Biol 2153 w/ Dr. Brumfield SNP- single nucleotide polymorphism Law of Segregation Meiosis Read ch.

1&2 Explore websites y www.23andme.com y Ncbi.nim.nih.gov/omim Biol 2153 w/ Dr. Brumfield Read ch. 2&3 Recommended problems from ch. 2: #1,3,5-13, 15-18,20-26 (edition 3) Types of genetics y Transmission genetics o Tracking heredity through generations y

24Aug10

26Aug10

y y

Pedigree analysis o Key to pedigrees square=male, circle=female, slashed square or circle=deceased, filled square or circle=affected individual, double lines linking circle and square=consanguineous mating Cytogenetics o Cellular level analysis of genetics o chromosomes Molecular genetic analysis o Study of DNA, RNA, and protein variation with respect to heritability Population genetics o Genetic variation in a population o Dr. Brumfield s field

Monohybrid & Dihybrid crosses Genetically caused cystic fibrosis results from a deletion mutation in the allel on chromosome 7 that codes for CF. The mutated allele is called F508 or just . A homozygous individual (i.e. ++) is healthy A heterozygous individual (i.e. + ) is healthy, but a carrier A homozygous individual (i.e. ) has cystic fibrosis Law of Segregation During the formation of gametes the gametes receive one or the other allele with equal probability.

A Punnett square for a monohybrid cross: AA-25% not expressed AG-50% expressed GG-25% expressed A AA AG G AG GG

A G

Genotypic ratio 1:2:1 Phenotypic ratio 3:1 Mendel s monohybrid crosses of Green and Yellow peas: Y=yellow Y=green Y y y Yy Yy Y Yy Yy

All Yy, therefore all yellow offspring.

Genetic Dominance-one allele is phenotypically dominant Test Cross: A cross of individual of unknown genotype to an individual that is a known homozygous recessive.

Test cross: Phenotypic ratio is 1:1 if the tested individual is homozygous. Y y y Yy Yy y yy yy

Phenotypic ratio is 100% if the tested individual is heterozygous.

Y y y Yy Yy

Y Yy Yy

Law of Independent Assortment: During gamete formation segregating pairs of alleles assort independently of each other.

Dihybrid Cross: Genotypic proportions: AA: 4/16 AG: 8/16 GG: 4/16 ++: 4/16 + : 8/16 : 4/16 Both genes genotypic distribution: AA++: dry healthy AA+ : dry healthy AA : dry CF AG++: wet healthy AG+ : wet healthy AG : wet CF GG++: wet healthy GG+ : wet healthy GG : wet CF Phenotypic ratios: 9:3:3:1 Wet healthy: 9/16 Wet CF: 3/16 Dry healthy: 3/16 Dry CF: 1/16 A+ A G+ G A+ AA++ AA+ AG++ AG+ A AA+ AA AG+ AG G+ AG++ AG+ GG++ GG+ G AG+ AG+ GG+ GG

Biol 2153 w/ Dr. Brumfield

31Aug10

Interchromosomal Recombinants: The combination of two or more traits not found in either parent of a dihybrid generation (e.g. When crossing a YYRR (yellow, round pea) with a yyrr (green, wrinkled pea) the F1 generation will be all YyRr (yellow, round peas), if allowed to self-fertilize the F1 generation will yield an F2 generation in a distribution of 9:3:3:1. The yellow, wrinkled peas and the green, round peas are the interchromosomal recombinants.) Example Problem: For a set of bi-allelic genes with complete dominance of one allele, the number of possible phenotypes is 2n, where n is the number of genes. To calculate the number of gametes that an individual can produce, multiply the number of possible gametes for each gene. AaBBCcdd 2 1 2 1 = 4 types of gametes

Product Rule: Probability of two or more independent events occurring together is the product of the probabilities of each event. Sum Rule: Probability of either of two mutually exclusive events is the sum of their individual probabilities. Example Problem: What would be the probability of producing either all dominant or all recessive phenotypes for the genes A & B? A B a b x = 9/16 dominant + x = 1/16 recessive =10/16=5/8 What would be the probability of producing a completely homozygous genotype in the F2? P: AABBCC x aabbcc F1: AaBbCc x AaBbCc (self-fertilization) F2: AA aa BB bb ( + ) x ( + )

CC (

cc + ) =8/64 = 1/8

Biol 2153 w/ Dr. Brumfield

02Sep10

Conditional Probability: Pc = conditional probability what is the probability that one outcome will occur given the specific condition upon which the outcome is dependent. Pa =the probability of an F2 plant being heterozygous Pb =the probability of the condition under which the event is being assessed Pc = Pa/Pb

Calculating the frequency of carriers in a population. Hardy-Weinberg allows conversion between population allele frequencies and population genotype frequencies p2+2pq+q2=1 genotypic frequencies in the population y p2= ++ (homozygote) y 2pq= + (heterozygote) y q2= (homozygote) allele frequencies in the population y p=frequency of + allele y q=frequency of allele

p+q=1

Example Problem: Incidence of CF is 1 in 2000. What is the frequency of carriers? 1/2000=0.0005=q2 q=0.0224 p+q=1 p+0.0224=1 p=0.9776 2pq=2(0.9776)(0.0224)=0.0438 4%

Binomial Distribution: When you would like to calculate the probability of cases where one of two alternative outcomes is possible: Probability= n!/(s!t!) x (asbt) a=number of trials s=number of times a occurs t=number of times b occurs a=probability of a b=probability of b

Example Problem: What is the probability of a set of parents having four children consisting of 3 boys and 1 girl? Probability= 4!/(3!1!) x (1/2)3(1/2)1 =1/4

Autosome: A non-sex determining chromosome. Humans have 22 pairs of autosomes and one pair of sex chromosomes to make 23 total pairs of chromosomes. Autosomal recessive disorder: A recessive disease trait that yields a horizontal pattern of affected family members on a genealogical diagram. Autosomal Dominant disorder: A dominant disease trait that yields a vertical pattern of affected family members on a genealogical diagram.

