Vous êtes sur la page 1sur 20

UNIVERSITE DABOMEY CALAVI ********* ECOLE POLYTECHNIQUE DABOMEY CALAVI ************ DEPARTEMENT DE GENIE DE BIOLOGIE HUMAINE (GBH2) ***************

EXPOSE DE GENETIQUE MOLECULAIRE ************* THEME

LES MUTATIONS GENOMIQUES

Prsent par :
MEHOUME Sabine

Au :
Professeur Clment AGBANGLA

Anne acadmique 2011 -2012

INTRODUCTION
Les mutations constituent un phnomne essentiel dans le domaine gntique. Elles permettent aux populations dorganismes vivants daugmenter leur variabilit, pour que la slection naturelle puisse agir efficacement et dboucher sur le processus que nous appelons volution biologique. En rsum, une mutation est un vnement ayant pour effet de modifier de faon permanente la structure du matriel hrditaire : lADN. Les biologistes distinguent trois niveaux de mutations : gniques, chromosomiques et

gnomiques. I- DEFINITION DE LA MUTATION Le terme mutation est utilis pour dsigner une modification irrversible de l'information gntique et hrditaire dans la squence d'un gnome. Autrement dit cest la modification brusque et irrversible du matriel gntique aboutissant une variation de la squence des bases azotes de lADN. Lorsqu'une mutation apparat dans une cellule sexuelle, ou gamte, elle est transmissible la descendance et, le plus souvent, stable. Une mutation peut tre sans consquence sur le gne touch et la protine pour laquelle il code (dans ce cas, elle passe inaperue),

mais

elle

peut

aussi

tre

l'origine

d'une

maladie,

d'un

dysfonctionnement ou d'une anomalie du dveloppement d'un tre vivant, voire tre ltale. De nombreuses mutations entranent une modification du phnotype (ensemble des caractres observables au niveau dun organisme. Lensemble des gnes caractrisant cet organisme tant appel gnotype) sans consquence dfavorable, ni favorable. linverse, mais trs rarement, certaines mutations peuvent savrer favorables si le gne ainsi modifi code pour une protine mieux adapte l'excution d'une fonction prexistante, ou si elle confre lorganisme un caractre lui assurant une meilleure adaptation son milieu. Les mutations sont la condition sine qu'anone de lvolution biologique.

II- LES DIFFERENTS NIVEAUX DE MUTATION A- Mutations gniques Les mutations gniques sont celles qui se produisent au niveau du gne. Lunit dune mutation au niveau gnique est une paire de bases chez les vivants mais chez le virus cest un nuclotide. Selon leurs modalits de modification du gne on distingue : Les mutations faux sens : ces mutations ponctuelles peuvent tre de type transition lorsquune base purine est remplace par

une autre base purine ou une base pyrimidique est remplace par une autre base pyrimidique. Une mutation faux sens est de type transversion lorsquune base purine est remplace par une base pyrimidique ou dune base pyrimidique par une base purique. Les mutations non-sens : le changement de nuclotide par un codon provoque le remplacement dun codon spcifiant dun acide amine par un codon stop. Cela entraine la production dune protine, Les mutations silencieuses : Ce sont des mutations qui ne pas modifient la squence dune protine a cause de la redondance du code gntique (le nouveau triplet code le mme acide amine que le triplet original),ou parce quelle touche une rgion non codante de lADN ou un intron .Cette mutation na aucune consquence sur le phnotype. Une mutation synonyme sert dsigner une mutation silencieuse qui touche un exon, sans changer la squence de la protine tronque. La mutation est dite: Neutre si elle ne modifie pas la squence en acides amins de la protine

Faux-sens si elle entrane la modification de la squence en acides amins de la protine Non-sens si elle entrane l'apparition d'un signal stop qui interrompt la fabrication de la protine. Lexemple ci-dessous illustre l'effet d'une mutation

ponctuelle non-sens dans le gne de la b-globine (un des gnes servant la fabrication de lhmoglobine). Le remplacement d'une seule base, C par un T au niveau du codon 39 du gne de la bta-globine provoque l'incorporation d'un signal stop la place de la glutamine, et donc larrt de synthse de la protine. Ceci aboutit une maladie, la b-thalassmie, caractrise par un dfaut de fabrication de lhmoglobine.

Frame shift mutation : Insertion : une (ou plusieurs) base est ajoute la squence d'ADN. Le reste du message est alors dcal, et donc en gnral perturb. Dltion : une (ou plusieurs) base est supprime de la squence d'ADN. De mme le reste du message

est dcal et la protine perd, dans la plupart des cas, sa fonctionnalit. Ce sont toutes ces anomalies de l'ADN que l'on cherche mettre en vidence dans le cas d'un test gntique.

