JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2005, p. 53325337 0095-1137/05/$08.00 0 doi:10.1128/JCM.43.10.53325337.2005 Copyright 2005, American Society for Microbiology.

. All Rights Reserved.

Vol. 43, No. 10

Evaluation of Universal Probes and Primer Sets for Assessing Total Bacterial Load in Clinical Samples: General Implications and Practical Use in Endodontic Antimicrobial Therapy
H. P. Horz,1 M. E. Vianna,1,2 B. P. F. A. Gomes,2 and G. Conrads1*
Division of Oral Microbiology and Immunology, Department of Operative and Preventive Dentistry & Periodontology, and Department of Medical Microbiology, RWTH Aachen University Hospital, Aachen, Germany,1 and Endodontic Area, Department of Restorative Dentistry, Piracicaba Dental School, State University of Campinas, Piracicaba, SP, Brazil2
Received 16 February 2005/Returned for modication 26 April 2005/Accepted 20 July 2005

By reexamining 10 previously published universal PCR assays using the ARB phylogenetic software package and database with 41,000 16S rRNA gene sequences, we found that they differed considerably in their coverage of the domain Bacteria. We evaluated the broadest-range real-time quantitative PCR protocol for its efcacy in measuring the antimicrobial effects of endodontic treatments. Bacteria in a tooths root canal both initiate and perpetuate periapical inammatory lesions (7). Thus, the principal goal of root canal treatment is to reduce the number of bacteria (1); conversely, the principal cause of treatment failure is considered to be the residual bacteria in the apical part of the root canal (18, 24). To evaluate the efcacy of any antimicrobial therapy, it is therefore important to determine the total number of bacteria in the root canal before and after treatment. For the enumeration of bacteria, the real-time quantitative PCR (RTQ-PCR) technology represents a promising alternative to the traditional but time-consuming and error-prone cultivation approach. However, the microbiota involved in endodontic infections is not a predened group of pathogens but makes up a complex, dynamic, and varying consortium of many oral bacterial species (5, 22, 23). Thus, any RTQ-PCRbased evaluation of an endodontic treatment ideally should be able to measure the entire bacterial load without missing certain taxa. While several PCR-based pitfalls due to cell lysis techniques or PCR conditions have been reported (31), the universality of universal PCR primers has been less fully evaluated. Numerous broad-range 16S rRNA gene-directed primers and probes have been developed with the intention of targeting all bacteria present in clinical or environmental samples (10, 21, 26); to this end, the quality of PCR assays is usually conrmed by testing representative species of a wide range of bacterial taxa. However, since it is impossible to empirically test all bacterial strains it cannot be proven whether those PCR assays considered to be universal actually encompass the entire bacterial spectrum. For example, some evidence exists that even the prominent pair of primers, 27F and 1492R (32), which target highly conserved regions of the 16S rRNA gene, are not completely universal (3, 20, 28). For every PCR-based assay for the detection of bacteria in clinical samples in general and for the enumeration of endodontic bacteria in particular, it is therefore crucial to know the taxon coverage of the PCR system used. We addressed this issue by evaluating in silico 10 previously published broad-range 16S rRNA gene-directed PCR assays using the most updated ARB database (13). ARB is a graphically oriented software package that comprises various tools for database handling and sequence analysis. The special advantage of ARB is the development of a structured database of more than 41,000 validated 16S rRNA gene sequences in an aligned format that includes all recognized division-level lineages of the domain Bacteria. The high number of interacting software tools integrated in ARB permits not only a general probe evaluation against all sequences but also a disclosure of all phylogenetic groups (including clinically relevant taxa) that are not covered. Using the function probe match in ARB, we determined for each assay the proportion of 16S rRNA gene sequences that perfectly matched with the primers and, if given, with the hybridization probe (Table 1). Although the site and the type of a mismatch are not equally critical for successful amplication in every case, the mere presence of a mismatch can lead to a biased retrieval of different 16S rRNA gene sequence types in a multitemplate PCR assay (25, 31) and, ultimately, to inaccurate quantication. Therefore, we considered only perfect matches (i.e., no mismatch between probe and target DNA) for estimating the universal capacity of the PCR assays. Using these criteria, we observed signicant differences among protocols, as seen in Table 1. The PCR assays used by Siqueira et al. (23), Corless et al. (2), and Khan et al. (8) showed only a low incidence of perfect matches (5 to 17%); and protocols published by Labrenz et al. (12) and Yang et al. (33) indicated perfect matches with 27% and 35% of the sequences, respectively. The RTQ-PCR described by Klaschik et al. (9) had a 41% coverage; however, the gram-positive and gram-negative organism-specic hybridization probes matched only a very small proportion of the sequences included in ARB. In contrast, we observed a much higher percentage of perfect matches with the protocols used by Takai et al. (26), Tseng et al. (27), Maeda et al. (14), and Nadkarni et al. (17), with the last protocol having the highest scores for both PCR ampli5332

