 5, Elements Apex Locator, morphological factor
From the *State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory of Oral Biomedicine Ministry of Education, School and Hospital of Stomatology, Wuhan University, Wuhan, China; and Department of Endodontics, Baylor College of Dentistry, Texas A&M University system Health Science Center, Dallas, TX, USA. Supported by the National Natural Science Foundation of China (grant no. 30872881). Address requests for reprints to Dr Bing Fan, The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory of Oral Biomedicine Ministry of Education, School and Hospital of Stomatology, Wuhan University, 237 Luoyu Road, Wuhan 430079, China. E-mail address: bingfan8@hotmail.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.006
roper root canal therapy procedures exhibit the following features: complete removal of infected pulp tissues, thorough canal cleaning, shaping, disinfection, and three-dimensional obturation. These purposes can be achieved only when the termination of root canal is determined accurately (1, 2). During this process, the minor foramen or physiological foramen is the desirable endpoint for the procedures within the root canal (3, 4) . Traditionally, tactile and radiographic methods have been used to determine the minor foramen; however, tactile sense is empirical and the radiograph can only provide a two-dimensional image of a threedimensional object (1, 2). Electronic apex locators (EALs) are now widely used for locating the minor foramen. The latest generation of EALs detects the minor foramen through calculating the subtle variation of impedance values between the le tip within the root canal generated by electrical impedances with different frequencies. Because of the development and advances in electronic engineering technology in the past several decades, the precision and stability of EALs have been greatly improved (5, 6). The accuracy of various EALs has been reported to be from 31% to 97.37% (712). In previous studies, accurate measurements were usually dened as measuring le tips within 0.50 or 1.00 mm around the preset endpoint of the root canal (1, 2). However, it remains questionable if the major foramen was set as the endpoint. In an ex vivo study conducted by Ounsi and Naaman (13), part of le tips, which were considered accurately determined by the Root ZX to the apical constriction, had actually gone beyond the root canal when the accuracy was dened as 0.5 mm around the major foramen. Correspondingly, the measured working length was actually unacceptable for root canal treatment. Therefore, it might be more objective to evaluate EALs by the distribution of measuring le tips in relation to the major foramen. The le tips location determined by EALs has been observed using radiographic (14, 15), histologic (7, 8), and direct le length measuring methods (11, 12, 16). Radiographic interpretation can be compromised by image distortions, whereas the histologic examination is destructive to the specimens. In both in and ex vivo studies, the conventional method is to represent the le tips location by calculating the difference between the measuring le and the actual root canal length (1, 2, 11, 12, 16). However, the unexpected movement of the rubber stop and the lack of parallelism between the measuring le and gauge might result in procedural errors that would inuence the study results (17). ElAyouti and Lost developed a mounting and measuring unit (MMU) to assist locating le tips. They found that the MMU was superior to the conventional method in repeatability and produced less measurement errors (17). Preferably, it would be more appropriate to use MMU instead of other methods to study the performance of EALs in laboratory studies. The diameter of apical foramen has been thought to be a major factor that inuences the performance of EALs (6, 18). Stein et al (19) reported that the accuracy of EAL was associated with the major foramens diameter but was not affected by the minor foramens diameter, whereas other researchers found that the measurements of EALs varied with the minor foramens diameter (10, 20, 21). Moreover, Pagavino et al (10) reported that the measuring error of EAL was signicantly different in teeth with different major foramen locations. The purpose of this study was to investigate the ability of three EALs, Root ZX (J. Morita, Kyoto, Japan), Raypex 5 (VDW, Munich, Germany), and Elements Apex Locator (SybronEndo, Anaheim, CA), to detect the minor foramen and related morphological inuencing factors during working length determination.
Investigation of Apex Locators
1399
the distance between the major foramen and the le tips (DMFF). Positive values represented the le tip short of the major foramen, whereas negative values represented the le tip beyond the major foramen. Subsequently, the apical anatomic features of the tooth, including the minor foramens morphology and the major foramens location, were identied and measured with the aid of a stereomicroscope (Stemi Sv11-Apo; Carl Zeiss, Jena, Germany). This procedure was similar to the process described by Cheung et al (22). The major foramen was adjusted parallel to the objective lens (20). The teeth with tip major foramen were labeled as 0 (Fig. 2A), and those with a lateral major foramen were labeled as 1 (Fig. 2C). Subsequently, the image of minor foramen was captured by adjusting the focus onto the smallest inner canal diameter through the major foramen (40) (Fig. 2B and D). The image software (Image-Pro Plus 4.5; Media Cybernetics, Silver Spring, MD) was used to measure the minor foramens morphological features, such as area, diameters, perimeter, and roundness. The roundness was used to describe the shape of the minor foramen; the value of 1 represented a round object. The difference between the DMFFs determined by three EALs was analyzed using the Friedman test followed by the Wilcoxon signed rank test. The DMFFs determined by each EAL in the teeth with different major foramens location were compared with the Mann-Whitney U test. The statistical difference was considered at p 0.05. The inuence of morphological factors on the DMFFs was analyzed by linear regression using the stepwise method, and the association between them was expressed in the linear regression equation as follows: Y = b+bnXn, where Y is the response variable of DMFF, X is the inuencing factors, b is the coefcient of regression indicating that the DMFF increases or decreases with the variation of the inuencing factors, and b is a constant that represents the measurements of the control.
Figure 1. Photograph of the modied mounting and measuring unit. (A) Base of the unit, (B) micrometer and measuring le, (C) container for sodium chloride solution, and (D) electrodes of EALs.

A total of 356 permanent teeth with a single, straight root canal that were extracted for periodontal, orthodontic, or prosthetic reasons were selected for this study. All the extracted teeth were numbered and stored in 10% formalin solution. The teeth were decoronated at the cementoenamel junction, and Gate-Glidden drills (Dentsply-Maillefer, Ballaigues, Switzerland) numbers 1 through 3 were used to are the coronal two thirds of each root canal. A physiologic sodium chloride solution (0.9%) was used for irrigation during the process, and the patency of the apical foramen was maintained with a no. 10 K-le. A modied MMU was built up for electronic measurements (Fig. 1). A digital micrometer (Tricle, Shanghai, China) connected with a no. 10 K-le (Dentsply-Maillefer) was used as the measuring le. By rotating the screw a full circle, the no. 10 K-le moved 0.5 mm vertically up or down. Before the electronic measurements, the measuring le was introduced into the root canal until the tip became just visible at the most coronal border of the major foramen (20) as viewed under a surgical operating microscope (Pico, Carl Zeiss, Jena, Germany), and the reading of digital micrometer was recorded as L0. Subsequently, the root apices were immersed into a plastic container lled with 0.9% sodium chloride, and the Root ZX, Raypex 5, and Elements Apex Locator following the manufacturers instructions were used to detect the minor foramen. After lling the root canal with 0.9% sodium chloride, the lip clip was attached to the container, and the electrode was connected to the K-le. For the Root ZX, the digital reading was recorded as the le was withdrawn from the reading Apex to the 0.5 ashing bar; for the Raypex 5, the reading was recorded when all three green bars were reached, and the symbol represented the position of minor foramen for the Elements Apex Locator. All electronic measurements were made in triplicate, and the mean value of readings was recorded as Le. The value was calculated by Le minus L0 and indicated 1400
Ding et al.
Results
The average of DMFFs was 0.261 mm for the Root ZX, 0.376 mm for the Raypex 5, and 0.383 mm for the Elements Apex Locator. Statistical analysis showed that there was a signicant difference between the Root ZX and the Raypex 5 (p < 0.001) as well as the Root ZX and the Elements Apex Locator (p < 0.001), but no signicant difference was found between the Raypex 5 and the Elements Apex Locator (p = 0.507). Of the 356 teeth, 180 had the major foramen at the root tip, whereas 176 had a lateral major foramen. For each EAL, the DMFFs showed a signicant difference in teeth with different major foramen locations (p < 0.001) (Table 1). The distribution of DMFFs determined by each EAL was presented in Table 2. File tips were located less than 0.5 mm and within the range of 0.5 to 1.0 mm coronal to the major foramen in 82.87% and 11.24% of cases for the Root ZX, 67.70% and 26.41% for the Raypex 5, and 64.05% and 22.47% for the Elements Apex Locator, respectively. There were six le tips identied beyond the major foramen with the Root ZX, with two and four tips beyond when using the Raypex 5 and Elements Apex Locator, respectively. There were two le tips that were over 1.5 mm short of the major foramen when using both the Root ZX and Raypex 5, and 24 tips were identied short when using the Elements Apex Locator. The morphological features of the minor foramen are given in Table 3. The DMFFs determined by EALs were signicantly associated with the apical anatomic features of the teeth (p = 0.001-0.011) (Table 4). The relationship between them was expressed by the linear regression equation as follows: for the Root ZX: Y = 0.187+1.615X1 0.08X2; for the Raypex 5: Y = 0.196 + 0.799X1 0.061X2 + 0.714X3;
Figure 2. The major foramen (outlined in red) and the minor foramen (outlined in green). (A) Tip major foramen, (B) the corresponding minor foramen, (C) lateral major foramen, and (D) the corresponding minor foramen. (This gure is available in color online at www.aae.org/joe/.)
and for the Elements Apex Locator, Y = 0.007 + 3.106X1 0.128X2 + 0.879X4. In these equations, X1 is the area of minor foramen, X2 is the location of major foramen, X3 is the narrow diameter of minor foramen, and X4 is the wide diameter of minor foramen.
tip was found 0.69 mm and 1.10 mm coronal to the major foramen for the Raypex 5 and Elements Apex Locator, respectively, which were greater than the results in this study (0.376 mm for the Raypex 5 and 0.383 mm for the Elements Apex Locator). The disagreement might
TABLE 1. The Median, Q1 (25%), and Q3 (75%) Values for the Distance from the File Tip to the Major Foramen (mm) Median
Root ZX T L Total Raypex 5 T L Total Elements Apex Locator T L Total 0.359* 0.209 0.261 0.483* 0.337 0.376 0.667* 0.335 0.383
Discussion
In the current study, a modied MMU was constructed to measure the DMFFs determined by EALs. The digital micrometer was mounted to a xed base that ensured the stability of measuring le during the operation. The different values recorded by the micrometer indicated the distance that the measuring le traveled. With the aid of the MMU, it was unnecessary for the operators to adjust the rubber stop and measure the le length manually. Therefore, the procedural errors were reduced signicantly (17). The ndings of the present study, which showed that the average distance from the EAL-indicated position of the minor foramen to the major foramen was 0.261 mm for the Root ZX and 0.376 mm for the Raypex 5, are supported by previous studies. By exposing the apical part of 20 permanent teeth, Wrbas et al (8) reported that the le tip was identied 0.12 and 0.15 mm short of the major foramen when using the Root ZX and Raypex 5, respectively. Vajrabhaya et al (23) found that the le tips were determined on average to be 0.2 mm coronal to the apical foramen when using the Root ZX on permanent teeth. However, in an ex vivo study of Pascon et al (12) on sixty extracted teeth, the le
Q1 (25%)
0.183 0.080 0.128 0.277 0.202 0.247 0.311 0.211 0.248
Q3 (75%)
0.434 0.337 0.394 0.606 0.512 0.565 0.683 0.520 0.599
N
180 176 356 180 176 356 180 176 356
Positive values indicate le tip short of major foramen. T, the extracted teeth with tip major foramen; L, the extracted teeth with major foramen deviated from the root main axis. *A signicant difference between the two groups of extracted teeth with different major foramens location for each EAL. A signicant difference between Root ZX and the other two EALs at p < 0.001.
1401
TABLE 2. Location of File Tips in Relation to the Major Foramen Root ZX DMFF (mm)*
0.5 < DMFF # 0.0 0.0 DMFF # 0.5 0.5 < DMFF # 1.0 1. 0 < DMFF # 1.5 DMFF > 1.5
Raypex 5 %
1.68 82.87 11.24 3.65 0.56
Elements Apex Locator %

0.56 67.70 26.41 4.77 0.56
N
6 295 40 13 2
N
2 241 94 17 2
N
4 228 80 20 24
%
1.12 64.05 22.47 5.62 6.74
*Positive values indicate le tip short of major foramen. Negative values indicate le tip beyond major foramen; DMFF, the distance of the major foramen to the le tips. DMFF, distance between the major foramen and the le tips.
TABLE 3. Morphological Features of the Minor Foramen Area (mm2)

Minimum Maximum Median Q1 (25%) Q3 (75%) 0.015 0.943 0.063 0.044 0.090
Mean diameter (mm)

0.134 1.086 0.276 0.232 0.332
Wide diameter (mm)

0.150 1.342 0.316 0.269 0.407
Narrow diameter (mm)

0.112 0.934 0.238 0.197 0.289
Perimeter (mm)
0.439 3.611 0.906 0.766 1.105
Roundness
1.00 1.91 1.03 1.01 1.07
TABLE 4. Results of Linear Regression of Morphological Features as the Inuencing Factors Root ZX b
Area Wide diameter Narrow diameter Location 1.615 0.080
Raypex 5 p
0.003 0.004
Elements Apex Locator p