Les mutations peuvent tre soit neutres (sans effet), soit bnfiques, soit nocives.Cette notion de mutation bnfique ou nocive peut varier en fonction de l'environnement ou d'autres paramtres. Par exemple, dans le cas de la couleur de la peau, une peau fonce protge du soleil sous les tropiques (risque plus faible de dvelopper un cancer de la peau). Au contraire, dans l'hmisphre Nord, elle favorise le dveloppement du rachitisme et ncessite chez l'enfant une prvention alimentaire par la vitamine D. Vous comprenez maintenant que l'ADN n'est important qu'en tant que support de l'information gntique ; ce qui dtermine l'effet nfaste ou non d'une mutation dans un gne, c'est son impact sur la protine code par ce gne, et ceci, dans un contexte environnemental donn. Dautre part, il n'existe pas de rgle tout faite permettant de prdire la gravit d'une mutation quel quen soit le type.

Pour garder l'analogie du langage de l'ADN, les mutations correspondent des erreurs de frappe. Prenons la phrase suivante en franais j'utilise de la colle . Diffrentes mutations possibles et leurs consquences sont dtailles ci-dessous

Comme modifications On voit que, suivant le contexte, et par le fait du hasard, certaines peuvent laisser la phrase inchange, changer son sens, la rendre dure lire, la rendre incomprhensible ou tronque donc illisible. Il en va exactement de mme pour l'effet des mutations dans l'ADN, les phrases correspondant des protines. Les mutations peuvent laisser ces dernires inchanges, les rendre moins actives ou inactives, leur confrer une fonction diffrente (potentiellement toxique), les rendre totalement inactives, les tronquer ou empcher leur production.

Mutations dynamiques Ces mutations voluent d'une gnration l'autre, elles correspondent des rptitions importantes de certains triplets au niveau de l'ADN (CAG et GGG). En gnral, le terme de mutation s'accompagne d'un prjug ngatif. Il voque en premier lieu quelque chose d'anormal se traduisant par des malformations ou une maladie. Il faut dire que la science-fiction avec son lot de mutants en tout genre a largement contribu l'ancrage de ce prjug.

B- Mutations chromosomiques Une catgorie plus rare de mutations est constitue de ce quon appelle les mutations chromosomiques. Des morceaux entiers de chromosomes sont dj existants. Dans un cas comme dans lautre, des dizaines, voire des centaines de gnes se retrouvent dplacs. Etant donn que la rgulation de lactivit dun gne dpend en partie de sa localisation dans le gnome, les mutations chromosomiques ont en gnral des effets extrmement dramatiques, car elles altrent la quantit de produit gnique, ou modifient le moment o un gne donn est activ o dsactiv.

1- Anomalies du nombre Trisomie 21 (syndrome de Down). Peut tre, due la non disjonction des Chr. 21 lors de la 1re division de miose, la non disjonction des chromatides la 2me division de miose ou mors de la premire mitose de luf. Le plus souvent ces incidents se produisent lors de la gamtogense chez la femme ge . Autres anomalies du nombre portant sur les autosomes : Excs : trisomie 13, 14, 15 ou 18 (dcs prcoce). Dfaut: monosomie des autosomes inconnus. Il existe des cas o les chromosomes se referment sur eux-mmes (ring). Ces

chromosomes se perdent.au cours des mitoses et les sujets deviennent monosomiques pour beaucoup de cellules. Esprance de vie trs brve. Anomalies du nombre portant sur les htronomes.(poly 3) Non-disjonction lors de la miose, des chromosomes sexuels. Phnotypes fminins: -Syndrome de Turner 45X (AA, XO): taille petite, pubert incomplte, niveau mental infrieur la moyenne. -Trisomie X 47X(AA, XXX): morphologie normale, fertilit faible. -Syndromes ttra ou penta X(AA, XXXX ou XXXXX): tats

pathologiques marqus. Phnotypes masculins: -Syndrome de Klinefelter (AA, XXY): grande taille, aspect fminin, pubert incomplte. -Double chromosome Y(AA, XYY): grande taille, calvitie prcoce. (Taux de criminalit recense plus importante que la moyenne, le fait d'tre pris rsultant d'un QI infrieur la moyenne !) Le sexe est dtermin par la prsence ou l'absence d'un chromosome Y. Le surnombre de X dtermine des tats pathologiques. 2- Anomalies de structure. Rsultent de cassures chromosomiques, entranent une perte ou un dplacement des segments isols et la formation de chromosomes remanis. 2.1- Dltions et duplications chromosomiques Aprs cassure, un fragment sans centromre ne suit pas la mitose. Le plus souvent pas viables. Certains cas pathologiques connus: -Maladie du cri du chat: perte du bras court du chromosome 5. -Dltion du bras court d'un des X chez la femme. Duplication: insertion d'un fragment de chromosome supplmentaire.

