Vous êtes sur la page 1sur 263

Biologa de 2 de bachillerato

Robert Hooke

Jos Luis Snchez Guilln IES PANDO

Oviedo 2010

2010 I.E.S. PANDO Departamento de Biologa-Geologa OVIEDO-Asturias (ESPAA).

NDICE

BLOQUE I: BIOMOLCULAS 1. Mtodos de estudio de la clula......................... 6 1. Bioelementos y biomolculas: Generalidades............. 10 2. El agua y las sales minerales........................... 7 3. Los glcidos.......................................... 12 4. Los lpidos........................................... 10 5. Las protenas......................................... 14 BLOQUE II: LA CLULA (ESTRUCTURA Y METABOLISMO) 1. Origen de los seres vivos y Teora celular............. 11 2. Membranas y transporte.................................11 3. El medio interno celular................................3 4. Sistemas de membranas...................................7 5. Metabolismo: Enzimas....................................8 5a. Fotosntesis y quimiosntesis....................... 15 5b. Respiracin celular y fermentaciones................ 17 BLOQUE III: INFORMACIN CELULAR 1. El ncleo celular...................................... 5 2. Los cidos nuclicos...................................10 3. El ADN como portador de la informacin gentica......... 3 4. Trascripcin y traduccin de la informacin gentica... 11 5. La replicacin del ADN..................................3 6. El ciclo celular: Mitosis...............................8 7. Los cromosomas metafsicos..............................4 8. La meiosis............................................. 7 9. Las mutaciones........................................ 10 10. La herencia gentica: Mendelismo...................... 17 11. Gentica aplicada......................................5

pags pags pags pags pags pags

pags pags pags pags pags pags pags

pags pags pags pags pags pags pags pags pags pags pags

BLOQUE IV: MICROBIOLOGA Y BIOTECNOLOGA 1. Microbiologa y biotecnologa.......................... 29 pags BLOQUE V: INMUNOLOGA 1. Inmunologa........................................... 22 pags

I) Biomolculas

1) Mtodos de estudio de la clula

1-1
MTODOS DE ESTUDIO DE LA CLULA

CLASIFICACIN Clasificaremos los mtodos que se utilizan para el estudio de la clula en dos grandes grupos: I) Tcnicas para el estudio fisicoqumico: sirven para conocer la composicin y relacionar esta composicin con las estructuras celulares. Estos mtodos son: a) Centrifugacin b) Cromatografa c) Electroforesis d) Cultivos "in vitro" II) Tcnicas para el estudio morfolgico de la clula. Nos permiten conocer cmo es su forma, su tamao y su estructura. Son, fundamentalmente: a) Microscopa ptica b) Microscopa electrnica 1) Microscopio electrnico de Trasmisin (MET) 2) Microscopio electrnico de barrido (MEB)

I) TCNICAS PARA EL ESTUDIO FISICOQUMICO DE LA CLULA Este tipo de mtodos se utilizan para el aislamiento, localizacin e identificacin de las sustancias que constituyen la materia viva. Presentan dos problemas principalmente: a) Los componentes de un ser vivo se encuentran formando mezclas muy complejas. b) La mayora de las sustancias que encontramos en los seres vivos son, a su vez, de una gran complejidad. Pensemos,por ejemplo, que una sola de los varios miles de protenas que contiene una clula puede estar formada por ms 5000 aminocidos. Pasemos a continuacin al estudio de cada uno de estos mtodos.

J. L. Snchez Guilln

Pgina I-1-1

I) Biomolculas

1) Mtodos de estudio de la clula

A) CENTRIFUGACIN Consiste en la separacin de los componentes de una mezcla en funcin de las diferencias entre las velocidades que presentan al someterlos a elevadas aceleraciones (g). Esto se consigue haciendo girar la mezcla en un rotor a un gran nmero de vueltas por minuto. Los aparatos empleados con este fin se denominan ultracentrfugas. Esta tcnica requiere los siguientes pasos: 1) FRACCIONAMIENTO U HOMOGENEIZACIN: El material biolgico, por ejemplo: un fragmento de tejido del hgado, es triturado para disgregarlo y romper las membranas celulares. La rotura de las membranas deja en libertad los orgnulos celulares y el contenido del hialoplasma. Si la homogeneizacin se realiza suavemente, los orgnulos permanecern intactos. Obtendremos as una "papilla" que estar compuesta de restos de membranas, orgnulos celulares, ncleos, molculas libres y agua.
Fig. 2 Centrfuga. Fig. 1 Homogeneizador.

2) CENTRIFUGACIN: Las ultracentrfugas son mquinas que consiguen velocidades de rotacin muy elevadas, hasta 500.000 v/mn. En el interior de estos aparatos se alcanzan grandes aceleraciones que se miden en g (1g=9,8 m/s2). En una ultracentrfuga pueden alcanzarse hasta 100.000 g. Los materiales biolgicos sometidos a estas aceleraciones se desplazan hacia el fondo de los recipientes que los contienen con velocidades que dependen de su masa, de su forma y volumen, y de la naturaleza del medio en el que se realice la centrifugacin. B) CROMATOGRAFA Se fundamenta en la separacin de los componentes de una mezcla por sus diferencias de absorcin. stas diferencias van a ser debidas a las fuerzas de Van der Wals que se establecen entre los componentes de la mezcla y una sustancia que acta de fase estacionaria. Segn la naturaleza de la fase estacionaria, tendremos los siguientes tipos de cromatografa: 1) CROMATOGRAFA SOBRE PAPEL: Se emplea para la separacin de sustancias qumicas que presenten propiedades muy Fig. 4 Cromatografa de gases. parecidas. Se opera de la siguiente manera. Una pequea cantidad de la mezcla a separar se deposita sobre un fragmento de papel poroso en el que quedar embebida. A continuacin se
Fig. 3 Cromatografa de papel.

J. L. Snchez Guilln

Pgina I-1-2

I) Biomolculas

1) Mtodos de estudio de la clula

introduce el borde del papel en una sustancia en la que sean solubles los componentes de la mezcla que queremos separar. El disolvente se desplazar por capilaridad y los ir arrastrando. Los componentes de la mezcla viajarn ms o menos rpido segn establezcan fuerzas ms o menos grandes con las molculas del papel. Para observar los componentes ya separados se emplean reacciones coloreadas especficas. 2) CROMATOGRAFA DE GASES: El aparato consiste en un serpentn largo y delgado cuyas paredes estn impregnadas de un lquido (fase estacionaria). La mezcla a separar se vaporiza y atraviesa el serpentn transportada por un gas. La fase estacionaria retiene ms o menos los diferentes componentes de la mezcla. stos se detectan cuando al atravesar una llama entran en combustin, lo que aumenta la conductividad elctrica del detector. Este mtodo tiene la ventaja de necesitar pequesimas cantidades (0,05 mg) y es capaz de separar sustancias muy parecidas qumicamente; por ejemplo: cidos grasos,azcares u hormonas. C) ELECTROFORESIS En este mtodo, la mezcla a separar se deposita en una cubeta sobre un soporte de tipo poroso (acetato de celulosa o tambin gel de almidn). A continuacin se establece una diferencia de potencial entre los extremos del soporte. Las sustancias que componen la mezcla se desplazarn en funcin de su carga elctrica. Naturalmente este mtodo se emplear con sustancias que presenten cargas elctricas (protenas y cidos nuclicos) D) CULTIVOS IN VITRO Estos mtodos nos van a permitir mantener lneas celulares en el exterior de un organismo en condiciones favorables a su multiplicacin. La gran ventaja va a ser la facilidad para el tratamiento del material biolgico y su estandarizacin. Las clulas extradas deben mantenerse para su cultivo en un medio con las condiciones fsicas y qumicas adecuadas y suministrarles aquellas sustancias que ellas no son capaces de sintetizar. En la actualidad se venden medios de cultivo concretos para cada tipo celular y que permiten mantener los cultivos durante largos perodos de tiempo.
Fig. 5 Cubeta para electroforesis.

Fig. 6 Cultivo de bacterias en cpsula de petri.

II) MTODOS MORFOLGICOS Los mtodos morfolgicos nos van a permitir la observacin directa de la estructura celular. El ojo humano puede distinguir a 25 cm dos objetos separados entre s 0,2 mm. ste es el poder separador o poder de resolucin del ojo. Las clulas de mamfero suelen tener unos 0,01 mm, por lo que no es posible verlas a simple vista y mucho menos observar en ellas detalles estructurales. El microscopio va a permitir su observacin al aumentar el poder de resolucin del ojo.

J. L. Snchez Guilln

Pgina I-1-3

I) Biomolculas

1) Mtodos de estudio de la clula

CLASES DE MICROSCOPIOS A) MICROSCOPIO PTICO O FOTNICO 1) FUNDAMENTO: Funciona de la siguiente manera: Una fuente luminosa enva rayos de luz a una primera lente, llamada condensador, que concentra los rayos de luz sobre el objeto a observar. Estos rayos atraviesan el objeto y una lente denominada objetivo da una imagen aumentada de ste. Una segunda lente, el ocular, vuelve a aumentar la imagen dada por el objetivo. Esta ltima imagen es la que ser recibida por el observador. 2) PREPARACIN DEL MATERIAL: En el microscopio ptico la luz atraviesa el objeto a observar. Si ste es muy grueso, la luz no lo atravesar y el objeto aparecer demasiado oscuro; adems se superpondrn los diferentes planos dando una imagen borrosa. Si el objeto es demasiado delgado o muy transparente, no se observarn sus estructuras. En cualquier caso, deberemos realizar una preparacin. En general, una preparacin requiere las siguientes etapas 1- CORTE. Los objetos demasiado gruesos son cortados mediante aparatos denominados microtomos. stos permiten realizar cortes de apenas unas micras de grosor, corrientemente entre 3 y 20 . El tejido destinado al corte debe congelarse o incluirse en parafina para darle una mayor consistencia y que se pueda cortar con facilidad.
10

ocular

revolver objetivo pinzas macromtrico micromtrico platina Fuente de iluminacin

Fig. 7 Partes del miccroscopio ptico.

16

ocular

revolver objetivos platina diafragma lmpara

macromtrico micromtrico

Fig. 8 Partes del miccroscopio ptico.

2- FIJACIN. Su fin es matar a las clulas con la menor alteracin de las estructuras posible, para evitar las modificaciones que pudiesen producirse posteriormente por el metabolismo celular o por la descomposicin. Como fijadores se emplean determinadas sustancias qumicas (por ejemplo: formaldehdo y tetrxido de osmio). 3- DESHIDRATACIN. La extraccin del agua del interior de las clulas permitir tambin una mejor conservacin y la penetracin de los colorantes. Para deshidratar el material a observar se le sumerge en alcoholes de cada vez mayor graduacin que por dilucin irn extrayendo el agua.4- TINCIN. Es la coloracin de las clulas o de partes de stas para que resalten y posibilitar as su observacin. Algunos colorantes son selectivos pues tien partes concretas de la clula. Existen dos clases de colorantes: a) Los colorantes vitales. Que tien las estructuras celulares pero sin matar a las clulas (por ejemplo: el verde jano, el rojo neutro, el azul tripn, el azul de metileno). b) Los colorantes no vitales. Que matan a las clulas (eosina, hematoxilina).

J. L. Snchez Guilln

Pgina I-1-4

I) Biomolculas

1) Mtodos de estudio de la clula

5- MONTAJE. Una vez realizadas las anteriores operaciones el material se coloca entre un porta-objetos y un cubre-objetos. Para un montaje no definitivo, se coloca entre "porta" y "cubre" una gota de glicerina. Este tipo de preparaciones tiene una duracin limitada y slo sirven para la observacin momentnea o a lo sumo de unos das. Si se desea una mayor duracin debe realizarse el montaje en gelatina-glicerina o en euparal. B) EL MICROSCOPIO ELECTRNICO Existen dos clases de microscopios electrnicos: B1) Microscopio electrnico de trasmisin (MET). B2) Microscopio electrnico de barrido (MEB).

Fig. 9 Fundamento del microscopio ptico. Fig. 10 Fundamento del microscopio electrnico de trasmisin (MET).

B1) EL MICROSCOPIO ELECTRNICO DE TRANSMISIN (MET) 1) FUNDAMENTO: El microscopio electrnico fue puesto a punto en 1931 a partir de los trabajos tericos de De Broglie. Los electrones pueden comportarse como ondas o como partculas. Como ondas pueden llegar a tener una longitud 100.000 veces menor que la luz visible. Al ser partculas negativas pueden ser desviadas por campos elctricos que actan como lentes. En esencia su funcionamiento es similar al del microscopio ptico. Un ctodo emite un haz de electrones que son acelerados por la aplicacin de una diferencia de potencial entre el ctodo y el nodo. El flujo de electrones es concentrado sobre el objeto por una primera lente magntica que hace las veces de condensador. Los electrones atraviesan la muestra. Una segunda lente magntica, el objetivo, da una imagen aumentada del objeto. Una tercera lente, el ocular, aumenta de nuevo la imagen dada por la anterior. La imagen final es proyectada sobre una pantalla o fotografiada. Los microscopios electrnicos permiten aumentos tiles que van de 2000 a 100.000 pudiendo llegar hasta 600.000. Los microscopios electrnicos son aparatos de hasta 2 m de alto y llegan a pesar 500 kg.