* Corresponding author. Mailing address: Division of Oral Microbiology and Immunology, University Hospital (RWTH), Pauwelsstrasse 30, D-52057 Aachen, Germany. Phone: 49-241-9632141. Fax: 49-2418082483. E-mail: gconrads@ukaachen.de.

5333

TABLE 1. Overview of broad-range bacterial PCR assays and the proportion of perfect matches between primers (and the probe, if given) with the target molecule, determined by in silico analysis of all 16S rRNA gene sequences included in the ARB databasea
Assay no. Primer or probe Reference Sequence (5 3 ) Escherichia coli position Intended application as published

NOTES

% Perfect matchesb

Detection system

1 Reverse Probe 2 Reverse 3 Reverse p1370 4 Reverse Bac806R Probe Bac516F 5 Forward PLK1 TACGGGAGGCAGCAGT GGACTACYVGGGTATCTAAT TGCCAGCAGCCGCGGTAATACRDAG 787806 516540 343358 Klaschik et al. (9) 520535 489516 488517 943964 10831101 10521074 519536 907926 4665 518536 13271347 ACTCCCATGGTGTGACGG CGGTGAATACGTTCCCGGGCCTTGTAC AACGCGAAGAACCTTAC CGGTGTGTACAAGACCC 14031420 13691395 968984 13851401 Siqueira et al. (23) Corless et al. (2) Khan et al. (8) Labrenz et al. (12) Yang et al. (33) Forward Bac349F AGGCAGCAGTDRGGAAT 349365 AGICCCGIGAACGTATTCAC 13711390 Takai and Horikoshi (26) Forward p201 GAGGAAGGIGIGGAIGACGT 11751194 ACGTCRTCCMCACCTTCCTC 11751194 Tseng et al. (27) Forward GTGSTGCAYGGYTGTCGTCA 10481067 Maeda et al. (14) GGACTACCAGGGTATCTAATCCTGTT CGTATTACCGCGGCTGCTGGCAC 772797 506528

Forward

TCCTACGGGAGGCAGCAGT

331349

Nadkarni et al. (17)

RTQ-PCR detection of bacteria in carious dentine

74, 63

ABI PRISM 7700, TaqMan (ABIc)

RTQ-PCR detection of bacteria in dental plaque RTQ-PCR detection of bacterial pathogens RTQ-PCR detection of bacteria in various environments

73

GeneAmp 5700, SYBR green (ABI) 71

GeneAmp 5700, Sybr green (ABI)

64, 55

GeneAmp 5700, TaqMan (ABI)

Gram-specic RTQ-PCR detection of 17 intensive care unit relevant pathogens

41, 3 (gram-negative bacteria), 0.1 (gram-positive bacteria)

LightCycler (Roche)

Reverse PLK2 Probe ISN2 Probe ISP2 6 Reverse p1033R Probe UniProbe 7 Reverse Com2 8 Reverse K2R 9 Reverse Probe 10 Forward 968f Reverse 1401r Forward Forward ANA1F Forward Com1 Forward p891F TGGAGCATGTGGTTTAATTCGA TGCGGGACTTAACCCAACA CACGAGCTGACGACARCCATGCA CAGCAGCCGCGGTAATAC CCGTCAATTCCTTTGAGTTT GCCTAACACATGCAAGTCGA GTATTACCGCGGCTGCTGG CCATGAAGTCGGAATCGCTAG