Huntington Disease y mutation of HD gene (on chromosome 4) y HD gene makes a product called huntingtin

Microsatellite DNA regions of DNA characterized by tandem repeats o Tandem repeats are sets of repeated codons within a section of DNA

In Huntington one region of the HD gene has the sequence CAG repeated 10 to 35 times. Healthy number of repeats: 10-35 HD number of repeats: >36 (up to about 120) HD hypothetical genotypes: CAG10/CAG12 healthy CAG10/CAG80 HD CAG80/CAG80 HD Dominance relationships: y Complete dominance y Incomplete dominance (half way between both parents) y Co-dominant (both parents phenotypes are expressed) Tay-Sachs disease (chromosome 15)- A (phenotypically) autosomal recessive disorder The gene that causes Tay-Sachs produces an enzyme called hexosaminidase HH-healthy, genes on both chromosomes produce the enzyme Hh-healthy, genes produce the normal amount of enzyme (but still sufficient) hh-no enzyme produced

Biol 2153 w/ Dr. Brumfield Tay-Sachs disease P generation: HH x hh F1 generation: all Hh Phenotypes: Healthy or not HH-healthy Hh-healthy hh-Tay-Sachs

07Sep10

quantitiy of HEX-A gene product 100% 50% 0%

Co-Dominance: Both alleles are expressed in the phenotype (a blend of the parents phenotypes) ABO blood types (chromosome 9) 3 alleles: A, B, O Genotype I AI A I AI O I BI B I BI O Antigen A A B B Antibody-A agglutination agglutination no agglutination no agglutination Antibody-B no agg. no agg. agg. agg.

I AI B IoIo

AB O

agglutination no agglutination

agg. no agg.

Specificity of A&B antigens is based on the terminal sugar of the carbohydrate. H substance (H gene is on chromosome 19) IA allele converts H substance to the A antigen or IB allele converts H substance to the B antigen

Bombay phenotype: y Offspring of an AB parent has type O blood y Mutation at H gene (no H substance produced) o Therefore: phenotypically O due to inability for RBCs to display antigens o But: genotypically A,B, or AB

A B for A for AB for B

A AA AB

B AB BB

H h

H HH Hh

h Hh hh

for H substance for no H substance

Branched line diagram for Bombay phenotype Type H sub. Production H- A- No H- H- AB- No H- H- B- No H- 3/16-A, 6/16-AB, 3/16-B, 4/16-O

overall probability A- 3/16 O- 1/16 AB- 6/16 O- 2/16 B- 3/16 O- 1/16

Gene interactions: More than one gene influences a particular characteristic

Epistasis: Effects of an allele at one gene hide the effects of alleles at other genes Pleiotropy: A single gene determines a series of distinct and seemingly unrelated characteristics

Example of pleiotropy Foxes of Novsibirsk: Siberian foxes changed coat color as they were selectively bred for tameness

Coat color of mice y Wild type allele is agouti y Mutant allele is for yellow Agouti x agouti all agouti Agouti x yellow 1/2 yellow & agouti Yellow x yellow 2/3 yellow & 1/3 agouti Mutant yellow allele is completely dominant to agouti y Homozygous yellow allele is lethal; hence the strange yellow x yellow results o This is referred to as a recessive lethal allele  An allele that prevents birth or survival of homozygotes  Heterozygotes carrying the lethal allele survive Agouti(AA) x Agouti (AA) Agouti (AA) Yellow(AAy) x Yellow(AAy) A Ay AA- Agouti AAy- yellow AyAy-death Therefore: 2/3-yellow, 1/3-agouti Yellow(AAy) x Agouti(AA) Agouti Yellow A A A AA AA Ay AAy AAy

A AA AAy

Ay AAy AyAy

2-gene system A-gene y Agouti is dominant to black y Phenotypes: A_(Agouti) aa(black) B-gene

y y

A recessive mutant allele (b) eliminates pigmentation Phenotypes: bb (albino) B_(pigmented) F1 generation: AaBb AaBb x AaBb F2 generation: 9/16 A_B_ Agouti

3/16 A_bb albino

3/16aaB_ black

1/16 aabb albino

F2 final phenotypic ratios 9/16-agouti, 3/16 black, 4/16 albino Recessive Epistasis: y allele causing the epistasis is recessive y typified by a 9:3:4 phenotypic distribution Dominant Epistasis: y allele causing the epistasis is dominant y typified by a 12:3:1 or a 13:3 phenotypic distribution Example of Dominant Epistasis Summer Squash A_: white fruit aa: fruit not white F1 generation: AaBb AaBb x AaBb F2 generation: 9/16 A_B_ White F2 final phenotypic ratio 12/16: white 3/16: yellow 1/16: green

B_: yellow fruit bb: green fruit

3/16 A_bb White

3/16 aaB_ Yellow

1/16 aabb Green

Novel phenotypes are sometimes produced by gene interactions Example: shape in summer squash P1:AABB (disk shaped) x F1:AaBb (disk shaped) x F2: genotype 9/16 A_B_ 3/16 A_bb 3/16 aaB_ 1/16 aabb aabb (disk shaped) AaBb (disk shaped) phenotype disk shaped sphere shaped sphere shaped disk shaped

F2 final phenotypic ratio: 10/16 disk shaped, 6/16 sphere shaped

Biol 2153 w/ Dr. Brumfield Read Ch. 4 (review mitosis) HW problems: 1,2,4-6,9,11,12,14,16,19,22-26,28-32 (3rd edition)
2

09Sep10

Test

Example: In the 2009 NFL season Drew Brees threw 514 passes and 363 completions, for a percentage of 70.6%; an NFL record. Hypothesis: We can expect a completion percentage of 70.6% from Drew Brees for the 2010 season. Hypothetical situation: After 5 games of the 2010 season, Brees has thrown 170 passes and completed 80, for a percentage of 47%. Is this statistic significantly different from the expected average? Test Categories Completed Incomplete
2

Observed data Expected data deviation 80 120 -40 + 90 50 40 170

(dev.)2 1600 1600

(dev.)2/exp. 13.3 + 32 45.3

The 2 test statistic is 45.3 If 2 >3.84, then the observed data is significantly different from what was expected. (the 3.84 value comes from a table based on how many variables are being considered) Example: 20 children are all boys; is this an improbable situation? test Cat. Obs. Data Boys 20 Girls 0
2

Expect a ratio of 1:1 (Dev.)2/exp. 10 10 20

exp. Data 10 10

dev. 10 -10

(Dev.)2 100 100

20>3.84, therefore the data is significantly different from expected.

Example: 1008 peas (YyRr x YyRr) 2 test Cat. Obs. Exp. Yellow, round 587 567 Yellow,wrinkly 197 189 Green, round 168 189 Green, wrinkly 56 63

Expect a ratio of 9:3:3:1 Dev. 20 8 -21 -7 Dev.2 400 64 441 49 dev.2/exp. 0.71 0.34 2.33 0.78 4.16

4.16<7.82, therefore observed results are statistically consistent with expected.

Degrees of freedom= (number of categories in a A partial table of DF 1 2 3 4 5 6 7 8 9

2

test table) 1

values for the first nine degrees of freedom:

critical 2 value 3.84 use for a monohybrid cross 5.99 7.82 use for a dihybrid cross 9.49 11.07 12.59 14.07 use for a trihybrid cross 15.51 16.92

Do not memorize these; they will always be provided if needed.