J. L. Snchez Guilln

Pgina I-1-5

I) Biomolculas

1) Mtodos de estudio de la clula

2) PREPARACIN del MATERIAL Los electrones necesitan desplazarse en el vaco, esta es la razn por la que no es posible la observacin de clulas vivas al microscopio electrnico. 2-1) FIJACIN. Las clulas son fijadas mediante fijadores no coagulantes. Los ms corrientes son el tetrxido de osmio (OsO4), el formaldehdo (HCHO) y el permanganato potsico (MnO4K). Los metales pesados que algunos contienen se fijan selectivamente a las diferentes estructuras celulares. Aquellas que retengan ms los metales aparecern ms oscuras. Es por esto que la imagen depende mucho del tipo de fijador utilizado. 2-2) DESHIDRATACIN e INCLUSIN. La pieza es deshidratada e infiltrada mediante una resina o plstico para darle una mayor consistencia y facilitar su corte. 2-3) CORTE. Los cortes se realizan mediante ultramicrotomos de cuchilla de vidrio o de diamante. Los cortes ms finos (0,03) son depositados sobre un tamiz y dispuestos para su observacin al microscopio. B2) MICROSCOPIO ELECTRNICO DE BARRIDO (MEB) Este tipo de microscopio permite obtener imgenes tridimensionales del objeto a estudiar. Primero se efecta un sombreado metlico de la superficie de la muestra, y la rplica obtenida es barrida por un haz de electrones. Los electrones secundarios que se forman son captados y convertidos en imgenes sobre una pantalla de televisin. Estos microscopio son muy tiles para revelar estructuras anatmicas submicroscpicas, sin embargo su aumento no suele pasar de 20.000.
Microscopio ptico Fuente de iluminacin: La luz Se pueden ver seres vivos Poco aumento (X1000) Se observa la estructura Preparaciones sencillas Aparato relativamente barato Microscopio electrnico Fuente de iluminacin: electrones No se pueden ver los seres vivos Mucho aumento (X300 000) Se observa la ultraestructura Preparaciones complejas Instrumento muy caro

J. L. Snchez Guilln

Pgina I-1-6

I) Biomolculas

2) Biomolculas

I-2 BIOELEMENTOS Y BIOMOLCULAS

LOS BIOELEMENTOS: CONCEPTO Y CLASES

Los bioelementos son los elementos qumicos que constituyen los seres vivos. De los aproximadamente 100 elementos qumicos que existen en la naturaleza, unos 70 se encuentran en los seres vivos. De estos slo unos 22 se encuentran en todos en cierta abundancia y cumplen una cierta funcin. Clasificaremos los bioelementos en:
>Bioelementos primarios: O, C, H, N, P y S. Representan en su conjunto el 96,2% del total. >Bioelementos secundarios: Na+ , K+ , Ca2+ , Mg 2 + , Cl-. Aunque se encuentran en menor proporcin que los primarios, son tambin imprescindibles para los seres vivos. En medio acuoso se encuentran siempre ionizados. Oligoelementos o elementos vestigiales: Son aquellos bioelementos que se encuentran en los seres vivos en un porcentaje menor del 0.1%. Algunos, los indispensables, se encuentran en todos los seres vivos, mientras que otros, variables, solamente los necesitan algunos organismos.

TABLA BIOELEMENTOS Primarios O C H N P S Secundarios Na+ K+ Mg 2 + Ca2 + ClOLIGOELEMENTOS Indispensables Mn Fe Co Cu Zn Variables B Al V Mo I Si

J. L. Snchez Guilln

Pgina I-2-1

I) Biomolculas

2) Biomolculas

PRINCIPALES CARACTERSTICAS DE LOS BIOELEMENTOS PRIMARIOS

El hecho de que los bioelementos primarios sean tan abundantes en los seres vivos se debe a que presentan ciertas caractersticas que los hacen idneos para formar las molculas de los seres vivos. As: * Aunque no son de los ms abundantes, todos ellos se encuentran con cierta facilidad en las capas ms externas de la Tierra (corteza, atmsfera e hidrosfera). TABLA Los elementos qumicos ms abundantes en la corteza terrestre y en los seres vivos (en % en peso). Elementos Oxgeno Silicio Aluminio Hierro Corteza (%) 47 28 8 5 Elementos Oxgeno Carbono Hidrgeno Nitrgeno Seres vivos (%) 63 20 9,5 3

* Sus compuestos presentan polaridad por lo que fcilmente se disuelven en el agua, lo que facilita su incorporacin y eliminacin.

Tabla de los Bioelementos


H Li Na K Rb Cs Fr Be Mg Ca Sr Ba Ra Sc Y La Ac
Cs Th Pr Pa Nd U Pm Np Sm Pu Eu Am Gd Cm Tb Bk Dy Cf Ho Es Er Fm Tm Md Yb No Lu Lw

He B Al Ti Zr Hf V Nb Ta Cr Mo W Mn Tc Re Fe Ru Os Co Rh Ir Ni Pd Pt Cu Ag Au Zn Cd Hg Ga In Tl C Si Ge Sn Pb N P As Sb Bi O S Se Te Po F Cl Br I At Ne Ar Kr Xe Rn

Primarios Bioelementos Secundarios Oligoelementos

Indispensables Variables

15

* El C y el N presentan la misma afinidad para unirse al oxgeno o al hidrgeno, por lo que pasan con la misma facilidad del estado oxidado al reducido. Esto es de gran importancia, pues los procesos de oxidacin-reduccin son la base de muchos procesos qumicos muy importantes y en particular de los relacionados con la obtencin de energa como la fotosntesis y la respiracin celular.

J. L. Snchez Guilln

Pgina I-2-2

I) Biomolculas

2) Biomolculas

* El C, el H, el O y el N son elementos de pequea masa atmica y tienen variabilidad de valencias, por lo que pueden formar entre s enlaces covalentes fuertes y estables. Debido a esto dan lugar a una gran variedad de molculas y de gran tamao. De todos ellos el carbono es el ms importante. Este tomo es la base de la qumica orgnica y de la qumica de los seres vivos.

LAS BIOMOLCULAS: CLASIFICACIN

Los bioelementos se unen entre s para formar molculas que llamaremos biomolculas: Las molculas que constituyen los seres vivos. Estas molculas se han clasificado tradicionalmente en los diferentes principios inmediatos, llamados as porque podan extraerse de la materia viva con cierta facilidad, inmediatamente, por mtodos fsicos sencillos, como : evaporacin, filtracin, destilacin, disolucin, etc.

Los diferentes grupos de principios inmediatos son:


Inorgnicos Orgnicos

-Agua -CO2 -Sales minerales

-Glcidos -Lpidos -Prtidos o protenas -cidos nucleicos

LOS COMPUESTOS ORGNICOS DE LOS SERES VIVOS.

Son compuestos orgnicos los compuestos de carbono. Esto es, aquellos en los que el tomo de carbono es un elemento esencial en la molcula y forma en ella la cadena bsica a la que estn unidos los dems elementos qumicos. Los seres vivos contienen compuestos orgnicos. Son stos los que caracterizan a la materia viva y la causa de las peculiares funciones que realiza. La gran variedad de compuestos orgnicos que contienen los seres vivos no se clasifican desde un punto de vista qumico, sino a partir de criterios muy simples, tales como su solubilidad o no en agua, u otros. Siguiendo estos criterios se clasifican en : -Glcidos o hidratos de carbono -Lpidos -Prtidos (protenas) -cidos nucleicos

Las funciones que cumplen estos compuestos en los seres vivos son muy variadas,

J. L. Snchez Guilln

Pgina I-2-3

I) Biomolculas

2) Biomolculas

as: -Glcidos y lpidos tienen esencialmente funciones energticas y estructurales. -Las protenas: enzimticas y estructurales. -Los cidos nucleicos son los responsables de la informacin gentica. Algunas sustancias son de gran importancia para los seres vivos pero estos las necesitan en muy pequea cantidad y nunca tienen funciones energticas ni estructurales. Por esta causa reciben el nombre de biocatalizadores. Son biocatalizadores las vitaminas, las enzimas y las hormonas.

REPARTICIN DE LOS COMPONENTES MOLECULARES DE LA CLULA (en % sobre masa total)

Principios inmediatos Glcidos Lpidos Prtidos cidos Nucleicos ARN ADN Precursores Agua Sales minerales

PROCARIOTAS

EUCARIOTAS

3 2 15 6 2 1 70 1

3 4,5 18 1,25 0,25 2 70 1

EL ENLACE COVALENTE

Los tomos que forman las molculas orgnicas estn unidos mediante enlaces covalentes. Se trata de un enlace muy resistente cuando la molcula est en disolucin acuosa, lo que es el caso de los seres vivos.

H O H H C C C S H H H

Este tipo de enlace se forma cuando dos los diferentes tomos que constituyen una biomolcula. tomos comparten uno o ms pares de electrones. Si comparten 2 electrones, uno cada tomo, diremos que ambos estn unidos mediante un enlace simple; si comparten 4, aportando dos cada uno, el enlace ser doble, y si son seis tendremos un enlace triple. Los enlaces se representan mediante trazo entre los tomos a los que une. As, por

Fig. 1 Unin mediante enlaces covalentes de

J. L. Snchez Guilln

Pgina I-2-4

I) Biomolculas

2) Biomolculas

ejemplo: -C-C-, para el enlace simple carbono-carbono o -C=C- , para el doble. Es de destacar que el enlace simple permite el giro, lo que no sucede con los enlaces doble y el triple. El enlace covalente se da entre elementos no metlicos de electronegatividad similar: C-C, C-O, C-N, C-H. Si existe una mayor diferencia de electronegatividad, como ocurre entre el oxgeno y el nitrgeno con el hidrgeno, el elemento ms electronegativo (el oxgeno y el nitrgeno, respectivamente) atrae hacia s los electrones crendose una polaridad. Esto es, la molcula tendr zonas cor carga elctrica positiva y otras con carga negativa.

+ +

Polaridad del enlace O-H

Polaridad del enlace N-H

Fig. 2 Polaridad del enlace-O-H y del enlace >N- H.

CARACTERSTICAS DEL TOMO DE CARBONO

El carbono es el elemento nmero 6 de la tabla peridica (Z=6 y A =12). Su estructura electrnica es 1s 2 2s 2 2p 2 . Como ya se ha dicho, es el elemento ms importante de los seres vivos, aunque no sea el que se encuentra en ms abundancia. En la corteza terrestre es un elemento relativamente raro. Lo encontramos en la atmsfera en forma de CO2 , disuelto en las aguas formando carbonatos y en la corteza constituyendo las rocas calizas (CO3 Ca) el carbn y el petrleo.

C
Cuatro simples

C
Uno doble y dos simples

C
Dos dobles.

C
Uno triple y uno simple.

Fig. 3 Enlaces covalentes que puede tener el tomo de carbono al unirse a otros bioelementos.

LOS ENLACES COVALENTES DEL CARBONO Y DE OTROS BIOELEMENTOS

El tomo de carbono tiene 4 electrones en la ltima capa. Esto hace que pueda unirse a otros tomos mediante cuatro enlaces covalentes pudindose formar tres estructuras distintas. Estas son: -La hibridacin tetradrica. En la que el tomo de carbono est unido mediante cuatro enlaces covalentes simples a otros cuatro tomos. En este tipo de hibridacin el tomo de carbono ocupa el centro de un tetraedro y los cuatro enlaces simples se dirigen hacia sus vrtices.

O O

S S

N N N

El hidrgeno tiene un electrn de valencia.

El oxgeno tiene dos electrones de valencia.

El azufre tiene dos electrones de valencia.

El nitrgeno tiene tres electrones de valencia.

Fig. 4 Enlaces covalentes que pueden tener el resto de los bioelementos primarios.

J. L. Snchez Guilln

Pgina I-2-5

I) Biomolculas

2) Biomolculas

-La hibridacin trigonal. En la que el tomo de carbono se une a otros tres tomos mediante dos enlaces simples y uno doble. En este caso los cuatro tomos forman un tringulo con el tomo de carbono situado en el centro. Debe tenerse en cuenta que el enlace doble es algo ms corto que los enlaces simples, por lo que el tringulo no ser equiltero sino issceles.

H. tetradrica

H. trigonal

H. digonal

H. digonal

Fig. 5 Hibridaciones del tomo de carbono.

-La hibridacin digonal. Cuando el tomo de carbono est unido a otros dos tomos mediante un enlace simple y uno triple o mediante dos dobles. Los dems bioelementos van a poder formar, bien con el carbono o entre s, los enlaces covalentes que pueden verse en el recuadro.

