BLD 430 Notes

1/12/2012 3:31:00 PM

Eukaryotic vs. Prokaryotic cells Organization o Prokaryotic have circular chromosome Size of genome o Eukaryotic is larger (3.5 billion BP for humans) Cell walls Nucleus o Structure: contains DNA found on chromosomes, contained by nuclear membrane made of phospholipids o Organization Finite packet per cells o Features Mitosis Cell makes copy of itself Stages o 1) Interphase o 2a) Early prophase o 2b) Middle prophase o 2c) Late prophase o 3) Metaphase o 4a) Early anaphase o 4b) Late anaphase o 5) Telophase o 6) Restart with interphase Cytoplasm and components not evenly split Mitochondria has its own DNA o Uneven split, diseases Daughter cells have half of the DNA from the parent cell Daughter = haploid First 1 cell replicates its DNA, then it divides into 2 daughter cells Chromosome copies Haploid and diploid Humans are (normally) diploid = 2n Bigger chromosome: more genes

Meiosis Ploidy

o Greater chance of defect if deleted vs a small chromosome Ex) n, 2n, 2n+1, 2n-1, XXY Basic genetics Mendel o Segregation o Independent assortment o Dominant and recessive o Co-dominance o Sex linked (XX or XY) Phenotype: what you see/measure Genotype: what is on the genes Allele: variation of the gene that can show up Loci: location of the gene Do not do testing for genes with little/no variation Punnett squares for prediction Linkage o Gene frequency o Genes move through the population together Higher chance when closer together on chromosome o Recombination: part of chromosome gets stuck to another chromosome; rare with HLA Less recombination when more linkage/closer together on chromosome o Linkage disequilibrium: less than predictable movement of 2 genes because of linkage No random segregation o Lod scores Log of the odds of 2 genes or genes/diseases being linked Magic lod number = 3 If its almost 3, sample a larger population Lod of 3 = 1/1000 chance the genes are not linked Normal distribution Hardy-Weinberg equilibrium: rarely fits a real life scenario o Assumptions No natural selection advantage

Nucleic

Large population Random mating Multigenic traits o Chronic diseases o Many loci Epistasis: influences of genes on one another Pedigree diagrams o Family tree Acid Chemistry Molecules of life: nucleic acids ACGT for DNA ACGU for RNA A and G are purines C and T are pyrimidines Double helix o C and G form a triple Hydrogen bond o A and T form a double Hydrogen bond Central dogma o DNA replicates o then transcribes to RNA o then translates to protein Introns and exons: only exons read into protein Prokaryotes have no introns Splicing Codons are 3 base pairs, give code for amino acid Single-nucleotide polymorphism AUG: Methionine is the start codon 3 stop codons Code is redundant but not ambiguous

DNA code o 5 3 is the direction of reading o Sense vs anti-sense 5 3 is usually sense

Nucleic Acid Chemistry Secondary structure

o Impacts lab diagnostics o DNA binding back onto itself o Hairpin loops 5 ACGTACGTCCCCACGTGGGGACGT 3 ACGT is the looped portion, CCCC binds with GGGG o RNA: loop structures, tRNA Oligonucleotides o Short nucleic acid polymer/strand o Can bind to DNA strand, in multiple locations o Usually multiple strands floating around o If oligonucleotides bind to one another, it renders useless as a reagent and this is BAD, results in improper secondary structure Temperature of Melting (TM) o DNA wants to bind to something via Hydrogen bonding o Good estimation for short strands o A and T = 2, C and G = 4 o Ex) ACGTATATCGTGCAGT 9(AT) = 18 7(CG) = 28 18 + 28 = 46 degrees Celsius

Mutations Want to detect for disease prediction Change in base pairchange in codonchange in amino acidchange in proteinmutation 1) Point Missense: results in amino acid change 2) Silent Point Missense: no change in amino acid Nucleic 3) Frameshift: single base pair insertion 4) Frameshift: single base pair deletion 5) Nonsense: premature stop codon Acid Isolation Match isolation to assay needs o DNA and RNA properties, high molecular weight for assay Nucleic acid source = anywhere o Preferred (except for tumors): peripheral blood