Meiosis: y the process through which one goes from diploid (2n) to haploid (n) y explains how the Law of Segregation works o two alleles from each trait separate y Also, explains the Law of Independent assortment Chromosomes y 23 is the haploid number of chromosomes=n in humans y 46 is the diploid number of chromosomes=2n y 22 autosomes + 1 sex chromosome =23 (n) y 44 autosomes + 2 sex chromosomes = 46 (2n) Different creatures have different diploid numbers y Mendel s peas 14 y Dogs 78 y Goldfish 94 Somatic cells: All cells except gametes and their precursor cells (soma is latin for body) Germ cells: Reproductive cells that undergo meiosis Mitosis: Meiosis: 2n 2n 2n n

Biol 2153 w/ Dr. Brumfield

14Sep10

y y y

HW1/Quiz1 tomorrow Read ch. 4 Ch. 4 problems: 1,2,4-6,9,11,12,14,16,19,22-26,28-32 (3rd edition)

Exam I on Tuesday 21Sep10 in A101 Life Sciences Stages of Meiosis: y Interphase o Duplication of the genome occurs via DNA replication y Prophase o Chromatin condenses y Prometaphase o Breakdown of nuclear envelope o Microtubules extend from two centrosomes at either pole of the cell o Chromosomes attach to the microtubules through the kinetochore o Microtubules form the mitotic spindle y Metaphase o Chromosomes line up half way between poles y Anaphase o Centromeric connection breaks up between sister chromatids o Two chromosomes move to opposite poles y Telophase o Spindle fibers disperse, nuclear envelope forms around chromatids at each pole y Cytokinesis o Final division into two daughter cells Meiosis I: A diploid pair of chromosomes (one from each parent) DNA is replicated to form two dyads Synapsis occurs, joining the two dyads to form a tetrad (a.k.a. bivalent) crossing over between regions of maternal chromosomes occurs the rest of Meiosis I is spent separating the tetrad into two daughter cells Meiosis II: Meiosis II is spent dividing the two daughter dyads into four monads

Oogenesis: 1. Diploid germ cells in the ovary called oogonia, multiply rapidly by mitosis and produce a large number of primary oocytes 2. Meiosis I results in two daughter cells. The larger of thes is called a secondary oocyte and it receives about 95% of the cytoplasm. The other small daughter cell is called the first polar body. 3. Meiosis II results in another asymmetrical division that produces a haploid ovum and a secondary polar body. 4. The ovum is haploid and carries 22 autosomes and one sex chromosome. 5. Oogenesis begins in the fetus. By six months gestation, the ovaries are fully formed and contain about 500,000 primary oocytes arrested in Prophase I

6. From the onset of puberty one primary oocyte is released each month, so that on average, a woman will release about 480 ovum over their reproductive life. During menopause, the rest of the oocytes disintegrate 7. At ovulation, the primary oocyte completes Meiosis I and proceeds as far as Metaphase of Meiosis II 8. If cell is fertilized it quickly completes Meiosis II 9. The zygote grows by mitosis Non-disjunction y More prevalent during oogenesis than spermatogenesis, because ova lack centrosomes y Chromosomes of dyad do not pull apart to opposite poles resulting in two chromosomes in one monad and none in the other y Trisomy 21 (Down Syndrome) Spermatogenesis y Begins in the testes as germ cells called spermatogonia o Mitotic divisions of these cells produce primary spermatocytes y Undergo symmetrical Meiosis I, producing two secondary spermatocytes y These undergo symmetrical Meiosis II to produce four monad spermatids o These mature into sperm y 22 autosomes and one sex chromosome Sex determination Systems: Humans: XY, where the male is the heterogametic sex Birds and Butterflies: ZW, where female is the heterogametic sex Drosophila: XY, where males are the heterogametic sex

Example:Drosophila P1: red-eyed (wild type) female x white-eyed male (++) (w) F1: + w or F2: + w +w +

red-eyed females red-eyed males

Example: P1: red-eyed male x heterozygous red-eyed female (+) (+w) F1: + + or w F2:

 red-eyed males white-eyed males red-eyed females

+ w

+ ++ +w

+ w

Example: P1: white-eyed female x red-eyed male (ww) (+) F1: w + F2: w + w+ white-eyed males w red-eyed females

Biol 2153 w/ Dr. Brumfield Exam I on Tuesday Read Ch. 5 p.123-140 X-linked trait (sex-linked trait) y Trait coded by a gene on the X chromosome y Human X linked traits o Color blindness o Some forms of hemophilia o Muscular dystrophy (Duchenne type) o G6PDH deficiency (favism)

16Sep10

Sex-limited inheritance: Expression of a specific phenotype is limited to one sex (e.g. rooster feathering vs. henfeathering in chickens; only males ever display rooster feathering, though both sexes can display henfeathering) Sex-influenced inheritance: The sex of an individual influences the expression of a phenotype that is not limited to one sex (e.g. pattern baldness in humans; both sexes can exhibit pattern baldness, but a female must be homozygous for the trait to be expressed, whereas a male need only have one copy of the dominant baldness gene) Sources of genetic variation: 1. Independent assortment of chromosomes In humans 2n=223=8x106 different chromosome Combinations produced by meiosis 2. Mutations 3. Recombinations (crossing over)

A tetrad is formed by the linkage of two dyads. Non-sister chromatids overlap to form a junction at which a set of genes can be transferred from one dyad to the other; thereby causing rearrangement of genetic sequences. The interchromosomal recombinants are the sets of genes that are not carried by either parent, but, instead, are caused by the rearrangement of the parental sets.

Linked genes y During recombination, crossing over occurs between non-sister chromatids o Genes with close loci are much less likely to be separated by a crossing over event (i.e. the frequency of crossing over is proportional to the distance separating the loci on the chromosomes)

2 linked recessive mutant genes in Drosophila Melanogaster Eye color: bw(brown eyes) or + (red eyes) Wing vein: hv (heavy vein) or + (thin vein) P1: bw+/bw+ (homozygous for both brown eyes and thin veins) X +hv/+hv (homozygous for both red-eyes and heavy veins) F1: bw+/+hv (red-eyed, thin veined) brown, thin veined red, thin veined red, heavy veined bw+ +hv bw+/bw+ +hv/bw+ bw+/+hv +hv/+hv

bw+ +hv

Biol 2153 w/ Dr. Brumfield Read Ch. 5 p123-140 Drosophila eyes 2-linked genes bw (brown eyes, recessive) hv (heavy wing veins) P1: F1: bw+/bw+ bw+/+hv x x + (red eyes, wild-type) + (thin wing veins) +hv/+hv bw+/+hv