LOS ESQUELETOS DE LAS MOLCULAS ORGNICAS

Tipos de esqueletos de las molculas orgnicas

-C- C- C- C- C- C- C- C-

Las diferentes biomolculas van a estar constitudas bsicamente por tomos de carbono unidos entre s mediante enlaces covalentes. La resistencia y versatilidad de los enlaces carbono-carbono y del carbono con otros elementos: oxgeno, nitrgeno o azufre, va a posibilitar el que se puedan formar estructuras que sern el esqueleto de las principales molculas orgnicas.

1) Cadena lineal saturada

-C- C- C=C- C- C=C- C2) Cadena lineal insaturada 4) Doble ciclo mixto.

-C- C- C-C- C- C- C- C-C- C- C3) Cadena ramificada. 5) Ciclo mixto.

Fig. 6 Ejemplos de esqueletos carbonados de las biomolculas.

FUNCIONES ORGNICAS

Las molculas orgnicas van a tener determinadas agrupaciones caracters ticas de tomos que reciben el nombre de funciones o grupos funcionales. Las principales funciones son: -Alcohol o hidroxilo -Aldehdo -Cetona -cido orgnico o carboxilo -Amina -Amida -Tiol o sulfidrilo

FUNCIONES ORGNICAS Concepto: Agrupaciones caractersticas de tomos Alcohol: Cetona: Aldehdo: cido: Amino: Amida: Tiol: -O-H >C=O -CHO -COOH -NH2 -CONH2 -S-H

Fig. 7 Los principales frupos funcionales.

J. L. Snchez Guilln

Pgina I-2-6

I) Biomolculas

2) Biomolculas

Las cuatro primeras estn formadas por C, H, y O (funciones oxigenadas); las dos siguientes, por tener nitrgeno, se denominan funciones nitrogenadas. Los aldehdos se diferencian de las cetonas por estar siempre en un carbono situado en el extremo de la mol cula; esto es, el carbono que lleva una funcin aldehdo se encuentra unido a otro carbono o a un hidrgeno. Entre las funciones con azufre la ms importante en los compuestos de los seres vivos es la funcin tiol (-SH). Encontraremos esta funcin en algunos aminocidos. El fsforo se encuentra sobre todo en los cidos nucleicos y sus derivados en forma de cido fosfrico (H3 PO4 ) o sus iones (iones fosfato). Las diferentes funciones pueden representarse de una manera simplificada tal y como se indica en la figura.

C O H
Funcin alcohol

H
Funcin aldehdo

O
Funcin cetona Funcin cido

C O C C C O

C S H
Funcin tiol

C O H O
Funcin amida

C N
Funcin amina

H H

C N

H H

* En los enlaces libres slo puede haber o carbonos o hidrgenos.

Fig. 8 Los principales grupos funcionales.

Fig. 9 Representacin en un modelo de esferas de una biomolcula: un aminocido.

ALGUNAS PROPIEDADES QU MICAS DE LAS FUNCIONES ORGNICAS

Los alcoholes por deshidrogenacin (oxidacin) se transforman en aldehdos o cetonas y estos por una nueva oxidacin dan cidos. Por el contrario, los cidos por reduccin dan aldehdos y estos a su vez dan alcoholes. Estos procesos son de gran importancia en el metabolismo de los seres vivos, en particular en los procesos de obtencin de energa.

FORMULACIN DE LAS BIOMOLCULAS

Las sustancias orgnicas pueden representarse mediante diferentes tipos de frmulas. Estas pueden ser: a) Frmulas desarrolladas o estructurales: En ellas se indican todos los tomos que forman la molcula y todos los enlaces covalentes los unen. Este tipo de frmulas da la mxima informacin pero las molculas complejas es laborioso representarlas.

CH3-CH3 H H H C C H H H
Frmula desarrollada Frmula semidesarrollada

C2H6
Frmula emprica

Fig. 10 Frmulas desarrollada, semidesarrollada y emprica del etano.

b) Frmulas semidesarrolladas: en las que se indican nicamente los enlaces de la cadena

J. L. Snchez Guilln

Pgina I-2-7

I) Biomolculas

2) Biomolculas

carbonada. El resto de los tomos que estn unidos a un determinado carbono se agrupan segn ciertas normas (ejemplo: CH3 -, -CH2 - , CH2 OH-, -CHOH-, CHO-, -CO-, -COOH, -CHNH2 -). c) Frmulas empricas: En ellas se indican nicamente el nmero de tomos de cada elemento que hay en la molcula; as, frmula emprica de la glucosa: C6 H12 O6 . Es de destacar que las frmulas empricas no dan una idea de la estructura de la molcula y que puede haber muchos compuestos que, siendo diferentes, tengan la misma frmula emprica y diferente frmula estructural. En ciertos casos, por ejemplo, si la molcula es muy compleja, se recurre a determinadas simplificaciones. As, las largas cadenas carbonadas de los cidos grasos pueden representarse mediante una lnea quebrada en la que no se indican ni los carbonos ni los hidrgenos pero s se indican las funciones, los dobles enlaces u otras variaciones que posea la molcula. Tambin se simplifican las cadenas cclicas, en las que a veces tampoco se indican ni los carbonos ni los hidrgenos.

CH2OH C H C OH OH C H H C OH H

O
OH C H

Fig. 11 Ejemplo de representacin entre desarrollada y semidesarrollada de la glucosa, en la que algunas funciones se han agrupado.

CH2OH
Funcin alcohol

CHO C CO C
Funcin aldehdo Funcin cetona Funcin cido

CHSH
Funcin tiol

COOH
Funcin amida

CH2NH2

CONH2

Fig. 12 Representacin semidesarrollada de los principales grupos funcionales.


O COOH

OH OH

Fig. 13 Representacin simplificada de una biomolcula.

CONCEPTOS DE POLMERO Y MONMERO

Frecuentemente los compuestos que constituyen los seres vivos estn formados por la unin ms o menos repetitiva de mol culas menores. Por ejemplo, el almidn y la celulosa estn formados por la unin de miles de molculas de glucosa. Las protenas por decenas, centenares o miles de aminocidos, y la unin de miles o millones de nucletidos forma los cidos nucleicos. Cada una de las unidades menores que forman estas grandes molculas es un monmero y el compuesto que resulta de la unin se llama polmero. Los polmeros son, a su vez, macromolculas, molculas de elevado peso molecular. Pequeas molculas.........................................................................de 100 u a 1000 u Grandes molculas (macromolculas)..................................... de 10 4 u a ms de 10 6 u

Unidad de masa molecular: unidad de masa atmica (u) o dalton (da). 1u = 1da = 1,660*10 -24 g

J. L. Snchez Guilln

Pgina I-2-8

I) Biomolculas

2) Biomolculas

monmero

Fig. 14 Fragmento de la molcula de almidn. El almidn es un polmero formado por el monmero glucosa.

ENLACES INTRA E INTERMOLECULARES

Los medios biolgicos son una mezcla compleja de compuestos qumicos, tanto orgnicos como inorgnicos. Unos son de pequeo tamao: como el in H+ (1da). Otros, como los cidos nucleicos, pueden tener 10 8 da o incluso ms. Todas estas molculas van a interaccionar entre s. La principal de estas interacciones es la reaccin qumica en la que se produce una trasformacin qumica de las sustancias que intervienen en ella. Otros tipos de interaccin son los diferentes enlaces que pueden darse entre molculas o entre partes de una misma molcula. Estos enlaces van a dar una mayor estabilidad a las macromolculas por la formacin de agregados o de molculas de mayor tamao. Estas uniones pueden ser, entre otras: 1-Enlaces inicos. Se suelen dar preferentemente en mol culas que contienen grupos -COOH y -NH2 . Estos grupos en agua se encuentran ionizados: -COOH -COO- + H+ -NH2 + H+ -NH3 + El enlace se debe a las fuerzas de carcter elctrico que se establecen entre las cargas negativas de los grupos -COO- y las positivas de los grupos -NH+ 3 , bien dentro de una misma mol cula o entre molculas prximas. Estos enlaces en medio acuoso son muy dbiles. 2- Los puentes disul fu ro. Se llama as a los enlaces covalentes que se forman al reaccionar entre s dos grupos -S-H para dar -S-S- . Este tipo de enlaces son extraordinariamente resistentes. Los encontraremos en las protenas uniendo las subunidades

J. L. Snchez Guilln

Pgina I-2-9

I) Biomolculas

2) Biomolculas

que componen algunas molculas proteicas. 3-Enlaces o puentes de hidrgeno. Se trata de enlaces dbiles pero que si se dan en gran nmero pueden llegar a dar una gran estabilidad a las mol culas. Los enlaces de hidrgeno se deben a la mayor o menor electronegatividad de los elementos que participan en un enlace covalente. As, por ejemplo, en los grupos -C-O-H, el oxge no es ms electronegativo que el hidrgeno y atrae hacia s el par de electrones que forma el enlace covalente. En las proximidades del oxge no habr un exceso de carga negativa y, por el contrario, el hidrgeno estar cargado positivamente. Lo mismo sucede con los grupos -C-N-H, u otros, en los que tambin se produce una diferencia de electronegatividad. Como consecuencia se generarn fuerzas elctricas entre tomos que presentan un exceso de carga positiva (H) y otros con exceso de carga negativa (O, por ejemplo). Estos enlaces son de gran importancia en determinados compuestos y, en particular, en las protenas y en los cidos nucleicos. 4-Fuerzas de Van der Waals. Se trata de fuerzas de carcter elctrico debidas a pequeas fluctuaciones en la carga de los tomos. Actan cuando las molculas se encuentran muy prximas unas a otras. 5- Uniones hidrofbicas. Ciertas sustancias insolubles en agua cuando estn en un medio acuoso van a mantenerse unidas entre s por su repulsin al medio en el que se encuentran. Estas uniones, aunque son muy dbiles, van a ser de gran importancia en el mantenimiento de los componentes lipdicos de la membranas celulares y en la configuracin de muchas protenas.
Grupo -COOH

+
Grupo H2N-C-

Fig. 15 Enlaces inicos entre grupos -COOH y H2N-

Fig. 16 Puentes disulfuro (4) entre las subunidades de una protena.

Fig. 17 Puentes o enlaces de hidrgeno entre las bases nitrogenadas del ADN.

Es de destacar que los enlaces ms dbiles, inicos y de hidrgeno, particularmente, pueden contribuir en gran manera a la estabilidad de la configuracin de una molcula cuando se dan en gran nmero.

J. L. Snchez Guilln

Pgina I-2-10

I) Biomolculas

3) El agua

I-3 EL AGUA

IMPORTANCIA DEL AGUA PARA LOS SERES VIVOS

El agua es el lquido ms abundante de la corteza y uno de los pocos lquidos naturales. No es de extraar entonces que el agua sea una sustancia esencial en los seres vivos. El agua es el componente ms abundante en los medios orgnicos, los seres vivos contienen por trmino medio un 70% de agua. No todos tienen la misma cantidad, los vegetales tienen ms agua que los animales y ciertos tejidos (por ejemplo: el tejido graso) contienen menos agua -tiene entre un 10% a un 20% de agua- que otros como, por ejemplo: el nervioso, con un 90% de agua. Tambin vara con la edad, as, los individuos jvenes tienen ms agua que los adultos (la carne de ternera es ms tierna que la de vaca). El agua en los seres vivos se encuentra tanto intra como extracelularmente. El agua intracelular, la que est en el interior de las clulas, representa 2/3, aproximadamente, del agua que contiene un ser vivo y el agua extracelular representa el tercio restante. Esta ltima se encuentra baando las clulas o circulando en forma de sangre, linfa, savia, etc. En los seres unicelulares y en los organismos acuticos el agua es adems su medio ambiente. El agua no es un simple medio ni una mera fase inerte, es un lquido muy reaccionable. Interviene en muchas reacciones qumicas, bien como reactivo o como producto de la reaccin, y resulta imprescindible para la estabilidad de muchas sustancias biolgicas, por ejemplo, las protenas. Por ltimo diremos que la vida se origin hace ms de 3500 millones de aos en el medio acutico y las condiciones de aquel ambiente primitivo imprimieron un sello permanente en la qumica de los seres vivos. Todos los seres vivos han sido diseados alrededor de las propiedades caractersticas del agua, tales como su carcter polar, sus enlaces de hidrgeno y sus elevados puntos de fusin, ebullicin, calor especfico y tensin superficial.

J. L. Snchez Guilln

Pgina I-3-1

I) Biomolculas

3) El agua

ALGUNAS PROPIEDADES DEL AGUA

Masa molecular.......... Punto de fusin......... Punto de ebullicin .... Densidad (a 4 0 C)........ Densidad (00 C)..........