10-20 micrograms DNA per 1mL whole blood o Buccal swabs = mouth cheeks, no RBCs o Back of tooth near root area o Fresh or frozen tissue, forensics Main steps o Cell lysis o Partition away proteins and lipids from DNA o Extract nucleic acids Cell isolation o Tissue samples Fixed: needs deparaffinisation with hear or solvents Fresh: easier to work with, dissociate cells o Peripheral blood: remove RBCs Membrane lysis o Use SDS detergent (found in shampoo) o Remove hemoglobin (protein) o Disrupt lipid association Protein removal o Most proteins are enzymes (some destroy DNA) o Use Proteinase K to render proteins nonfunctional and partition them from DNA Nucleic acid extraction o Organic: old method Phenol/chloroform: burns Precipitate with alcohol (alcohol and salt pairing is key) o Inorganic Salt precipitation Silica adsorption Anion exchange chromatography Isolating DNA (durable) o Binding to silica or glass Guandium tiocynate Inhibit nucleases Promotes binding Eluate using low salt buffer Uses gradients

o Magnetic isolation: popular High throughput (6-384 samples, automated) DNA binds to magnetic bead Need to keep proper orientation/alignment of well/plate Isolating RNA o Splicing & infectious disease problems RNA contains only exons, so its shorter than DNA (introns + exons) o RNA is delicate o Rnases big problem .1% DEPC blocks Rnase activity Bake glassware at 150 degrees Celsius for 4 hours Pretreat with .5M NaOH for 10 minutes Contaminants o Affects purity/quality o From sample or environment o Proteins: block assay enzymes = bad; slow the migration o Lipids o Carbohydrates o Phenol if organic extraction used Quality o 260#/280# = unitless ratio o 260 = true DNA optical density/peak absorbance o 280 = 50% pure DNA absorbance o Measure quality of DNA that comes out of isolation o Want high molecular weight DNA for assays (instead of sheared electrophoresis) o Ratio of 2 is 100% pure Acceptable as low as 1.4, generally 1.8-2 Ratio over 2 indicates RNA contamination o Mitochondrial DNA also isolated in addition to isolating cellular/nuclear DNA o Look at temperature and salt (sodium) concentration of assay solution when adding DNA, as it wants to form secondary structure

Nucleic Acid Isolation Quantity o Need X amount of DNA for given assay o Spectrometry: OD# o Fluorometry o Spot on a gel against standards with ethidium bromide stain o Spot on parafilm against standards with ethidium bromide stain o 1mL whole blood = 10-20mmg DNA o OD260 of 1.0 = 50 micrograms/mL o OD260 x 50mmg/mL x Dilution Factor = microgram/mL Convert to microgram/microliter THIS IS A CONCENTRATION: MAY NEED TO FIND VOLUME THAT ASSAY REQUIRES Storage o DNA: short term = 4 degrees Celsius, long term = frozen 100mM tris or tris EDTA (TE) Water o RNA best frozen at -80 degrees Celsius o Protect DNA from light and hydrolysis o Avoid re-freezings Example Problem OD260 = .09 OD280 = .05 Dilution = 1/200 1) What is purity? o .09/.05 = 1.8 good purity Enzyme 2) What is concentration in microgram/microliter? o (.09*50*200)/1000 = .9 microgram/microliter 3) Have 200 microliter stock, how much total DNA? o .9ug/uL*200uL = 180 micrograms DNA 4) Assay needs 250ng DNA, how much to add? o 900ng/uL = 250ng/X uL, X = .278 microliters Modification: from bacterial/biological enzymes, mimic environment Ligase