23Sep10

F2: brown, thin red, thin red, heavy bw+ +hv bw+/bw+ +hv/bw+ bw+/+hv +hv/+hv

bw+ +hv

Because gene order does not matter in a two gene cross: +bw/hv+ = bw+/+hv = +hv/bw+

hv+/bw+

Test cross: y Can distinguish whether traits are completely linked or located on separate autosomes y A result of four phenotypes would indicate that they are on separate autosomes (or they have incomplete linkage) y A result of two phenotypes would indicate that they are on the same autosome (i.e. completely linked) Test cross F1: bw +/+ h x bw h/bw h +h bw h/+ h

bw h

bw+ bw +/bw h

2 phenotypes; therefore, completely linked on same chromosome Test Cross with Recombination: F1: ++ bwhv bw+ +hv bwhv bwhv/++ bwhv/bwhv bwhv/bw+ bwhv/+hv

4 phenotypes; therefore, recombination between genes

Drosophila Geneticist Thomas Hunt Morgan used the following key for three Drosophila traits: y y y=yellow body vs. w=white eye vs. normal gray body=+ normal red eye=+

m=miniature wing

vs.

normal wing=+

Morgan s 1st experiment: P1: F1: F2:

yw/yw yw/

x (male) x

++/

(sex-linked genes)

yw/++ (female)

98.7% of the offspring were parental types 1.3% were recombinant types Punnett square that produced the F2: yw ++ yw/yw ++/yw yw/ ++/

yw

Morgan s 2nd experiment: P1: wm/wm F1: F2: wm/++

x &

++/ wm/ offspring

62.8% of offspring were parental types 37.2% were recombinant types

Alfred Sturtevant: y Lab assistant for Morgan y Had the idea to use % recombinants in offspring to make a map of the chromosome Ex. Yellow body(y), white eyed(w) 0.5% of offspring are recombinants White eyed(w), miniature wing(m) 34.5% of offspring are recombinants Yellow body(y), miniature wing(m) 35% of offspring are recombinants

Units of measure for physical distance between the loci of various genes on any one chromosome is the centiMorgan (cM)

Biol 2153 w/ Dr. Brumfield y Ch. 5 (gene mapping) y Exam I returned tomorrow

28Sep10

HW 2 handed out tomorrow

% of recombinance will not exceed 50% of the total y Due to crossing over occurring only between the center two chromatids of a tetrad y Genes that are >50cM apart will produce gametes as if they were independently assorting y 40cM indicates that 40% of the gametes will be recombinants o 20% for Ab (recombinant) o 20% for aB (recombinant) o 30% for AB o 30% for ab Chromosome Mapping- Gene sequence a b = b a

y y

Take advantage of double crossovers (DCOs) Three gene pairs must be examined, all heterozygous for two alleles o Probability of a single exchange is directly proportional to distance o DCOs are two separate, simultaneous independent exchanges o Probability of a DCO is the probability of a SCO between A&B multiplied by the probability of a SCO between C&B

20cM

30cM C

Probability of a DCO is 0.2(20cM)

0.3(30cM)

0.06

Three-point mapping 3 criteria a) Genotypes of individual producing recombinant gametes must be heterozygous at all loci b) The genotypes of all gametes must be determinable by looking at the phenotype of offspring c) Lots of offspring Drosophila y: yellow body, w:white eye, ec:echinus eye shape

P1: F1: F2:

y w ec /y w ec x y w ec /+++ x

+++/ y w ec / Females Males 1.y w ec/ 2.+++/ 1.y++/ 2.+ w ec/ 1.y w +/ 2.++ ec/ 1. y+ec/ 2.+w+/ % of offspring

Parental gametes SCO gametes (y-w) SCO gametes (w-ec) DCO gametes

1.y w ec /y w ec 2.+++/ y w ec 1.y++/ y w ec 2.+ w ec/ y w ec 1.y w +/y w ec 2.++ ec/y w ec 1.y + ec/ y w ec 2.+w+/ y w ec

94.44% 1.5% 4.0% 0.06%

Parental/non-crossover (NCO) gametes occur in the greatest proportion of offspring y Have same combinations of alleles as F1 females Gene distance calculation: y-w= 1.5% + 0.06% = 1.56 cM w-ec= 4.0% + 0.06% = 4.06 cM To determine gene order: y Compare parental gametes (F1) NCOs to the DCOs +++/y w ec y vs. +w+/y + ec

Look for the altered gene to determine which is the center gene of a set of three

Example: +++/a b c Offspring: 10,000 wild-type females 980 males with c phenotype 730 males with ab 342 males with a 330 males with bc 57 males with b 55 males with ac 3 males with abc *NCOs #SCOs x +++/?

* * # # # #

Due to the appearance of phenotypic variation only in males, the set of genes in this example are known to be sex-linked. The gene order is known to be acb or bca, via comparison of NCOs to DCOs Gene arrangement: Determined by comparing the two genotypes of the NCOs. +c+/a+b & acb/

Biol 2153 with Dr. Brumfield 30Sep10 Ch. 5 recommended problems: 1,2,3(a-c),5,8-9,11-12,15,18,20-21,23,25,27 Interference: y Real data often show fewer DCOs than were expected A 20cM 20% B 30cM C 30%

Probability of a DCO is the probability of a crossover between A&B(0.2) multiplied by the probability of a crossover between B&C(0.3). Expected frequency of DCOs=(0.2)(0.3)=0.06 Observed frequency of DCOs=0.03 y Coefficient of coincidence (C)=freq. of obs./freq. of exp. (C)= 0.03/0.06=0.5 y Interference (I)=1-C =1-0.5 =0.5 An I value of 0 indicates no interference. An I value of 1 indicates complete interference and no DCOs.

Example: Drosophila Male abc/+++ x Female +++/? Offspring: 5000 wild-type females 760 male a+c 780 male +b+ 196 male a++ 211 male +bc 12 male ab+ 18 male ++c 1 male abc 2 male +++

Sex-linked?...yes Gene order?...abc Gene arrangement?...a+c/+b+ Map distances?... a-b:33/1980 =1.6cM b-c:410/1980=20.7cM C?...(3/1980)/0.0033=0.46 I?...1-0.46=0.54

Example: Rs/rS x rs/rs

What proportion of progeny will be RS/rs? 10 map units= 10% crossover, therefore, 5% are RS/rs. Example: antshrikes Males g r y /g r y x females +++/+++

F1: All male and female wild-types traits must be autosomal Offspring: 2 120 485 98 3 92 223 112 1135

g++ ++y gry +r+ +ry gr+ +++ g+y

Gene order: rgy Gene arrangement: rgy/+++ r 18.9cM g 19.1cM y

Questions for next Tuesday: What is the total length of the map in this question? Which of the progeny classes in the table is heterozygous for all mutant genes in this experiment?