18 da 0 oC (a 1 atm) 100 oC (a 1 atm) 1g/cm 3 0'97g/cm 3

Fig. 1 Modelo de la molcula de agua

ESTRUCTURA QUMICA DEL AGUA

La molcula de agua est formada por dos tomos de hidrgeno y uno de oxgeno. En el agua existen tambin los productos resultantes de la disociacin de algunas de sus molculas: el in H3 O+ y el OH-.

oxgeno

H En la molcula de H2 O los enlaces covalentes + + entre el oxgeno y los dos tomos de hidrgeno forman un ngulo de 104'5 0 . Adems, el tomo Fig. 2 Representacin de la molcula de agua. de oxgeno atrae hacia s los electrones del enlace covalente. Esto hace que la molcula presente un exceso de carga negativa en las proximidades del tomo de oxgeno y un exceso de carga positiva en los tomos de hidrgeno. Por lo tanto, cada molcula de agua es un dipolo elctrico.

ESTRUCTURA QUMICA DEL AGUA COMO SUBSTANCIA

Al ser las molculas de agua dipolos elctricos se establecen enlaces de hidrgeno entre el tomo de oxgeno de una molcula y los tomos de hidrgeno de las molculas vecinas. Estos enlaces de hidrgeno se forman y se escinden a gran velocidad, aunque su estabilidad disminuye al elevarse la temperatura. Debido a estos enlaces las molculas de agua se mantienen unidas - cohesividad - y el agua es lquida a temperaturas a las que otras sustancias de masas moleculares similares como el CH4 y el H2 S son gaseosas. De la cohesividad dependen tambin una serie de propiedades del agua de gran importancia para los seres vivos.

= + +
Fig. 3 Formacin de enlaces de hidrgeno entre molculas de agua.

J. L. Snchez Guilln

Pgina I-3-2

I) Biomolculas

3) El agua

COHESIVIDAD DEL AGUA

La cohesividad, debida a los puentes de hidrgeno entre las molculas de agua, es responsable de importantes caractersticas del agua y de muchas de las funciones que el agua cumple en los seres vivos. As, son debidas a la cohesividad:
+

O H

H H
+

Enlace de hidrgeno

- Fenmenos como el de la capilaridad, que permite la ascensin de la savia a travs de los finsimos conductos que forman los vasos leosos en las plantas. - Es tambin responsable de que el agua sea un lquido prcticamente incompresible capaz de dar volumen y turgencia a muchos seres vivos (p.e.:gusanos) y por ejemplo, es la responsable del esqueleto hidrosttico de las plantas. - Tambin es responsable de la elevada tensin superficial del agua; propiedad que permite las deformaciones del citoplasma celular y los movimientos internos en la clula.

Fig. 4 Los enlaces de hidrgeno entre molculas de agua son los responsables de la cohesividad de sus molculas.

Fig. 5 Los enlaces de hidrgeno entre molculas de agua son los responsables de la cohesividad de sus molculas.

- Como ya se ha dicho es la responsable de los elevados puntos de fusin y ebullicin del agua. Otras sustancias de masas moleculares parecidas son gaseosas a temperaturas en las que el agua es lquida. El hecho de que el agua sea lquida en su mayor parte a las temperaturas que se dan en la Tierra ha posibilitado el desarrollo de la vida en nuestro planeta. - De su elevado calor especfico: cantidad de calor necesaria para elevar la temperatura de una cierta masa de agua. Esto hace que el agua almacene o libere una gran cantidad de calor al calentarse o al enfriarse; lo que permite que el agua acte como amortiguador trmico, evitando bruscas alteraciones de la temperatura y evitando de esta forma que, por ejemplo, algunas molculas como las protenas, muy sensibles a los cambios trmicos, se alteren. - Su elevado calor de vaporizacin: cantidad de calor necesario para evaporar un gramo de agua es tambin debido a la cohesividad, pues para pasar del estado lquido al

J. L. Snchez Guilln

Pgina I-3-3

I) Biomolculas

3) El agua

gaseoso es necesario romper los enlaces de hidrgeno entre las molculas de agua. Estas dos ltimas propiedades son de gran importancia a la hora de regular la temperatura en muchos seres vivos, por ejemplo: la sudoracin.

CO- O-CH2 CO- O-CH CO- O-CH2

Fig. 6 Los triacilglicridos (grasas neutras) son sustancias muy insolubles en agua.

SOLUBILIDAD

El agua es un buen disolvente de los compuestos inicos. Esto es debido a que el agua es una sustancia polar. Las molculas de agua se disponen alrededor de los iones positivos con la parte negativa de su molcula hacia ellos y en el caso de los iones negativos les enfrentan la parte positiva. Tambin son solubles en agua las sustancias polares, por ejemplo: los glcidos; normalmente, estas sustancias tienen una elevada proporcin de oxgeno. Por el contrario, aquellas sustancias orgnicas que presentan una elevada proporcin de hidrgeno y pocos tomos de oxgeno son poco solubles en agua; por ejemplo: los lpidos. Algunas sustancias tienen una parte de su molcula que es soluble en agua (hidrfila) y otra parte insoluble (hidrfoba). Estas sustancias se dice que son anfipticas. Las sustancias anfipticas, cuando estn en un medio acuoso, orientan su molcula y dan lugar a la formacin de micelas, monocapas o bicapas. Las grandes molculas, como las protenas, si son solubles en agua, forman un tipo especial de disoluciones denominadas disoluciones coloidales. Las disoluciones coloidales van a poder estar en dos estados: sol y gel. En el estado de sol predomina la fase dispersante, el agua, por ejemplo, sobre la fase dispersa y la solucin es ms fluida. En estado de gel predomina la fase dispersa, por ejemplo: la protena, sobre la fase dispersante, y la solucin es ms viscosa. El paso de un estado a

Fig. 7 Modelo de triacilglicrido (grasa neutra). Estas sustancias tienen pocos grupos polares y una gran proporcin de -CH- y poco oxgeno.

O C O- CH 2 O C O- CH O CH3

H2COPOCHCHNCH3 OH CH3

Fig. 8 Los fosfoglicridos son sustancias anfipticas.

Estado de sol

Estado de gel

macromolcula

agua u otro disolvente

Fig. 9 Estados de sol y de gel de una disolucin coloidal.

J. L. Snchez Guilln

Pgina I-3-4

I) Biomolculas

3) El agua

otro es reversible y diversos factores fsicos y qumicos pueden hacer que una solucin pase de un estado a otro sin necesidad de variar la concentracin de soluto. Estos factores pueden ser: el pH, la temperatura o una alteracin en la concentracin de determinados iones presentes en el medio. Los soluciones coloidales pueden separarse por dilisis por medio de membranas cuyos poros slo permiten pasar las molculas de pequeo tamao y no las partculas coloidales.

Fig. 10 Hemodilisis.

IONIZACIN Y pH
Parte polar Parte apolar

Parte de las molculas (10 -7 moles por litro de agua, 1 mol=6 '023x10 23 molculas) estn disociadas (ver en la figura 13 la ecuacin de ionizacin del agua). Las sustancias cidas al disolverse en agua se disocian y producen iones H+ que aumentan la concentracin de iones H3 O+ del medio. Las sustancias bsicas se disocian tambin produciendo iones OH- que se unen a los iones H3 O+ formndose dos molculas de agua, por lo que la concentracin de iones H3 O+ del agua disminuye. La concentracin de iones H3 O+ del agua se puede tomar, por lo tanto, como una medida de su acidez, si es alta, o de su basicidad, si es baja. El pH se define como el logaritmo decimal negativo de la concentracin de iones H3 O+ de una disolucin. En el agua pura (neutra) la concentracin de protones es de 10 -7 moles por litro (pH=7). Por lo tanto: si el pH < 7, la disolucin ser cida; si el pH = 7, ser neutra; si el pH > 7, ser bsica.

Fig. 11 Los lpidos anfipticos forman monocapas sobre una superficie acuosa.

Fig. 12 Bicapa formada por un lpido anfiptico.

H2O + H2O

H3O+ + OH-

Puede decirse, a modo de ejemplo, que el pH de la sangre es ligeramente bsico (pH=7'37) mientras que el del estmago es fuertemente cido (pH=1).

Fig. 13 Ionizacin del agua.

J. L. Snchez Guilln

Pgina I-3-5

I) Biomolculas

3) El agua

Las variaciones del pH son de gran importancia en muchos procesos biolgicos de la clula. As, por ejemplo, en los procesos de acumulacin de energa en el ATP o en la activacin de las enzimas de los lisosomas.

H2O + HA

H3O+ + A-

EL AGUA COMO SUSTANCIA REACCIONABLE

Fig. 14 Ionizacin de un cido en agua.

El agua participa activamente en los procesos qumicos que se dan en la clula, pues es en s misma una sustancia muy reaccionable. As: - En las reacciones de hidrlisis. Se trata de la rotura de un enlace covalente por la adicin de H y OH a los tomos que estn unidos entre s. De esta manera se separan, por ejemplo, los aminocidos que forman las protenas cuando estas se hidrolizan; el H y el OH se unen al nitrgeno y al carbono que forman el enlace peptdico en un proceso similar, pero inverso, al de la formacin del enlace. Algo parecido ocurre con otros enlaces como con el glicosdico o con el enlace ster. - El agua puede ser adicionada a un doble enlace formndose una funcin alcohol. - El agua tiene tambin una gran importancia en la fotosnte sis por ser la sustancia que repone los electrones que se utilizan en los procesos de sntesis de sustancias orgnicas.

SOLUCIONES AMORTIGUADORAS1 Los procesos qumicos que se dan en la clula producen sustancias que alteran el pH del medio celular. Ciertas sustancias actan como amortiguadores del pH o tampones evitando que ste sufra grandes variaciones. As, por ejemplo, el in bicarbonato (HCO3 -) acta como tampn en los medios orgnicos. Si el pH es cido habr un exceso de iones H3 O+ . Estos sern captados por el in HCO-3 que se transformar en H2 CO3 y H2 O, con lo que el pH aumentar. El H2 CO3 , a su vez, se descompondr en CO2 y H2 O. El proceso se desarrolla a la inversa si hay pocos iones H3 O+ . El in bicarbonato acta como un tampn eficaz para valores de pH en las proximidades de 7, que es el pH de la sangre. En los medios intracelulares el tampn ms frecuente es el in fosfato(H 2 PO4 -).

Los textos en letra itlica suelen ser textos de ampliacin o de aclaracin y no entran en los exmenes.

J. L. Snchez Guilln

Pgina I-3-6

I) Biomolculas

3) El agua

LAS SALES MINERALES Podemos encontrarlas disueltas en los medios celulares internos o externos, o precipitadas en huesos y caparazones. Cuando estn disueltas se encuentran disociadas en cationes y aniones. Los principales cationes y aniones presentes en los medios orgnicos son:

gramos/litro Cloruro de sodio Cloruro de potasio Cloruro de calcio Cloruro magnsico Bicarbonato de sodio Fosfato monosdico Glucosa Agua destilada 8,0 0,2 0,2 0,1 1,0 0,05 1,0 Hasta 1000 cm3

Cationes: Na+ , K+ , Ca+ 2 y Mg +2 . Aniones:Cl-, SO4 -2 , PO4 -3 , CO3 -2 , HCO3 - y NO3 -

La proporcin de iones, y sobre todo de cationes, debe mantenerse constante en los medios orgnicos pues ciertos cationes tienen efectos antagnicos. Por ejemplo, el Ca+ + y el K+ tienen funciones antagnicas en el funcionamiento del msculo cardaco .

Fig. 15 Solucin de Tyrode, utilizada para cultivos de tejidos, preservado de rganos e irrigaciones de la cavidad peritoneal.

PRINCIPALES MINERALES

FUNCIONES

DE

LAS

SALES

- Esqueletos y caparazones. - Mantener la salinidad. - Estabilizar las disoluciones. Por ejemplo, los amortiguadores del pH. - Especficas: Movimiento muscular, impulso nervioso etc.

Fig. 16 Las conchas de los moluscos estn formadas por una matriz orgnica de naturaleza fundamentalmente protenica (conquiolina) y un depsito inorgnico de carbonato clcico.

J. L. Snchez Guilln

Pgina I-3-7

I) Biomolculas

3) El agua

J. L. Snchez Guilln

Pgina I-3-8

I) Biomolculas

4) Glcidos

I-4 GLCIDOS

CONCEPTO, CARACTERSTICAS Y FUNCIONES GENERALES DE LOS GLCIDOS

Los glcidos son compuestos orgnicos constituidos por carbono, hidrgeno y oxgeno; en algunos casos pueden tener adems otros elementos qumicos como nitrgeno o azufre. Se les ha llamado hidratos de carbono porque algunos responden a la frmula general Cn(H2 O)m y azcares por su sabor dulce, aunque slo los de baja masa molecular lo tienen.
Concepto: Qumicamente son polihidroxialdehdos, polihidroxicetonas, sus derivados o sus polmeros (ms adelante se explicarn estos conceptos).

H C=O H-C-O-H H-O-C-H H-C-O-H H-C-O-H H-C-O-H H


Fig. 1 Frmula lineal de la Dglucosa.

