L1

All Cells Store Their Hereditary Information in the Same Linear Chemical Code (DNA)

 All Cells Replicate Their Hereditary Information by Templated Polymerization

 DNA replication is semi-conservative

 The central dogma of biology

 All Cells Transcribe Portions of Their Hereditary Information into the Same Intermediary Form (RNA)

THE UNIVERSAL FEATURES OF CELLS ON EARTH

A Living Cell Can Exist with Fewer Than 500 Genes Humans have > 20,000

 The Tree of Life Has Three Primary Branches: Bacteria, Archaea, and Eucaryotes

L2

All Chemical Bonds --Covalent and Noncovalent -- Have Different Bond Strengths
determined by the Amount of energy needed to break that bond. (generally expressed in kcal/mol.)

A Cell Is Formed from Carbon Compounds

Cells Contain Four Major Families of Small Organic Molecules

02_15_organic molecules.jpg

A typical phospholipid in a cells membrante. (Glycerol in green)

02_20_lipid membranes.jpg

Nucleotides Are the Subunits of DNA and RNA

DNA is synthesized in the 5 to 3 direction

Amino Acids Are the Subunits of Proteins

PeptideBondRevisited Majorpointnotmentioned: Thepeptidebondisplanar,becauseithas doublebondcharacter

Review

CATALYSIS AND THE USE OF ENERGY BY CELLS

Biological Order Is Made Possible by the Release of Heat Energy from Cells

Photosynthetic Organisms Use Sunlight to Synthesize Organic Molecules

The Free-Energy Change for a Reaction Determines Whether It Can Occur

Enzymes Lower the Barriers That Block Chemical Reactions

For Sequential Reactions, GValues Are Additive

Two Sequential Reactions X Y Y Z

GValue= +5 kcal/mol

GValue= -13 kcal/mol

GValue= -8 kcal/mol
Allows favorable reaction to drive unfavorable reaction!

03_18_Reaction coupling.jpg

Catalysis does not change the amounts of reactants and products from an uncatalyzed reaction onlye the speed at which it reaches equilibrium

L3

Review

Basic Amino Acid Structure

Example: Alanine

Primary Structure

Schematicofgrowing polypeptidechain, depictingalternating locationandcharacter ofaminoacids (frequentlyfoundbut notuniversal)

The Shape of a Protein Is Specified by Its Amino Acid Sequence in multiple ways: Through variable rotation at two backbone bonds

The Shape of a Protein Is Specified by Its Amino Acid Sequence in multiple ways: Through non-covalent interactions between residues through space

Bythecoalescenceofhydophobicresidues,especiallyinthecore interiorofproteins

Proteins Fold into a Conformation of Low Energy

Openquestion:mightnotbetheLOWESTenergy Also:someproteinswontrefoldduetokineticfactors

The Helix and the Sheet Are Common Folding Patterns secondary structure

The Helix and the Sheet Are Common Folding Patterns secondary structure

Allostericmechanismforeffectingfeedbackinhibition

Protein Folding Levinthal Paradox: If a protein is made up of 100 amino acid residues, a total number of conformations is 3100 = 5 x 1047 However, folding of proteins takes place in msec to sec order. Therefore, proteins fold not via a random search Itisspeculatedthatinitiallythesecondary structuralelementsform,andthenthese groupswillattemptlongerrange interactions,andfinallytheuniquefolds willcollapsearoundthosepieces.

L4

A DNA Molecule Consists of Two Complementary Chains of Nucleotides

Antiparallel !

NEW
If given this sequence : CTCACCATGAGTCCCTGGCAGCCCCTGCTC

This means that what you have is: 5- CTCACCATGAGTCCCTGGCAGCCCCTGCTC 3

or in the double stranded form: 5- CTCACCATGAGTCCCTGGCAGCCCCTGCTC 3 3- GAGTGGTACTCAGGGACCGTCGGGGACGAG 5

Putting the other strand in proper orientation 5- GAGCAGGGGCTGCCAGGGACTCATGGTGAG 3

Alternatively, you could just write: GAGCAGGGGCTGCCAGGGACTCATGGTGAG

Specificity for Base Pairing between bases (A,C,G,T) controlled by hydrogen bonds

A-T: 2 H-bonds G-C: 3 H-bonds

EucaryoticDNAIsPackagedintoaSetofChromosomes

The composition of your DNA, by type:

Each DNA Molecule That Forms a Linear Chromosome Must Contain Three Things

1 2 3

Nucleosomes Are a Basic Unit of Eucaryotic Chromosome Structure

Nucleosomes Are ~ 1.5 turns around 8 histone proteins (two each of four types) plus a cap histone, H1 (not shown)

The Covalent Modifications and the Histone Variants Act in Concert to Produce a Histone Code That Helps to Determine Biological Function

Lysinesarepositively charged.Stronginteraction withnegativelycharged DNA.Genesaregenerally turnedoff.

Whenlysinesare acetylated,thepositive chargeisremoved,thus weakerinteractionswith DNA,andgenesare generallyturnedon.

Multispecies Sequence Comparisons Identify Important DNA Sequences of Unknown Function

Evolution in action - shows how gene duplication can create and forms. Prior to duplication, the single copy had to be optimized for both low and high oxygen tension. When two copies exist, one copy can optimize for low oxygen tension, and the other for high oxygen tension.