o Single strand antisense DNA o Oligonucleotides added as complement o Ligase connects oligonucleotides together/closes gap Polymerase o Reads template and makes more DNA o Start with single strand antisense DNA o Elongates in the 53 by adding complementary bases o Runs until the template strand runs out Adds an Adenosine at the end Reverse Transcriptase o Turn RNAcDNA o RNA has poly-A tail o Enzyme starts with poly-T Binds, then runs 53 Does not include introns Restriction Endonuclease o Cut within sequence o Uses recognition sequence: specific DNA base sequence o Cuts double stranded DNA into smaller segments o Sticky and blunt ends/cuts o # base cutter: lower number gives more cuts/bands ^base cutter # 4 base cutter would be ^4 o Bacteria use this as protective mechanism o Segments allowed to reassemble, may get different order Exonuclease o Opposite of endonuclease o Cuts its way in o Moves down a strand and removes bases o 5 or 3 exonucleases Other o Phosphatase: remove phosphate group o Kinase: adds phosphoryl group, labeling, 5 usually o Terminal Transferase: adds bases to 3, template independent o Cleavase: cuts unbound flaps of DNA in artificial structure Storage

o Avoid re-freezing o Enzymes added in excess to avoid having the enzyme be the limiting reagent o Re-create environment that enzyme is found in (bacteria) o Comes in glycerol Need 1/10 dilution Unit: how much enzyme to affect 1 microgram in 1 hour Comes as Units/microliter o Buffers Need 1/10 dilution Lab Math: Restriction Endonuclease Digest Amounts of o DNA o Enzyme o Buffer o Water: dilution o Adjust temperature: mimic bacterial environment; range o Adjust time: do excess Example 1 o Need to digest 5 micrograms DNA o DNA stock is .1 micrograms/microliter o Enzyme: EcoRI at 10 Units/microliter & assumed buffer is 10x o Use 4 Units/microgram DNA o How much of each reagent is needed in the test tube? 5 ugram / (.1 ugram/uliter) = 50 microliters DNA 5 ugram * 4 Units/ugram = 20 units enzyme 20 Units / (10 Units/uliter) = 2 microliters enzyme Add 6 microliters buffer 60 uliter total volume Add 2 microliters water Example 2 o DNA stock is 1 microgram/microliter o Need to digest 10 micrograms o Enzyme is 6 units/microgram o Enzyme stock is 40 units/microliter o Buffer is assumed 10x

o How

much of each reagent is needed in the test tube? 10 ugram / (1 ugram/uliter) = 10 microliters DNA 10 ugram * 6 units/ugram = 60 units enzyme 60 units / (40 units/uliter) = 1.5 microliters enzyme Add 1.5 microliters buffer 15 uliter total volume Add 2 microliters water

Example Problem OD260 = .04 OD280 = .02 Dilution = 1/200 Digest 10 micrograms DNA with 4 unit/microgram enzyme EcoRI at stock 4 unit/microliter; buffer assumed 10x How much DNA, enzyme, buffer, and water to add? o (.04 * 50 * 200) / 1000 = .4 microgram/microliter DNA o 10 microgram/(.4 microgram/microliter)=25 microliter DNA o 4 units/microgram * 10 micrograms = 40 units enzyme o 40 units / (4 unit/microliter) = 10 microliters enzyme o Minimum total volume: microliters of Enzyme * 10 Total volume: 100 microliters o 100 micoliters total / 10x = 10 microliters buffer o Make up the remaining difference with water: 55 microliter Electrophoresis Separate molecules by o Size: LMW migrates more than HMW; migration is exponential scale, origin o Charge o Secondary structure: acts like HMW, slinky Matrices o Agarose: protein, like jell-o o Polyacrylamide: plastic, longs changes cross-linked (not fully) Neurotoxin when liquid form o Proprietary: secret o Density in relation to separation/resolution Best at middle of the gel

Location of fragments on gel relative to size

Formats o Flat bed (submerged): agarose o Vertical (sandwich): polyacrylamide o Capillary: dont set stays liquid Selection based on needs o Size of interest o Number of samples o Range of resolution: mid-section of gel is best o Method of detection Process o Cast: pour and wait at least 30min Polyacrylamide: mix and polymerize Agarose: melt then gel o Load: including capillary o Run/electrophorese o Stain: to make visible o Document Running Buffer o Tris acetic acid EDTA o Tris boric acid EDTA o Tris = buffer o Acid = current source o EDTA = chelate o Made as stock then diluted o Do not use water Gel Loading o Calculate volume to be loaded Calculate volume of loading well, volume of comb Agarose can have multiple combs o Loading dye/buffer: colors and salt Colors: HMW and LMW Salt: dense, sinks in the wells Usually 6x o Total amount to load/5 = amount of dye (usually) o Heat is bad for resolution