Peu d'effets. 2.2- Doubles ruptures chromosomiques -Dltion segmentaire: perte d'un segment, effets srieux. -Inversion: sujet normal. -Chromosomes en anneaux : pertes, donc monosomies. 2.2.1 Translocations

Passage d'un fragment de chromosome sur un autre, homologue ou non. Les translocations rciproques sont des cassures suivies d'un change entre deux chromosomes distincts. Les translocations par fusion centrique sont quilibres car il y a fusion de 2 chromosomes tlocentriques au niveau du centromre. A l'occasion de la translocation, il peut y avoir perte de matriel. Le plus souvent, la perte est ngligeable et les sujets ne manifestent

aucun trouble. Mais lors de la gamtogense il se forme des gamtes anormaux. Exemple de la translocation quilibre entre le chromosome 21 et le chromosome 13,14 ou 15. (Groupe D) Ce sujet peut former 6 types de gamtes:

- normal : (21 et D) - diplo 21 : (21-D) et (21) - transloqu : (21-D) - nullo 21 : (D) seul - diplo-D : (21-D) et (D) (rare) - nullo-D : (21) seul (rare) Aprs fcondation avec un individu normal, il y a quatre types d'embryons: -25% normaux -25% mongoliens (masqus car caryotype nombre normal) -25% porteurs d'une translocation -25% monosomiques 21. Ltalit. C- Mutations gnomiques Les mutations gnomiques ont lieu lorsquune configuration chromosomique entire est rplique, ou bien lorsque les

chromosomes de deux gnomes diffrents se fondent dans la mme cellule. Dans la nature, ces phnomnes, qui se produisent rarement, sont rsums sous le terme polyplodie .Un individu polyplode peut

natre de la fusion des gamtes de deux espces diffrentes, ou de la non rduction du nombre chromosomique pendant la miose. Les mutations gnomiques sont en gnral dsastreuses pour un

organisme, car elles bouleversent le fragile quilibre des fonctions de milliers de gnes. Malgr cela, il est frquent que de nouvelles espces de plantes voient le jour par polyplodie, alors que le phnomne est bien plus rare chez les animaux. Le premier grand type de mutation gnomique est le changement du nombre de chromosomes. Les changements du nombre de chromosomes sont gnralement rpertoris en deux groupes:

1) Les changements de jeux complets de chromosomes (euplodie aberrante) 2) Les changements de parties de jeux de chromosomes (aneuplodie).

Leuplodie aberrante
Les organismes possdant un nombre de chromosomes multiple du nombre haplode de chromosomes sont dits euplodes. Les euplodes possdant plus de deux jeux de chromosomes sont dits polyplodes. Les organismes qui possdent un nombre suprieur ou infrieur au nombre normal de jeux de chromosomes sont des polyplodes aberrants. On parle de triplodes (3n), ttraplodes (4n), pentaplodes (5n), hexaplodes (6n), etc. Un individu appartenant une espce normalement diplode, qui possde plutt un seul jeu de chromosome (n), est dit monplode.

Chez les polyplodes, il faut distinguer les autopolyplodes, composs de multiples jeux provenant dune mme espce ; des allopolyplodes, comportant des jeux de chromosomes issus de deux espces diffrentes ou plus. Les allo polyplodes ne se forment quentre des espces troitement apparentes. Il faut cependant garder lesprit que chez les allopolyplodes les diffrents jeux de chromosomes ne sont que partiellement homologues (homologues) et non parfaitement homologues, comme chez les autopolyplodes.

Un aneuplode est un organisme dont le nombre de chromosomes diffre du type sauvage par une partie du jeu de chromosomes. Gnralement, le jeu de chromosomes aneuplode diffre du type sauvage seulement par un chromosome ou par un petit nombre de chromosomes. Les aneuplodes peuvent comporter un nombre de chromosomes suprieur ou infrieur celui du type sauvage. La nomenclature des aneuplodes est base sur le nombre de copies du chromosome concerne dans l tat aneuplode. Par exemple, ltat aneuplode 2n 1 est appel monosomique, car il comporte une seule copie dun chromosome spcifique au lieu des deux copies prsentes chez son parent diplode. Laneuplode 2n + 1 est appel trisomique, 2n - 2 est nullisomique et n + 1 est disomiq