L5

Chapter 5

DNA REPLICATION MECHANISMS

Replication Basics
Replication requires an Origin site Replication requires a Primer Replication requires a Template Replication adds nucleotides in a 5->3 direction

Garland Science 2008

Base-Pairing Underlies DNA Replication and DNA Repair

The DNA Replication Fork Is Asymmetrical

06_12_asymmetrical.jpg

Steps needed to complete lagging strand synthesis

LigaseenzymessealnicksinDNAbackbones

Sealing a broken phosphodiester bond. DNA ligase uses a molecule of ATP to activate the 5 end at the nick (step 1) before forming the new bond (step 2). In this way, the energetically unfavorable nick-sealing reaction is driven by being coupled to the energetically favorable process of ATP hydrolysis.

COMPLETION OF DNA REPLICATION IN CHROMOSOMES

Telomerase Replicates the Ends of Chromosomes

The High Fidelity of DNA Replication Requires Several Proofreading Mechanisms

The Most Common Form of DNA Damage is the Thymine Dimer induced by UV light

If the cell didnt know which strand to repair:

DNA REPLICATION MECHANISMS

A Strand-Directed Mismatch Repair System Removes Replication Errors That Escape from the Replication Machine

Single strand breaks can use two methods of repair

Method 1 Base excision repair

Method 2 Nucleotide excision repair

Figure 5-48b Molecular Biology of the Cell ( Garland Science 2008)

Mechanism of Double Strand Break repair involves strand invasion of sister chromatid

Retrovirus HIV and AIDS

L6

Transcription and Translation

( DNA RNA) ( RNA Protein)

Making RNA

Degrading RNA Making protein

Degrading protein

Portions of DNA Sequence Are Transcribed into RNA

Transcription Produces RNA Complementary to One Strand of DNA

07_02_Genes express.jpg

07_03_RNA _v_DNA.jpg

Cells Produce Several Types of RNA

TranscriptionRNA polymerase

Transcription-Depends on DNA sequence

Bacterial

Signals Encoded in DNA Tell RNA Polymerase Where to Start and Stop

07_09_2_bacterial gene.jpg

Figure 6-22a Molecular Biology of the Cell ( Garland Science 2008)

RNA Splicing Removes Intron Sequences from Newly Transcribed Pre-mRNAs

Alternative Splicing can produce different versions from same gene

Figure 6-27 Molecular Biology of the Cell ( Garland Science 2008)

Location for transcription and translation

Reading frame is crucial

tRNA converts the nucleotide code to the amino acid code

Amino Acids Are Added to the C-terminal End of a Growing Polypeptide Chain

Ribosome contains one mRNA binding site, and three tRNA biding sites
Exit, peptidy, aminoacyl

Essential Cell Biology ( 2009 Garland Science)

 The RNA Message Is Decoded in Ribosomes

Stop Codons Mark the End of Translation

 Poly-Ubiquitin is a signal for degradation, ATP powers threading of protein into proteasome, where the protein is digested

L7

Gene Expression Can Be Regulated at Many of the Steps in the Pathway from DNA to RNA to Protein

Chapter 7

Transcriptional control is based on a genetic switch, which requires two basic components:
Short Stretches of Defined DNA Sequence Gene Regulatory Proteins that Recognize and Bind to the Sequence

Different base pairs in DNA can be recognized from their edges without the need to open the double helix.

(bound to carbon, unavailable) (hydrophobic patches)

DNA recognition codes

Unique patterns in the major groove for DNA binding proteins to recognize

Transcription regulators contain DNA-binding motifs bind to the major groove of a DNA helix

DNA-Binding Zinc Finger Motifs offer the best chance to engineer new DNA binding specificities as the fingers are essentially modular.

The Tryptophan Repressor Is a Simple Switch That Turns Genes On and Off in Bacteria

The proteins that Make this molecule A very important conceptual example

When the molecule is abundant It prevents the proteins from being made

This previous example in L3 was a case of shutting down a protein's activity

Allosteric effect of Ligand binding

The Cell Regulates the Catalytic Activities of its Enzymes

Feedback Inhibition: Products at the End of a Molecular Pathway Can Inhibit an Enzyme at an Earlier Point in the Pathway.

A Transcriptional Activator and a Transcriptional Repressor Control the Lac Operon

Gene Activator Proteins can Work Synergistically

Eucaryotic Gene Repressor Proteins Can Inhibit Transcription in Various Ways

 Simple Gene Regulatory Circuits Can Be Used to Make Memory Device

Chapter 7

Transcription circuits allow the cell to carry out logic operations - feed-forward loop to measure duration

A and B are both needed to make Z

The genetic toggle switch: an early synthetic gene circuit

Built at Boston U. by Gardner and Collins: 1999

Two stable states of gene expression. Switchable. Built in bacteria (later in yeast and mammals)

Methylation of promoters can turn genes off

Gene on

Gene off

Methylation of a C in a CpG island

DNA Methylation is inherited and can lead to disease

DNA-Binding proteins bound to DNA can also be inherited

08_24_chromatin.state.jpg

Methylation and protein inheritance referred to as Epigenetics

 4 examples of translational regulation

Identify DNA sequences bound by Transcription Factors A gel-mobility shift assay: The mobility of the DNA fragment shifts upon binding to proteins. This DNA mobility can be detected with polyacrylamide-gel electrophoresis.

Purifying Transcription Factors-DNA Affinity Chromatography

Sequence-Specific DNA-Binding Proteins

Identifying DNA sequences bound by transcription factors-chromatin immunoprecipitation