Algunos son molculas de relativamente baja masa molecular; la glucosa tiene una Mm=180 da. Otros, como el almidn, tienen masas moleculares de ms de 100 000 da y son grandes molculas, macromolculas. Sus propiedades fsicas y qumicas son muy variadas. Y en cuanto a sus funciones biolgicas:

CH2OH O H H OH H OH

OH

OH

glucosa. -La glucosa, sacarosa, glucgeno y almidn son sustancias energticas. Los seres vivos obtienen energa de ellas o las usan para almacenar energa. Esta energa est contenida en determinados enlaces que unen los tomos de estas molculas.

Fig. 2 Frmula cclica de la D-

-Celulosa y quitina son estructurales. Forman parte de las paredes de las clulas vegetales (celulosa) o de las cubiertas de ciertos animales (quitina). -Ribosa y desoxirribosa forman parte de los cidos nucleicos.

J. L. Snchez Guilln

Pgina I-4-1

I) Biomolculas

4) Glcidos

Estos son slo algunos ejemplos que nos pueden ilustrar sobre las funciones que cumplen los glcidos.

CLASIFICACIN DE LOS GLCIDOS

Atendiendo a su complejidad se clasifican en: A) Monosacridos u osas: Son los ms sencillos. No son hidrolizables; esto es, no se pueden descomponer por hidrlisis en otros glcidos ms simples. Constituyen los monmeros a partir de los cuales se forman los dems glcidos. B) sidos: Formados por la unin de varios monosacridos mediante enlaces "Oglicosdicos", pudiendo poseer en su molcula otros compuestos diferentes de los glcidos. Son hidrolizables, descomponindose en los monosacridos y dems compuestos que los constituyen. Se dividen en: * Holsidos. Son aquellos que estn constituidos por carbono, hidrgeno y oxgeno, exclusivamente. A su vez se subclasifican en: -Oligosacridos, formados por entre 2 y 10 monosacridos unidos. -Polisacridos, formados por un gran nmero de monosacridos. * Hetersidos. Formados por osas y otros compuestos que no son glcidos. Por lo tanto, adems de carbono, hidrgeno y oxgeno, contienen otros elementos qumicos.

LOS MONOSACRIDOS CONCEPTO Y NATURALEZA QUMICA Concepto: Qumicamente son polihidroxialdehdos, polihidroxicetonas o sus derivados. Se caracterizan por no ser hidrolizables.

Un polihidroxialdehdo es un compuesto orgnico que tiene una funcin aldehdo en el primer carbono y en los restantes carbonos una funcin alcohol. Las polihidroxicetonas en lugar de una funcin aldehdo tienen una funcin cetona, normalmente en el carbono 2. Los monosacridos que tienen funcin aldehdo se llaman aldosas y cetosas los que tienen una funcin cetona. Los monosacridos responden a la frmula emprica Cn(H2 O)n, de aqu proviene el nombre de hidratos de carbono. El valor de n normalmente est comprendido entre 3 y 7.

J. L. Snchez Guilln

Pgina I-4-2

I) Biomolculas

4) Glcidos

Segn el nmero de tomos de carbono se clasifican en : Triosas........n = 3 Tetrosas.......n = 4 Pentosas.......n =5 Hexosas........n = 6 Heptosas.......n = 7 As, un monosacrido con 6 tomos de carbono y con la funcin aldehdo ser una aldohexosa; si tiene cuatro tomos de carbono y una funcin cetona, ser una cetotetrosa, y as sucesivamente.

H C=O H-C-O-H H-O-C-H H-C-O-H H-C-O-H H-C-O-H H


A

H H-C-O-H C=O H-C-O-H H-C-O-H H-C-O-H H


B

Fig. 3 A) La glucosa, una aldohexosa; B) la ribulosa. , una cetopentosa.

PROPIEDADES FSICAS Y QU MICAS DE LOS MONOSACRIDOS

- Propiedades fsicas: Los monosacridos son slidos, cristalinos, incoloros o blancos, de sabor dulce. Como los grupos hidroxilo son polares, los monosacridos son muy solubles en agua, pues se establecen enlaces polares con las molculas de agua. - Propiedades qumicas: El grupo carbonilo reduce fcilmente los compuestos de cobre (licor Fehling) y de plata oxidndose y pasando a grupo cido. Esta propiedad es caracterstica de estas sustancias y permite reconocer su presencia, pues la reduccin de las sales cpricas del licor de Fehling a cuprosas hace virar el reactivo del azul al rojo ladrillo.

Cu+ + ------- Cu+ azul rojo


H C=O 2 H-C-O-H
1

H H-C-O-H
2 3 1

FRMULA LINEAL DE LOS MONOSACRIDOS

H-O-C-H H-C-O-H H-C-O-H


5 4

C=O

H-C-O-H H-C-O-H H-C-O-H H


B
5 4

DIASTEREOISOMERA

H-C-O-H H
A

Las frmulas lineales de los monosacridos se escriben con el carbono 1, el carbono que lleva la funcin aldehdo o el carbono ms prximo a la funcin cetona, en la parte superior y el resto

Fig. 4 Numeracin de los tomos de carbono en A) una aldosa y en B) una cetosa.

J. L. Snchez Guilln

Pgina I-4-3

I) Biomolculas

4) Glcidos

de los carbonos en orden descendente. Los monosacridos tienen tomos de carbono asim tricos (carbonos que tienen 4 sustituyentes diferentes) por lo que presentan diastereoisomera (ismeros pticos). Los diastereoismeros se diferencian en su formulacin en la colocacin de los H y OH de cada carbono asimtrico a un lado u otro del esqueleto carbonado de la molcula.

-CH-C-O-H -C-

-CH-O-C-H -C-

Fig. 5 Diferenciacin en la posicin de los -OH en los carbonos asimtricos de los monosacridos.

El nmero de ismeros pticos, para un monosacrido dado, es de 2 n, siendo n el nmero de tomos de carbono asim tricos que tenga. La glucosa con cuatro tomos de carbono asimtricos tendr 2 4 = 16 ismeros pticos. De los 2 n ismeros posibles de un monosacrido, la mitad Fig. 6 Disposicin de los sustituyentes pertenecen a la serie D, y la otra mitad son sus alrededor de un carbono asimtrico. imgenes especulares y pertenecen a la serie L. Los monosacridos que tienen el OH del ltimo tomo de carbono asim trico a la derecha pertenecen a la serie D, los de la serie L lo tienen a la izquierda. En los seres vivos normalmente slo aparece una de las formas. Por convenio, se ha decidido que esta forma es la D.

H C O H C OH H C OH H C OH H
1

H C O HO C H H C OH H C OH H
2

H C O H C OH HO C H H C OH H
3

H C O HO C H HO C H H C OH H
4

Fig. 7 Diastereoismeros de una aldotetrosa. Las formas 1 y 2 son D; las formas 3 y 4 son L. 1 y 4 son enantimeras al se una la imagen especular de la otra. Lo mismo ocurre con 2 y 3.

EL HEMIACETAL INTRAMOLECULAR. CICLACIN DE LA MOLCULA

Si las aldopentosas y las hexosas se disuelven en agua, o si forman parte de los disacridos o polisacridos, el grupo carbonilo (-C=O) reacciona con el grupo hidroxilo ( -C-O-H) del carbono 4, en las aldopentosas, o del carbono 5, en las hexosas, formndose un hemiacetal (reaccin entre un alcohol y un aldehdo) o un hemicetal (reaccin entre un alcohol y una cetona) y la molcula forma un ciclo.

J. L. Snchez Guilln

Pgina I-4-4

I) Biomolculas

4) Glcidos

Las frmulas c clicas de la hexosas se representan, segn la proyeccin de Haworth, con el plano del anillo perpendicular al plano de escritura, los carbonos 2 y 3 dirigidos hacia delante, el carbono 5 y el oxge no del anillo hacia detrs. Los OH que en la frmula lineal estaban a la derecha se ponen por debajo del plano y los que estaban a la izquierda se ponen hacia arriba. En la formas D el -CH2 OH se pone por encima y en las L por debajo. Si las frmulas c clicas forman un anillo pentagonal reciben el nombre de furanosas, mientras que si ste es hexagonal se denominan piranosas. En stas ltimas, a su vez, el anillo puede adoptar dos disposiciones diferentes: de silla, si el carbono 1 y el 4 estn a ambos lados del plano formado por los carbonos 2, 3 y 5, y de bote o nave si estn a un mismo lado.

Fig. 8

Pirano y furano.

H C H H O H H H C C C C C H O O H O O O H H H H H H-O H O H H H

H C C C C C C H O H O H O H O H

Fig. 9 Formacin de un hemiacetal en una aldohexosa. Dentro del crculo el OH hemiacetlico.

FORMAS y

HO

H CH2OH H O H HO H OH HO H H HO H CH2OH O H OH OH H

Cuando se produce la ciclacin de la molcula aparece un nuevo tomo de carbono asimtrico, el carbono 1 en las aldosas o el 2 en las cetosas. Este carbono recibe el nombre de carbono anomrico. El OH de este carbono, -OH hemiacetlico, puede estar a uno u otro lado del plano de la molcula originndose dos nuevos ismeros pticos. Cada uno de estos ismeros se distingue mediante los smbo los y (formas y ). La forma se representa situando el OH hemiacetlico por debajo del plano de la molcula; en la forma se sita por encima. Las formas y de un monosacrido reciben el nombre de formas anmeras1 .
1

HO H

Fig. 10

Formas de bote o silla de la glucosa.

CH2OH

C
H H

O
OH

C
OH OH H

C
H

C
H

C
OH

Fig. 11

Forma cclica de la D glucosa.

Curiosidad: Al aparecer un nuevo tomo de carbono asimtrico cambia el ngulo con el que el monosacrido desva el plano de la luz polarizada. Por ejemplo: D-glucosa a 201C desva el plano +112.21 D-glucosa a 201C " " +18.7 1

J. L. Snchez Guilln

Pgina I-4-5

I) Biomolculas

4) Glcidos

NOMENCLATURA CCLICAS

DE

LAS

FORMAS

CH2OH

CH2OH

C
H

C C
OH OH OH H H
OH
2

Fig. 12

Frmula de la D fructofuranosa.

ORIENTACIN DE LAS FRMULAS CCLICAS DE LOS MONOSACRIDOS

Normalmente, las frmulas cclicas de los monosacridos se representan con el carbono anomrico hacia la derecha, el resto de los carbonos del ciclo por orden en el sentido de las agujas del reloj. No obstante, la molcula puede representarse bien girada (giro de 180 o segn el eje Y) o volteada (giro de 180 o segn el eje Z). En los esquemas se ha representado la -D-fructofuranosa en posicin normal (a), girada (b) y volteada (c).

CH2OH

OH
1 CH OH 2 4 3

C
H

C
OH CH2OH

C
H
4

C C
HO OH H

HOH2C
2

C C
HO H H

OH

C O

C5
H

HOH2C

a)

b)

c)

La mezcla de y "

"

+52.7 1

J. L. Snchez Guilln

OH

OH

C
H

C 3

H H

Para nombrar la forma cclica de un monosacrido, se indica en primer lugar si es o , a continuacin, si es D o L y, por ltimo, el nombre del monosacrido y el tipo de anillo. Por ejemplo: -D-glucopiranosa, -D-fructofuranosa

OH

CH2OH

Pgina I-4-6

I) Biomolculas

4) Glcidos

EJEMPLOS DE MONOSACRIDOS DE INTERSBIOLGICO


CH2OH

C
H H

O
OH

CH2OH

CH2OH

C
H

C C
OH OH OH OH H H OH

C
OH OH H

C
H

C
H

C
OH

C
H H

Glucosa: Sustancia muy difundida tanto entre los vegetales (uvas) como entre los animales. Forma parte de muchos disacridos y polisacridos. Importante fuente de energa de las clulas. En la sangre hay un uno por mil de glucosa procedente de la digestin.
CH2OH

Fructosa: Cetohexosa. Sustancia muy difundida entre las plantas, sobre todo en sus frutos, y en la miel. En el hgado se transforma en glucosa. Junto con la glucosa forma el disacrido sacarosa.

OH

CH2OH

OH

C
H

C C
OH H H H
CH2OH

C
H

C C
OH H H H
CH2OH

C
OH

C
H

Ribosa: Aldopentosa. Forma parte de muchas sustancias orgnicas de gran inters biolgico, como el ATP o el ARN.

Desoxirribosa: Derivada de la ribosa. Le falta el grupo alcohol en el carbono 2. Forma parte del ADN.

C
HO H

O C
OH OH H H

C
H H

O C
H H

C
H OH

C
OH OH H

C
H

C
OH

C
H

C
NH CO CH3

Galactosa: Junto con la glucosa forma la lactosa, disacrido de la leche.

N-acetilglucosamina: Derivado de la glucosa. Se encuentra en las paredes de las bacterias y es tambin el monmero que forma el polisacrido quitina presente en el exoesqueleto de los insectos y las paredes celulares de muchos hongos.

J. L. Snchez Guilln

OH OH

Pgina I-4-7

I) Biomolculas

4) Glcidos

LOS OLIGOSACRIDOS. EL ENLACE O-GLICOSDICO.