TATTACCGCGGCTGCT CCGCAGAATAAGCACCGGCTAACTCCGT CCTAACCAGAAAGCCACGGCTAACTACGTG

RTQ-PCR detection of bacterial pathogens

39, 35

ABI PRISM 7700, TaqMan (ABI)

RTQ-PCR analysis of bacteria in aquatic systems T-RFLPd analysis of intestinal microora RTQ-PCR detection of bacterial pathogens

27

iCycler, SYBR green (Bio-Rad) 17

8, 7

ABI PRISM 7700, TaqMan (ABI)

DGGEe analysis of endodontic bacteria

a Only PCR assays that amplied fragments of less than 500 bp were considered in order to meet the ABI guidelines for RTQ-PCR. Only assays with primers located within E. coli positions 45 and 1430 (the testable range of the ARB sequences) were included in the study. The list of PCR protocols may not be complete. The ARB database currently consists of 41,019 16S rRNA gene sequences of at least 1,000 bp in length in an aligned format (last update, 2004). b Numbers indicate the proportion of 16S rRNA gene sequences that showed a perfect match with both the forward and the reverse primers; underlining indicates the proportion of perfect matches with both primers and the detection probe. c ABI, Applied Biosystems. T-RFLP, terminal restriction fragment length polymorphism. DGGE, denaturing gradient gel electrophoresis.

VOL. 43, 2005

5334

NOTES TABLE 2. Coverage of selected bacterial phyla by 10 different broad-range PCR assaysa
% Coverage of the following phyla (no. of sequences in ARB): Reference Proteobacteria (18,920) Actinobacteria (5,348) Firmicutes (8,022) Spirochetes (852) Chlamydiae (168)

J. CLIN. MICROBIOL.

Bacteroidetes (2,677)

Further phyla (5,032)

Nadkarni et al. (17) Maeda et al. (14) Tseng et al. (27) Takai and Horikoshi (26) Klaschik et al. (9)b Yang et al. (33) Labrenz et al. (12) Khan et al. (8) Corless et al. (2) Siqueira et al. (23)

86, 74 79 77 63, 56 67, 4 47, 42 33 29 16, 16 1

82, 72 85 77 82, 73 1, 0 1, 1 1 1 0 3

81, 69 72 73 80, 69 8, 1 55, 51 3 9 1, 1 20

1, 1 44 57 1, 1 1, 0 88, 85 1 1 0 0

0 1 79 0 0 82, 81 1 0 0 1

83, 76 61 62 87, 65 84, 1 16, 12 83 11 1, 0 0

16, 9 54 38 18, 8 20, 0 21, 17 40 9 1, 1 1

a Numbers indicate the proportion of 16S rRNA gene sequences within the particular phylum that showed a perfect match with both the forward and the reverse primers; underlining indicates the proportion of perfect matches with both primers and the detection probe. The assignment of sequences from uncultured bacteria to the indicated phylum was based on the topology of the universal tree implemented in ARB. b For the protocol of Klaschik et al. (9), underlined values within the actinobacteria and the rmicutes were retrieved by testing with the gram-positive organismspecic probe; all other phyla were tested by use of the gram-negative organism-specic probe.

cation and probe hybridization (i.e., 74% and 63%, respectively). However, as is evident from Table 2, no PCR protocol includes all taxonomic groups (i.e., phyla), and among themselves, the protocols vary strongly in their individual coverage. For example, although it is superior to all the other assays, the protocol of Nadkarni et al. (17) covers the phyla chlamydiae and spirochetes only poorly (Table 2), with the latter phylum including such clinically relevant genera as Treponema and Borrelia. These data reect the difculty of designing a broadrange protocol which would evenly cover all taxonomic groups. Because a perfect universal assay is lacking, we focused on the protocol of Nadkarni et al. (17) as the one that came the closest to being perfect (according to overall coverage) and whose general methodological characteristics (e.g., reproducibility and sensitivity) had been extensively validated (11, 15, 17). Since to our knowledge the RTQ-PCR technology has not so far been applied to the eld of endodontics, our aim was to test the protocol of Nadkarni et al. (17) for its principal applicability in quantifying endodontic bacteria. To accomplish this, we measured the bacterial load before and after applying two different intracanal irrigating substances. Thirty-two patients who presented for root canal treatment at the Piracicaba Dental School and who were otherwise healthy and who had not received antibiotic treatment during the previous 3 months were selected for this study. Their ages ranged from 19 to 63 years. All teeth selected were uniradicular and asymptomatic, did not respond to sensitivity testing, had not received previous