Biol 2153 with Dr. Brumfield y Read chapter 6 (p.167-191) y Chapter 6 suggested problems (1,2,4-10,13,17,19,21-23) y No discussion section 20Oct10

07Oct10

History of DNA discovery y 1953 y Friederich Miescher: Swiss scientist (1844-1895) credited with the first study of DNA o Discovered an acidic substance called nuclein in the pus of gangrenous bandages y Frederick Griffith: British Naval Officer (1879-1941) o Developed the transforming principle o Worked with two strains of Streptococcus pneumonia  Trying to make a vaccine  Two strains y R strain (rough) o Does not cause pneumonia when injected into mice o Non-virulent y S strain (smooth) o Virulent o Deadly in mice o Enveloped by a polysaccharide capsule o Griffith s experimental design Strain Treatment Outcome IIIS inject live mouse dies IIR inject live mouse lives IIIS Heat to kill, then inject mouse lives IIIS Heat to kill and mouse dies combine with IIR y Oswald Avery: (1877-1955) American physician and medical researcher o Known for discovery in 1944 that DNA is the material of which genes and chromosomes are formed o Avery s experimental design Strain Treatment Outcome IIIS heat killed, removed filtrate Carbohydrates, proteins And lipids using Extracting protocols

Illustration of Avery s experiment: the filtrate is sequentially treated with protease, RNase, and DNase to determine what molecule(s) is(are) essential to transformation The Result: DNA must be the transforming factor Evidence that DNA is genetic material in Eukaryotes  Mass of DNA in haploid vs. diploid cells. Protein is expected in the same amounts in both types of cells. DNA amount should vary  Human n cell has 3.25 picograms(pg) of D NA  Human 2n cell has 7.30pg

 Chicken n cell has 1.26pg  Chicken 2n cell has 2.49pg  Trout n cell has 2.67pg  Trout 2n cell has 5.79pg  Amphiuma n cell has 80pg  Amphiuma 2n cell has 160pg  Recombinant DNA studies  Splice a human gene (e.g. insulin producing gene in a bacterial genome) y Erwin Chargaff: (1905-2002) o Known for Chargaff s Rules  1. In natural DNA the number of guanine unites (Gs) equals the number of cytosine untis (Cs). The number of adenine units (As) equals the number of thymine units (Ts).

Ox Thymus Yeast Human sperm  Phage T2 Drosophila Maize

A 26 24 29

Molar proportions T C 25 21 25 14 31 18

G 16 13 18

2. Composition of DNA varies from one species to another. %GC 36% 45% 49.1%

Conclusions 1. The number of As is proportional to the number of Ts ( and also for Gs to Cs) 2. The sum of A & G (the purines) equals the sum of C & T (pyrimidines) 3. The % GC may or may not equal the % AT

y y

Rosalind Franklin (1920-1958) o Used X-ray diffraction to demonstrate the helical nature of DNA o Co-discovered by Maurice Wilkins (1916-2004) Francis Crick (1916-2004) o British physicist, molecular biologist, and neuroscientist James Watson (1928- ) o A geneticist, born in Chicago, was working in England with Crick in the physics department o Published discovery of DNA structure in 1953

Watson-Crick model: DNA is a double helix  Composed of 4 nucleotides (ntds)

 A stretch of DNA that is 1000 base pairs (bps)long can yield 41000 combinations  DNA is a right-handed double helix  Two strands are complementary  A double hydrogen bond to T  G triple hydrogen bond to C  Purines (A & Gs) bind to pyrimidines (C & Ts)  The two chains are anti-parallel  One complete turn of the helix is 3.2 nm long  Double helix is 2 nm wide  Space between bps on the same chain is 0.34nm=3.4 Illustrations of DNA demonstrating relative positions of A, T, C, and G

Biol 2153 with Dr. Brumfield y Read ch. 7 (p.207-219) y HW posted to Moodle y Exam II on Tuesday

12Oct10

DNA is composed of a string of nucleotides Mononucleotide= 1 ntd (1 base pair) di-nucleotide= 2 ntds (2 bps) tri-nucleotide= 3 ntds (3 bps) oligonucleotide= >3 ntds short chain of multiple bps, up to about 40 bps polynucleotide= a long chain of ntds DNA sequences are written in the 5 to 3 direction This is the direction in which genes are transcribed Ex. upstream 5 -AGCT-3 downstream 3 -TCGA-5 RNA y y y y

Ribonucleic acid Usually single-stranded Has the sugar ribose instead of deoxy-ribose Has the base pair uracil (U) instead of thymine (T)

There are organisms (viruses) that have single-stranded DNA as their genomes

Alternative forms of DNA y Under different conditions of isolation or nucleotide frequencies

y y y

B-DNA is right-handed double helix o Biological version of DNA A-DNA Z-DNA is left-handed double helix o Discovered by synthesizing an oligonucleotide composed of only Gs and Cs o Of no known biological value

DNA replication y It s critical that DNA be copied accurately y Over 3 billion bps in the human genome y Mutation of the BRCA1/BRCA2 genes causes an increase in the likelihood of breast cancer o BRCA1 mutation has a penetrance of 70% y Penetrance o Proportion of a population with a specific genotype that shows the expected phenotypes Watson and Crick noted that either strand could act as a template for the production of a new strand.

T A G C A T C G A G T C T C A G T A G C A T C G

Semi-conservative vs. non-conservative 1. A G T C A G C 2. T C A G T C G 1. 2. 3. 4. AGTCAGC TCAGTCG AGTCAGC TCAGTCG Conservative replication *not correct!*

Semi-conservative: Correct! y Un-zipping of original two to be used as separate scaffoldings to construct its mate Dispersive replication: Also, not correct! y Randomly matching chunks of the original two strands matched to newly constructed mates Meselsohn-Stahl Experiment (1958) y DNA marked with 15N or 14N and allowed to replicate

The resultant patterns of 15N to 14N will indicate if replication is conservative or semiconservative 1. Bacterial cells (E. coli) grown in the presence of 15N until all of the nitrogenous bases of DNA contain 15N 2. Transfer the cells to a medium that contains only 14N, thys all new DNA molecules synthesized will incorporate 14N 3. Remove portion of the cells after each generation and test them for contents via density centrifugation

DNA polymerases the enzymes that make DNA An enzyme that can synthesize a new DNA strand on a template strand In E. coli three different DNA polymerases have been isolated

