Vous êtes sur la page 1sur 5

Gilberto Duwe Lucas Corazza Mariele da Costa ATIVIDADES AULA DNA E RNA

1. Diferencie a molcula de DNA da molcula de RNA.

As bases nitrogenadas so as mesmas que as do DNA, exceto a pirimidina uracila que substitui a pirimidina timina, os ribonucleotideos sucessivos so reunidos por ligaes fosfodiester 5 e 3 formando o DNA. As molculas do RNA so em geral polmeros com um s filamento de ribonucletideos apesar de a maioria das molculas de RNA assumir uma estrutura secundria, formando pontes de hidrognio em uma estrutura de hlice dupla. 2. Explique a funo da fenda maior e menor do DNA. O principal papel das fendas fornecer a informao de quais bases esto se pareando em uma regio qualquer sem a necessidade de abrir a dupla fita, e a fenda maior oferece maior acessibilidade de ligao com protenas que a fenda menor. 3. O que o processo de transcrio? Sntese de molculas de RNA, usando molculas de DNA como molde, e sua ordem marcada pelos nucleotdeos complementares. 4. Em que a transcrio difere da replicao. A transcrio usa-se o DNA como molde, j a replicao o DNA um processo semiconservativo, no qual a fita parental serve como molde para a fita filha. 5. Desenhe um gene especificando as suas regies. Desenho aps as questes. 6. O que o processamento e onde ocorre.

O processamento ocorre no ncleo e sua definio o conjunto de modificaes que os transcritos primrios experimentam at serem convertidos em RNA funcionais. 7. O que indica o trmino da transcrio? Quando seqncias do DNA so reconhecidas e a sntese interrompida. 8. Quais so os RNAs existentes e qual a funo de cada um deles. RNA de transferncia: transferir os aminocidos para as posies corretas nas cadeias polipeptdicas em formao nos complexos de ribossomos e RNA mensageiro. RNA mensageiro: determina a posio dos aminocidos nas protenas. RNA ribossmico: combina com o mensageiro para formar os poliribossomos. 9. Qual a funo da cauda Poli A e do CAP no mRNA? A cauda poli facilita o transporte para o citoplasma, protege da desnaturao e facilita a traduo. O CAP, protege o mRNA da desnaturao e facilita o transporte do ncleo para o citoplasma. 10. Onde ocorre o processamento do RNA? O processamento ocorre no ncleo. 11. O que promotor? Qual a seqncia em eucariotos? O promotor inicia a transcrio e sinaliza a partir de qual nucleotdeo o gene deve ser transcrito, pode- se localizar prximo a extremidade 5 do segmento codificador onde inicia-se a sntese do DNA. Sua seqncia em eucariotos TATA e CAAT. 12. O que so introns e o que so exons? Introns- seqncia de DNA que no so traduzidas em uma protena. Exons- seqncia de DNA que so expressas, traduzidas em protenas.

13. Explique por que o cdigo gentico dito ser redundante. Por existir apenas 20 aminocidos essenciais, e vrios cdons codificarem o mesmo aminocido, o cdigo gentico pode ser dito redundante.
14. O que so cdons sinnimos.

So cdons que modificam um mesmo aminocido. 15. A partir do mRNA descrito abaixo monte a seqncia da protena. mRNA: AUGAUAAUCAUUGGAAGACAUGCGAAUUUUUGGUUCUGUUAA Protena: AUG/AUA/AUC/AUU/GGA/AGA/CAU/GCG/AAU/UUU/UGG/UUC/UGU/UAA 16. Com base na seqncia de DNA abaixo monte a seqncia do mRNA correspondente. DNA: AAGTTTCCAGGATTACCCAAAGGTTTAAGGCCAGTACGGAAGGA mRNA: UUCAAAGGUCCUAAUGGGUUUCCAAAUUCCGGUCAUGCCUUCCU 17. O que so cdons e qual informao contem? Cdons so trincas de nucleotdeos e contem a informao necessria para codificar aminocidos e produzir protenas. 18. Quais so as duas regies do tRNA fundamentais para a sntese de protenas? As duas regies so Cdon e Anticdon. 19. Relacione as colunas (1) DNA polimerase (2) Origem de Replicao (3) Primer (4) Enzima que corrige as bases que foram pareadas erradamente durante a replicao (5) Transcrio (6) Replicao semi-conservativa (7) RNA polimerase

(8) Replicao (9) DNA ligase (10) DNA girase (11) Promotor (12) Pontes de hidrognio (13) Traduo (14) mRNA (15) Enzima aminoacil-transferase (16) tRNA (17) Codon ( 4 ) DNA polimerase ( 2 ) Local onde inicia a replicao ( 17 ) Seqncia de trs bases que codifica para um aminocido ( 9 ) Enzima que liga os aminocidos a extremidade 3' do tRNA ( 5 ) Processo em que o mRNA lido para a sntese de protenas ( 1 ) Enzima responsvel pela replicao do DNA ( 8 ) Processo de sntese de DNA ( 6 ) Processo de conservao de uma das fitas de DNA durante a replicao ( 15 ) Enzima que une os nucletdios durante a replicao da fita descontnua ( 10 ) Enzima que desenrola a fita de DNA durante a replicao ( 14 ) Molcula que transporta a informao para a sntese de protenas ( 12 ) Mantm unida a dupla fita de DNA ( 7 ) Enzima responsvel pela sntese de RNA ( 16 ) Molcula responsvel pelo transporte de aminocidos at os ribossomos ( 11 ) Seqncia de bases necessria para a DNA polimerase iniciar a replicao ( 13 ) Sntese de RNA ( 3 ) Seqncia de bases onde a RNA polimerase se liga para iniciar a transcrio Desenho:

Explique como funciona as foras de Van der Walls para a estabilizao da molcula de DNA. As interaes no covalentes, as foras de Van der Walls, so muito mais fracas que as ligaes covalentes, onde apenas 4kJ suficiente para romper um mol de interaes tpicas de Van der Walls. Consequentemente a isso as foras so continuadamente formadas e quebradas. A estabilidade medida pela constante de equilbrio da reao de ligao, variando exponencialmente com a energia de ligao, j as macromolculas de DNA e RNA, contem tanto stios potenciais para as pontes de hidrognio, van der walls, e a sua estabilidade se da atravs do empilhamento das bases, explicando assim como seria a estabilizao da molcula de DNA.

Porque no processo de clonagem de um fragmento de DNA, no ocorre a duplicao de todo o cromossomo.