endodontic treatment, and showed radiographic evidence of periapical bone loss. The teeth were randomly divided into two treatment groups: the 2.5% NaOCl (group 1, n 16) and the 2% chlorhexidine (CHX) gel (group 2, n 16). The irrigating substances were prepared according to Vianna et al. (29). Access to the pulp chamber and sample collection (before and after endodontic procedures) were performed by the protocol described by Jacinto et al. (6). The initial samples were collected and transported to the laboratory within 15 min. Aliquots (100 l) were immediately processed for culture analysis, while 900 l was frozen ( 70C) for later molecular analysis. The working length (1 mm from the radiographic apex) was established with a radiograph and was conrmed with an apical locator (Novapex; Forum Technologies, Israel). The apical preparation was performed by using K les (DYNAFIDM, Bourges, France), followed by the use of Step-Back preparation. In the rst group, the root canal was irrigated with 5 ml of 2.5% NaOCl after each ling; and in the second group, the root canal was irrigated with 1 ml of the CHX gel and immediately after with 4 ml of physiological saline solution. The working time for the chemomechanical procedure was 20 min for all cases. Before collection of the second sample, the root canal was rinsed for 1 min with 5 ml of irrigating neutralizers (for the NaOCl group, 0.5% sodium thiosulfate, 0.5% Tween 80, and 0.07% lecithin). The time that elapsed for the subsequent processing of the second samples was identical to the time required for the initial sample set (see above). Finally, all teeth were lled and the access cavities were restored with

TABLE 3. Mean RTQ-PCR CT values determined for bacterial samples of 32 patients with periapical lesions before and after chemomechanical treatment with either NaOCl or CHX gel as the irrigating substancea
CT value (standard deviation) Detection format Before NaOCl group (n After 16) CT Before CHX gel group (n After 16) CT

SYBR green TaqMan

21.38 (2.77) 25.76 (4.70)

31.08 (2.59) 34.67 (1.86)

9.70 8.91

21.92 (2.47) 26.99 (3.01)

25.37 (1.72) 31.60 (2.63)

3.45 4.61

a Data acquisition was based on a threshold value of 0.2, which was approximately 10 times the background uorescence, dened as the mean uorescence values for the rst 6 to 15 PCR cycles. All samples were run in duplicate. The variation between duplicates was less than 3%.

NOTES

5335

TABLE 4. Bacterial load and percent reduction determined for root canal samples of 32 patients with periapical lesions before and after chemomechanical treatment with either NaOCl or CHX gel as the irrigating substancea
NaOCl group SybrGreen Sample Bacterial load (rRNA gene copy no.) % Reduction Before After Bacterial load (rRNA gene copy no.) Before After % Reduction TaqMan Sample SYBR green Bacterial load (rRNA gene copy no.) Before After % Reduction

CHX gel group

TaqMan

Bacterial load (rRNA gene copy no.)

% Reduction

Before

After

H1 H2 H3 H4 H5 H6 H7 H8 H9 H10 H11 H12 H13 H14 H15 H16 Mean Median

a

19 32 19 15 30 20 22 53 71 12 33 58 19 25 19 22 21 28 106 105 45 2 102 102 99.64 99.99 19 76 106 105 73 16

106 102 104 106 105 105 106 106 106 107 103 104 105 105 106 105 99.99 96.87 100 99.99 99.99 99.30 99.99 99.99 99.97 99.98 99.09 99.96 99.99 99.98 99.99 99.18 32 43 37 11 43 31 11 36 59 87 33 10 24 21 17 35 64 12 25 76 42 16 12 17 36 31 17 17 12 81 10 22 103 103

2 102 1 102 Negative 2 102 2 102 14 103 22 102 1 102 21 103 16 103 3 102 2 102 1 102 3 102 1 102 18 103