5 3 elongation 3 5 exonuclease/proof-reading 5 3 exonuclease

DNA polymerase I Yes Yes Yes

II Yes Yes No Yes Yes No

III

Error rate: 10-8 to 10-9 errors per base pair replicated DNA synthesis is semi-continuous and primed by RNA. How DNA synthesis is initiated: y None of the three polymerases can initiate DNA synthesis y DNA synthesis starts with a primer o A short sequence that can be elongated by the polymerase  DNA strands unwinding y Catalyzed by an enzyme called helicase y DNA downstream becomes supercoiled y Relaxed by DNA gyrase  Primer is synthesized by primase y RNA y Okazaki fragments each have a RNA primer  Primers are removed by 5 3 exonuclease activity of DNA polymerase I, the enzyme fills in the space by synthesizing DNA  Fragments are linked by ligase Biol 2153 with Dr. Brumfield y Ch. 7 (p. 207-219) y No discussion section next week y Mid-term grades y HW 3 on Moodle (due on 27Oct10) 14Oct10

Exam II on Tuesday

In vivo function of DNA polymerases DNA polymerase I: removes the primer, fills in the gap left by the primer, proofreads while synthesizing DNA DNA polymerase II: involved in DNA repair of damage caused by external forces DNA polymerase III: main enzyme responsible for DNA synthesis Recombination at the molecular level y Best studied in E. coli and yeast y Protein called Spo11, makes a break in the DNA strand of one chromatid y Enzyme called RecA helps unwind the DNA of the non-sister chromatid and weaves the broken strand into it The double X-shaped DNA structure that results is called a double Holliday junction Strands disengage

SRU gene male determining gene on the Y-chromosome Mutations Heritable changes in DNA i) Germline (inherited) or somatic (non-inherited) (1) Can inherit a gene that makes you more susceptible to somatic mutations ii) Types (1) Forward mutations (a) Changes allele from wild-type to something else (2) Reverse mutations (a) Changes allele from something else to wild-type iii) Mutation classifications: (1) Substitutions (a) When a base at a certain position is mutated to one of the other three bases (i) Transition 1. Purine to a purine or Pyrimidine to pyrimidine (A to G) or (C to T) (ii) Transversion 1. Purine to pyrimidine or Pyrimidine to purine (iii) Transition/Transversion ratio should be 1:2=0.5 (2) Deletion (a) Removal of one or more ntd from the DNA (3) Insertion (a) Insertion of DNA (greater than or equal to one ntd) (b) Frameshift mutations are caused by indels (4) Inversions (a) A section of sequence inverted 180 degrees (5) Reciprocal translocations (a) Sections of two non-homologous chromosomes exchange places

Mutations in protein-coding genes 1) Synonymous (silent) substitutions GTC(valine) to GTA(valine 2) Non-synonymous substitutions a) Mis-sense mutations result in an amino acid change i) GTC(valine) to TTC(phenylalanine) b) Non-sense mutations changes a codon into one of the termination codons. This prematurely ends transcription.

Biol 2153 with Dr. Brumfield y HW 3/ Quiz 3 tomorrow y Read ch. 8 (p. 225-287) y Suggested HW problems #1,5,13,15,19,21,22,26

26Oct10

Adaptation Hypothesis y New mutations that occur directly in response to the new environment Spontaneous Mutation Hypothesis y Mutations that arise randomly Luria-Delbruck Fluctuating Experiment y Published in 1943 y E. coli infected with a phage (T1) y Grew E. coli in the presence of T1; plated E. coli out o Under Adaptation hypothesis E. coli grows sporadically at low numbers o Under Spontaneous Mutation hypothesis E. coli grows well or not at all y Actual data runs (# of colonies) 1. 2 2. 0 3. 3 4. 2 5. 1 6. 0 7. 165 8. 1 9. 0 10. 3

Mutant classifications 1) Spontaneous mutations natural mutations that arise during DNA replication a) Not in response to environmental perturbations i) Depurination: a purine is hydrolysed and replaced with a different nitrogenous base (1) Depurination occurs about 1000 times each hour in human cells ii) Deamination: removal of an amine group changes cytosine to uracil (1) Because it is U it pairs with A (adenine)

(2) Deamination changes a CG pair to a TA pair iii) Naturally occurring cosmic rays, X-rays, UV, and oxidation iv) Mistakes during DNA replication (1) In vitro error rates: one mutation in every 106 bps copied (a) Lower rates in vivo (2) The 3 -5 proof-reading function of exonuclease is the reason for the low mutation rate (3) Microsatellite nucleotide repeats have higher mutation rates (a) Fragile X syndrome (2nd most common genetic cause of mental retardation) ~ 1 in 4000 males, ~ 1 in 8000 females (i) Wild type allele: 5-54 repeats of CGG at FMR-1 (ii) Permutation allele: 55-200 repeats (iii) Diseased allel: >200 repeats 1. Women who have 60 CGG repeats have a 17% chance of passing on a diseased allele 2. Women who have 90 CGG repeats have a 50% chance of passing on a diseased allele 2) Induced mutations a) Changes in DNA that result from external or artificial factors (exposure to medical X-rays) b) Mutagens i) Any physical or chemical agent that raises the frequency of mutations above the spontaneous mutation rate c) UV radiation creates thymine/thymine dimers (T-T) i) Adjacent thymines become cross-linked to form a dimer and inhibits normal replication of DNA

Mutation repair y There are a number of other DNA repair systems, other than exonuclease o E.g. nucleotide excision repair system  UvrB and UvrC endonucleases nick strand containing T-T dimer  Damaged fragment released from DNA  DNA polymerase synthesizes new DNA strand in the gap  Ligase seals the end of the repaired strand

Biol 2153 with Dr. Brumfield Read ch. 8 (p. 255-287) Suggested problems: #1,5,13,15,19,21,22,26 Transcription
transcription translation (tRNA)

28Oct10

DNA

mRNA

protein

Transcription occurs in the 5 to 3 direction

Three Steps of Transcription: 1. Initiation a. Binding of RNA polymerase to double-stranded DNA b. The sequence of DNA needed for the initiation reaction is called a promoter c. The DNA site at which the first ntd is incorporated is called the start site/start point d. Enzyme starts by making several short transcripts (~10 bps each), then aborting transcription 2. Elongation a. RNA polymerase unwinds the DNA helix as it moves along the template b. As the enzyme moves, the RNA is displaced from the DNA template strand, which pairs with its original partner to re-form the double helix 3. Termination a. The point at which no further bases are added

More on the Three Steps: 1. Initiation a. RNA polymerase i. The holoenzyme (i.e. the active form of an enzyme) 1. Contains 4 subunits a. b. c. d. i. , , and subunits form the core enzyme ii. is called the sigma factor 1. the sigma factor acts to insure that RNA polymerase is only binding to the DNA at the promoter sites 2. When initiation succeeds the sigma factor is released and the core enzyme elongates the chain of DNA b. Promoters i. See Figure 8.12 ii. DNA sequences upstream of the start point of transcription iii. Some DNA sites in promoters are extremely conservative taxonomically 1. E.g. the -10 region (Pribnow box) is a conserved sequence of 6 ntds, TATAAT a. Found 10 bps upstream of the start site 2. E.g. the -35 region a. Found 35 bps upstream of the start site 2. Extension a. Synthesis occurs in 5 3 direction b. Synthesis usually initiated at a start codon (initiation codon)

3. Termination a. Occurs when RNA polymerase encounters a termination sequence i. Termination sequence is ~40 bps long ii. mRNA releases from DNA template strand iii. core RNA polymerase dissociates The above described process produces a primary mRNA transcript.