0.011 0.008 0.009
95% CI
1.454-1.775 0.118 to 0.042
B
0.799 0.714 0.061
95% CI
0.185-1.413 0.185- 1.243 0.107 to 0.016
b
3.106 0.879 0.128
95% CI
2.218-3.994 0.323-1.435 0.202 to 0.054
p
0.002 0.001 0.002
If the linear relationship is not statistically signicant, it is represented as . CI, 95% condence interval; b, coefcient of regression.
be attributed to the number and category of teeth and different research methods used in different studies (1, 2, 17). The DMFFs determined by the same EAL varied among the teeth although all measurements were conducted under the same condition. Huang (18) stated that the moisture content in root canals and the diameter of the apical foramen are two main factors inuencing the performance of EALs. In the present study, the DMFF determined by the Root ZX was found to increase as the minor foramens area increased, which was in accordance with previous studies. In a laboratory study with glass tubules, Fan et al (24) found that the increase of the tubule diameter decreased the accuracy of the Root ZX when the tubules were lled with electrolytes. Ebrahim et al (25) relocated the smallest diameter of the canal to the major foramen and reported that the measured length by the Root ZX became shorter as the average diameter of the root canal increased. In an ex vivo study, Herrera et al (21) enlarged the apical constriction to three different sizes and reported that the precision of Root ZX decreased as the average diameter of the apical constriction increased. Using histologic assessment, Stein et al (19) found the le tips determined by Neosono-D (Amadent Medical and Dental Corp., Cherry Hill, NJ) deviated from the major foramen as its diameter increased but were not affected by the diameter of minor foramen. The disparity might be explained as the results of different methods used to measure the parameters of the minor foramen as well as the different EALs used in these studies. The DMFFs determined by the Raypex 5 were found to increase as the area and 1402
narrow diameter of the minor foramen increased, and the DMFFs determined by the Elements Apex Locator varied along with the area and wide diameter of the minor foramen. The difference among the three EALs might be caused by their design concepts for processing the impedance from electrical currents. Root ZX calculates the ratio of impedances generated from alternating currents with 8-kHz and 0.4-kHz frequencies. Raypex 5 makes use of the same frequencies of alternating currents but bases the measurement on the mean square root values of the electrical signals. Elements Apex Locator is designed to compare the resistance and capacitance elements of the impedance separately with a built-in database to determine the le tips location (1, 2, 6). As for the major foramens location, the nding of this study was supported by the research of Pagavino et al (10). The le tips were determined much closer to the major foramen in teeth with a lateral major foramen when three EALs gave the minor foramen reading. They also stressed that the DMFFs would be slightly over calculated if the most coronal border of major foramen was considered as the apical reference in the case of lateral foramina. According to the study of Meredith and Gulabivala (26), the impedance in a root canal was a complex electrical network comprising resistive and capacitive series and parallel elements. Nekoofar et al. (6) stated that the impedance within root canal varied with the shape of the canal. Therefore, it is worth investigating in the further study, whether the morphological features of the apical foramen would exert inuence on the intra-canal impedance, and then on the performance of EALs.
Ding et al.
Under the conditions of this ex vivo study, the ability of three EALs to detect the minor foramen was found to be signicantly different. When the minor foramen reading was given, the le tips determined by the Root ZX were much closer to the major foramen than when the Raypex 5 and Elements Apex Locator were used. The minor foramens morphology and the major foramens location were both important inuencing factors on the performance of EALs.
12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. and Apex Locator, and RomiAPEX D-30. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2007;104:e914. Pascon EA, Marrelli M, Congi O, et al. An ex vivo comparison of working length determination by 3 electronic apex locators. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2009;108:e14751. Ounsi HF, Naaman A. In vitro evaluation of the reliability of the Root ZX electronic apex locator. Int Endod J 1999;32:1203. Akisue E, Gavini G, de Figueiredo JA. Inuence of pulp vitality on length determination by using the Elements Diagnostic Unit and Apex Locator. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2007;104:e12932. Martinez-Lozano MA, Forner-Navarro L, Sanchez-Cortes JL, et al. Methodological considerations in the determination of working length. Int Endod J 2001;34: 3716. Plotino G, Grande NM, Brigante L, et al. Ex vivo accuracy of three electronic apex locators: Root ZX, Elements Diagnostic Unit and Apex Locator and ProPex. Int Endod J 2006;39:40814. ElAyouti A, Lost C. A simple mounting model for consistent determination of the accuracy and repeatability of apex locators. Int Endod J 2006;39:10812. Huang L. An experimental study of the principle of electronic root canal measurement. J Endod 1987;13:604. Stein TJ, Corcoran JF, Zillich RM. Inuence of the major and minor foramen diameters on apical electronic probe measurements. J Endod 1990;16:5202. Fouad AF, Rivera EM, Krell KV. Accuracy of the Endex with variations in canal irrigants and foramen size. J Endod 1993;19:637. Herrera M, Abalos C, Planas AJ, et al. Inuence of apical constriction diameter on Root ZX apex locator precision. J Endod 2007;33:9958. Cheung GS, Yang J, Fan B. Morphometric study of the apical anatomy of C-shaped root canal systems in mandibular second molars. Int Endod J 2007;40:23946. Vajrabhaya L, Tepmongkol P. Accuracy of apex locator. Endod Dent Traumatol 1997;13:1802. Fan W, Fan B, Gutmann JL, et al. Evaluation of the accuracy of three electronic apex locators using glass tubules. Int Endod J 2006;39:12735. Ebrahim AK, Yoshioka T, Kobayashi C, et al. The effects of le size, sodium hypochlorite and blood on the accuracy of Root ZX apex locator in enlarged root canals: an in vitro study. Aust Dent J 2006;51:1537. Meredith N, Gulabivala K. Electrical impedance measurements of root canal length. Endod Dent Traumatol 1997;13:12631.
Acknowledgments
The authors thank Professor Dong-E Chen for her assistance in the statistical part of this research.
References
1. Kim E, Lee SJ. Electronic apex locator. Dent Clin North Am 2004;48:3554. 2. Gordon MP, Chandler NP. Electronic apex locators. Int Endod J 2004;37:42537. 3. Ricucci D, Langeland K. Apical limit of root canal instrumentation and obturation, part 2. A histological study. Int Endod J 1998;31:394409. 4. Wu MK, Wesselink PR, Walton RE. Apical terminus location of root canal treatment procedures. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2000;89:99103. 5. Kobayashi C. Electronic canal length measurement. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1995;79:22631. 6. Nekoofar MH, Ghandi MM, Hayes SJ, et al. The fundamental operating principles of electronic root canal length measurement devices. Int Endod J 2006;39:595609. 7. Tselnik M, Baumgartner JC, Marshall JG. An evaluation of root ZX and elements diagnostic apex locators. J Endod 2005;31:5079. 8. Wrbas KT, Ziegler AA, Altenburger MJ, et al. In vivo comparison of working length determination with two electronic apex locators. Int Endod J 2007;40:1338. 9. Briseno-Marroquin B, Frajlich S, Goldberg F, et al. Inuence of instrument size on the accuracy of different apex locators: an in vitro study. J Endod 2008;34:698702. 10. Pagavino G, Pace R, Baccetti T. A SEM study of in vivo accuracy of the Root ZX electronic apex locator. J Endod 1998;24:43841. 11. Bernardes RA, Duarte MA, Vasconcelos BC, et al. Evaluation of precision of length determination with 3 electronic apex locators: Root ZX, Elements Diagnostic Unit
1403
Development of Virtual Simulation Platform for Investigation of the Radiographic Features of Periapical Bone Lesion
Yuan Gao, DDS, PhD,* Markus Haapasalo, DDS, PhD, Ya Shen, DDS, PhD, Hongkun Wu, DDS, PhD,* Huiyong Jiang, MD, and Xuedong Zhou, DDS, PhD*
Abstract
Introduction: The periapical radiograph is used as an important tool in the assessment of periapical bone lesions in endodontic therapy. The purpose of this study was to develop a virtual simulation platform for radiographic research of periapical bone lesions based on a digitally reconstructed radiograph and to investigate the radiographic features of different simulated periapical bone lesions. Methods: A cadaver mandible was scanned by microcomputed tomography. The application framework for the creation of a digitally reconstructed radiograph with virtual periapical lesions was constructed. Subsequently, different size and shape periapical lesions were created virtually in an incisor, a premolar, and a molar, and the digitally reconstructed radiographs were produced. Result: The detection of periapical lesions based on digitally reconstructed radiographs was depended on lesion size, position, shape, and tooth position. Virtual periapical lesions could not be visualized with lesions smaller than 1 mm in the incisor, 2 mm in the premolar, and 3 mm in the molar, and these virtual lesions were conned within the cancellous bone. A 4-mm lesion in the molar was still not visualized even if it encroached on the cortical bone. If the lesions encroached on the junctional trabeculae and cortical bone or the lesion was created with the maximal buccal-lingual dimension in ellipsoid shape and conned within the cancellous bone giving it an abnormal shape, it could be seen, except for the thinnest 1-mm lesion in incisor region. Conclusions: The virtual simulation platform described here provides a reproducible assessment of periapical lesions and aids in a better understanding of the characteristics of periapical lesions. (J Endod 2010;36:14041409)
Key Words
Digitally reconstructed radiograph, periapical bone lesions, radiography, virtual simulation
he periapical radiograph is used as an important tool in the assessment of periapical bone pathology (1, 2). Several studies have reported that routine periapical radiography does not always reliably reect the presence of a lesion and does not show the real size of a lesion and its spatial relationship with anatomic structures (35). Thus, more advanced radiographic techniques for the detection of periapical lesions have been used in dentistry, including digital radiography, densitometry methods, cone beam computed tomography (CBCT), magnetic resonance imaging, ultrasound, and nuclear techniques (610). Despite the advantage of these techniques and equipments, the apical radiograph may nonetheless be the primary diagnostic tool available to most clinicians. The recognition and understanding of the radiographic features of periapical lesions will help in the diagnosis and treatment planning of endodontic infections and in control and evaluation of healing. Most studies of experimentally created periapical lesions have frequently led to the conclusion that the lesions are visible in the radiographs only if the junction of the cortex and cancellous bone is eroded (4, 11). In contrast to these studies, Shoha et al (12) reported that experimental lesions associated with human mandibular premolars and conned to cancellous bone only could be detected radiographically. These classic experiments in the past several decades used dry or wet maxillas or mandibles and created articial periapical lesions by drills or burs and then investigated the radiographic features of the lesions. However, the size of articial periapical lesions within the bone by drill or bur cannot be controlled easily and precisely in three-dimensional levels, and the boundary or transitional zone between cortical and cancellous bone can seldom be accurately dened (5). Therefore, it is difcult to compare the conclusions by various authors, in particular regarding lesions located in the transitional (or junction) area between cortical and cancellous bone (6). In recent years, the digitally reconstructed radiograph has become an important tool in radiotherapy treatment planning, treatment verication, and computer-aided surgery (13). The digitally reconstructed radiograph, also called a simulated x-ray image, is a direct ray casting technique that consists of simulating x-rays passing through the reconstructed computed tomography (CT) volume based on the optical absorption model, thus generating an x-ray like image. According to the principle of digitally reconstructed radiographs, it is possible to get a simulated dental x-ray image without taking a real radiograph (1315). If a methodology can develop an accurate and reproducible simulated periapical lesion and produce a radiograph of it, then a correlation between the radiographic features and three-dimensional morphological characteristics of periapical lesions can be established to achieve an accurate, simulated evaluation of the lesions, which
From the *State Key Laboratory of Oral Diseases, West China College and Hospital of Stomatology, Sichuan University, Chengdu, China; Division of Endodontics, Department of Oral Biological and Medical Sciences, University of British Columbia, Vancouver, Canada; and Anatomy Laboratory, Medical College, Jiujiang University, Jiujiang, China. Supported by the Open Research Fund Program of the State Key Laboratory of Oral Diseases of China (grant no. SKLOD008) and the Youth Fund Program of Sichuan University (grant No. 2008072). Address requests for reprints to Dr Xuedong Zhou, State Key Laboratory of Oral Diseases, West China College and Hospital of Stomatology, Sichuan University, 14, 3rd section of RenMin Nan Road, Chengdu, China 610041. E-mail address: zhouxd@scu.edu.cn. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.003
1404
Gao et al.
will improve feature recognition leading to better diagnostic accuracy of periapical lesions. Therefore, the purpose of this study was to develop a virtual simulation platform for radiographic research of periapical lesions based on a digitally reconstructed radiograph and investigate the radiographic demonstration of simulated the lesions with variation in lesion size and location. module and the simulated x-ray image of the virtual periapical lesions was calculated by using a ray casting algorithm (13). The matrix size of the simulated x-ray image was 1,081 811 with the pixel size of 37 mm, which corresponds to a size of a simulated x-ray image of 4 3 cm, same as with a real apical radiograph. The simulated x-ray image was generated to correspond to an image obtained by the parallel techniques. The process can be described as the attenuation of virtual x-ray beams emitted from a source; a parallel ray x-ray source was assumed, passing through the mandible with a virtual periapical lesion and ending at a detector. The simulated x-ray images were calculated and displayed in a separate window and saved.