106 103 104 106 105 105 106 106 106 106 103 105 105 105 106 106

104 103 103 102 102 103 103 103 103 104 103 103 103 102 103 103

98.00 72.09 93.24 99.93 99.90 99.48 99.89 99.95 99.93 99.64 48.48 98.30 99.30 99.61 99.94 99.93 94.23 99.63

C1 C2 C3 C4 C5 C6 C7 C8 C9 C10 C11 C12 C13 C14 C15 C16 Mean Median

69 16 47 20 13 16 30 63 43 18 14 12 47 30 17 67 10 23

103 104 104 104 106 105 105 104 106 104 106 105 105 105 106 106 106 105

63 78 38 70 53 28 43 15 47 61 56 66 13 60 15 42 37 62

103 102 104 103 103 103 103 103 103 103 104 103 104 103 104 105 104 103

8.69 95.12 19.14 65.00 99.59 98.25 98.56 97.61 99.89 66.11 96.00 94.50 97.23 98.00 99.11 93.73 82.91 96.62

46 36 89 24 84 24 37 10 67 42 21 18 91 44 18 63

103 104 104 104 105 105 105 105 106 104 106 105 105 105 106 106

41 11 48 22 28 34 11 10 51 44 12 54 34 11 44 96

103 103 104 103 103 104 102 103 103 103 105 103 104 104 104 105

10.86 96.94 46.06 90.83 99.66 85.83 99.97 99.00 99.92 89.52 94.28 97.00 96.26 97.50 97.55 84.76

12 30

106 105

80 53

104 103

86.62 96.60

DNA from Prevotella nigrescens (ATCC 33563) was used to establish the standard curve for calculating the gene copy numbers. The linear scope of detection ranged from 102 to 108.

VOL. 43, 2005

5336

NOTES

J. CLIN. MICROBIOL.

2 mm of Cavit and resin (Z-250; 3M Dental Products, St. Paul, Minn.). In order to determine the RTQ-PCR-measurable scale of bacterial reduction, we used both the SYBR green and the TaqMan formats (i.e., SYBR green PCR master mix and TaqMan PCR master mix, respectively; Applied Biosystems). The PCR conditions used were different for both assays: (i) for the TaqMan format, denaturation at 94C for 10 min and 40 cycles of 94C for 1 min and annealing at 60C for 1 min and 45 s; (ii) for the SYBR green format, denaturation at 94C for 10 min and 40 cycles of 94C for 1 min, annealing at 60C for 1 min, and elongation at 72C for 1 min and 30 s, followed by a nal elongation at 72C for 5 min. Melting curve analysis was performed to assess reaction specicity. RTQ-PCR was performed with the aid of an ABI-PRISM 7000 sequence detection system (Applied Biosystems, Foster City, Calif.) by using optical-grade 96-well plates. Samples were run in duplicate in a total volume of 25 l. Final reaction mixtures contained 100 nM of each primer and 2 l of template DNA (approximately 50 ng of template DNA). Data acquisition and subsequent analysis were performed with ABI-PRISM 7000 SDS software (Applied Biosystems). DNA extracted from Prevotella nigrescens ATCC 33563 was used to establish the standard curve, based on a series of 10-fold dilutions. The bacterial load was quantied by determining the cycle threshold (CT), i.e., the number of PCR cycles required for the uorescence to exceed a value signicantly higher than the background uorescence. We assumed a threshold value of 0.2, which was approximately 10 times the background uorescence, dened as the mean uorescence values of the rst 6 to 15 PCR cycles. Since there is an inverse linear relationship between the logarithm of the initial bacterial DNA load and the corresponding CT value, the change in the CT value ( CT) from before and after chemomechanical preparation of the root canal gives a rst estimate of the bacterial reduction and, thus, of treatment efcacy. The mean CT determined by the SYBR green format in the NaOCl treatment group was 9.70, whereas it was 8.91 by the TaqMan assay (Table 3). In contrast, the mean CT determined by the SYBR green format in the CHX gel treatment group was only 3.45, whereas it was 4.61 by TaqMan analysis. These values could indicate a better bacterial clearance in the NaOCl group. It is important that determination of the precise cell number of a multispecies bacterial population is complicated by the wide range of rRNA operon numbers among different bacterial taxa (range, 1 to 10) (4, 17). The numbers (bacterial loads) calculated here are therefore referred to as rRNA gene copy numbers, since the ratio between rRNA genes and cells is unknown. The individual bacterial load differed considerably among samples, ranging from 3.2 103 to 1.2 108 rRNA gene copy numbers before treatment and from negative to 9.6 106 rRNA gene copy numbers after endodontic treatment (Table 4). In the CHX gel treatment group, the SYBR green- and the TaqMan-based detection formats led, with a few exceptions (samples C6 and C7), to similar results, which is in accordance with previous ndings (14). In the NaOCl treatment group, however, we observed a posttreatment trend toward lower gene copy numbers when we used the SYBR green format. This might largely be due to the SYBR green-specic effect on impairment of PCR efciency (19), which becomes more relevant with low template concen-