Less heat = less time, but less samples

Agar Example Problem (w/v) Comb specific dimensions How thick of a gel needed to load sample plus loading dye Volume: 3 dimensions, given 2; 1 cm3 = 1mL Comb dimensions o .5 cm thick o 1.5mm wide = .15cm o ? cm depth Dye is 6x Want to load 120 microliters of sample and dye (100 sample, 20 dye) (from most recent example) o .12 mL = .5cm * .15cm * ?cm o Depth = 1.6cm: pour How to make matrix o Plate: 15cm by 15cm o 1.6 cm * 15cm *15cm = 360 mL will hold exactly 120 microliters(round to 400mL for added buffer) o Need to know density of gel (.5-4%) (w/v) Determines resolution Denser = better resolution for LMW o Gel is 1% = 1gram/100mL Have 400mL, need 4 gram Agar Buffer (TAE: 50x) o V1C1 = V2C2 400mL * 1x = ? mL * 50x 8mL buffer o 4 gram Agar, 8 mL buffer, 392 mL water Polyacrylamide Example Problem (v/v) Volume of well: 8cm * 7cm * .075cm = 4.2 mL Density: 6-30% (w/v) o Have 10% from 30% stock Buffer TAE is stock 50x How much water, buffer, and gel to add?

o Gel: 4.2mL(10%) = ?mL(30%) 1.4 mL Poly Gel o 4.2ml * 1x = ? mL * 50x .084 mL buffer o 4.2 - .084 1.4 = 2.716 mL water Also add Ammonium Persulfate and TEMED

Electrophoresis Prepare gel o Agar is w/v o Poly is v/v o Empirical calculations Staining o Smear: bad separation; not banded pattern o Protein remains at origin o Ethidium bromide: carcinogen, teratogen Intercalates with DNA (perma-bond) o SybrGreen: new, safer, no intercalation; grooves (dsDNA) o Silver: more sensitive, cant use agar; small fragments Documentation o Make assessments o Digital picture Capillary o No stain or documentation Already built in with lasers o Looks like heart monitor read out Pulsed Field o Non-clinical o For very big chunks of DNA: loop and break Use hexagonal CHEF to help this issue Done in .5% agar Similar to mechanical shearing

BLD 430 Notes

1/12/2012 3:31:00 PM

Electrophoresis Denaturing Gels o Formamide o Temperature (melting) Held constant o Denature dsDNA ssDNA o % formamide at which the dsDNA ssDNA Based on temperature of melting per DNA sequence o Large segments DNA Single stranded conformational polymorphism o Secondary structure Heteroduplex o Based on migration RFLP o Restriction fragment length polymorphism o Using restriction endonuclease o Cannot use for whole genomic o Fragments are additive Recovery of fragments

o Generate reagent o Be careful with UV light on DNA stained with Ethidium Bromide o Diffusion o Electrophoresis is not end point Hybridization Gel or blot Get DNA onto solid medium: gels do not work well Membrane Plastic: never fully cross-link Prepare gel for transfer o Poor transfer using polyacrylamide o Denature dsDNA to ssDNA with NaOH o Break ribose backbone Transfer o Vacuum: negative pressue o Capillary

o Positive pressure Immobilize: permanent; storage o Bake: vacuum o UV: faster, crosslink o Select size (basepairs) to transfer Block non-specific binding o Block open space Block reactive side chains o Non-fat dried milk Actual hybridization with probe o Probe is DNA RNA: made or bought Stringency/annealing o Want probe to bid with specificity: bind target o Let all bind then wash away o Let only the correct bind o Sensitivity: detect small amount o Specificity: o Signal strength: trade off Buffer o o o o o o o Blocking agent: milk, etc. Dextran sulfate: help probe bind to target Salt: buffer, sodium EDTA: chelate Mg cofactor in DNase SDS: detergent reduce non-specific binding Reduce temperature per % formamide Higher Tm with more G-C, L = length