Selection of Specimen and Micro-CT Scanning One male adults (35 years old) mandibular cadaver specimen was obtained from the anatomy laboratory at the Medical School of Jiujiang University. Ethical permission was obtained from the Research Committee of the West China Stomatological Hospital. The specimen was selected on the basis that it was structurally sound and without apical pathology and signs of previous dental treatment in the area. The specimen was stored in 10% formalin before use. The mandible was scanned by using a micro-CT system (m-CT-80; Scanco Medical, Bassersdorf, Switzerland) with an isotropic voxel size of 37 mm at 70 kV and 114 mA. A total of 2,330 cross-sectional slice images in TIFF format were acquired in 2,048 2,048 pixels, and the volume image of the mandibular specimen as cropped into three regions of volume image for the creation of digitally reconstructed radiographs with virtual periapical lesions, including a mandibular incisor, premolar, and molar. Application Framework for the Creation of a Digitally Reconstructed Radiograph with a Virtual Periapical Lesion The MeVisLab package (available from www.mevislab.de/ download/?no_cache=1) provides a visual data-ow program environment on its graphic user interface (16). The graphic user interface contains modules connected by data pipes. Each module encapsulates a specic function; it has a parameter panel providing a control to its functions, whereas the data pipes carry input and output data between them. The modules and data pipes comprise a data-ow framework for creation of digitally reconstructed radiograph with virtual periapical lesions. The main three parts of the creation of digitally reconstructed radiograph with virtual periapical lesions are as follows: Part 1: navigating the position of a bone lesion The image data from the three regions of a mandibular incisor, premolar, and molar were transferred to an image-load module, and the region data were displayed semitransparent with volume rendering. The virtual periapical bone lesion with a given shape was navigated under the apex of interest, and the coordinates of the virtual lesion were recorded for further use. Part 2: creating the virtual periapical bone lesions Virtual lesions of different sizes and coordinates created in part 1 were imported, and the shape of the lesion was set. The virtual lesion eliminated the bony trabeculae and lamina dura around the root apex, but the root was not affected, simulating the halo appearance of naturally occurring lesions according to previous literature (17). The grayscale value of the virtual lesions was obtained from values representing the bone marrow space in the area to mimic the destruction of trabeculae and lamina dura around the root apex. Part 3: creating a digitally reconstructed radiograph of the virtual periapical bone lesions The edited image volumes with virtual periapical lesions were transferred into the digitally reconstructed radiograph projection
Digitally Reconstructed Radiograph of Different Virtual Periapical Lesions and Radiographic Classication According to the previously described application framework and procedure, virtual periapical lesions were created in two ways: (1) the normal way, the lesion was created around the tooth root and the center of the lesion under the root apex with spherical or ellipsoid shape; and (2) the abnormal way, the lesion was created in the cancellous bone with oval shape under the tooth root, and the buccolingual dimension of the lesion was expanded as large as possible without encroaching the junctional and cortical bone. In the apical region of the rst right incisor, ve spherical virtual periapical lesions were created with the diameter of 1 to 5 mm. In the apical region of the second left premolar, six spherical shape virtual periapical lesions were created with a diameter of 1 to 6 mm. In addition, two ellipsoid virtual periapical lesions were created with a buccolingual long axis of 7 and 8 mm and a 6-mm mesiodistal diameter (round shape). In the rst left mandibular molar apical region, six spherical virtual periapical lesions were created with a diameter of 1 to 6 mm. In addition, four ellipsoid virtual periapical lesions were created with a buccolingual long axis of 7 to 10 mm, all with a mesiodistal diameter of 6 mm. All of these virtual periapical lesions created in normal shape. In addition, different-sized ellipsoid virtual periapical bone lesions were created in the cancellous bone with an oval shape under the tooth root in an abnormal shape; the buccal-lingual dimension of the lesion was expanded as large as possible without encroaching the junctional and cortical bone, with a mesiodistal diameter (round shape) of 1, 2, and 3 mm in the incisor and 1, 2, 3, and 4 mm in the premolar and molar. Finally, the digitally reconstructed radiographs of each virtual periapical lesions with different sizes and positions were calculated, and 34 sets of digitally reconstructed radiograph were obtained. Radiolucent areas were classied into three categories: detection/visualization with a denite radiolucency (V), slight or questionable visualization of radiolucency (SQV), and no visualization of any radiolucent areas (NV). The digital radiographic images were evaluated by three endodontists, and the classication was decided by consensus when there was a disagreement initially. All data were processed on a Dell T7400 workstation (Dell Computer Corporation, Round Rock, TX) running on 64-bit Windows XP (Microsoft Corp, Redmond, WA).
Results
A virtual simulation platform was developed for simulation radiography. Virtual periapical lesions of different sizes can be created with accurate dimensions and position, and the corresponding digitally reconstructed radiograph can be generated accordingly as shown in Figures 1 through 4. The detection of the different bone lesions is shown in Table 1. Virtual lesions could not be visualized by the radiographs if the virtual 1405
Virtual Simulation Platform
Figure 1. (A-E) The virtual periapcial bone lesion with a diameter of 1 to 5 mm. The 3D volume-rendering images and digitally reconstructed radiographs of different-sized virtual periapical lesions in the incisor. The left image pair shows the dimension and the relation of periapical lesion with bone, and the right image shows the digitally reconstructed radiograph in each image from A to E. (This gure is available in color online at www.aae.org/joe/.)
periapical lesions were conned within the cancellous structure (Figs. 1A, 2A and, and 3A-D) and created in a normal shape. However, virtual periapical lesions could be seen (Fig. 1B, 2C, and 3E) when normal periapical lesions were enlarged, and they encroached on the junctional trabeculae and cortical bone or when the periapical lesions were created within cancellous structure in an abnormal shape, with the exception of the smallest 1-mm lesion in the incisor region.
Virtual Periapical Bone Lesions with Normal Shape In the incisor region, the 1-mm lesion was conned to cancellous bone, and no radiolucency was detected (Fig. 1A). The outer edges of the 2-mm lesion touched the junctional trabeculae but without obvious cortical involvement, and a slight radiolucency can be observed (Fig. 1B). The 3-mm lesion penetrated into the buccal cortical plate and included half of its thickness (Fig. 1C), whereas the 4- and 5-
Figure 2. (A-H) The virtual periapical bone lesion with a diameter of 1 to 6 mm and 7 to 8 mm in the buccolingual dimension. The 3D volume-rendering images and digitally reconstructed radiographs of different-sized virtual periapical lesions in the premolar. The top image pair shows the dimension and the relation of periapical lesion with bone, and the bottom image shows the digitally reconstructed radiograph in each image from A to H. (This gure is available in color online at www.aae.org/joe/.)
1406
Gao et al.
Figure 3. (A-J) The virtual periapical lesion with a diameter of 1 to 6 mm and 7 to 10 mm in the buccolingual dimension. The 3D volume-rendering images and digitally reconstructed radiographs of different-sized virtual periapical lesions in the molar. The top image pair shows the dimension and the relation of periapical bone lesion with bone, and the bottom image shows the digitally reconstructed radiograph in each image from A to J. (This gure is available in color online at www.aae.org/joe/.)
mm lesions involved the full thickness of the buccal cortical plate and perforated it (Fig. 1D and E). In the premolar region, the lesions with a diameter of 1 and 2 mm were conned to the cancellous bone (Fig. 2A and B). The outer edge of the 3-mm lesion was in contact with the junctional bone with little cortical involvement, and radiolucency was barely observed (Fig. 2C). The 4- to 6-mm lesions (round shape) (Fig. 2D-F) and ellipsoid lesions with a 7-mm long axis (buccolingual) (Fig. 2G) involved the buccal cortical plate from one fourth (0.5 mm) to full thickness (2 mm) of the buccal cortical bone, and 8-mm ellipsoid lesions perforated buccal cortical bone (Fig. 2H). In the molar region, the 1- to 3-mm lesions (Fig. 3A-C) were conned to the cancellous bone, and the 4-mm lesion touched the junctional bone, but no radiolucency was observed (Fig. 3D). The 5-mm lesion (Fig. 3E) penetrated the cortical bone for about 0.5 mm, and radiolucency was observed. The round 6-mm lesion and ellipsoid lesions with a 7- to 9-mm long axis (buccolingual) (Fig. 3F-I) involved the buccal cortical plate from 1 mm to full thickness (2.5 mm). Ellipsoid lesions with a 10mm long axis perforated the buccal cortical bone, and clear radiolucencies could be observed (Fig. 3J).
(maximum buccolingual length without cortical involvement) were detected in the digitally reconstructed radiograph (Fig.4B1-4C1-4), even with the smallest mesiodistal diameter of 1 mm.
Discussion
An understanding of how periapical bone lesions are represented on the radiographic image is fundamental to the use of these images as a diagnostic aid or in designing research involving radiographic images. In this article, a platform for intraoral radiographic simulation of periapical lesions is presented. A digitally reconstructed radiograph is the articial version of an x-ray image, and the digitally reconstructed radiograph module in MeVisLab package was used to create a twodimensional digitally reconstructed radiograph projection of a threedimensional (3D) CT dataset. In 3D CT, the data provide information of the x-ray attenuation of the object (18). Although CT provides a 3D representation of the objects attenuation coefcients and enables the computation of virtual radiographs in any imaging geometry, modern spiral CT, or CBCT devices still provide insufcient spatial resolution for realistic virtual intraoral imaging. Hence, we used micro-CT to generate the digitally reconstructed radiograph, with a resolution similar to conventional periapical radiography. Based on the highresolution micro-CT image, 3D image manipulation techniques by application framework were applied virtually to periapical bone lesion model to facilitate realistic simulation of lesions or other changes that may have taken place between the virtual evaluations. The images showed that the results after these manipulations are similar to those after the removal of local bone or tissue by means of a drill. More 1407
Virtual Periapical Bone Lesions with Abnormal Shape In the incisor region, the entire virtual lesion was conned to cancellous bone (Fig. 4A). No radiolucency was observed when the lesion diameter was only 1 mm (Fig. 4A1). However, lesions with a diameter of 2 mm or more were detected in the digitally reconstructed radiograph although the lesions did not affect cortex (Fig. 4A2-3). In the premolar and molar regions, all lesions with abnormal shape
Figure 4. The 3D volume-rendering images and digitally reconstructed radiographs of different-sized virtual periapical lesions in the incisor, premolar, and molar regions created into an abnormal shape. (A-C) The 3D volume-rendering images with a different-sized periapical bone lesions in the incisor, the premolar, and the molar. The digitally reconstructed radiographs of different-sized virtual periapical lesions: incisor, lesion diameter 1 to 3 mm (A1-A3); premolar, lesion diameter 1 to 4 mm (B1-B4); molar, lesion diameter 1 to 4 mm (C1-C4). (This gure is available in color online at www.aae.org/joe/.)
sophisticated models of tissue modication for dental hard structure can also be performed in this virtual simulation platform. In endodontic radiology education, it would be benecial to simulate radiographic projections to facilitate and in part replace traditional teaching methods. The simulation technique can also be useful when analyzing projections (eg, by observing relevant bone lesion inside the models). This would probably enhance understanding of the characteristics of periapical bone lesions and thus improve the diagnostic accuracy of periapical bone lesions. The contribution of radiography to the diagnosis of periapical bone lesions has been the subject of extensive research. It is common to nd clinical signs of bone disease despite negative radiographic ndings. In these instances, there may be pronounced tissue destruction, but the destroyed tissue is entirely in cancellous bone. Inammatory cells are substituted for marrow cells, a pathologic condition that does not allow detection in a radiograph. Previous investigations of naturally occurring and experimentally created periapical bone lesions had shown that lesions can be distinguished on roentgenograms if they erode the junction area of the cortex and cancellous bone or perforate the cortex because cortical bone contains much more calcium per unit of volume than cancellous bone (3). In the present study, we created the virtual periapical bone lesions in two different shapes. First, the lesion was created around the tooth root and the center of the lesion under the root apex with a spherical or ellipsoid shape, simulating normal shape and position of a periapical lesion. The ndings favor the concept that cortical plate or at the least junctional trabeculae involvement is a prerequisite for the radiographic delectability of periapical lesions in incisor, premolar, and molar region. However, a 4-mm lesion in 1408
the molar region was barely seen despite the involvement of junctional trabeculae. It is possible that a periapical lesion of a certain size can be detected in a region covered by a thin cortex, whereas a similar lesion will not be detected in a region covered by a thicker cortex (19). In addition to normal lesions, we also created a number of untypical lesions entirely conned in cancellous bone to further analyze possibility of detecting such lesions. This may be explained by the fact that the junctional and transitional area between the cortical and cancellous bone as dened in our experiment may not be the same as in earlier studies. We found that the junction area may not exist as an anatomically demonstrable structure; it is the transitional area between cortical and cancellous bone where the marrow spaces become smaller than in the cancellous bone but are still visible in the micro-CT image. However, the distinct boundary cannot be determined because it was reported by van der Stelt (5). In addition, the shape of the articial lesions in the present study was well dened, but with clinical lesions this is often not the case. Some previous studies have also shown that the removal of a large amount of cancellous bone can make a lesion noticeable in certain circumstances (5, 12). In view of the experimental evidence presented, early stages of periapical bone inammation cannot be detected by means of conventional roentgenograms, and the radiographic appearance of different lesions is affected by many factors, including the lesion shape, location, and size. Thus, although early detection of a change is an important step in the assessment of treatment efcacy and patient management, it may be difcult because the changes are subtle. Hopefully, more sensitive technique such as CBCT and DSR will provide more reliable methodology for early detection of periapical pathology (20, 21).
Gao et al.
TABLE 1. Radiographic Detection of Different Virtual Periapical Bone Lesions Periapical bone lesion of normal shape Bone location
Incisor
Periapical bone lesion of abnormal shape Bone lesion size (mm)

1 2 3 1 2 3 4
Bone lesion size (mm)

1 2 3 4 5 1 2 3 4 5 6 7 (B-L long axis) 8 (B-L long axis) 1 2 3 4 5 6 7 (B-L long axis) 8 (B-L long axis) 9 (B-L long axis) 10 (B-L long axis)
Radiolucency
NV SQV V V V NV NV SQV V V V V V NV NV NV NV SQV V V V V V
Radiolucency
NV SQV SQV V V V V
Premolar
Molar
1 2 3 4
V V V V
V, lesion visible; SQV, slight or questionable visualization; NV, lesion not visible; B-L, buccolingual.
The results of the present study have clinical, educational, and research implications. It is important that clinicians and dental students realize the limits of conventional radiographic techniques. Although the results from virtual simulation models cannot always completely extrapolate to the in vivo/patient situation, they can provide valuable insight into the early detection of periapical lesions.
References
1. Stheeman SE, Mileman PA, van t Hof MA, et al. Diagnostic condence and the accuracy of treatment decisions for radiopaque periapical lesions. Int Endod J 1995;28: 1218. 2. Barbat J, Messer HH. Detectability of articial periapical lesions using direct digital and conventional radiography. J Endod 1998;24:83742. 3. Cotti E, Campisi G, Garau V, et al. A new technique for the study of periapical bone lesions: ultrasound real time imaging. Int Endod J 2002;35:14852. 4. Bender IB, Seltzer S. Roentgenographic and direct observation of experimental lesions in bone: 2. J Am Dent Assoc 1961;62:70816. 5. van der Stelt PF. Experimentally produced bone lesions. Oral Surg Oral Med Oral Pathol 1985;59:30612. 6. Huumonen S, rstavik D. Radiological aspects of apical periodontitis. Endodontic Topics 2002;1:325. 7. Cotti E, Campisi G. Advanced radiographic techniques for the detection of lesions in bone. Endodontic Topics 2004;7:5272. 8. Nielsen RB, Alyassin AM, Peters DD, Carnes DL, Lancaster J. Microcomputed tomography: an advanced system for detailed endodontic research. J Endod 1995;21: 5618. 9. Cotton TP, Geisler TM, Holden DT, Schwartz SA, Schindler WG. Endodontic applications of cone-beam volumetric tomography. J Endod 2007;33:112132.
10. Nair MK, Nair UP. Digital and advanced imaging in endodontics: a review. J Endod 2007;33:16. 11. Bender IB, Seltzer S. Roentgenographic and direct observation of experimental lesions in bone: 1. J Am Dent Assoc 1961;62:15260. 12. Shoha RR, Dowson J, Richards AG. Radiographic interpretation of experimentally produced bony lesions. Oral Surg Oral Med Oral Pathol 1974;38: 294303. 13. Li X, Yang J, Zhu Y. Digitally reconstructed radiograph generation by an adaptive Monte Carlo method. Phys Med Biol 2006;51:274552. 14. Pehlivan B, Pichenot C, Castaing M, et al. Interfractional set-up errors evaluation by daily electronic portal imaging of IMRT in head and neck cancer patients. Acta Oncol 2009;48:4405. 15. Thompson CM, Hamilton CS, Vaarkamp J. Thorax set-up verication with multiple oblique treatment portal images. Br J Radiol 2009;82:9505. 16. Gao Y, Peters OA, Wu H, et al. An application framework of three-dimensional reconstruction and measurement for endodontic research. J Endod 2009;35: 26974. 17. Radiographic appearance of articially prepared periapical lesions conned to cancellous bone. Int Endod J 1986;19:6472. 18. Nilsson T, Ahlqvist J, Johansson M, et al. Virtual reality for simulation of radiographic projections: validation of projection geometry. Dentomaxillofac Radiol 2004;33:4450. 19. Estrela C, Bueno MR, Leles CR, et al. Accuracy of cone beam computed tomography and panoramic and periapical radiography for detection of apical periodontitis. J Endod 2008;34:2739. 20. Cotton TP, Geisler TM, Holden DT, et al. Endodontic applications of cone-beam volumetric tomography. J Endod 2007;33:112132. 21. Miguens SA Jr, Veeck EB, Fontanella VR, et al. A comparison between panoramic digital and digitized images to detect simulated periapical lesions using radiographic subtraction. J Endod 2008;34:15003.
1409
Comparison of the Vibringe System with Syringe and Passive Ultrasonic Irrigation in Removing Debris from Simulated Root Canal Irregularities
Tina Rodig, Dr. med. dent,* Meral Bozkurt,* Frank Konietschke, Dr, and Michael Hulsmann, Prof. Dr. med. dent*
Abstract
Introduction: The aim of this study was to compare the efciency of a sonic device (Vibringe), syringe irrigation, and passive ultrasonic irrigation in the removal of debris from simulated root canal irregularities. Methods: Root canals with 2 standardized grooves in the apical and coronal parts were lled with dentin debris. Three different irrigation procedures were performed with NaOCl (1%) and (1) syringe irrigation, (2) Vibringe, and (3) passive ultrasonic irrigation. The amount of remaining debris was evaluated by using a 4-grade scoring system. Results: Ultrasonic irrigation removed debris signicantly better from the articial canal irregularities than the Vibringe System and syringe irrigation (P < .0001). The Vibringe System demonstrated signicantly better results than syringe irrigation in the apical part of the root canal (P = .011). Conclusions: Passive ultrasonic irrigation is more effective than the Vibringe System or syringe irrigation in removing debris. The sonic device demonstrated signicantly better results than syringe irrigation in the apical root canal third. (J Endod 2010;36:14101413)
isinfection of the root canal system by using antimicrobial and tissue-dissolving irrigants is considered an essential part of chemomechanical debridement (1). Residual pulp tissue, bacteria, and dentin debris remain in areas that are routinely left uninstrumented after root canal preparation (2, 3). Reports on the efcacy of irrigation at different coronal-apical levels have been contradictory (4, 5). Therefore, a coronal groove was added to an existing research model (6) to evaluate debris removal not only from apical but also from coronal thirds of the root canal. Conventional syringe irrigation is still widely accepted (3), although its ushing action is not sufcient in removing debris from root canal irregularities (2, 7). Enhancement of the ushing action of irrigants by ultrasound is well-documented (8, 9) and has the potential to remove dentin debris and organic tissue from inaccessible root canal areas (10, 11). Conicting results regarding the effectiveness of sonic or ultrasonic activation of the irrigant to remove smear layer, debris, and bacteria (1214) have been published. Recently, the Vibringe System (Vibringe B. V. Corp, Amsterdam, Netherlands), an irrigation device that combines manual delivery and sonic activation of the solution, has been introduced. The Vibringe is a cordless handpiece that ts in a special disposable 10-mL Luer-Lock syringe that is compatible with every irrigation needle. No data on the effectiveness of this system are available at present. The aim of the present study was to compare the efciency of conventional syringe irrigation, the Vibringe System, and passive ultrasonic irrigation (PUI) in the removal of dentin debris.
Key Words
Debris, irrigation, root canal, sonic, ultrasonic, Vibringe System