trations. Irrespective of the individual bacterial load, the antimicrobial reduction within treatment groups was largely consistent in both the SYBR green and the TaqMan analyses. While the microbial reduction in the NaOCl treatment group was in most cases greater than 99% (for the SYBR green format, mean of 99.64% and median of 99.99%; for the TaqMan format, mean of 94.23% and median of 99.63%), we observed a much lower microbial reduction in the CHX gel treatment group (for the SYBR green format, mean of 82.91% and median of 96.62%; for the TaqMan format, mean of 86.62% and median of 96.60%). This difference between the two treatment groups was statistically signicant by the nonparametric Mann-Whitney test (P 0.01). We also determined the bacterial load by parallel plate counting. In the initial samples, the numbers of CFU ranged from 4 102 to 1 106, with a median of 3.2 105 CFU. In contrast, the CFU counts in the posttreatment samples declined drastically to a median of 0 (range, from 0 to 6.8 102 CFU). While a direct comparison between the cell numbers retrieved by counting the numbers of CFU and the gene copy numbers determined by RTQ-PCR is not possible, the scale of microbial reduction can be compared since it is proportional to the initial values measured. The bacterial reduction determined by parallel cell counting was similar in both treatment groups (for the CHX gel group, mean of 99.6% and median of 99.9%; for the NaOCl group, mean of 99.9% and median of 100%). Thus, the difference between the treatment groups was much more pronounced when the reduction was measured by RTQ-PCR. This assay detects not only noncultivable species but also, to a certain extent, dead cell debris, a risk factor for a successful clinical outcome (16). The most broad-range RTQ-PCR might therefore be a valuable, complementary tool for the monitoring of anti-infective therapies. In conclusion, assessment of the total bacterial load in a sample by universal PCR will certainly have an increasing impact on future microbiology, and important formats will be RTQ-PCR and PCR-based microarrays for diagnostic purposes (30). We have shown that the universal PCR assays published previously might potentially detect only a small to medium proportion of the bacterial 16S rRNA gene sequences included in ARB. Therefore, every user of a PCR protocol should rst ensure its relevance for its intended application by retesting the probes and primers for covering the most important or dominant species in a particular sample. Even then, the results should be interpreted carefully, since the problem of nding a true universal PCR assay that reliably and invariably detects all bacterial species present in complex samples remains unresolved.
This work was supported by the CAPES (BEX 3410/04-8), FAPESP (02/13980-9), and the START program of the Faculty of Medicine, RWTH Aachen, Germany. We thank Ilse Seyfarth, Vreni Merriam, and Diane M. Citron for various forms of assistance.
REFERENCES 1. Bystrom, A., and G. Sundqvist. 1981. Bacteriologic evaluation of the efcacy of mechanical root canal instrumentation in endodontic therapy. Scand. J. Dent. Res. 89:321328. 2. Corless, C. E., M. Guiver, R. Borrow, V. Edwards-Jones, E. B. Kaczmarski, and A. J. Fox. 2000. Contamination and sensitivity issues with a real-time universal 16S rRNA PCR. J. Clin. Microbiol. 38:17471752. 3. Derakshani, M., T. Lukow, and W. Liesack. 2001. Novel bacterial lineages at