III-LES CAUSES DE MUTATIONS L'origine des mutations spontanes Les mutations sont des erreurs de copie du matriel gntique. Les grandes causes connues de mutations sont Les erreurs faites lors de la prparation la division cellulaire, Une trs grande partie des erreurs commises au cours de la rplication du gnome sont corriges immdiatement par des mcanismes complexes et efficaces de rparation de l'ADN, et seule une faible part de ces erreurs deviennent des mutations transmises aux cellules-filles. Une mutation spontane rsulte d'un processus naturel. On doit les distinguer des mutations induites qui rsultent dune interaction entre lADN et un agent extrieur ou mutagne. Cependant, dans les deux cas, la plupart des mcanismes sont identiques. Toutefois les mutations qui rsultent derreurs de rplication sont vraiment spontanes. 1-La fiabilit de la polymrase et les erreurs de rplication Une erreur de rplication avec mise en place dun nuclotide incorrect entrane une mutation lors de la rplication suivante. La frquence des erreurs de la polymrase influe sur la frquence des mutations spontanes. Il existe une 3-5 ex nuclase dont le rle est veiller aux erreurs dincorporation des nuclotides durant la rplication. Des mutations peuvent rsulter de la prsence dune exonuclase correctrice qui supprime tort des paires de bases insres par la polymrase. 2 - Des altrations affectant les bases Les bases de lADN sont lobjet daltrations structurales spontanes appeles tautomrisations. Chaque base peut exister sous deux formes : ainsi la guanine peut revtir la forme keto ou la forme enol . Ces deux formes sont appeles tautomres ou isomres structuraux. La forme keto est

plus courante. La forme enol peut apparatre par transfert dun proton et dlectrons. Les diffrentes formes de tautomres ont des proprits dappariements diffrentes. Si durant la rplication, G est sous la forme enol , la polymrase pourra positionner, en face, un T la place dun C parce que les modalits dappariement ont chang (et ce nest pas une erreur de la polymrase) . Le rsultat est une transition du dinuclotide G-C en A-T. Un autre processus de mutagnse est la dgradation spontane dune base. La damination de C en U est frquente. Elle peut tre rpare par un processus qui dtecte luracile. Dans le cas contraire, le U engendre en vis vis linsertion dun A et entrane une transition de G-C en T-A lors de la rplication. La dsamination de la mthyl-cytosine en T peut aussi intervenir. La mthyl-cytosine est prsente dans le gnome humain dans les squences 5CpG3 qui nexiste normalement pas dans les squences codantes des gnes. Cependant, si elle existe et si elle est dsamine en T, aucun systme de rparation ne peut le reconnatre (car T est une base normale). CpG est donc un point chaud . Le troisime type de mutation spontane est constitu par les dgts causs par les radicaux libres de loxygne. Ceux-ci, dans la cellule, proviennent du mtabolisme oxydatif et sont aussi gnr par des agents physiques tels que les radiations. Le rsultat peut tre la production de 8-hydroxyguanine qui sapparie tort avec A induisant une traversions de G-C en T-A. Un autre type enfin, est l alkylation(addition de groupes alkyl tels que mthyl, thyl ou propyl) sur des bases ou le squelette de lADN. Il peut en rsulter la formation de complexes par exemple S-adenosylmthionine avec l ADN. Les bases alkyles peuvent tre des points de rupture ou de mauvais appariements. 3 - Les mutations spontanes du cadre de lecture Ce sont des secteurs avec un nuclotide rpt :

Ex : 5AGTCAATCCATGAAAAAATCAG3 3TCAGTTAGGTACTTTTTT AGTC5 Il peut sagir dun glissement entre le brin conserv de lADN et le brin en cours de synthse lors de la rplication. De tels secteurs sont des points chauds .

IV-AGENTS MUTAGENES La mutation est un phnomne spontan, d des erreurs dans le processus de rplication de l'ADN. Mais, dans certaines circonstances, le taux de mutations peut tre augment considrablement par des facteurs physiques ou chimiques, appels agents mutagnes ; Certains types d'ondes lectromagntiques (rayons X, rayons gamma, les rayons ultraviolets). Des substances chimiques qui interagissent avec lADN (ou ventuellement avec l'ARN) tels que pesticides, drivs de benzne, solvants, etc. Des substances chimiques qui interagissent avec des lments impliqus dans la rplication de l'ADN, comme la colchicine qui empche la formation du fuseau achromatique d'o une altration du nombre de chromosomes. une modification du systme de rparation de l'ADN, qui cesse alors de corriger les erreurs de rplications.

CONCLUSION.

Les mutations sont sans doute le moteur de l'volution des tres vivants. Mieux connatre leurs mcanismes nous permettra de comprendre l'volution, mais dans une plus brve chance de soigner certaines maladies hrditaires. Si les gnes atteints sont connus, l'utilisation du diagnostic antnatal permet de reprer les anomalies gntiques.

BIBLIOGRAPHIE - www.google.bj . consult le 06/02/2012 - Programme du cours de gntique chimie-biologie-gologie 2me anne Universit de cocody Abidjan laboratoire de gntique UFR de biosciences. Consult le 10/02/2012 -Gelehrter T., Collins F. Principes de gntique molculaire et mdicale. Editions Pradel, Paris 1992.consult le 04/02/2012 -Catgories : Mcanisme de l'volution | Modification de l'information gntique consult le 12/02/2012