Specimen Preparation Ten extracted maxillary lateral incisors with straight roots were decoronated to obtain a standardized root length of 17 mm. The root canals were prepared with FlexMaster (VDW, Munich, Germany) nickel-titanium rotary instruments to a working length (WL) of 16 mm and an apical size of #35/02. Between the instruments, irrigation was performed with 2 mL NaOCl (1%) by using a syringe and a 30-gauge needle (NaviTip; Ultradent, South Jordan, UT). The roots were split longitudinally into 2 halves, allowing subsequent reassembling. A modied nger spreader was inserted into an ultrasonic handpiece (Piezon Master 400; EMS, Nyon, Switzerland) to cut 1 longitudinal groove of 4.0-mm length, 0.2-mm width, and 0.5-mm depth into root canal dentin of each half. The locations of the grooves were 26 mm from WL in one root half (apical section) and 1014 mm from WL in the opposite half (coronal section). This experimental design is based on a previous study (6) and has been used in several investigations concerning the removal of debris (1517). Subsequently, digital photographs of the root halves were taken before and after irrigation from identical angles by using a microscope (MOTIC Ergonomic Trinokular Zoom Stereo Mikroskop; Motic, Wetzlar, Germany) with 30 magnication. Dentin debris was produced by mixing 100 mg dentin chips with 0.175 mL NaOCl (1%) in a standardized ratio to achieve a wet sand-like consistency. Each groove was lled with debris to simulate a clinical situation when dentin debris accumulates in uninstrumented root canal extensions. Subsequently, the root halves were reassembled and xed by using a clamp.
From the )Department of Preventive Dentistry, Periodontology and Cariology, and Centre for Statistics, University of Gottingen, Gottingen, Germany. Address requests for reprints to Dr T. Rodig, Department of Preventive Dentistry, Periodontology and Cariology, University of Gottingen, Robert-Koch-Str. 40, 37075 Gottingen, Germany. E-mail address: troedig@med.uni-goettingen.de. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.023
1410
Rodig et al.
Irrigation Procedures Preliminary experiments had shown that a single specimen could be reused up to at least 5 times without visible damage to the root canal surface. Therefore, the 10 teeth were used repeatedly in the 3 experimental groups. The irrigation procedures were performed consecutively with a random sequence of the specimens. In group 1, irrigation was accomplished with a 10-mL syringe and a 30-gauge needle (NaviTip). In group 2, the irrigant was delivered and sonically activated via the Vibringe System by using a 30-gauge needle (NaviTip) according to manufacturers instructions. In group 3, irrigation was performed with an ultrasonic device (Piezon Master 400) and a stainless steel K-type le size 15 (Endosonore; Maillefer, Ballaigues, Switzerland), with its power set at the 14 of the scale. In all groups a total volume of 20 mL NaOCl (1%) was delivered. The ow rate in groups 1 and 2 was approximately 5 mL/min. In group 3, the delivery rate during PUI with a continuous ush of the irrigant was 10 mL/min. Insertion depth of the needle and the ultrasonic le was 1 mm short of WL in all groups. After irrigation the root halves were separated to take digital photographs of the canal walls. The remaining debris was removed from the grooves, followed by a complete relling of the root canal extensions before the next irrigation procedure. All measures were carried out under a microscope at 30 magnication. Scoring Procedure and Statistical Analysis The amount of remaining debris in the grooves was scored under the microscope with 30 magnication by 2 calibrated dentists with a scoring system described previously (18): 0, the groove is empty; 1, less than half of the groove is lled with debris; 2, more than half of the groove is lled with debris; 3, the complete groove is lled with debris (Fig. 1). Intraobserver reproducibility and interobserver agreement were calculated. In cases of differences, both scores were included in the statistical analysis that was performed with a nonparametric analysis of variance for factorial longitudinal data and the closed testing principle (P = .05).
Results
Interobserver agreement was 90% (k = 0.9057, condence interval = 0.83100.9804), and intraobserver reproducibility was 98% (k = 0.9843, condence interval = 0.96261), with no signicant inuence of the observer (P = .9825). The results of the scoring procedure are presented in Fig. 2 and Table 1. There were statistically significant differences between the experimental groups (P < .0001) and the location of the groove (P < .0001). A signicant interaction between the irrigation protocol and the location of the groove (P = .018) was found. For syringe irrigation and Vibringe System, pairwise comparisons demonstrated signicantly better cleanliness of the apical groove (P = .005; P = .002, respectively). No difference between the grooves was detected for ultrasonics (P = .160), which removed debris significantly better than Vibringe System and syringe irrigation (P < .0001), irrespective of the location of the groove. For the coronal groove, the difference between syringe irrigation and the use of the Vibringe System was not statistically signicant (P = 1). In contrast, the results for the apical groove demonstrated a signicantly better performance for Vibringe System than for syringe irrigation (P = .011). Overall, the cleanliness of the apical groove was signicantly superior in comparison to the coronal groove (P < .0001). None of the specimens irrigated with a syringe showed completely clean articial root canal irregularities without any remaining debris (score 0). Debris was completely removed after irrigation with the Vibringe System in 5% of the specimens and after PUI in 92.5% of the specimens.
Discussion
The design of the present study is comparable to that described by Lee et al (19) and has been used in several other investigations
Figure 1. Standardized debris score for grooves according to van der Sluis et al (18). (A) Score 0: the groove is empty; (B) score 1: less than half of the groove is lled with debris; (C) score 2: more than half of the groove is lled with debris; (D) score 3: the complete groove is lled with debris. Original magnication, 30.
Efciency of Sonic Device, Syringe Irrigation, and PUI in Removal of Debris
1411
rate of the irrigant that enters the apical part of the root canal cannot be standardized (23). Although irrigant ow rate is considered a highly signicant factor determining ow pattern in uid dynamics (24), it is unknown whether it inuenced the performance of ultrasonic irrigation. Controversy exists regarding the removal of debris from different parts of the root canal. Debris removal from the coronal part is considered to be easier than from the apical part (14), whereas other authors found no differences among root canal thirds (25). In this study, a previously described tooth model (6) was modied to determine root canal cleanliness at apical as well as coronal levels. The overall evaluation revealed that cleanliness of the apical groove was superior to cleanliness of the coronal groove. All irrigation devices were placed 1 mm short of WL in close proximity to the location of the apical groove. Therefore, the introduction depth of the needle tip and the distance to the grooves seem to play an important role in the removal of debris, reinforcing the benet of the physical ushing action (4, 26). Although a nal irrigation protocol with apical cleaning as the main goal was tested, both grooves were lled with standardized amounts of debris. It might be speculated that the coronal third is ushed more often with NaOCl during the clinical procedure, resulting in better debridement coronally. The Vibringe System performed similarly to conventional syringe irrigation in the coronal part but removed signicantly more debris in the apical part. A possible explanation is that the oscillation amplitude of the sonically activated irrigation needle is higher at the tip than at the attached end (16, 27), resulting in an increased uid velocity. In the coronal part the larger distance of the needle or le tips to the groove seems to reduce the efcacy of the agitation of the irrigant. In conclusion, the present study showed that none of the tested irrigation devices were able to completely remove debris from articial extensions in straight root canals. PUI removed signicantly more debris than syringe irrigation or a sonically activated device (Vibringe). The Vibringe System performed signicantly better than conventional syringe irrigation in the apical part of the root canal.
Figure 2. Frequencies of pooled evaluations for investigator and root half. Readings were generated from 20 root halves per group scored by 2 observers, resulting in 40 readings per irrigation procedure (40 grooves).
(15, 17, 18, 20). The advantage of the groove model is the standardized size and location of the grooves, allowing a consistent evaluation with high intraobserver reproducibility and good interobserver agreement. Because the needle tip and the ultrasonic le do not have a physical effect on the debris in the groove, the ushing action of the irrigant is the main factor for debris removal. The major disadvantage of this model is that the standardized grooves do not represent the complexity of a natural root canal system. Therefore, it might be easier to remove dentin debris from articial grooves than from isthmuses or oval extensions in vivo, resulting in an overestimation of the removal efciency of different irrigation techniques. The results indicated that PUI removed signicantly more debris from root canal irregularities than the sonically activated Vibringe System and syringe irrigation. A more effective removal of debris with ultrasonic irrigation compared with sonic activation has been demonstrated (12, 14, 16), which could be due to the higher driving frequency of ultrasound (30 kHz) in comparison to the sonic device (150 Hz). Therefore, the ow velocity and the cleaning efciency are lower for sonically activated irrigation (14, 21), resulting in less effective delivery of irrigant to the root canal extensions. The general consensus that ultrasonic irrigation is more effective than syringe irrigation in removing remnants of debris (11, 19, 22) is conrmed by the results of the present study. The percentages of complete debris removal (score 0) for sonic and ultrasonic irrigation were 5% and 92.5%, respectively. These results are in agreement with a recent study that reported on 5.5% 6.7% completely clean root canals after sonic irrigation and 89% after ultrasonic irrigation (16). In this study, the ow rate was approximately 5 mL/min for conventional manual or sonically activated irrigation and 10 mL/min for PUI. During PUI with a continuous ush, the volume and ow
TABLE 1. Frequency Distribution of Debris Score by Experimental Groups and Location of the Groove Score Group
Syringe Vibringe Ultrasonics
References
1. Haapasalo M, Endal U, Zandi H, Coil J. Eradication of endodontic infection by instrumentation and irrigation solutions. Endodontic Topics 2005;10:77102. 2. Wu MK, Wesselink PR. A primary observation on the preparation and obturation of oval canals. Int Endod J 2001;34:13741. 3. Peters OA. Current challenges and concepts in the preparation of root canal systems: a review. J Endod 2004;30:55967. 4. Huang TY, Gulabivala K, Ng YL. A bio-molecular lm ex-vivo model to evaluate the inuence of canal dimensions and irrigation variables on the efcacy of irrigation. Int Endod J 2008;41:6071. 5. Wu MK, Wesselink PR. Efcacy of three techniques in cleaning the apical portion of curved root canals. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1995;79: 4926. 6. Lee SJ, Wu MK, Wesselink PR. The efcacy of ultrasonic irrigation to remove articially placed dentine debris from different-sized simulated plastic root canals. Int Endod J 2004;37:60712. 7. Cunningham WT, Martin H, Forrest WR. Evaluation of root canal debridement by the endosonic ultrasonic synergistic system. Oral Surg Oral Med Oral Pathol 1982;53: 4014. 8. Stock CJ. Current status of the use of ultrasound in endodontics. Int Dent J 1991;41: 17582. 9. van der Sluis LW, Versluis M, Wu MK, Wesselink PR. Passive ultrasonic irrigation of the root canal: a review of the literature. Int Endod J 2007;40:41526. 10. Gutarts R, Nusstein J, Reader A, Beck M. In vivo debridement efcacy of ultrasonic irrigation following hand-rotary instrumentation in human mandibular molars. J Endod 2005;31:16670. 11. Passarinho-Neto JG, Marchesan MA, Ferreira RB, Silva RG, Silva-Sousa YT, SousaNeto MD. In vitro evaluation of endodontic debris removal as obtained by rotary instrumentation coupled with ultrasonic irrigation. Aust Endod J 2006;32:1238.
Location of the groove