VOL. 43, 2005

the (sub)division level as detected by signature nucleotide-targeted recovery of 16S rRNA genes from bulk soil and rice roots of ooded rice microcosms. Appl. Environ. Microbiol. 67:623631. Farrelly, V., F. A. Rainey, and E. Stackebrandt. 1995. Effect of genome size and rrn gene copy number on PCR amplication of 16S rRNA genes from a mixture of bacterial species. Appl. Environ. Microbiol. 61:27982801. Gomes, B. P., E. T. Pinheiro, C. R. Gade-Neto, E. L. Sousa, C. C. Ferraz, A. A. Zaia, F. B. Teixeira, and F. J. Souza-Filho. 2004. Microbiological examination of infected dental root canals. Oral Microbiol. Immunol. 19: 7176. Jacinto, R. C., B. P. Gomes, C. C. Ferraz, A. A. Zaia, and F. J. Filho. 2003. Microbiological analysis of infected root canals from symptomatic and asymptomatic teeth with periapical periodontitis and the antimicrobial susceptibility of some isolated anaerobic bacteria. Oral Microbiol. Immunol. 18:285292. Kakehashi, S., H. R. Stanley, and R. J. Fitzgerald. 1965. The effects of surgical exposures of dental pulps in germ-free and conventional laboratory rats. Oral Surg. Oral Med. Oral Pathol. 20:340349. Khan, A. A., M. S. Nawaz, L. Robertson, S. A. Khan, and C. E. Cerniglia. 2001. Identication of predominant human and animal anaerobic intestinal bacterial species by terminal restriction fragment patterns (TRFPs): a rapid, PCR-based method. Mol. Cell. Probes 15:349355. Klaschik, S., L. E. Lehmann, A. Raadts, M. Book, A. Hoeft, and F. Stuber. 2002. Real-time PCR for detection and differentiation of gram-positive and gram-negative bacteria. J. Clin. Microbiol. 40:43044307. Kroes, I., P. W. Lepp, and D. A. Relman. 1999. Bacterial diversity within the human subgingival crevice. Proc. Natl. Acad. Sci. USA 96:1454714552. Kuboniwa, M., A. Amano, K. R. Kimura, S. Sekine, S. Kato, Y. Yamamoto, N. Okahashi, T. Iida, and S. Shizukuishi. 2004. Quantitative detection of periodontal pathogens using real-time polymerase chain reaction with TaqMan probes. Oral Microbiol. Immunol. 19:168176. Labrenz, M., I. Brettar, R. Christen, S. Flavier, J. Botel, and M. G. Hoe. 2004. Development and application of a real-time PCR approach for quantication of uncultured bacteria in the central Baltic Sea. Appl. Environ. Microbiol. 70:49714979. Ludwig, W., O. Strunk, R. Westram, L. Richter, H. Meier, Yadhukumar, A. Buchner, T. Lai, S. Steppi, G. Jobb, W. Forster, I. Brettske, S. Gerber, A. W. Ginhart, O. Gross, S. Grumann, S. Hermann, R. Jost, A. Konig, T. Liss, R. Lussmann, M. May, B. Nonhoff, B. Reichel, R. Strehlow, A. Stamatakis, N. Stuckmann, A. Vilbig, M. Lenke, T. Ludwig, A. Bode, and K. H. Schleifer. 2004. ARB: a software environment for sequence data. Nucleic Acids Res. 32:13631371. Maeda, H., C. Fujimoto, Y. Haruki, T. Maeda, S. Kokeguchi, M. Petelin, H. Arai, I. Tanimoto, F. Nishimura, and S. Takashiba. 2003. Quantitative real-time PCR using TaqMan and SYBR green for Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, tetQ gene and total bacteria. FEMS Immunol. Med. Microbiol. 39:8186. Martin, F. E., M. A. Nadkarni, N. A. Jacques, and N. Hunter. 2002. Quantitative microbiological study of human carious dentine by culture and realtime PCR: association of anaerobes with histopathological changes in chronic pulpitis. J. Clin. Microbiol. 40:16981704. Martin, H. 1991. Cleanliness, disinfection, and sterilization of the root canal. Curr. Opin. Dent. 1:734736. Nadkarni, M. A., F. E. Martin, N. A. Jacques, and N. Hunter. 2002. Deter-

NOTES

5337

18.