Biol 2153 with Dr. Brumfield Exam III on 23Nov10

02Nov10

Transcription in Eukaryotes 1. Three RNA polymerases (I, II, and III) a. Type II is responsible for synthesizing mRNA b. Type III is responsible for synthesizing tRNA c. Type I is responsible for synthesizing rRNA 2. Promoter contains a conserved sequence known as the TATA (actually TATAAAA) box approximately 30 ntds upstream of start site 3. Post-transcriptional modification a. Modification of primary transcript to produce a mature transcript 5 AUGCAGUACAUGCCUCGUAUCAA 3 b. Addition of 7-methylguanosine cap to 5 end (required for efficient translation of transcript into protein) 7mG cap 5 AUGCAGUACAUGCCUCGUAUCAA 3 c. Addition of ~100-200 As to the 3 end (poly-A tail) i. Function unknown 7mG cap 5 AUGCAGUACAUGCCUCGUAUCAA 3 poly-A tail Exon exon exon d. Introns spliced out of transcript (RNA splicing) and exons ligated

Mature transcript: 7mG cap 5 AUGCAGUAUGCGU 3 poly-A tail

RNA splicing mechanisms y Ribozymes

o The intron itself is capable of splicing itself o Known to occur in processing of transcripts for rRNAs Spliceosome o A complex of small nuclear RNAs (snRNAs) and proteins (small nuclear riboproteins(snRNPs)) splice introns from the primary transcript Polycistronic o Differential splicing of the same gene primary transcript can lead to different proteins after translation

Genetic code and Translation y y y y y y y The information in the mature RNA is coded as a series of three base pair codons With four different types of base pairs (A, C, G, U) there are 43 different combinations 64 ways There are only 20 amino acids o The genetic code is degenerate More than one codon for most amino acids Most mature mRNA begin with methionine (AUG) Mature mRNAs often end with one of three stop codons (UAA, UAG, UGA) Base pair substitutions at the third codon position are usually synonymous (silent) e.g. leucine (CUU, CUC, CUA, CUG)

Translation 1. Ribosome 2. tRNA 3. mature mRNA transcript 3 strategies: initiation, elongation, termination Transfer RNA y y y y y short (75-90 bps) have a characteristic clover-leaf shape amino acyl tRNA synthetases link amino acids to the 3 end of tRNA a tRNA that has an amino acid linked to it is referred to as a charged tRNA 32 different tRNAs that differ in anticodon sequence o Less than the 61 codons that code for amino acids  The other 3 are stop codons tRNA anticodons have a base (inosine) that can form complementary pairing with U, C, or A base pairs

Ribosome y y y y composed of two subunits each subunit is composed of one or more molecules of rRNA and an array of ribosomal proteins in prokaryotes, the large ribosomal subunis is composed of the following: 23S rRNA, 5S rRNA, and 31 ribosomal proteins also has a small subunit that contains the following: 16S rRNA and 21 proteins

S=Svedberg coefficient: a size measure based upon sedimentation velocity centrifugation

Translation in E. coli 1. initiation a. small ribosomal subunit binds to mRNA at ribosome binding site b. the first charged tRNA binds to mRNA at the P site c. the first tRNA is charged with a modified form of methionine called formylmethionine d. large ribosomal subunit binds to initiation complex (mRNA,tRNA, and small ribosomal subunit) 2. elongation a. second charged tRNA enters the A site b. peptide bond forms between the two amino acids (catalyzed by peptidyl transferase), uncharged tRNA leaves the ribosome c. the entire complex shifts to the right by three ntds i. the next charged tRNA enters the complex 3. termination a. elongation proceeds until it encounters a stop codon b. tRNA and polypeptide chain are released c. ribosome subunits separate

P site= peptidyl tRNA binding site A site= amino acyl tRNA binding site

Biol 2153 with Dr. Brumfield HW IV/Quiz IV next week Ch. 9 readings y y converting mRNA to cDNA (p.316-318) PCR (p.327-330)

04Nov10

Read Article on Moodle (Genomes by the thousand)

1. Site of transcription and translation a. Prok: All occurs in cell cytoplasm (no nuclear membrane) b. Prok: Can occur concurrently c. Euk: transcription and post-transcriptional modifications occur in nucleus d. Euk: mature transcript migrates to the cytoplasm where translation occurs at ribosomes 2. Initiation and translation a. Prokaryotes i. Begins at ribosomal binding sites on mRNA ii. These sites are defined by a conserved sequence called a Shine-Dalgarno box 1. AGGAGG a. Adjacent to the start codon (AUG) 2. Can be multiple ribosome binding sites on a single transcript b. Eukaryotes i. Each mature transcript has a single initiation site ii. Small ribosomal subunit binds to the methylated cap at 5 end (7mG) of mature transcript and then migrates to the initiation site (usually the start codon-AUG) iii. The mRNA region between the 5 methylated cap and the initiation codon is called the 5 -untranslated region (5 -UTR)

Details of RNA splicing y y y y Splice donor site o GU at the beginning of an Intron, followed by several purines Splice acceptor site o AG at the end of an Intron, preceded by 12-14 pyrimidines Branch site o CACUGAC, in the middle of an Intron ~60% of organisms (eukaryotic organisms) have exons that end in AG

y y

During splicing, the leading G of the intron is cut and reattaches to the last A of the branch site sequence to form a lariat . Finally, intron is cut at the splice acceptor site, intron leaves, and exons are ligated

Mature transcript 7mG-5 AUG AGG AUU CAC 3 -poly A tail

Start codon

In-frame mutation: Produces a similar protein to what was intended Out-of-frame mutation (frameshift mutation): Produces a radically different protein

DNA sequencing y Sanger sequencing o 21Kb (21,000 bps) y Next-generation sequences y Roche (454 instrument)-pyrosequencing o 1Mb (1,000,000 bps) y Illumina (Solexa) o 25Gb (25,000,000,000 bps) y Pacific Biosciences 1000 Genomes Project y Initiated in 2008 y Goal was to create a database of 95% of DNA sequence variants y Five population groups: Europe, South Asia, West Africa, Americas y Pilot phase of project o Sequenced 179 individuals y Published in Nature y Main results o Describe the genomic location and frequency in population of 15,000,000 SNPs  SNP: single nucleotide polymorphism o 1 million indels found o 20,000 structural variants o Each person carries 250 to 300 loss of function variants in genes  Mutations that cause loss of stop codon, gain of stop codon where one is not needed, or mutation in a splice recognition site

Functional Gene Variants y Synonymous SNPs y Non-synonymous SNPs

60157 68300

y y y y y y y

Small in-frame indels Stop losses Stop introducing SNPs Splice site disrupting SNPs Small frame shift indels Gene disrupted by deletions Total genes contained loss of function variants

714 77 1057 517 954 147 2304

First line of Nature article on 1000 Genomes Project : Understanding the relationship between genotype and phenotype is one of the central goals in biology and medicine.