Coronal Apical Coronal Apical Coronal Apical
0
0 0 0 2 17 20
1
3 10 5 15 3 0
2
13 10 9 3 0 0
3
4 0 6 0 0 0
Readings were pooled for both observers. Score 0: groove is empty; score 1: less than half of groove is lled with debris; score 2: more than half of groove is lled with debris; score 3: complete groove is lled with debris.
1412
Rodig et al.
12. Stamos DE, Sadeghi EM, Haasch GC, Gerstein H. An in vitro comparison study to quantitate the debridement ability of hand, sonic, and ultrasonic instrumentation. J Endod 1987;13:43440. 13. Jensen SA, Walker TL, Hutter JW, Nicoll BK. Comparison of the cleaning efcacy of passive sonic activation and passive ultrasonic activation after hand instrumentation in molar root canals. J Endod 1999;25:7358. 14. Sabins RA, Johnson JD, Hellstein JW. A comparison of the cleaning efcacy of shortterm sonic and ultrasonic passive irrigation after hand instrumentation in molar root canals. J Endod 2003;29:6748. 15. van der Sluis LW, Wu MK, Wesselink PR. The efcacy of ultrasonic irrigation to remove articially placed dentine debris from human root canals prepared using instruments of varying taper. Int Endod J 2005;38:7648. 16. Jiang LM, Verhaagen B, Versluis M, van der Sluis LW. Evaluation of a sonic device designed to activate irrigant in the root canal. J Endod 2010;36:1436. 17. van der Sluis LW, Wu MK, Wesselink PR. A comparison between a smooth wire and a K-le in removing articially placed dentine debris from root canals in resin blocks during ultrasonic irrigation. Int Endod J 2005;38:5936. 18. van der Sluis LW, Wu MK, Wesselink PR. The evaluation of removal of calcium hydroxide paste from an articial standardized groove in the apical root canal using different irrigation methodologies. Int Endod J 2007;40: 527. 19. Lee SJ, Wu MK, Wesselink PR. The effectiveness of syringe irrigation and ultrasonics to remove debris from simulated irregularities within prepared root canal walls. Int Endod J 2004;37:6728. 20. van der Sluis LW, Wu MK, Wesselink P. Comparison of 2 ushing methods used during passive ultrasonic irrigation of the root canal. Quintessence Int 2009;40: 8759. 21. Ahmad M, Pitt Ford TR, Crum LA, Walton AJ. Ultrasonic debridement of root canals: acoustic cavitation and its relevance. J Endod 1988;14:48693. 22. Cheung GS, Stock CJ. In vitro cleaning ability of root canal irrigants with and without endosonics. Int Endod J 1993;26:33443. 23. van der Sluis LW, Gambarini G, Wu MK, Wesselink PR. The inuence of volume, type of irrigant and ushing method on removing articially placed dentine debris from the apical root canal during passive ultrasonic irrigation. Int Endod J 2006;39:4726. 24. Tilton JN. Fluid and particle dynamics. In: Perry RH, Green DW, Maloney JO, eds. Perrys chemical engineers handbook. 7th ed. New York: McGraw-Hill; 1999:150. 25. Munley PJ, Goodell GG. Comparison of passive ultrasonic debridement between uted and nonuted instruments in root canals. J Endod 2007;33:57880. 26. Abou-Rass M, Piccinino MV. The effectiveness of four clinical irrigation methods on the removal of root canal debris. Oral Surg Oral Med Oral Pathol 1982;54:3238. 27. Ahmad M, Pitt Ford TJ, Crum LA. Ultrasonic debridement of root canals: acoustic streaming and its possible role. J Endod 1987;13:4909.
Efciency of Sonic Device, Syringe Irrigation, and PUI in Removal of Debris
1413
Effects of Storage Temperature on Surface Hardness, Microstructure, and Phase Formation of White Mineral Trioxide Aggregate
Mohammad Ali Saghiri, BSc, MSc,* Mehrdad Lot, DMD, MSc, Morteza Daliri Joupari, PhD, Mohammad Aeinehchi, DMD, MS, and Ali Mohammad Saghiri, BSc, MSck
Abstract
Introduction: Storage temperature inuences the properties of Portland cement during mixing. Because of similarities between Portland cement and mineral trioxide aggregate, the aim of the present study was to evaluate surface microhardness, topography, and phase structure of white mineral trioxide aggregate (WMTA) after storage in a range of temperatures. Methods: Thirty WMTA sachets were divided into 3 groups of 10. The 3 groups were stored at 4 C, 25 C, and 40 C for 48 hours with accompanying ampules. Sachets were immediately mixed after removal from storage according to manufacturers instructions and mixed and packed into cylindrical glass tubes at room temperature. Surface microhardness of each specimen was measured after 3 days. Four specimens from each group were prepared and observed under scanning electron microscope and x-ray diffraction. Data were subjected to one-way analysis of variance and a post hoc Tukey test at P <.05. Results: Mean surface hardness standard deviation after storage at 4 C, 25 C, and 40 C were 25.23 5.99, 53.56 3.28, and 62.89 1.76, respectively. Statistically signicant differences were observed among the groups (P < .001). More voids and a disorganized, ake-like topography were observed in specimens stored at 4 C in comparison with those stored at 25 C and 40 C. X-ray diffraction meter generated similar peaks at 40 C and 25 C, but slight differences were observed at 4 C. Conclusions: This study indicated that storage temperature might inuence surface hardness and microstructure of WMTA. (J Endod 2010;36:14141418)
Key Words
Surface hardness, temperature, white mineral trioxide aggregate
ineral trioxide aggregate (MTA) is currently used for multiple purposes, including pulp capping (1), apexication (2, 3), perforation repair, root-end lling material (4, 5), and for pulpotomy (6) and partial pulpotomy (7). MTA powder contains ne hydrophilic particles that set in the presence of moisture (8) and is a mechanical mixture of Portland cement (75%), bismuth oxide (20%), and gypsum (5%) (9). In addition, a recent study has shown that MTA contains several oxides, including CaO, SiO2, and Al2O3, similar to Portland cement (10). The principal setting process of Portland cement is initiated on contact with water when a chemical reaction between water and cement begins (11). The particle size (12), powder-to-liquid ratio (13), environmental temperature (14, 15), and presence of air in the mixture (16) might all affect the physical properties, progress of hydration, and kinetics of Portland cement. Hydration of MTA produces calcium hydroxide and calcium silicate hydrate gel (C-S-H). C-S-H gel contributes to the strength of cement, and it also contributes to the durability of hydrated cement (17). Some research studies have investigated the effect of environmental conditions on mechanical and physical properties of WMTA, including evaluation of the morphology of WMTA stored under various conditions (18), sealing ability at different pH values (19), surface hardness (20, 21), and setting time (22, 23), to improve the properties of WMTA. Studies have demonstrated that the hydration of Portland cement is sensitive to temperature, and the reaction is exothermic (24, 25). Portland cement and MTA have almost a similar chemical composition. This similarity leads to the speculation that WMTA might possess the same physical properties of Portland cement during hydration. In addition, studies have depicted that storing dental restorative composite in a cool place might increase shelf life (26, 27). Temperature has a great inuence on the physical properties of dental gutta-percha cones (28, 29). WMTA is used worldwide under different climatic conditions, and some dental practitioners store it in the refrigerator alongside dental restorative composites and gutta-percha cones. A search of the literature indicated that few articles have been published on the potential effect of weather conditions on the properties of Portland cement (30, 31). Therefore, the purpose of the present study was to investigate the effect of different storage temperatures on microhardness, surface topography, and phase structure of WMTA.
From the *Department of Biomedical Engineering, Science and Research Branch, Islamic Azad University, Tehran, Iran; Research Center for Pharmaceutical Nanotechnology and Department of Endodontics, Dental Faculty, Tabriz University (Medical Sciences), Tabriz, Iran; National Institute for Genetic Engineering and Biotechnology, Karaj, Iran; Department of Endodontics, Faculty of Dentistry, Azad University of Medical Sciences, Tehran, Iran; and kDepartment of Computer Engineering, Amirkabir University of Technology, Tehran, Iran. Address requests for reprints to Mohammad Ali Saghiri, PhD Student, Department of Biomedical Engineering, Science and Research Branch, Islamic Azad University, Tehran, Iran. E-mail address: saghiri@gmail.com. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.022
1414
Saghiri et al.
This study was divided into 2 parts. In part I, thirty sealed sachets each containing 1 g of WMTA (Tooth-colored formula; Dentsply, Tulsa Dental, OK) along with 30 ampules of sterile water (each weighing 0.3 g) were selected. Sachets and ampules were divided into 3 groups of 10 each accompanied with ampules. All the specimens of the rst group were stored in a refrigerator (Absal Co, Tehran, Iran) at 4 C. The temperature uctuations of the refrigerator were less than 0.5 C in 24 hours. The specimens of the second and third groups were stored at 25 C and 40 C, respectively, in an incubator (ATOI-050, Shanghai All-Time Commercial, Shanghai, China) for 48 hours. The temperature uctuations of the air thermostat were less than 0.1 C in 24 hours. Immediately after being retrieved from the storage environment, each sachet was mixed with its ampule according to manufacturers instructions. Each mixed sachet was packed into a cylindrical glass tube with an internal diameter of 8 mm and a height of 10 mm by using a nonsurgical manual MTA carrier (Dentsply, Tulsa Dental) after the hand condenser (Hu-Friedy, Chicago, IL) was checked to make sure the tip would t the length. One operator condensed WMTA by using hand pressure according to previous studies (32, 33). The lled cylindrical glass tubes were stored at 37 C and 100% relative humidity for 72 hours to ensure that WMTA hardened completely. In part II, the experimental protocol was similar to the one used in a study carried out by Saghiri et al (21). In brief, surfaces containing set WMTA were polished with 600-grit and 1200-grit silicon carbide papers under water cooling to create at surfaces. The polished platforms were rinsed with deionized water for 1 minute and dried with oil-free air for 5 seconds. The Vickers microhardness test was performed for each specimen by using a Clemex CMT microhardness tester (Clemex Technologies Inc, Longueuil, Canada). Three indentations were made on the polished surface. The diagonal lengths of the resulting indentations were measured under a microscope, and the Vickers microhardness value was calculated. The mean value of the hardness was used as the hardness value for each specimen. After 6 indentations were made on surfaces, standard reference material (SRM) blocks were used to calibrate the testing machines. The SRM block was cleaned with ethylene alcohol and a soft wipe material, and 2 indentations were made on it. Then the diagonal lengths were measured, and the machine was adjusted. Differences between the means were analyzed by one-way analysis of variance and a post hoc Tukey test at a signicance level of P <.05. In addition, 4 specimens from each group were selected and prepared for scanning electron microscopy and x-ray diffraction (XRD) for the evaluation of microstructure morphologies and phase structure. The surfaces of 2 samples from each group were sputter-coated and observed under scanning electron microscope (SEM) (Leo 440i; Oxford Microscopy, Oxford, UK) by using secondary electron (SE) and back-scattered electron (BSE) detectors. Two specimens from each group were prepared for XRD. After removing the 2 specimens of WMTA out of the glass tubes, they were milled into the powder by mortar and pestle. XRD patterns were recorded with the XRD device (Seifert XRD 3000; Seifert Co, Ahrensburg, Germany; Co-Ka radiation). Samples were scanned at a range of 090, and data were collected in a continuous scan mode at a scanning rate of 4 /min. Subsequently in each of the 3 groups, crystalline phases of WMTA after hydration were determined by XRD analysis. respectively (P < .001). Post hoc Tukey test revealed signicant differences among all the groups (P < .001) (Fig. 1).
SEM Analysis SEM micrographs are displayed in Fig. 2. SE detector revealed that uniform needle-shaped crystals predominantly covered the surfaces of the 25 C and 40 C groups; however, needle-shaped crystals were not found on the surface of the specimens stored at 4 C. BSE detector illustrated that the uniformity had disappeared, and more voids and bubbles were observed at 4 C samples compared with other groups. In addition, agglomeration of ne particles of C-S-H gel was observed. The surfaces of group I specimens (4 C) showed that anhydrate particles were bare, with irregular particles lying on top (Fig. 2a, b). BSE and SE detectors revealed that the surfaces of the cement particles were still bare, but lumps and platelets had formed in addition to the fragments already present on the anhydrate particles. Fig. 2c, d shows that group II specimens (25 C) consisted of needle-like protruding structures and regular structures on top of homogeneity. Fig. 2e, f shows that group III specimens (40 C) consisted of uniform hexagonal structures and interlocking solids. Phase Composition XRD results of WMTA samples stored at 4 C, 25 C, and 40 C are presented in Fig. 3. The same main constituent phases were observed in WMTA diffractograms in the 3 groups. Patterns of groups II and III (25 C and 40 C) were similar; however, for group I (4 C) the intensity of the peak decreased at 2q = 29.3 and increased at 2q = 47.2 .
Discussion
In this study, the 40 C conditions were selected to simulate tropical conditions; 4 C was selected to consider cool conditions such as refrigerator, and the room temperature (25 C) was selected as control. SE and BSE detectors have been successfully used in several studies to evaluate surface topography and some deeper parts of cements (21, 34). In the current study, applying these 2 SEM methods provided a better opportunity to understand structural differences of WMTA at different temperatures. This ability is attributed to the fact that higher
Results
Microhardness Mean surface hardness standard deviation after storage at 4 C, 25 C, and 40 C were 25.23 5.99, 53.56 3.28, and 62.89 1.76,
Figure 1. Box plots of hardness values in each group stored at 4 C (I), 25 C (II), and 40 C (III), which illustrate the mean standard deviation, minimum and maximum amount of hardness values, as well as the variance in each experimental group. (This gure is available in color online at www.aae.org/joe/.)
Effects of Storage Temperature on Surface Hardness, Microstructure, and Phase Formation of WMTA
1415
Figure 2. SEM images of specimens stored at 4 C (I), 25 C (II), 40 C (III), BSE and SE, respectively. More voids (<) can be seen on the surface of WMTA stored at 4 C (group I) in addition to uniform hexagonal (/)structures and interlocked solids stored at 40 C (original magnication, 1000). (This gure is available in color online at www.aae.org/joe/.)
atomic elements appear brighter in BSE, so that differences in the gray level observed in hardened cement paste allow the distinction, in descending order, of brightness between anhydrous phases, calcium hydroxide, C-S-H gel, and porosity (3436). XRD system has been widely used as a nondestructive analysis to identify the phase composition of materials. WMTA is a complex material, and its hydration possibly provides additional complexity. In fact, no single method exists that completely determines all the chemical reactions taking place in a WMTA structure from the mixing and onward. Therefore, several complementary techniques must be used. Studies have indicated that storage of Portland cement in cool conditions leads to the extension of initial setting time, potential of plastic shrinkage, and crack formation (37). Low powder-to-liquid ratios, short setting time, and the presence of defects all lead to lower strengths (30, 38). A previous study (24) has speculated on the possible mechanisms mediating the effect of temperature and has reported that at low temperatures hydration starts very slowly, allowing the dissolved ions more time for diffusion before the hydrates precipitate, resulting in a less 1416
dense CSH. In addition, this study (31) reported that in the case of increased temperature, fast hydration might occur, leading to a greater interlocking solid state of hydration products and building up of a dense mass. With knowledge of the initial setting time and primary mechanical strength, dental practitioners would be able to plan treatment completion. By storing WMTA below 4 C, for example in a refrigerator with other dental materials such as dental composite and gutta-percha cones, adverse effects might ensue. Up to now some research studies (22, 39, 40) have tried to improve WMTA properties by adding some ingredients to it; however, the current study shows that surface hardness and surface topography of WMTA could be amended without any additives. It also shows that lowering storage temperature might decrease microhardness of WMTA as well. Some previous studies (17, 41, 42) have shown the suitability and reliability of XRD test for evaluating hydration of MTA. XRD structural analysis results revealed that specimens in both 25 C and 40 C groups were completely crystalline and showed similar patterns. The results of XRD analysis of WMTA cement are consistent with previous results
Saghiri et al.
Figure 3. XRD patterns of WMTA stored at 4 C (I), 25 C (II), and 40 C (III), indicating presence of the same main constituents (same phases in the materials composition after hydration; however, the intensity of the peak at 2q = 29.3 for 4 C group decreased). (This gure is available in color online at www.aae.org/joe/.)
reported by Islam et al (43) and Camilleri et al (18). XRD showed a diffraction peak at 2q = 29.3 , which is ascribed to C3S and C-S-H phases, the main binding phases in the Portland cementbased system (44). In group I (4 C) the intensity of the peak at 2q = 29.3 decreased, which might be attributed to lower C-S-H content in the nal hydrated product leading to harmful effects on hydration reaction such as higher setting time (45). Despite lack of signicant differences in XRD patterns, the microhardness values of the 3 groups revealed signicant differences. These ndings probably can be attributed to the inuence of storage temperature on the exothermic reaction of the cement during hydration, which might affect physical properties of WMTA to some extent. The authors attributed this phenomenon to the exothermic nature of hydration reactions versus the storage temperature, leading to decreases or increases in hexagonal (needle-like) shapes and porosity in the bulk of WMTA. In summary, at increased temperatures a regular shape was formed, and the total porosity of the cement decreased, which might produce a mechanical resistance against the indenter penetration and consequently altered microhardness.
WMTA are affected by storage temperature. Observations after the storage of WMTA at high temperatures suggest that its leakage might be less than that of WMTA stored at room temperature. Because there is no published report on these issues, further investigation is recommended.
Acknowledgments
This article was based on the thesis presented by the rst author to the Faculty of Biomaterials at Azad University Science and Research Branch of Tehran, Iran, in partial fulllment to the requirements for PhD in Biomaterial Engineering. We are indebted to Professor Kamal Asgar for the provision of laboratory facilities in the Department of Dental and Biological Materials at the University of Michigan. Also special thanks to Drs Alireza Vosoughhosseini, Houtan Aghili, Mohammad Saghiri, HajarAfsar Ladjvardi, Sahar Dadvand, Kasra Karamifar, and Majid Abdolrahimi for all of their contributions to this research.
Conclusions
The main conclusions extracted from this investigation can be summarized as follows. Surface microhardness and total porosity of cement paste are drastically affected by the storage temperature. In the case of storage at higher temperatures, the hydrates are more homogeneously distributed, which results in not only smaller pores but also better interlocking of the different phases. In addition, needle-like structures would form, leading to better interlocking of the solids. Lower storage temperatures were found to increase the hardness of the coarse porous surface, which could also be lowered by a weaker interlocking between the hydrate products caused by their more heterogeneous distribution and the presence of very short needles. In addition, porosity generally correlates negatively with measured surface hardness, ie, surface hardness increases with decreasing porosity. The lower surface hardness observed at decreased storage temperatures is probably mainly caused by the observed increase in porosity. Furthermore, the room temperature or higher temperatures up to 40 C seem to provide appropriate thermal conditions for WMTA storage because at these temperatures the cements microhardness is suitable for clinical use with desirable hydration value. Only a handful of studies support ambient temperatures for storing WMTA; the results of this study cannot be extrapolated to clinical success of WMTA as a root-end lling material because it merely represents how microhardness, topographic image, and phase structure of
References
1. Aeinehchi M, Eslami B, Ghanbariha M, Saffar AS. Mineral trioxide aggregate (MTA) and calcium hydroxide as pulp-capping agents in human teeth: a preliminary report. Int Endod J 2003;36:22531. 2. Steinig TH, Regan JD, Gutmann JL. The use and predictable placement of mineral trioxide aggregate in one-visit apexication cases. Aust Endod J 2003;29:3442. 3. Levenstein H. Obturating teeth with wide open apices using mineral trioxide aggregate: a case report. SADJ 2002;57:2703. 4. Torabinejad M, Watson T, Pitt Ford T. Sealing ability of a mineral trioxide aggregate when used as a root end lling material. J Endod 1993;19:5915. 5. Torabinejad M, Smith P, Kettering J, Pitt Ford T. Comparative investigation of marginal adaptation of mineral trioxide aggregate and other commonly used root-end lling materials. J Endod 1995;21:2959. 6. Witherspoon DE, Small JC, Harris GZ. Mineral trioxide aggregate pulpotomies: a case series outcomes assessment. J Am Dent Assoc 2006;137:6108. 7. Barrieshi-Nusair K, Qudeimat M. A prospective clinical study of mineral trioxide aggregate for partial pulpotomy in cariously exposed permanent teeth. J Endod 2006;32:7315. 8. Parirokh M, Torabinejad M. Mineral trioxide aggregate: a comprehensive literature reviewpart I: chemical, physical, and antibacterial properties. J Endod 2010;36: 1627. 9. ProRootMTA safety data sheet. Available at: http://store.maillefer.com/lit2/pdfs/ MTA-MSDS-W_01-02C.pdf. Accessed March 10, 2010. 10. Asgary S, Shahabi S, Jafarzadeh T, Amini S, Kheirieh S. The properties of a new endodontic material. J Endod 2008;34:9903. 11. Taylor HFW. Cement chemistry. 2nd ed. London: Thomas Telford; 1997. 12. Osbaeck B, Johansen V. Particle size distribution and rate of strength development of Portland cement. J Am Ceram Soc 1989;72:197201. 13. Bentz DP. Inuence of water-to-cement ratio on hydration kinetics: simple models based on spatial considerations. Cem Concr Res 2006;36:23844.
Effects of Storage Temperature on Surface Hardness, Microstructure, and Phase Formation of WMTA
1417
14. Klieger P. Effect of mixing and curing temperature on concrete strength. ACI J Proc 1958;54:106381. 15. Mouret M, Bascoul A, Escadeillas G. Strength impairment of concrete mixed in hot weather: relation to porosity of bulk fresh concrete paste and maturity. Mag Concrete Res 2003;55:21523. 16. Buenfeld N, Okundi E. Release of air from unsaturated aggregate during setting of concrete. J Construction and Building Materials 1999;13:1437. 17. Camilleri J. Hydration mechanisms of mineral trioxide aggregate. Int Endod J 2007; 40:46270. 18. Camilleri J, Montesin F, Brady K, Sweeney R, Curtis R, Ford T. The constitution of mineral trioxide aggregate. Dent Mater 2005;21:297303. 19. Saghiri MA, Lot M, Saghiri AM, et al. Effect of pH on sealing ability of white mineral trioxide aggregate as a root-end lling material. J Endod 2008;34:12269. 20. Namazikhah MS, Nekoofar MH, Sheykhrezae MS, et al. The effect of pH on surface hardness and microstructure of mineral trioxide aggregate. Int Endod J 2008;41:10816. 21. Saghiri M, Lot M, Saghiri A, Vosoughhosseini S, Aeinehchi M, Ranjkesh B. Scanning electron micrograph and surface hardness of mineral trioxide aggregate in the presence of alkaline pH. J Endod 2009;35:70610. 22. Kogan P, He J, Glickman G, Watanabe I. The effects of various additives on setting properties of MTA. J Endod 2006;32:56972. 23. Huang T, Shie M, Kao C, Ding S. The effect of setting accelerator on properties of mineral trioxide aggregate. J Endod 2008;34:5903. 24. Escalante-Garca JI, Sharp JH. The microstructure and mechanical properties of blended cements hydrated at various temperatures. Cem Concr Res 2001;31:695702. 25. Price WH. Factors inuencing concrete strength. J Aci J Proc 1951;47:41732. 26. de la Torre-Moreno FJ, Rosales-Leal JI, Bravo M. Effect of cooled composite inserts in the sealing ability of resin composite restorations placed at intraoral temperatures: an in vitro study. Oper Dent 2003;28:297302. 27. Bausch JR, Delange C, Davidson CL. The inuence of temperature on some physical properties of dental composites. J Oral Rehabil 2007;8:30917. 28. Friedman C, Sandrik J, Heuer M, Rapp G. Composition and physical properties of gutta-percha endodontic lling materials. J Endod 1977;3:3048. 29. Heuer MA. Instruments and materials. In: Cohen S, ed. Pathways of the pulp. 3rd ed. St Louis, MO: CV Mosby; 1984. 30. Lothenbach B, Winnefeld F, Alder C, Wieland E, Lunk P. Effect of temperature on the pore solution, microstructure and hydration products of Portland cement pastes. J Cement and Concrete Research 2007;37:48391. 31. Escalante-Garcia JI, Sharp JH. Effect of temperature on the hydration of the main clinker phases in Portland cements: part Ineat cements. Cem Concr Res 1998; 28:124557. 32. Watts J, Holt D, Beeson T, Kirkpatrick T, Rutledge R. Effects of pH and mixing agents on the temporal setting of tooth-colored and gray mineral trioxide aggregate. J Endod 2007;33:9703. 33. Aminoshariae A, Hartwell G, Moon P. Placement of mineral trioxide aggregate using two different techniques. J Endod 2003;29:67982. 34. Maso JC. Pore structure and construction materials properties. London, New York: Chapman and Hall; 1987. 35. Scrivener KL, Patel HH, Pratt PL, Parrott LJ. Analysis of phases in cement paste using backscattered electron images, methanol adsorption and thermogravimetric analysis. Mater Res Soc Symp Proc 1987;85:667. 36. Zhao H, Darwin D. Quantitative backscattered electron analysis of cement paste. Cem Concr Res 1992;22:695706. 37. Hua C, Acker P, Ehrlacher A. Analyses and models of the autogenous shrinkage of hardening cement paste: Imodelling at macroscopic scale. Cem Concr Res 1995; 25:145768. 38. Porter M, Berto A, Primus C, Watanabe I. Physical and chemical properties of newgeneration endodontic materials. J Endod 2010;36:5248. 39. Lot M, Vosoughhosseini S, Saghiri MA, Mesgariabbasi M, Ranjkesh B. Effect of white mineral trioxide aggregate mixed with disodium hydrogen phosphate on inammatory cells. J Endod 2009;35:7035. 40. Wiltbank K, Schwartz S, Schindler W. Effect of selected accelerants on the physical properties of mineral trioxide aggregate and Portland cement. J Endod 2007;33: 12358. 41. Belo-Reyes I, Bucio L, Cruz-Chavez E. Phase composition of ProRoot mineral trioxide aggregate by x-ray powder diffraction. J Endod 2009;35:8758. 42. Lee YL, Lee BS, Lin FH, Lin AY, Lan WH, Lin CP. Effects of physiological environments on the hydration behavior of mineral trioxide aggregate. Biomaterials 2004;25: 78793. 43. Islam I, Kheng Chng H, Jin Yap A. Comparison of the physical and mechanical properties of MTA and Portland cement. J Endod 2006;32:1937. 44. Older I. Hydration. In: Hewlett PC, ed. Leas chemistry of cement and concrete. 4th ed. Oxford, UK: Butterworth-Heinemann; 2004. 45. Lin FH, Wang WH, Lin CP. Transition element contained partial stabilized cement (PSC) as a dental retrograde-lling material. Biomaterials 2003;24:21933.
1418
Saghiri et al.
Case Report/Clinical Techniques
Inferior Alveolar Nerve Paresthesia after Overlling of Endodontic Sealer into the Mandibular Canal
Maribel Gonzalez-Martn, PhD, DDS, Daniel Torres-Lagares, PhD, DDS, Jose Luis Gutierrez-Perez, PhD, MD, DDS, and Juan Jose Segura-Egea, PhD, MD, DDS
Abstract
The present study describes a case of endodontic sealer (AH Plus) penetration within and along the mandibular canal from the periapical zone of a lower second molar after endodontic treatment. The clinical manifestations comprised anesthesia of the left side of the lower lip, paresthesia and anesthesia of the gums in the third quadrant, and paresthesia and anesthesia of the left mental nerve, appearing immediately after endodontic treatment. The paresthesia and anesthesia of the lip and gums were seen to decrease, but the mental nerve paresthesia and anesthesia persisted after 3.5 years. This case illustrates the need to expend great care with all endodontic techniques when performing nonsurgical root canal therapy, especially when the root apices are in close proximity to vital anatomic structures such as the inferior alveolar canal. (J Endod 2010;36:14191421)
Key Words
Endodontic complications, paresthesias of the inferior dental nerve
From the Department of Stomatology, School of Dentistry, University of Seville, Seville, Spain. Address requests for reprints to Dr Juan Jose Segura-Egea, Professor of Endodontics, Department of Stomatology, School of Dentistry, University of Seville, C/Avicena s/n, 41009 Seville, Spain. E-mail address: segurajj@us.es. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.03.008
he elimination of all diseased pulp and dentin, adequate cleaning and shaping of the root canal system, and its 3-dimensional obturation and sealing constitute the basic principles of endodontic treatment. Ideally, the lling material should be limited to the root canal without extending to periapical tissues or other neighboring structures. However, overinstrumentation of the root canal with hand or mechanically driven les can perforate the mandibular canal, allowing the extrusion of sealers, dressing agents, and irrigation solutions and the passage of microorganisms into the canal during endodontic treatment (1). Totally biocompatible materials are not available. Consequently, their spread beyond the apical foramen can give rise to clinical manifestations in relation to the toxicity of the product, although minor material extrusions are generally welltolerated by the periradicular tissues (2). Sealers and lling materials differ chemically and include, among others, AH Plus, AH 26, Hydron, Diaket, Iodoform, Calasept, Endoseal, and chloropercha. Some of them can cause serious neurotoxic complications when extruded into the mandibular canal (35). Undesirable complications such as anesthesia, paresthesia, hypoesthesia, hyperesthesia, and dysesthesia can follow the extrusion of an endodontic sealer into the mandibular canal (612). The rst symptom of the overlling into the mandibular canal is sudden pain expressed by the patient during obturation of the root canal, which persists after the disappearance of the local anesthetic effects (13). The pain can be accompanied by local inammatory signs, with the endodontically treated tooth being painful to percussion, painful on palpation of the vestibular alveolar process, or a combination of signs of mechanical lesions and inferior dental nerve inammation with pain or numbness of the lower lip or otalgia (6). Some patients experience the persistence of the local anesthesia (12, 14). The present study describes a case in which endodontic sealer AH Plus spread to the mandibular canal, causing paresthesia and anesthesia in the area of innervation of the inferior alveolar nerve.
Case Report
A 32-year-old woman was referred for root canal treatment in the left second molar tooth because of an apical periodontitis subsequent to caries. The initial diagnosis for the tooth was acute apical abscess (15). She neither smoked nor consumed alcohol and had no personal or family disease antecedents of interest. Two years before, her rst mandibular left molar had been extracted, and an endosseous root-formed implant had been placed, supporting a metal-ceramic crown. After adequate anesthesia and isolation with rubber dam, an endodontic access cavity was established. Three canal orices were dened. After apical patency, the root length was estimated by using an apex detector (AFA Apex Finder; Analytic Technology, Orange County, CA) and then conrmed with a periapical radiograph. The root canal treatment was carried out by involving canal shaping with hand les by using the step-back technique and saline irrigation. After cleaning and shaping, the canal was dried and obturated with AH 26 (Dentsply DeTrey GmbH, Konstanz, Germany) and gutta-percha by using the lateral condensation technique. A small quantity of sealer was introduced into the root canal by using a manual instrument, then the main cone was placed and covered with a minimal quantity of sealer, and cold condensation was performed. Moreover, each additional cone was covered with a minimal quantity of sealer. There were no complications during treatment.
Inferior Alveolar Nerve Paresthesia after Overlling of Endodontic Sealer
1419