4. 5.

19. 20. 21. 22. 23.

6.

7. 8.

24. 25. 26. 27.

9. 10. 11.

12.

28.

13.

29.

30. 31. 32. 33.

14.

15.

16. 17.

mination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 148:257266. Nair, P. N., U. Sjogren, G. Krey, K. E. Kahnberg, and G. Sundqvist. 1990. Intraradicular bacteria and fungi in root-lled, asymptomatic human teeth with therapy-resistant periapical lesions: a long-term light and electron microscopic follow-up study. J. Endodont. 16:580588. Nath, K., J. W. Sarosy, J. Hahn, and C. J. Di Como. 2000. Effects of ethidium bromide and SYBR green I on different polymerase chain reaction systems. J. Biochem. Biophys. Methods 42:1529. Paster, B. J., F. E. Dewhirst, W. G. Weisburg, L. A. Tordoff, G. J. Fraser, R. B. Hespell, T. B. Stanton, L. Zablen, L. Mandelco, and C. R. Woese. 1991. Phylogenetic analysis of the spirochetes. J. Bacteriol. 173:61016109. Rolph, H. J., A. Lennon, M. P. Riggio, W. P. Saunders, D. MacKenzie, L. Coldero, and J. Bagg. 2001. Molecular identication of microorganisms from endodontic infections. J. Clin. Microbiol. 39:32823289. Siqueira, J. F., Jr. 2003. Taxonomic changes of bacteria associated with endodontic infections. J. Endodont. 29:619623. Siqueira, J. F., I. N. Rocas, and A. S. Rosado. 2004. Investigation of bacterial communities associated with asymptomatic and symptomatic endodontic infections by denaturing gradient gel electrophoresis ngerprinting approach. Oral Microbiol. Immunol. 19:363370. Sjogren, U., B. Hagglund, G. Sundqvist, and K. Wing. 1990. Factors affecting the long-term results of endodontic treatment. J. Endodont. 16:498504. Suzuki, M. T., and S. J. Giovannoni. 1996. Bias caused by template annealing in the amplication of mixtures of 16S rRNA genes by PCR. Appl. Environ. Microbiol. 62:625630. Takai, K., and K. Horikoshi. 2000. Rapid detection and quantication of members of the archaeal community by quantitative PCR using uorogenic probes. Appl. Environ. Microbiol. 66:50665072. Tseng, C. P., J. C. Cheng, C. C. Tseng, C. Wang, Y. L. Chen, D. T. Chiu, H. C. Liao, and S. S. Chang. 2003. Broad-range ribosomal RNA real-time PCR after removal of DNA from reagents: melting proles for clinically important bacteria. Clin. Chem. 49:306309. Vergin, K. L., E. Urbach, J. L. Stein, E. F. DeLong, B. D. Lanoil, and S. J. Giovannoni. 1998. Screening of a fosmid library of marine environmental genomic DNA fragments reveals four clones related to members of the order Planctomycetales. Appl. Environ. Microbiol. 64:30753078. Vianna, M. E., B. P. F. A. Gomes, V. B. Berber, A. A. Zaia, C. C. R. Ferraz, and F. J. de Souza. 2004. In vitro evaluation of the antimicrobial activity of chlorhexidine and sodium hypochlorite. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endodont. 97:7984. Vianna, M. E., H. P. Horz, B. P. F. A. Gomes, and G. Conrads. 2005. Microarrays complement culture methods for identication of bacteria in endodontic infections. Oral Microbiol. Immunol. 20:253258. von Wintzingerode, F., U. B. Gobel, and E. Stackebrandt. 1997. Determination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis. FEMS Microbiol. Rev. 21:213229. Weisburg, W. G., S. M. Barns, D. A. Pelletier, and D. J. Lane. 1991. 16S ribosomal DNA amplication for phylogenetic study. J. Bacteriol. 173:697 703. Yang, S., S. Lin, G. D. Kelen, T. C. Quinn, J. D. Dick, C. A. Gaydos, and R. E. Rothman. 2002. Quantitative multiprobe PCR assay for simultaneous detection and identication to species level of bacterial pathogens. J. Clin. Microbiol. 40:34493454.