Los oligosacridos estn formados por la unin de 10 o menos de 10 monosacridos mediante un enlace O-glicosdico. As, si reaccionan el -OH del carbono anomrico de un monosacrido con otro -OH de otro monosacrido, ambas sustancias quedarn unidas mediante un enlace O-glicosdico. Como consecuencia de la unin se forman un disacrido y una molcula de agua. C6 H12 O6 + C6 H12 O6 C12 H22 O11 + H2 O El -OH o los -OHs que intervienen en la unin pueden encontrarse bien en forma o , lo que dar lugar a sustancias diferentes.
CH2OH O H H OH H H H H OH H CH2OH O H

OH

OH

OH

OH

OH H2O CH2OH

OH

CH2OH O H H H H O OH H O H

H H OH OH

OH

OH

OH

Fig. 13 Formacin de maltosa, disacrido reductor, mediante la unin 14 de dos molculas de glucosa.

Los disacridos son sustancias de propiedades similares a las de los monosacridos. Ahora bien, si los -OH de los carbonos anomricos de ambos monosacridos intervienen en el enlace O-glicosdico, enlace dicarbonlico, el disacrido no ser reductor, pues no tiene ningn OH hemiacetlico/hemicetlico libre y es este OH el que les da las propiedades reductoras.
Fig. 14 Modelo de esferas de la sacarosa, un Los oligosacridos se encuentran, junto a disacrido. lpidos y protenas, en la membrana plasmtica donde actan como receptores de muchas sustancias y como molculas que sirven para que las clulas se reconozcan entre s.

La hidrlisis de los oligosacridos proporciona los correspondientes monosacridos: C12 H22 O11 + H2 O C6 H12 O6 + C6 H12 O6

J. L. Snchez Guilln

Pgina I-4-8

I) Biomolculas

4) Glcidos

EJEMPLOS DE DISACRIDOS DE INTERSBIOLGICO


OH CH2OH H H O OH OH H O HOCH2 H OH H O H H HO CH2OH

Sacarosa: Formada por -D-glucosa y -D-fructosa (enlace 12), unidas por los OH de los carbonos anomricos y por lo tanto no reductor. Es el azcar de mesa. Se encuentra en la caa de azcar y en la remolacha.
CH2OH O HO H O H OH H H H OH OH H OH H H CH2OH O H

OH

Lactosa: Formada por -D-galactosa y D-glucosa, unidas 1 4 . Reductor. Se encuentra en la leche de los mamferos.
CH2OH H H OH H O H H H OH H CH2OH O H

OH

OH

OH

OH

Maltosa: Formada por dos D-glucosas unidas por un enlace 1 4. Reductor. Se obtiene por hidrlisis del almidn y del glucgeno. Aparece en la germinacin de la cebada empleada en la fabricacin de la cerveza. Tostada se emplea como sucedneo del caf (malta).
CH2OH H H O OH OH H H H OH OH H H O H H CH2OH O OH

OH

Celobiosa: Formada por dos D-glucosas unidas por un enlace 1 4. Reductor. Se obtiene por hidrlisis de la celulosa.

J. L. Snchez Guilln

Pgina I-4-9

I) Biomolculas

4) Glcidos

POLISACRIDOS

Uno de los monosacridos de la maltosa presenta libre su OH hemiacetlico y podr unirse mediante un nuevo enlace O-glicosdico al OH alcohlico de otro monosacrido. Este proceso puede repetirse y formarse un compuesto constituido por la unin de muchos monosacridos al que llamaremos polisacrido.

O HO O HO OH O O HO

O O HO O O OH HO OH OH O O O

OH

Fig. 15

Fragmento de almidn. El almidn es un polisacrido compuesto por molculas de glucosa.

Los polisacridos son sustancias inspidas, amorfas e insolubles en agua, algunos, como el almidn, pueden formar dispersiones coloidales. Aunque los polisacridos podran estar constituidos por diferentes monosacridos, lo normal es que sea un slo monosacrido el que forma la molcula. Los polisacridos son macromolculas, molculas de elevada masa molecular, miles o centenares de miles de daltons. Por ejemplo, cada molcula de celulosa, polisacrido vegetal, contiene de 300 a 3 000 molculas de glucosa y tiene un peso molecular que oscila entre 54 000 y 540 000 da. Algunos polisacridos presentan ramificaciones. Es de destacar que los polisacridos, al tener un slo -OH hemiacetlico por molcula libre, presentan un carcter reductor tan pequeo que se puede considerar como que no son reductores.

POLISACRIDOS DE INTERSBIOLGICO

Los polisacridos de mayor importancia biolgica estn formados por un slo tipo de monosacrido. Se trata, por lo tanto de homopolisacridos. Veamos algunos ejemplos:

Fig. 16

Fragmento de amilosa. La amilosa es uno de los componentes del almidn.

El almidn: polisacrido con funcin energtica. Es sintetizado por los vegetales. Est

J. L. Snchez Guilln

Pgina I-4-10

I) Biomolculas

4) Glcidos

formado por miles de mol culas de glucosa en unin 1 -- 4. La molcula adopta una disposicin en hlice, dando una vuelta por cada 6 molculas de glucosa, adems, cada 12 glucosas, presenta ramificaciones por uniones 1 -- 6. El almidn se reconoce fcilmente por teirse de violeta con disoluciones de iodo (solucin de Lugol). El glucgeno: Polisacrido de reserva energtica en los animales. Se encuentra en el hgado y en los msculos donde se hidroliza transformandose en glucosa. Su estructura es similar a la del almidn, aunque ms ramificado y su masa molecular es mucho mayor.

Fig. 17 Estructura helicoidal del almidn y del glucgeno. 1) Ramificaciones producidas por las uniones 1-6.

La celulosa: Sintetizada por los vegetales, tiene funcin estructural, formando parte importante de la pared celular. Est formada por la unin 1 -- 4 de varios millares de molculas de glucosa. Debido al tipo de enlace cada molcula de glucosa est girada 180 o respecto a la anterior, lo que le da a la celulosa una estructura lineal pero "retorcida". Esta disposicin permite que se formen gran cantidad de puentes de hidrgeno entre cadenas yuxtapuestas, lo que produce muy fibras resistentes.

CH2OH O O H OH H H H OH H H

CH2OH O O H OH H H H OH H H
O

CH2OH

CH2OH

celobiosa

Fig. 18

Fragmento de celulosa.

La quitina. Formada por un derivado nitrogenado de la glucosa: la N-acetil-glucosamina). Constituye los exoesqueletos de los artrpodos.

CH2OH H H O OH OH H H H NH C=O CH3 O H

CH2OH O H OH H H H NH C=O CH3 H

CH2OH O H O OH H H H NH C=O CH3 H

CH2OH O H OH H H H

quitobiosa

Fig. 19

Fragmento de quitina.

J. L. Snchez Guilln

H H O HO H

OH

H H O HO H

OH

Pgina I-4-11

I) Biomolculas

4) Glcidos

Tambin podemos encontrar en los seres vivos otros polisacridos ms complejos. Por ejemplo: - Las pectinas, de las paredes celulsicas de los vegetales, formadas por la polimerizacin del cido galacturnico, un derivado cido de la galactosa Los
pptidoglucanos de las paredes bacterianas, formados por polisacridos asociados a cadenas peptdicas.
Fig. 20 Los exoesqueletos de los artrpodos estn formados por quitina y otras sustancias.

J. L. Snchez Guilln

Pgina I-4-12

I) Biomolculas

5) Lpidos

I-5 LPIDOS

CONCEPTO, PROPIEDADES Y FUNCIONES GENERALES Concepto: Los lpidos son sustancias qumicamente muy diversas. Slo tienen en comn el ser insolubles en agua u otros disolventes polares y solubles en disolventes no polares u orgnicos, como el benceno, el ter, la acetona, el cloroformo, etc Propiedades fsicas: Son sustancias untosas al tacto, tienen brillo graso, son menos densas que el agua y malas conductoras del calor. Funciones en los seres vivos: Los lpidos desempean importantes funciones en los seres vivos. Estas son, entre otras, las siguientes:

- Estructural: Son componentes estructurales fundamentales de las membranas celulares. - Energtica: Al ser molculas poco oxidadas sirven de reserva energticapues proporcionan una gran cantidad de energa; la oxidacin de un gramo de grasa libera 9,4 Kcal, ms del doble que la que se consigue con 1 gramo de glcido o de protena (4,1 Kcal). - Protectora: Las ceras impermeabilizan las paredes celulares de los vegetales y de las bacterias y tienen tambin funciones protectoras en los insectos y en los vertebrados. - Transportadora: Sirven de transportadores de sustancias en los medios orgnicos. - Reguladora del metabolismo: Contribuyen al normal funcionamiento del organismo. Desempean esta funcin las vitaminas (A,D, K y E). Las hormonas sexuales y las de la corteza suprarrenal tambin son lpidos.

PROTECTORA

TRANSPORTE

FUNCIONES

REGULADORA ENERGTICA

ESTRUCTURAL

Fig. 1 vivos.

Funciones de los lpidos en los seres

Fig. 2 Modelo de esferas de un lpido, un acilglicrido.

- Reguladora de la temperatura: Tambin sirven para regular la temperatura. Por ejemplo, las capas de grasa de los mamferos acuticos de los mares de aguas muy fras.

J. L. Snchez Guilln

Pgina I-5-1

I) Biomolculas

5) Lpidos

SAPONIFICACIN DE LOS LPIDOS

Muchos lpidos, como por ejemplo: los cidos grasos, reaccionan con bases fuertes, NaOH o KOH, dando sales sdicas o potsicas que reciben el nombre de jabones. Esta reaccin se denomina de saponificacin. Son saponificables los cidos grasos o los lpidos que poseen cidos grasos en su estructura.

R1-COOH + NaOH
cido orgnico
Fig. 3

R1-COONa + H2O
Sal sdica (jabn) agua

hidrxido sdico

Reaccin de saponificacin entre un cido orgnico y el hidrxido sdico.

CLASIFICACIN

Segn den o no la reaccin de saponificacin, clasificaremos los lpidos en:


Saponificables No saponificables

cidos grasos Acilglicridos Ceras Fosfolpidos

Esteroides

Es de destacar que, adems de estas, que son las que estudiaremos, existen otras clases de lpidos, como: los carotenoides, los terpenos, las prostaglandinas, etc.

LOS CIDOS GRASOS Concepto. Son cidos orgnicos de elevado nmero de tomos de carbono. Este nmero es siempre par y oscila, normalmente, entre 12 y 22. Descripcin: La cadena carbonada puede o no tener dobles enlaces. En el primer caso, diremos que el cido graso es insaturado y en el segundo, saturado. Los cidos grasos se diferencian por el nmero de tomos de carbono y por el nmero y la posicin de los dobles Tabla I: Los principales cidos grasos. enlaces. A veces, por comodidad, representaremos la cadena hidrocarbonada de los cidos grasos como una simple lnea

J. L. Snchez Guilln

Pgina I-5-2

I) Biomolculas

5) Lpidos

quebrada. La cadena de los cidos grasos saturado puede disponerse totalmente extendida, mientras que la cadena de los cidos grasos insaturados al tener dobles enlaces adopta una disposicin doblada. Los cidos grasos no suelen encontrarse en estado libre y se obtienen por hidrlisis cida o enzimtica de los lpidos saponificables.
Fig. 4 1) Acido graso saturado (ac. Palmtico) 2) cido graso insaturado (ac. Olico).

Propiedades qumicas

a) Reaccin de esterificacin: El grupo cido de los cidos grasos va a poder reaccionar con los alcoholes para formar steres y agua.

R1-COOH + HOCH2-R2
cido orgnico
Fig. 5

R1-COO-CH2-R2 + H2O
ster agua

alcohol

Reaccin de esterificacin entre un cido graso y un alcohol para dar un ster y agua.

b) Reaccin de saponificacin: Como se ha dicho anteriormente, con bases fuertes como la sosa (NaOH) o la potasa (KOH), dan las correspondientes sales sdicas o potsicas del cido graso que reciben el nombre de jabones.

ACILGLICRIDOS O GRASAS
cidos grasos Glicerina COOH COOH COOH HO-CH2

Son steres de la glicerina y de cidos grasos. Si un cido graso esterifica uno de los grupos alcohol de la glicerina tendremos un monoacilglicrido, si son dos, un diacilglicrido, y si son tres, un triacilglicrido, triglicri o, tambin d llamados: grasas neutras. Estas sustancias por saponificacin dan jabones y glicerina. Los acilglicridos sencillos contienen un slo tipo de cido graso, mientras que los mixtos tienen cidos grasos diferentes. Los acilglicridos saponifican dando correspondientes jabones y glicerina. los

HO-CH HO-CH2

3H2O
CO- O-CH2 CO- O-CH CO- O-CH2 Triacilglicrido

Fig. 6 Reaccin de formacin de un triacilglicrido.