Just after endodontic treatment, the postoperative periapical radiograph revealed the presence of radiopaque canal sealer in the mandibular canal (Fig. 1). Nevertheless, the patient was still under the effect of the anesthetic, and she reported no pain or other discomfort after the root canal treatment. The day after, no swelling, redness, or other signs of inammation were observed on intraoral exploration. However, the patient reported numbness on the left side of the lower lip and a tingling sensation in the vestibular gingival and in the lower left premolar and anterior teeth. Extraoral examination likewise failed to identify swelling, alterations in skin color, or adenopathies. The anesthetized zone was delimited by tactile exploration, and anesthesia in the region served by the left inferior alveolar and mental nerve was observed. The buccal gingival tissues over the left mandibular molar and premolar teeth felt no sensation; there was no sensation to thermal or mechanical stimuli in either the left lower lip or buccal gingivae. The lingual gingival tissues responded within normal limits to stimulation with an explorer. A panoramic radiograph was taken (Fig. 2), revealing the presence of radiopaque material (AH Plus) in the periapical area of tooth #18 (universal) and spreading distally along the mandibular canal. After discussing treatment options with the patient, it was decided to monitor the progress with periodic follow-up visits. The patient noticed a very rapid improvement during the rst months after the incident. Seven months later, she showed signicantly less paresthesia, and the anesthesia in the region of the lower left lip was decreased compared with the initial situation. However, there have been no signicant improvements during the subsequent 3 years. The skin anesthesia on the left side of the lower lip persists (Fig. 3), and the radiopaque material in the periapical area of tooth #37 is still radiographically evident (Fig. 4).
Figure 2. Panoramic radiograph taken the day after showing endodontic paste in the periapical zone of tooth #37 and the inferior alveolar canal.
Discussion
Sensory loss or alteration in the territory of the inferior alveolar nerve, the chin region, and lower homolateral half of the lip is a relatively infrequent complication in daily dental practice and is normally the result of an inadequate dental treatment (12). One of the potential iatrogenic causes of this problem is the incorrect treatment of the root canals of a lower molar or premolar (overextension and/or overlling). The proximity of the mandibular canal to the apices of the premolar and molar teeth requires a careful radiographic diagnosis when endodontic treatment of these teeth is planned. An initial pretreatment radiograph of the mandibular teeth will reveal the proximity of the canal to the apices (2). Preventive measures such as the use of an electronic apex detector, the application of a good apical stop, or moderate condensation will help avoid overlling or overextending the endodontic material (11). During endodontic treatment, it is extremely important to address the cleaning and shaping of the apical third accurately, knowing corrected length and width. The use of an electronic apex detector together with a radiograph taken with the les in position will not only ensure the correct working length but also prevent perforation of the canal and possible subsequent damage to the inferior alveolar nerve resulting from the endodontic treatment. In the case reported here, preventive measures were taken. The root length was estimated by using an apex detector and conrmed with a periapical radiograph. Poor length control does not seem to be the obvious cause of the overextension of sealer in this case. Moreover, only a small quantity of sealer was introduced into the root canal by using a manual instrument. The main cone was placed covered with
Figure 1. Post-treatment periapical radiograph. Presence of the extruded root canal sealer in the mandibular canal is evident.
Figure 3. Area of mental nerve anesthesia after 3.5 years is outlined on the skin. (This gure is available in color online at www.aae.org/joe/.)
1420
Gonzalez-Martn et al.