Example problem o Digest 15 micrograms DNA with 4 unit/microgram EcoRI. DNA stock is 2.5 microgram/microliter, enzyme stock is 5 unit/microliter, and buffer is assumed 10x. Comb is .5cm by .15cm and gel thickness is .85cm. Will it fit? o 15microgram / 2.5ug/uL = 6 microliters DNA o 4unit/ug * 15 ug = 60 units / 5unit/uL = 12 microliters enzyme o Minimum total volume is 120 microliters

Buffer is 12 microliters Water is 90 microliters 120/5 = 24 microliters loading dye New total volume = 144 microliters .85cm * .5cm * .15cm = .06375 mL Short by 80.25 microliters for the well NO FIT o First digest with initial volume, then add loading dye for new volume o How to make fit Make gel thicker o o o o o Increase enzyme concentration Precipitate DNA then resuspend in smaller volume Use vacuum Hybridization o Labeling of the probes Isotopes: phosphorous Isotopes track certain bases Enzymes: like EIA Digoxygenin: color/light emission

o Protocols Southern: DNA-DNA Northern: RNA-DNA or RNA-RNA Western: Protein-Ab (not in DNA labs) DNA-Antibody RFLP: Restriction fragment length polymorphism Southern Original cut Need high molecular weigh DNA Assay depends on specific recognition sequence: different enzymes RE cuts o At site: stable, linkage o Outside of site: tracking, less stable No banding pattern without probe to track o 2/21/12: Example Problem Probes

Only track probe Look where cuts are made Best to bind probe directly on gene Extra gene (3 copies) is trisomy; normal is 2 copies o Can also lack gene copy o Should get karyotyping Different offspring o Has different father than one shown in RFLP test o Genetic mutation o Pre-analytic error: retest Cut may not occur or person can be missing loci Problems with RFLP o Stringency: sensitivity and specificity Look at traditional steps to see if there was error along the way Based on temperature of wash High: blank/few bands Low: many bands o Pattern not correlating with clinical picture: penetrance

Amplification: PCR Second generation nucleic acid testing Need correct combination of enzyme and probe Faster than RFLP Making copies of DNA Primer: oligonucleotides Template o DNA o RNA (need to make cDNA reverse transcriptase) RNA is only exons Polymerase o Taq = enzyme o From hot springs: bacteria Primers o Flank the region of interest o Want specificity

dNTPs o Any of the deoxy nucleotides/bp o dCTP fails first (stability) o Stabiligy: dilute solution is bad o dUTP used as contamination control or RNA preview Buffer o 10x o Enzyme came from bacteria Typical reaction o Proportions of reagents are most important o Most materials in excess: easier sensitivity o Low fidelity = losing specificity o Robustness = sensitivity Cycling o Denature: separate strands; 95 deg C o Anneal o Extension: 72 deg C o 25-25 cycles Plateau at 34-40 cycles when reagents deplete o Area of interest between 2 primers o First round/cycle gives long product o 3 step cycle is typical 2 step: denature and elongate If annealing and elongation temps are close o Very robust system Works well, may have contamination Need a reagent blank Put everything in the tube except template Contamination from carry over or extra template Inhibition Hemoglobin Inhibits enzyme Turns brownish Variations: control 1st denature cycle Manipulate specificity and sensitivity Initial first cycle starts at room temp

Ramping: time between moving between temps; want shorter time Hot start, touch down, UNG=weight control contamination for infectious disease testing o Detection: resolution Electrophoresis Small: polyacrylamide Large: agarose Spot product on membrane and probe Look for single band SSO/SSOP SSP: makes specific probe; product or no product Multiplexing Multiple reactions in same tube Worry about allelic dropout Polymerase favors smaller product SSP uses larger HMW as control PCR alternatives Ligase/OLA TMA or SDA/NASBA From microbacteria Natural amplification, isothermal Rolling circle amplification Branched chain Adding detection molecules Hybrid capture Synthetic probe In situ hybridization As it is placed On tissue Infectious disease; cytogenetics Cleavease: way to detect mutation MLPA: couples with OLA with amplification

Real-time PCR Third generation

1/12/2012 3:31:00 PM