Hypolactasia (Lactose intolerance) y Autosomal recessive trait y Genetic variant identified as SNP (C/T 13910), 14Kb upstream of the LCH gene on the long arm of chromosome 2 o LCH is lactase-phlorizin hydrolase y SNP in promoter region

Biol 2153 with Dr. Brumfield Hw IV/Quiz IV tomorrow Read Ch. 11 (pages 408-419) Lactose intolerance (hypolactasia) frequency in adults y Southeast Asians 98% y African Americans 79% y North American Jews 69% y Mexican Americans 55% y North Europeans 5% LCH

09Nov10

y SNP(C/T) is an autosomal recessive genotype y Located at the promoter region y Gene product: lactase y CC genotype= lactose intolerant y CT &TT genotype= lactose tolerant Penetrance: with what percentage of certainty can someone establish phenotype based on genotype alone Very few genes have a penetrance of 100% Polymerase Chain Reaction (PCR) y Amplify a targeted gene region y Produces many many copies of DNA

Process o DNA extraction  From blood, skin cells, any human tissue  Performed using commercial extraction kits  Takes about four hours or less  Result is a tube of total DNA y total DNA is nuclear and mitochondrial genomes

Mitochondria y Organelle involved in cell respiration y Mitochondrial genome is a circular DNA molecule o Haploid o Matrilineal inheritance PCR  Amplify a gene or DNA region of interest  Can amplify a gene region as short as ~50 bp long or as long as ~16Kbp Necessary ingredients (for total volume: ~12.5L) 1. Total DNA 2. Two PCR primers (oligonucleotides) a. Sit in DNA region that flanks the region to be amplified 3. dNTPs (A,C,G,T) 4. Taq (DNA polymerase from Thermus aquaticus) a. T. aquaticus resides in hot springs in Yellowstone 5. Buffer 6. H2O Thermocycler 1. Denaturation at 94 C for ~15 seconds 2. Primer annealing at 45-65 C for ~15 seconds 3. Elongation at 72 C ~15seconds-2minutes 4. Go back to step 1 5. Repeat 35-40 times After 22 cycles over 1 million copies After 32 cycles over 1 billion copies PCR invented by Kary Mullis  Won the Nobel Prize PCR product (amplicon) o Final product of PCR o Assume that the gene of interest is 1 Kbp long (1000bp) o Run through gel electrophoresis o Gel matrix is usually agarose or acrylamide o DNA has an overall negative charge o DNA will migrate through gel matrix when electrical current is applied o Purpose: to assay the efficacy of PCR

o o o

Small DNA molecules migrate faster Last gel well is used for a ladder to define the scale of molecular size Gel is soaked in ethidium bromide  Bromide intercalates with DNA  Fluorescent under UV light

Sequencing options:  Perform Sanger method on amplicon o Yields the bp sequence  Fragment analysis o Instead of assaying the differences in CAN sequence of gene regions, assay the differences in size of DNA region o Search for microsatellites  Regions of DAN with tendemly repeated sequences  Trinucleotide repeats (AGG)25  Microsatellite loci are DNA regions whose alleles vary in size depending on number of repeats  Microsatellite loci have a high mutation rate

Biol 2153 with Dr. Brumfield Read Ch. 20 (p. 677-682) Problems: 20-5, 20-13, 20-14 DNA polymorphisms (allelic variation in DNA) Four general classes Size SNP 1 bp Microsatellites 1-20 kb Indels 1-100 bp # of alleles 2 2-30 2 # of loci >100 million 200,000 ?

11Nov10

Mutation rates 10-9 10-3 10-9

Detection method PCR/sequencing PCR/fragment analysis PCR/fragment analysis

Candidate gene/locus a gene (gene region) thought to influence a phenotypic trait Hemophilia A y Pedigrees show that the trait is X-linked and governed by a single gene (Mendelian traits) y Researchers assumed that the gene must be involved in production of a blood clotting factor y Details of blood clotting cascade were figured out; looked for blood clotting factors that were absent in hemophiliacs y Hemophiliacs missing Factor VIII protein o Scientists have long had the ability to determine the amino acid sequence of proteins y Scientists developed a degenerate probe (oligonucleotides? y When the Factor VIII gene was sequenced in hemophiliacs, they found mutations that were correlated to the disease phenotype o Genomic library:

Entire genome chopped into little pieces, splice these pieces into a plasmid, these are then used to infect a culture of E. coli

Positional cloning  Combines linkage analysis with the use of DNA markers  Relies on a physical map of the genome with identifiable landmarks (e.g. SNPs and microsats)  Ideally one would know the genotypes of a set of markers spaced at 10 cM intervals throughout the genome 1.Human Genome is ~3000cM long; so one would need ~300 genetic markers to map the genome at 10cM intervals y This would amount to performing a 301-point linkage analysis, for humans o 300 separate 2 point crosses 2.Identify candidate genes y Once the gene is narrowed down to about ~1000kb region researchers examine the sequence and try to find genes There are ~25,000 genes in human genome assuming they are evenly spaced, there should be about 8 genes per 1000 kb In silico (computer) hybridization algorithms used to find promoters, open reading frames, start codons

3.Finding the gene responsible for the phenotype y Compare groups of individuals with normal and abnormal phenotypes. If the DNA sequence of transcription of a candidate gene is consistently correlated with the disease phenotype, this suggests the gene has been identified Polygenic traits trait is the outcome of allelic variation at many genes (up to 100s of loci)

SNP 1 (chr. 1) AG x GG (parents) (offspring) Child 1 AG has disease Child 2 GG healthy Child 3 AG has disease Correlation/linkage between A allele and the disease SNP 2 (chr. 3) CT x CC (parents) (offspring) Child 1 CT has disease Child 2 CC healthy Child 3 TT has disease Possible linkage with T