treatment, even though she exhibited complete lip skin anesthesia 3.5 years after the endodontic mishap. This case illustrates the need to expend great care with all endodontic techniques when performing nonsurgical root canal therapy, especially when the root apices are in close proximity to vital anatomic structures such as the inferior alveolar canal.
References
1. Koseoglu BG, Tanrikulu S, Subay RK, Sencer S. Anesthesia following overlling of a root canal sealer into the mandibular canal: a case report. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;101:8036. 2. Poveda R, Bagan JV, Diaz Fernandez JM, Sanchis JM. Mental nerve paresthesia associated with endodontic paste within the mandibular canal: report of a case. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;102:e469. 3. Morse DR. Infection-related mental and inferior alveolar nerve paresthesia: literature review and presentation of two cases. J Endod 1997;23:45760. 4. Tamse A, Kaffe I, Littner MM. Paraesthesia following over extension of AH26: report of two cases and review of the literature. J Endod 1982;8:8890. 5. Rowe AHR. Damage to the inferior dental nerve during or following endodontic treatment. Br Dent J 1983;153:3067. 6. Brodin P, Red A, Aars H, rstavik D. Neurotoxic effects of root lling materials on rat phrenic nerve in vitro. J Dent Res 1982;6:10203. 7. Gatot A, Tovi F. Prednisone treatment for injury and compression of inferior alveolar nerve: report of a case of anesthesia following endodontic treatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1986;62:7046. 8. Kothary P, Cannell H. Bilateral mandibular nerve damage following root canal therapy. Br Dent J 1996;180:18990. 9. Scolozzi P, Lombardi T, Jaques B. Successful inferior alveolar nerve decompression for dysesthesia following endodontic treatment: report of 4 cases treated by mandibular sagittal osteotomy. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;97: 62531. 10. Kaufman AY, Rosenberg L. Paraesthesia caused by Endomethasone. J Endod 1980;6: 52931. 11. Neaverth EJ. Disabling complications following inadvertent overextension of a root canal lling material. J Endod 1989;15:1359. 12. Gallas-Torreira MM, Reboiras-Lopez MD, Garca-Garca A, Gandara-Rey J. Mandibular nerve paresthesia caused by endodontic treatment. Med Oral 2003;8:299303. 13. LaBlanc JP, Epker BN. Serious inferior alveolar nerve dyesthesia alter endodontic procedure: report of three cases. J Am Dent Assoc 1984;108:6057. 14. Grotz KA, Al-Nawas B, de Aguiar EG, Schulz A, Wagner W. Treatment of injuries to the inferior alveolar nerve after endodontic procedures. Clin Oral Invest 1998;2:736. 15. ABE (American Board of Endodontics). Pulpal & periapical diagnostic terminology. Available at: http://www.aae.org/NR/rdonlyres/0A9E773B-506D-4B63-884EDA68381CEAB0/0/ABETerminologyMay2007.doc. Accessed June 2, 2009. 16. Segura JJ, Calvo JR, Guerrero JM, Jimenez-Planas A, Sampedro C. EDTA inhibits in vitro substrate adherence capacity of macrophages: endodontic implications. J Endod 1997;23:2058. 17. Segura JJ, Jimenez-Rubio A. Effect of eugenol on macrophage adhesion in vitro to plastic surfaces. Endod Dent Traumatol 1998;14:724. 18. Jimenez Rubio A, Segura JJ, Jimenez A, Guerrero JM, Calvo JR. In vitro study of the effect of sodium hypochlorite and glutaraldehyde on substrate adherence capacity of macrophages. J Endod 1997;23:5624. 19. Escoda-Francoli J, Canalda-Sahli C, Soler A, Figueiredo R, Gay-Escoda C. Inferior alveolar nerve damage because of overextended endodontic material: a problem of sealer cement biocompatibility? J Endod 2007;33:14849. 20. Peutzfeldt A. Resin composites in dentistry: the monomer systems. Eur J Oral Sci 1997;105:97116. 21. Leonardo MR, Bezerra da Silva LA, Filho MT, Santana da Silva R. Release of formaldehyde by four endodontic sealers. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1999;88:2215. 22. Pulgar R, Segura-Egea JJ, Fernandez MF, Serna A, Olea N. The effect of AH 26 and AH Plus on MCF-7 breast cancer cells proliferation in vitro. Int Endod J 2002;35:5516. 23. Segura-Egea JJ, Jimenez-Rubio A, Pulgar R, Olea N, Guerrero JM, Calvo JR. In vitro effect of the resin component bisphenol A on macrophage adhesion to plastic surfaces. J Endod 1999;25:3414. 24. Serper A, Ucer O, Onur R, Etikan I. Comparative neurototxic effects of root canal materials on rat sciatic nerve. J Endod 1998;24:5924. 25. Carter RB, Keen EN. The intramandibular course of the inferior alveolar nerve. J Anat 1971;108:43340. 26. Loizeaux AD, Devos BJ. Inferior alveolar nerve anomaly. J Hawaii Dent Assoc 1981; 12:101.
Figure 4. Panoramic radiograph taken 3.5 years after the accident showing the persistence of the endodontic paste in the periapical zone of tooth #37 and the inferior alveolar canal.
a minimal quantity of sealer as well as each additional cone. Likewise, root does not seem to be signicantly overlled. However, the clinician did not use a master gutta-percha cone lm before obturation. Experimental studies have shown that eugenol and paraformaldehyde are the main materials causing neurotoxic reactions (3). The irrigation solutions, such as sodium hypochlorite and ethylenediaminetetraacetic acid (EDTA), might leak into the canal and damage the nerve chemically. Cytotoxic effects of EDTA (16), eugenol (17), and hypochlorite (18) have been described. Escoda-Francoli et al (19) suggested that some of the materials used in certain sealer cements, such as calcium tungstate (scheelite [CaWO4]) and zirconium oxide (baddeleyite [ZrO2]), are not totally reabsorbable or innocuous and do not seem to be well-tolerated when overextended beyond the apical foramen. AH Plus is one of the epoxy resin-based root canal sealers most commonly used. The monomer 2,2-bis[4-(2-hydroxy-3-methacrylyloxypropoxy)phenyl]-propane (BisGMA), prepared from bisphenol A and glycidyl methacrylate, is the major ingredient of the epoxy resinbased root canal sealers AH 26 and AH Plus (20). AH 26 cures with the generation of formaldehyde as a by-product, but AH Plus only releases small amounts of formaldehyde (21). However, AH Plus can cause cytotoxic effects (22) when extruded into the mandibular canal (4). Moreover, it has been shown that its component bisphenol A can cause cytotoxic effects (23). Serper et al (24) investigated the neurotoxic effects of the root canal lling materials Endomethasone, N2 Universal, Traitement SPAD, Sealapex, and Calciobiotic Root Canal Sealer on isolated rat sciatic nerves after local application, demonstrating the neurotoxic effects of root canal lling materials. They observed that recovery from chemical insults to nerve structures was relatively slow and was incomplete in the in vitro conditions. A larger and more rapid and appreciable recovery was found with sealers without paraformaldehyde and eugenol, which seems to be less toxic to nervous structures when compared with other compounds containing these substances. In the present case, the buccal gingival tissues over the left mandibular molar and premolar teeth felt no sensation. This could be explained because although the buccal nerve normally supplies these tissues, accessory branches of the inferior alveolar nerve have been described (25, 26). A literature review of paresthesia and anesthesia cases attributable to the extrusion of a root canal sealer indicated that the surgical removal of the sealer from the mandibular canal is an effective treatment and might restore normal sensation in the affected region (9, 19). However, in the present case, the patient did not want surgical
Inferior Alveolar Nerve Paresthesia after Overlling of Endodontic Sealer
1421
Autotransplantation of Teeth with Complete Root Formation: A Case Series

Ji-Hyun Bae, DDS, PhD,* Yong-Hoon Choi, DDS, MSD,* Byeong-Hoon Cho, DDS, PhD,* Young-Kyun Kim, DDS, PhD, and Su-Gwan Kim, DDS, PhD
Abstract
Introduction: Autotransplantation is a viable option for treating missing teeth when a donor tooth is available. This retrospective study reports the success rate for the autotransplantation of 19 molars with complete root formation. Methods: The study enrolled 19 patients (11 men and 8 women) in whom 19 molars were transplanted. The mean age was 38.5 years (range, 19-67). The transplanted third molars were stabilized with a silk suture or wire splint for 2 to 3 weeks. Root canal treatment of the transplanted teeth was performed before surgery in six patients and 1 to 2 weeks after transplantation in 13 patients. Postoperatively, the marginal and periapical conditions were examined clinically and radiographically. Results: In 16 of the 19 cases, the outcome met the success criteria, for an 84% success rate. Conclusions: In autogenous tooth transplantation, even if the donor tooth has complete root formation, a high success rate can be achieved if the cases are selected and treated properly. (J Endod 2010;36:14221426)
Key Words
Autotransplantation, complete root formation, success rate
utogenous tooth transplantation refers to the repositioning of autogenous teeth in another tooth extraction site or a surgically formed recipient site to replace teeth that are, for example, missing congenitally or involve ectopic eruption, severe caries, periodontal disease, trauma, or endodontic failure when a suitable donor tooth is available (1, 2). The success rate of autogenous tooth transplantation in the 1950s was approximately 50% because of the difculty in predicting root development after transplantation and dental root resorption (3, 4). Because too little was known of the causes and prevention of root resorption of transplanted autogenous teeth, the procedure was used infrequently. Since the 1990s, many studies have examined the healing of periodontal tissues and periodontal membrane and dental root resorption, and the transplant success rate increased rapidly, drawing new clinical interest (57). Tsukiboshi (5) reported a 90% survival rate and an 82% success rate for 250 cases observed for 6 years. Lundberg and Isaksson (6) reported a 94% success rate in cases with incompletely formed roots and 84% in cases with completely formed roots and a higher success rate in cases with immature teeth, whereas Majare et al (7) reported a high success rate for cases with mature teeth. Complications of autogenous tooth transplant include root resorption and attachment loss, and its success rate is lower than for implants. Nonetheless, autogenous teeth result in good utilization, the maintenance and regeneration of alveolar bone, and the maintenance of attached gingiva with a natural shape. Hence, the esthetic results are better, the cost is low, one-stage surgery can be used, orthodontic movement is possible, and the procedure can be performed in growing patients (2, 8). Therefore, this retrospective study examined the autotransplantation of mature teeth clinically and radiographically; a case series is reported with a review of the literature.
From the Departments of *Conservative Dentistry and Oral and Maxillofacial Surgery, Section of Dentistry, Seoul National University Bundang Hospital, Seongnam, Republic of Korea; and Department of Oral and Maxillofacial Surgery, School of Dentistry, Chosun University, Gwangju, Republic of Korea. Address requests for reprints to Dr Su-Gwan Kim, Department of Oral and Maxillofacial Surgery, School of Dentistry, Chosun University, 375, SeoSukDong, DongGu, GwangJu City, South Korea. E-mail address: sgckim@chosun.ac.kr. 0099-2399/$0 - see front matter Copyright 2010 American Association of Endodontists. doi:10.1016/j.joen.2010.04.028

This study analyzed the medical records and radiographs of 19 patients (11 men and 8 women) in whom 19 molars with complete root formation were autotransplanted in the Departments of Conservative Dentistry and Oral and Maxillofacial Surgery of Seoul National University Bundang Hospital. The ages of the patients at the time of surgery ranged from 19 to 67 years with a mean age of 38.5 years (Table 1). All of the patients were in good health, and a routine examination found no systemic or local contraindications to surgical treatment. The reasons for the transplantation were dental caries in seven patients; periodontal disease in three patients; cracked teeth and a request for autogenous tooth transplant after tooth extraction in a dental private ofce in two patients each; a vertical root fracture, congenitally missing tooth, and endodontic treatment failure in one patient each; and unknown reasons for extraction in two patients. The donor teeth were all third molars, except one patient in which an upper second molar was used. In all cases, the recipient sites were the rst or second molar areas (Table 2). In this study, the criteria for successful transplantation were as follows (1, 2): 1. The transplanted tooth functioned normally without excessive mobility; however, physiologic mobility was allowed. Tooth mobility was classied as grade I: slightly more than normal, grade II: moderately more than normal, and grade III: severe mobility faciolingually and mesiodistally combined with vertical displacement (9). 2. Clinically, no discomfort and a normal periodontal probing.
1422
Bae et al.

TABLE 1. Patient Age at the Time of Surgery Age
10-19 20-29 30-39 40-49 60-69 Total
M, male; F, female.
Sex
M F M F M F M F M
Number
1 1 1 3 3 1 4 2 3 19
3 to 21 months and averaged 15 months. Prosthetic treatment was performed 3 to 6 months after transplant.
Results
On radiographs taken immediately after the transplantation, the transplanted tooth was seen in a wide tooth extraction socket. Two weeks after the transplantation, the pain and tenderness had decreased although the tooth mobility was grade 3. One month after the transplantation, the morphology of the transplanted tooth and surrounding gingiva were similar to that of the adjacent teeth. Six months after the transplantation, the mobility of the transplanted tooth had stabilized at grade 1, and the periodontal condition was good. On radiographs, no pathologic radiolucency or tooth resorption was observed. The marginal bone support appeared similar to that of the neighboring teeth. A continuous periodontal space was present radiographically around the transplanted teeth. Good healing took place when the septal bone was elevated from the maxillary sinus oor, replacement of autogenous bone fragments or transplanted allogenic bone occurred, or the tooth was rotated and grafted. Comparable results were seen in the cases without bone grafting. Prosthetic restoration was performed after 3 to 6 months when the prognosis of the tooth could be predicted. In 16 of the 19 transplanted teeth, no inammation occurred during the healing period. In addition, no pain, discomfort, or other side effects were noted, and the tooth became stable over time. In the other three cases, severe inammation and tooth mobility were seen, and the teeth were not xed within the transplant site; these were considered failures and extracted. In all failed cases, the periodontal condition was poor, and the primary stability of the transplanted tooth was poor. The transplanted teeth met the success criteria in 16 cases for an 84% success rate.
3. Radiographically, no root resorption and a normal periodontal ligament space and lamina dura are present.
Surgical Procedure To prepare the recipient site, when a three-dimensional model of the donor tooth was available, a computer-aided rapid prototyping (CARP) model was used (Fig. 1); otherwise, the transplant site was based on the size measured on radiographs in advance. The recipient socket was prepared with a surgical round bur with copious saline irrigation. Minimizing trauma, the tooth to be transplanted was extracted carefully. To reduce the injury to the periodontal ligament, the tooth was wrapped with gauze wet with saline, an apicoectomy was performed with a diamond point, and the cavity for retrograde lling was formed and lled with mineral trioxide aggregate (MTA) (Fig. 2). To reduce the extraoral time, an endodontic treatment was performed before extracting the tooth to be transplanted if possible. When endodontic treatment could not be performed in advance, it was performed 1 to 2 weeks after transplantation. The donor tooth was tted in the prepared transplant site. If additional preparation was required, the additional area was formed using the same method. After tooth transplantation, autogenous bone fragments were placed in the adjacent defect or allogenic bone was grafted. When the transplant site was close to the maxillary sinus, the septal bone was elevated from the maxillary sinus oor using an osteotome and then the tooth was transplanted. When the septal bone was lightly tapped and lifted using a Summers Osteotome (Implant Innovations, Inc, West Palm Beach, FL), the sinus membrane was elevated, and the space in the recipient site where the donor tooth was grafted was secured (Fig. 3). For early stabilization, the donor tooth was rotated and transplanted in some cases. The transplanted teeth were xed with a wire or ber splint, and any occlusal interference was corrected. When the root was long and early stabilization was good, an over-crown suture was tied over the occlusal surface. The transplanted teeth were splinted for 2 to 3 weeks. The extraoral exposure of the transplanted teeth was from 3 to 16 minutes. Six patients underwent endodontic treatment before transplantation and 13 patients after transplantation. The follow-up ranged from
Discussion
To increase the success rate of autogenous tooth transplantation, a healthy periodontal membrane should be present on the transplanted tooth and the root morphology of the tooth to be transplanted should be simple. In addition, infection should be absent in the recipient site, and during surgery, the extraoral period should be short and trauma should be minimized (1, 10, 11). The most important factor for the success of autogenous tooth transplantation is the vitality of the periodontal ligament attached to the transplanted tooth (12). The periodontal ligament is sensitive to pH and osmotic potential, and its viability is reduced if extraoral dry time is long (13). Previous studies showed that the viability of periodontal ligament exposed to the extraoral space decreased rapidly after 18 minutes (12, 14). In our series, the teeth to be transplanted were wrapped with gauze wet with sterile saline during preparation of the recipient site. In all cases, the transplant was performed within 3 to 16 minutes. If the tooth to be transplanted had reduced root development (ie, an immature root), it increased the probability of pulp healing. In addition, if the tooth was covered with a thick follicle and periodontal
TABLE 2. The Number of Autotransplanted Teeth Distributed According to the Recipient Site Recipient sites Transplanted tooth
#1 #15 #16 #17 #32 Sum
#3
1
#2
5
#14
#15
#19
1 1 1 3
#18
#30
#31
1
2 1 5 0 2
4 1 5
2 3
Autotransplantation of Teeth with Complete Root Formation
1423