J. L. Snchez Guilln

Pgina I-5-3

I) Biomolculas

5) Lpidos

PROPIEDADES FSICAS DE LAS GRASAS Y FUCIN BIOLGICA

Las propiedades fsicas de estas sustancias son de gran importancia pues en cierto modo determinan su funcin biolgica. Estas propiedades se deben, en gran medida, a la longitud y al grado de insaturacin de la cadena hidrocarbonada de los cidos grasos que las forman.
* Solubilidad: Los cidos grasos son sustancias anfipticas ya que la cadena hidrocarbonada es apolar mientras que el grupo carboxilo es polar. Esta propiedad ser ms ampliamente tratada ms adelante.

Fig. 7 Las grasas animales y los aceites vegetales son mezclas complejas de acilglicridos y otros lpidos.

Los triglicridos son sustancias apolares, prcticamente insolubles en agua. Los monoacilglicridos y los diacilglicridos, al tener la glicerina radicales OH- libres, tienen cierta polaridad.
Fig. 8 Monoacilglicrido.

* Punto de fusin: Los cidos grasos saturados, al poderse disponer la cadena hidrocarbonada totalmente extendida, pueden empaquetarse O estrechamente lo que permite que se unan C-O-H O mediante fuerzas de Van der Waals con tomos C-O-H de cadenas vecinas (el nmero de enlaces, O C-O-H adems, est en relacin directa con la longitud O de la cadena). Por el contrario, los cidos C-O-H grasos insaturados, al tener la cadena doblada por los dobles enlaces no pueden empaquetarse Fig. 9 Las grasas que contienen cidos tan fuertemente. Es por esto que los cidos grasos saturados son slidas; pues sus grasos saturados tienen puntos de fusin mas componentes pueden empaquetarse ms densamente, lo que aumenta el punto de fusin. altos que los insaturados y son slidos (sebos) a temperaturas a las que los insaturados son lquidos (aceites). En los animales poiquilotermos y en los vegetales hay aceites y en los animales homeotermos hay sebos. Los sebos y los aceites estn formados por mezclas ms o menos complejas de acilglicridos.
= = = =

Las grasas tienen sobre todo funciones energticas. En los vegetales se almacenan en las vacuolas de las clulas vegetales (las semillas y frutos oleaginosos) y en el tejido graso o adiposo de los animales. Contienen en proporcin mucha ms energa que otras sustancias orgnicas, como por ejemplo el glucgeno, pues pueden almacenarse en grandes

J. L. Snchez Guilln

C-O-H

C-O-H

C-O-H

C-O-H O

Pgina I-5-4

I) Biomolculas

5) Lpidos

cantidades y en forma deshidratada, con lo que ocupan un menor volumen. En el intestino, las lipasas hidrolizan los acilglicridos liberando glicerina y cidos grasos.

3NaOH
CO- O-CH2 CO- O-CH CO- O-CH2 Triacilglicrido jabn COONa COONa + COONa HO-CH2 HO-CH HO-CH2

Glicerina

Fig. 10

Saponificacin de un triacilglicrido.

En algunos animales las grasas acumuladas bajo la piel sirven como aislante trmico o para regular la flotabilidad, pues son malas conductoras del calor y menos densas que el agua. Algunos cidos grasos de cadena muy larga son esenciales en la dieta y se les conoce bajo el nombre genrico de vitaminas F.
LAS CERAS

Son steres de un monoalcohol lineal y de un cido graso, ambos de cadena larga.

Palmitato de miricilo (cera de abeja)

Enlace ster

cido graso (C18)

Alcohol de cadena larga (C30)

Fig. 11

Palmitato de miricilo, cera de abejas.

LOS FOSFOLPIDOS

Son lpidos que forman parte de las membranas celulares. Derivan de la glicerina o de la esfingosina, un alcohol ms complejo. Los derivados de la glicerina se llaman fosfoglicridos y los que derivan de la esfingosina: esfingolpidos.
I) FOSFOGLICRIDOS

Se trata de una de las clases de fosfolpidos, lpidos con cido fosfrico. Qumicamente podemos definirlos como steres del cido fosfatdico y un compuesto polar, generalmente

J. L. Snchez Guilln

Pgina I-5-5

I) Biomolculas

5) Lpidos

un aminoalcohol. El cido fosfat dico es, a su vez, un ster de un diacilglicrido y del cido fosfrico. El alcohol es siempre una sustancia polar, soluble en agua, muy variada qumicamente (aminocido, base nitrogenada, etc). Como ejemplo de fosfoglicrido podemos ver en la Fig.12 la estructura de la lecitina (fosfatidilcolina).

O C O- CH 2 O C O- CH O
X Y +

CH3

H2COPOCHCHNCH3 OH
Z W

CH3

cido fosfatdico (apolar)

alcohol (polar)

Fig. 12 Lecitina. X) cidos grasos. Y) Glicerina. Z) cido fosfrico. W) Colina. X y Y estn unidos por enlaces ster; Y y Z, y Z y W lo estn por enlaces ster fosfato.

Otros ejemplos de fosfoglicridos segn sea w son:

Alcohol (W)

Fosfoglic rido

Colina Serina

Fosfatidilcolina Fosfatidilserina

ESFINGOLPIDOS

Su estructura molecular deriva de la unin del alcohol esfingosina y una sustancia polar que puede ser un aminoalcohol o un glcido. El ms conocido es la esfingomielina.

Fig. 13

Esfingonielina.

IMPORTANCIA BIOLGICA DE LOS FOSFOLPIDOS

Los fosfolpidos compuestos anfipticos y debido a esto desempean un papel estructural de gran importancia en los seres vivos pues constituyen las membranas celulares. stas estn formadas por una doble capa de fosfolpidos en la que estn integrados otros lpidos (colesterol, por ejemplo) y protenas. En el caso de la membrana plasmtica hay tambin oligosacridos.

J. L. Snchez Guilln

Pgina I-5-6

I) Biomolculas

5) Lpidos

LOS ESTEROIDES

Son lpidos no saponificables derivados del ciclo del esterano (ciclopentano-perhidrofenantreno). Muchas sustancias importantes en los seres vivos son esteroides o derivados de esteroides. Por ejemplo: el colesterol, los cidos biliares, las hormonas sexuales, las hormonas de la corteza suprarrenal, muchos alcaloides, etc. En la tabla de la pgina 9 se dan algunos ejemplos de esteroides presentes en los seres vivos.

Fig. 14

Esterano.

CARCTER ANFIPTICO DE LOS LPIDOS MICELAS, MONOCAPAS Y BICAPAS

Fig. 15

Colesterol.

Ciertos lpidos, y en particular los fosfolpi dos, tienen una parte de la molcula que es polar: hidrfila y otra (la correspondiente a los cidos grasos) que es no polar: hidrfoba. Las molculas que presentan estas caractersticas reciben el nombre de anfipticas. A partir de ahora y por comodidad, representaremos la parte polar (hidrfila) y la no polar (hidrfoba) de un fosfolpido como se indica en la Fig. 16. Cuando los fosfolpidos se dispersan en agua forman micelas. Los grupos hidrfilos se disponen hacia la parte acuosa y la parte hidrfoba de cada molcula hacia el interior. Las suspensiones que contienen este tipo de micelas son muy estables. Los lpidos anfipticos pueden tambin dispersarse por una superficie acuosa pudindose formar, si la cantidad es la adecuada, una capa de una molcula de espesor: monocapa. En este caso las partes hidrfilas se disponen hacia el interior y los grupos hidrfobos hacia el exterior de la superficie acuosa. Pueden tambin formarse bicapas, en particular entre dos

Fig. 16 anfiptico.

Representacin de un lpido

Fig. 17 Monocapa y bicapa formada por un lpido anfiptico.

J. L. Snchez Guilln

Pgina I-5-7

I) Biomolculas

5) Lpidos

compartimientos acuosos. Entonces, las partes hidrfobas se disponen enfrentadas y las partes hidrfilas se colocan hacia la solucin acuosa. Los lpidos anfipticos forman este tipo de estructuras espontneamente. Las bicapas pueden formar compartimientos cerrados denominados liposomas. La bicapas lipdicas poseen caractersticas similares a las de las membranas celulares: son permeables al agua pero impermeables a los cationes y aniones y son tambin malas conductoras elctricas. En realidad, las membranas celulares son, esencialmente, bicapa lipdi cas.

Fig. 18

Micelas.

Fig. 19 Las membranas celulares estn constitudas por bicapas lipdicas en la que se encuentran insertadas protenas.

J. L. Snchez Guilln

Pgina I-5-8

I) Biomolculas

5) Lpidos

EJEMPLOS DE ESTEROIDES

Colesterol: El OH confiere un carcter polar a esta parte de la molcula. Precursor de otras muchas sustancias. Presente en las membranas celulares de las clulas animales a las que confiere estabilidad.

Cortisona: Hormona de la corteza de las glndulas suprarrenales. Acta favoreciendo la formacin de glucosa y glucgeno.

Progesterona: Una de las hormonas sexuales femeninas.

Testosterona: Hormona sexual masculina.

Vitamina D: Regula el metabolismo del calcio y del fsforo.

Solanina: Alcaloide presente en la patata. Obsrvese que tiene un oligosacrido unido al anillo del esterano.

J. L. Snchez Guilln

Pgina I-5-9

I) Biomolculas

5) Lpidos

J. L. Snchez Guilln

Pgina I-5-10

I) Biomolculas

6) Protenas

I-6 PROTENAS

CONCEPTO Y CARACTERSTICAS Concepto: Se pueden definir como polmeros formados por la unin, mediante enlaces peptdicos, de unidades de menor masa molecular llamadas aminocidos.

Son molculas muy complejas. Su masa molecular es muy elevada, normalmente est comprendida entre 6000 da y 10 6 da, son macromolculas. Algunas protenas estn constituidas por la unin de varios polmeros proteicos que en ocasiones pueden tambin contener otras molculas orgnicas (lpidos, glcidos, etc). En este ltimo caso reciben el nombre genrico de prtidos. Las protenas son las molculas orgnicas ms abundantes en las clulas, ms del 50% del peso seco de la clula son protenas. Estn constituidas, fundamentalmente, por C, H, O y N y casi todas tienen tambin azufre. Algunas tienen, adems, otros elementos qumicos y en particular: P, Fe, Zn o Cu. El elemento ms caracterstico de las protenas es el nitrgeno. Son los compuestos nitrogenados por excelencia de los seres vivos. Las protenas son molculas especficas que marcan la individualidad de cada ser vivo. Son adems de una gran importancia porque a travs de ellas se va a expresar la informacin gentica, de hecho el dogma central de la gentica molecular nos dice:
DNARNAProtena

FUNCIONES GENERALES

Las protenas estn entre las sustancias que realizan las funciones ms importantes en los seres vivos. De entre todas pueden destacarse las siguientes: - De reserva. En general las protenas no tienen funcin de reserva, pero pueden utilizarse con este fin en algunos casos especiales como por ejemplo en el desarrollo embrionario: ovoalbmina del huevo, casena de la leche y gliadina del trigo. - Estructural. Las protenas constituyen muchas estructuras de los seres vivos. Las membranas celulares contienen protenas. En el organismo, en general, ciertas estructuras -cartlago, hueso- estn formadas, entre otras sustancias, por protenas.

J. L. Snchez Guilln

Pgina I-6-1

I) Biomolculas

6) Protenas

- Enzimtica. Todas las reacciones que se producen en los organismos son catalizadas por molculas orgnicas. Las enzimas son las molculas que realizan esta funcin en los seres vivos. Todas las reacciones qumicas que se producen en los seres vivos necesitan su enzima y todas las enzimas son protenas. - Homeosttica. Ciertas protenas mantienen el equilibrio osmtico del medio celular y extracelular. - Transporte, de gases, como es el caso de la hemoglobina, o de lpidos, como la seroalbmina. Ambas protenas se encuentran en la sangre. Las permeasas, molculas que realizan los intercambios entre la clula y el exterior, son tambin protenas. - Movimiento. Actan como elementos esenciales en el movimiento. As, la actina y la miosina, protenas de las clulas musculares, son las responsables de la contraccin de la fibra muscular. - Hormonal. Las hormonas son sustancias qumicas que regulan procesos vitales. Algunas protenas actan como hormonas, por ejemplo: la insulina, que regula la concentracin de la glucosa en la sangre. - Inmunolgica. Los anticuerpos, sustancias que intervienen en los procesos de defensa frente a de los agentes patgenos, son protenas.

LOS AMINOCIDOS

Son las unidades estructurales que constituyen las protenas. Todos los aminocidos que se encuentran en las protenas, salvo la prolina, responden a la frmula general que se observa en la figura. A partir de ahora nos referiremos exclusivamente a los aminocidos presentes en las protenas de los seres vivos. Estos, como indica su nombre, tienen dos grupos funcionales caractersticos: el grupo carboxilo o grupo cido (-COOH), y el grupo amino (-NH2 ). La cadena carbonada de los aminocidos se numera comenzando por el grupo cido, siendo el carbono que tiene esta funcin el carbono nmero 1, el grupo amino se encuentra siempre en el carbono 2 o carbono .