In this study, in the six patients for whom endodontic treatment was performed before surgery, the transplanted teeth were grabbed with gauze wet with saline, retrograde lling was performed rapidly using MTA, and the tooth was then transplanted; in none of these cases was the extraoral time longer than 18 minutes. A long time is required to form the bone socket at the recipient site after extracting the tooth to be transplanted by referring to the shape of the extracted tooth. Skilled surgeons could form a recipient site in a short time using techniques similar to implant drilling. However, it may require more than 30 minutes in most cases. When a longer time is required, the period of time that the donor tooth is exposed to the extraoral cavity becomes longer. In addition, while tting the extracted tooth to the bone socket, the root surface may be injured. In CARP, software is used to produce a shape identical to the real tooth. This was rst applied clinically in the 1980s (15). To prepare a model of the donor tooth, three-dimensional data on the tooth to be extracted are obtained (Fig. 1A) and converted into a Digital Imaging and Communications in Medicine format le. Then, a resin or starch model tooth is prepared using computer prototyping (Fig. 1B) (2, 16). When the data are sent to a company specializing in preparing computeraided rapid prototypes, a model can be prepared in 3 or 4 days. If a CARP model identical to the tooth to be transplanted is prepared before surgery, the bone preparation time is shortened, and injury to the root surface is reduced. Fong (17) stated that maxillary transplants should not be done because of the extreme variation in the size and shape of the maxillary third molars and because of the proximity of the maxillary antrum to the molar sockets. In our series, however, for the sites adjacent to the maxillary sinus, the septal bone was elevated from the maxillary sinus oor using an osteotome, and for the cases in which the tooth to be transplanted did not t the recipient site, it was rotated or autogenous bone fragments or allogenic bone was used and good results were obtained. The most important factor in bone formation is the cervical approximation of the transplanted tooth and bone in the recipient area. If the cervical approximation is good, because the bone tissue below the cervical portion is a closed wound and there is a lower chance of infection, there is a tendency to heal well without problems (2). When a maxillary tooth is moved to the mandible because the buccolingual width of the maxillary tooth is wider than the recipient area in the mandible in most cases excessive bone must sometimes be removed. In such cases, if the maxillary tooth is rotated before it is placed, it can be positioned in an anatomically appropriate manner without removing excessive alveolar bone (2). In autogenous tooth transplantation, long-term rm xation may have negative effects on healing, whereas nonrigid xation for 7 to 10 days stimulates the activation of alveolar ligament cells and bone healing (18, 19). Tsukiboshi et al (1) reported that the tooth should be xed for between 2 weeks and 2 months depending on whether the mobility is reduced. In our series, the xation was removed after 2 to 3 weeks when any vertical mobility had disappeared. Following Chamberlin and Goerig (20), tooth transplantation was judged successful if the tooth was xed in its socket without residual inammation; masticatory function was satisfactory and without discomfort; the tooth was not mobile; no pathological condition was apparent radiographically; the lamina dura appeared normal radiographically; the tooth showed radiographic evidence of root growth; and the depth of the pocket, gingival contour, and gingival color were all normal. The prognosis of autogenous tooth transplantation depends on the level of root development, the formation of the root apex, the condition of the periodontal ligament of the transplanted tooth, the method of tooth xation, the match between the transplanted tooth and recipient socket, and the time of endodontic treatment (1, 8,
Figure 1. Photographs of a left mandibular third molar extracted for transplantation (left) and a computer-aided rapid prototyping model made of resin (right). (This gure is available in color online at www.aae.org/joe/.)
membrane and was extracted with a weak force, the injury to the root surface was minimized, and replacement resorption rarely occurred. In most cases, the pulp healed and no endodontic treatment was required, shortening the treatment time and the future possibility of developing pulp disease; the risk of root fracture was almost zero. In the cases showing pulp necrosis, the root development ceased and inammatory root resorption occurred (6, 10). The pulp of a completely mature tooth cannot regenerate. Therefore, if the tooth to be transplanted is accessible, endodontic treatment should be completed before transplantation. Otherwise, the endodontic treatment should be initiated 1 to 2 weeks after autogenous tooth transplantation. The 1- to 2-week interval is very important because if endodontic treatment is performed too early after autogenous tooth transplantation, additional injury to the periodontal ligament may occur, whereas after 2 weeks, inammatory resorption may develop from the infected root canal (5). During autogenous tooth transplantation, extraoral endodontic treatment prolongs the extraoral time, and during manipulation of the instruments, Hertwigs epithelial root sheath of the root cemental surface is injured, increasing the possibility of root resorption (11).
Figure 2. A photograph of MTA retrograde lling. To reduce the injury to the periodontal membrane, the tooth was wrapped in gauze wet with saline. Using a diamond point, an apicoectomy was performed and an MTA retrograde lling performed. (This gure is available in color online at www.aae.org/joe/.)
1424
Bae et al.
Figure 3. When the transplant site is close to the maxillary sinus, the septal bone in the extraction socket was elevated. (A) A panoramic radiograph of a 25-year-old woman with severe caries of the right maxillary rst molar (#3). The tooth could not be restored, and it was decided to transplant the third molar (#1). (B) The septal bone was elevated into the sinus cavity using a Summers osteotome. (C) A panoramic radiograph immediately after transplantation. Because the recipient site was close to the maxillary sinus, the septal bone was elevated from the maxillary sinus oor and the tooth transplanted. (D) A photograph taken immediately after transplant. The #1 tooth was transplanted to the #3 position. (E) An intraoral radiograph 1 week after transplantation. The septal bone is elevated in the recipient extraction socket. (F) An intraoral radiograph immediately after endodontic treatment (1 month after transplantation). The features of the root apex of the transplanted tooth and the distal bone regeneration are shown. (G) An intraoral radiograph 6 months after transplantation. (H) A photograph after prosthesis treatment. (I) An intraoral radiograph 19 months after transplantation. No inammation or resorption was detected. The marginal bone support appeared similar to that of the neighboring teeth. A continuous periodontal space was present radiographically around the transplanted teeth. (This gure is available in color online at www.aae.org/joe/.)
10). Transplanted teeth have a poor outcome because of the failure of periodontal reattachment or the occurrence of root resorption in the engrafted cementum-root surface (2, 21). The failure of cementum reattachment may be induced by periodontal inammation, inammation in the alveolar socket, or in cases with insufcient early xation after transplantation. Therefore, transplantation is contraindicated in cases with infection in the root apex. During tooth extraction, chronic inammatory tissues should be removed completely. In this study, the follow-up period averaged 15 months, which is shorter than in other studies. Nevertheless, 16 of the 19 cases met the success criteria for an 84% success rate. No inammation or replacement root resorption developed during the follow-up period. This result is comparable to the success rates of autogenous tooth transplantation of teeth with a mature root apex reported by Lundberg and Isaksson (6) and Majare et al (7). In our series, three cases failed. The possible cause of the failure in all cases was the poor periodontal condition caused by the incomplete removal of chronic inammatory tissues. In one case, early stabilization could not be achieved, and splint xation was required for 3 months; however, the level of tooth mobility did not decrease, and it was considered a failure and extracted.
Autogenous tooth transplantation is a procedure used in cases when restoration is impossible because of, for example, severe dental caries, root fracture, alveolar problems, or the failure of endodontic treatment. It involves transplanting and xing another of the patients teeth. If the cases are selected properly and appropriate surgery and maintenance are performed, the success rate is relatively high, and it contributes greatly to prolonging the function of the natural teeth.
References
1. Tsukiboshi M, Andreasen J, Asai Y. Autotransplantation of teeth. Chicago; Quintessence, 2001:104, 97, 15267. 2. Lee S. Transplantation and replantation of teeth. Seoul: Shinhung; 2008. 815, 92116. 3. Apfel H. Autoplasty of enucleated prefunctional third molars. J Oral Surg (Chic) 1950;8:28996. 4. Miller HM. Transplantation; a case report. J Am Dent Assoc 1950;40:237. 5. Tsukiboshi M. Autotransplantation of teeth: requirements for predictable success. Dent Traumatol 2002;18:15780. 6. Lundberg T, Isaksson S. A clinical follow-up study of 278 autotransplanted teeth. Br J Oral Maxillofac Surg 1996;34:1815. 7. Mejare B, Wannfors K, Jansson L. A prospective study on transplantation of third molars with complete root formation. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;97:2318.
Autotransplantation of Teeth with Complete Root Formation
1425

8. Schwartz-Arad D, Herzberg R, Levin L. Evaluation of long-term implant success. J Periodontol 2005;76:16238. 9. Newman M, Takei H, Carranza F, et al. Carranzas Clinical Periodontology. 10th ed. Philadelphia, PA: WB Saunders Co; 2006:546. 10. Schwartz O, Bergmann P, Klausen B. Autotransplantation of human teeth. A life-table analysis of prognostic factors. Int J Oral Surg 1985;14:24558. 11. Smith JJ, Wayman BE. Successful autotransplantation. J Endod 1987;13:7780. 12. Andreasen JO. Periodontal healing after replantation and autotransplantation of incisors in monkeys. Int J Oral Surg 1981;10:5461. 13. Lindskog S, Blomlof L. Inuence of osmolality and composition of some storage media on human periodontal ligament cells. Acta Odontol Scand 1982;40: 43541. 14. Andreasen JO. Effect of extra-alveolar period and storage media upon periodontal and pulpal healing after replantation of mature permanent incisors in monkeys. Int J Oral Surg 1981;10:4353. 15. Herman GT, Coin CG. The use of three-dimensional computer display in the study of disk disease. J Comput Assist Tomogr 1980;4:5647. 16. Lee SJ, Jung IY, Lee CY, et al. Clinical application of computer-aided rapid prototyping for tooth transplantation. Dent Traumatol 2001;17:1149. 17. Fong CC. Transplantation of the third molar. Oral Surg Oral Med Oral Pathol 1953;6: 91726. 18. Pogrel MA. Evaluation of over 400 autogenous tooth transplants. J Oral Maxillofac Surg 1987;45:20511. 19. Sange S, Thilander B. Transalveolar transplantation of maxillary canines. A followup study. Eur J Orthod 1990;12:1407. 20. Chamberlin JH, Goerig AC. Rationale for treatment and management of avulsed teeth. J Am Dent Assoc 1980;101:4715. 21. Andreasen JO. Relationship between surface and inammatory resorption and changes in the pulp after replantation of permanent incisors in monkeys. J Endod 1981;7:294301.
1426
Bae et al.

Journal of Tics JOE 2010 Issue August

Transféré par

Informations du document

Description originale:

Titre original

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

Journal of Tics JOE 2010 Issue August

Transféré par

Droits d'auteur :

Formats disponibles

Clinical Research

Materials and Methods

JOE Volume 36, Number 8, August 2010

Biolms and Apical Periodontitis

Total (untreated + treated) (%)

82/106 (77) 31/42 (74) 51/64 (80)

Total (untreated + treated) (%)

6/106 (6) 2/42 (5)

JOE Volume 36, Number 8, August 2010

Biolms and Apical Periodontitis

Ricucci and Siqueira Jr.

JOE Volume 36, Number 8, August 2010

JOE Volume 36, Number 8, August 2010

Ricucci and Siqueira Jr.

JOE Volume 36, Number 8, August 2010

JOE Volume 36, Number 8, August 2010

Biolms and Apical Periodontitis

Ricucci and Siqueira Jr.

JOE Volume 36, Number 8, August 2010

Total (untreated + treated)

*These specimens were also included in the group >5 mm.

JOE Volume 36, Number 8, August 2010

Biolms and Apical Periodontitis

Ricucci and Siqueira Jr.

JOE Volume 36, Number 8, August 2010

JOE Volume 36, Number 8, August 2010

Biolms and Apical Periodontitis

Ricucci and Siqueira Jr.

JOE Volume 36, Number 8, August 2010

JOE Volume 36, Number 8, August 2010

Accessory Mesial Canals in Mandibular Molars

Mesial accessory canals (%n) First

JOE Volume 36, Number 8, August 2010

JOE Volume 36, Number 8, August 2010

Accessory Mesial Canals in Mandibular Molars

Second molars (n = 48) Detected

Total (n = 96) Detected

JOE Volume 36, Number 8, August 2010

JOE Volume 36, Number 8, August 2010

Accessory Mesial Canals in Mandibular Molars

JOE Volume 36, Number 8, August 2010

JOE Volume 36, Number 8, August 2010

Post-Operative Pain after Application of Two Irrigation Devices

Materials and Methods

Group A Maxi 1 Probe

JOE Volume 36, Number 8, August 2010

Post-Operative Pain after Application of Two Irrigation Devices

Frequency Cumulative percent

60.0 29.1 10.9 100.0 50 2 1 2 100.0 p < 0.0001*

Pain intensity distribution

p value (Mann-Whitney test)

Frequency Cumulative percent

Gondim Jr. et al.

34.5 45.5 72.7 89.1 90.9 94.5 98.2 100.0

76.4 89.1 94.5 100.0

Group A Maxi I Probe

54.5 41.8 3.6 100.0 90.9 9.1 100.0 p < 0.0001*

70.9 20.0 9.1 100.0 94.5 5.5 100.0 p <0.001*

94.5 5.5 100.0 100.0 100.0 p = 0.08*

JOE Volume 36, Number 8, August 2010

Post-Operative Pain after Application of Two Irrigation Devices

Gondim Jr. et al.