Fig. 1

Frmula general de un amino-cido.

COOH HN C H

Fig. 2 L-prolina; aminocido polar no ionizable. Es el nico aminocido que no responde a la frmula general.

J. L. Snchez Guilln

Pgina I-6-2

I) Biomolculas

6) Protenas

Por lo tanto, los aminocidos tienen en comn los carbonos 1 (grupo carboxilo) y 2 (el del grupo amino) diferencindose en el resto (R) de la molcula. En la frmula general de la Fig. 1 , R representa el resto de la molcula. R puede ser desde un simple H- , como en el aminocido glicocola, a una cadena carbonada ms o menos compleja en la que puede haber otros grupos aminos o carboxilo y tambin otras funciones (alcohol, tiol, etc.). Las protenas delos seres vivos slo tienen unos 20 aminocidos diferentes, por lo que habr nicamente 20 restos distintos. Es de destacar el hecho de que en todos los seres vivos slo se encuentren los mismos 20 aminocidos. En ciertos casos muy raros, por ejemplo en los venenos de algunas serpientes, podemos encontrar otros aminocidos diferentes de estos 20 e incluso aminocidos que no siguen la frmula general. La mayora de los aminocidos pueden sintetizarse unos a partir de otros, pero existen otros, aminocidos esenciales, que no pueden ser sintetizados y deben obtenerse en la dieta habitual. Los aminocidos esenciales son diferentes para cada especie, en la especie humana, por ejemplo, los aminocidos esenciales son diez: Thr, Lys, Arg, His, Val, Leu, Ileu, Met, Phe y Trp.

COOH H2N C CH2 CH H


Fig. 3 L-leucina; aminocido no polar.

CH3 CH3

COOH H2N C CH2 H


Fig. 4 L-tirosina; aminocido polar no ionizable.

OH

COOH H 2N C CH2 CH2 COOH H


Fig. 5 L-Glutmico; aminocido polar ionizable cido.

COOH H 2N C CH2 CH2 COOH H


Fig. 6 L-Arginina; aminocido polar ionizable bsico.

CLASIFICACIN DE LOS AMINOCIDOS

En funcin de sus caractersticas qumicas, los aminocidos se clasifican en:

Grupo I: Aminocidos apolares. Aminocidos cuyo resto R no es polar. Esto es, no posee cargas elctricas en R al tener en l largas cadenas hidrocarbonadas. Estos aminocidos, si estn en gran abundancia en una protena, la hacen insoluble en agua. Grupo II: Aminocidos polares no ionizables. Poseen restos con cortas cadenas hidrocarbonadas en las que hay funciones polares (alcohol, tiol o amida). Contrariamente al grupo anterior si una protena los tiene en abundancia ser soluble en agua.

J. L. Snchez Guilln

Pgina I-6-3

I) Biomolculas

6) Protenas

Grupo III: Aminocidos polares cidos. Pertenecen a este grupo aquellos aminocidos que tienen ms de un grupo carboxilo. En las protenas, si el pH es bsico o neutro, estos grupos se encuentran cargados negativamente. Grupo IV: Aminocidos polares bsicos. Son aquellos aminocidos que tienen otro u otros grupos aminos. En las protenas, estos grupos amino, si el pH es cido o neutro, estn cargados positivamente.

COOH H2N C CH2 COOH H


H2O H3O+

COOH H2 N C CH2 COO H

ASIMETRA DE LOS AMINOCIDOS

Fig. 8 Ionizacin del grupo amino suplementario de un aminocido polar ionizable cido.
COOH H2N C CH2 CH2 CH2 CH2 NH2 H
H2 O OH-

Excepto en la glicocola, en el resto de los aminocidos el carbono (el carbono que lleva la funcin amino) es asimtrico. La molcula ser pticamente activa y existirn dos configuraciones: D y L. Normalmente en los seres vivos slo encontramos uno de los ismeros pticos. Por convenio se considera que los aminocidos presentes en los seres vivos pertenecen todos ellos a la serie L. No obstante, en los microorganismos (paredes bacterianas, antibiticos generados por bacterias) existen aminocidos no proteicos pertenecientes a la serie D.

COOH H2N C CH2 CH2 CH2 CH2 NH3 H

Fig. 9 Ionizacin del grupo amino suplementario de un aminocido polar ionizable bsico.

OH C H C R
D aminocido

OH O NH2 H2N C C R
L aminocido

O H

Fig. 10 Asimetra de los aminocidos. Todos los aminocidos, excepto la glicocola, son asimtricos. De las dos formas, la D y la L, en los seres vivos slo existe, normalmente, la L.

J. L. Snchez Guilln

Pgina I-6-4

I) Biomolculas
Aminocidos del Grupo I (apolares)

6) Protenas

COOH H2N-C-CH3 H
Alanina-Ala

COOH H 2N C CH2 CH H
Leucina-Leu

COOH CH3 CH3 H2N C CH H


Valina-Val

CH3 CH3

COOH HN C H
Prolina-Pro

COOH H 2N C CH2 H COOH H 2N C CH2 CH2 S CH3 H COOH


N H
Metionina-Met Fenilalanina-Phe

COOH H 2N C CH2 H

H 2N

C CH CH2 CH3 H CH3


Isoleucina-Ile

Triptfano-Trp

Aminocidos del Grupo II (polares no ionizables)

COOH H2N C H H
Glicocola-Gly

COOH H2N C CH2 OH H


Serina-Ser

COOH H2N C CH CH3 H OH


Treonina-Trp

COOH H2N C CH2 SH H


Cistena-Cys

COOH H2N C CH2 H COOH O NH2 H2N C CH2 CH2-C H O NH2 OH


Tirosina-Tyr

COOH H2N C CH2 C H

Asparragina-Asn

Glutamina-Gln

Aminocidos del Grupo III (polares ionizables cidos)

Aminocidos del Grupo IV (polares ionizables bsicos)

COOH H 2N C CH2 COOH H COOH H2N C CH2 CH2 COOH H


Glutmico-Glu Asprtico-Asp

COOH H2N C CH2 H COOH H2N C CH2 CH2 CH2 NH C NH2 H COOH H2N C CH2 CH2 CH2 CH2 NH2 H
Lisina-Lys

N N H
Histidina-His

NH
Arginina-Arg

J. L. Snchez Guilln

Pgina I-6-5

I) Biomolculas

6) Protenas

EL ENLACE PEPTDICO

Cuando reacciona el grupo cido de un aminocido con el grupo amino de otro ambos aminocidos quedan unidos mediante un enlace peptdico. Se trata de una reaccin de condensacin en la que se produce una amida y una molcula de agua. La sustancia que resulta de la unin es un dipptido.
H H N H C R1
Aminocido 1

O C O H + H N H

H C R2

O C O H

Aminocido 2

H2 O H H N H C R1 H C R2

O C N H
dipptido

O C O H

Fig. 12

Reaccin de formacin del enlace peptdico.

CARACTERSTICAS DEL ENLACE PEPTDI CO

10) El enlace peptdico es un enlace covalente que se establece entre un tomo de carbono y un tomo de nitrgeno. Es un enlace muy resistente, lo que hace posible el gran tamao y estabilidad de las molculas proteicas.

Fig. 13 El enlace C-N se comporta como un doble enlace y no permite el giro.

J. L. Snchez Guilln

Pgina I-6-6

I) Biomolculas

6) Protenas

20) Los estudios de Rayos X de las protenas han llevado a la conclusin de que el enlace C-N del enlace pept dico se comporta en cierto modo como un doble enlace y no es posible, por lo tanto, el giro libre alrededor de l. 30) Todos los tomos que estn unidos al carbono y al nitrgeno del enlace peptdico mantienen unas distancias y ngulos caractersticos y estn todos ellos en un mismo plano.

Fig. 14

Caractersticas del enlace peptdico.

PPTIDOS, POLIPPTIDOS y PROTENAS

Cuando se unen dos aminocidos mediante un enlace peptdico se forma un dipptido. A cada uno de los aminocidos que forman el dipptido les queda libre o el grupo amino o el grupo carboxilo. A uno de estos grupos se le podr unir otro aminocido formndose un tripptido. Si el proceso se repite sucesivamente se formar un polipptido. Cuando el nmero de aminocidos unidos es muy grande, aproximadamente a partir de 100, tendremos una protena.

Fig. 15 pptido.

Modelo de esferas de la insulina, un

2 aa 3 aa de 4 a 10 aa de 10 a 100 aa ms de 100 aa

Dipptido Tripptido Oligopptido Polipptido Prote na

Toda cadena polipeptdica tendr en uno de sus extremos un aminocido con el grupo amino libre. Este ser el aminocido amino terminal (H-). En el otro extremo quedar libre el

J. L. Snchez Guilln

Pgina I-6-7

I) Biomolculas

6) Protenas

grupo carboxilo del ltimo aminocido, aminocido carboxilo terminal (-OH). Toda cadena proteica tendr por lo tanto una polaridad indicada mediante una H- y un -OH. Ejemplo: H-Gly-Ala-Pro-Leu-Trp-Met-Ser-OH. Muchas sustancias naturales de gran importancia son pptidos; por ejemplo: ciertas hormonas, como la insulina, que regula las concentraciones de glucosa en la sangre y que est formada por dos cadenas de 21 y 30 aminocidos unidas por puentes disulfuro; la encefalina (5 aminocidos) que se produce en las neuronas cerebrales y elimina la sensacin de dolor o las hormonas del lbulo posterior de la hipfisis: vasopresina y oxitocina (9 aa) que producen las contracciones del tero durante el parto; tambin son pptidos algunos antibiticos como la gramicidina.

Fig. 16 Modelo de barras y esferas de la oxitocina, una hormona peptdica.

ESTRUCTURA O CONFORMACIN DE LAS PROTENAS

La conformacin de una protena es la disposicin espacial que adopta la molcula proteica. Las cadenas peptdicas, en condiciones normales de pH y temperatura, poseen solamente una conformacin y sta es la responsable de las importantes funciones que realizan. La compleja estructura de las protenas puede estudiarse a diferentes niveles. A saber: primario, secundario, terciario y cuaternario.
I) NIVEL O ESTRUCTURA PRIMARIA- Viene dada por la secuencia: orden que siguen los aminocidos de una protena. Va a ser de gran importancia, pues la secuencia es la que determina el resto de los niveles y como consecuencia la funcin de la protena.

Fig. 17 Modelo de bolas de la ubicuitina, una protena.

Fig. 18 La insulina, una hormona de carcter peptdico, est formada por dos cadenas polipeptdicas.

La alteracin de la estructura primaria por eliminacin, adicin o intercambio de los ami-

J. L. Snchez Guilln

Pgina I-6-8

I) Biomolculas

6) Protenas

nocidos puede cambiar la configuracin general de una protena y dar lugar a una protena diferente. Como, adems, la funcin de la protena depende de su estructura, un cambio en la estructura primaria podr determinar que la protena no pueda realizar su funcin. Veamos, a continuacin, un ejemplo de estructura primaria: H-Ala-Gly-Ser-Lys-Asp-Asn-Cys-Leu-Met-AlaIle-Trp-Gly-......-Pro-Asn-Glu-OH
II) NIVEL O ESTRUCTURA SECUNDARIA- Las caractersti cas de los enlaces peptdicos imponen determinadas restricciones que obligan a que las protenas adopten una determinada estructura secundaria.
Fig. 19

Modelo de cintas de la ubicuitina.

sta puede ser en hlice , hlice de colgeno o en conformacin . Es de destacar que las tres son configuraciones en hlice diferenciandose en el nmero de aminocidos por vuelta (n) y en el dimetro de la hlice. En la hlice , n=4; en la hlice de colgeno, n=3 y en la conformacin , n=2. A continuacin estudiaremos solo la hlice y la conformacin por ser las configuraciones ms frecuentes.
a) Estructura en hlice . Se trata de la forma ms simple y comn. En este tipo de estructura la molcula adopta una disposicin helicoidal, los restos (R) de los aminocidos se sitan hacia el exterior de la hlice y cada 3,6 aminocidos sta da una vuelta completa.

Fig. 20 1) Hlices alfa; 2) conformaciones beta; 3) enlaces de hidrgeno; 4) puentes disulfuro; 5) zonas irregulares.

Este tipo de organizacin es muy estable, porque permite la formacin de puentes de hidrgeno entre el grupo C=O de un aminocido y el grupo N-H del cuarto aminocido situado por debajo de l en la hlice.
b) Conformacin . Se origina cuando la mol cula proteica, o una parte de la mol cula, adoptan una disposicin en zig-zag. La estabilidad se consigue mediante la disposicin en paralelo de varias cadenas con esta conformacin, cadenas

Fig. 21 Hlice alfa. Mediante flechas se indican algunos enlaces de hidrgeno. R) restos de los aminocidos.

J. L. Snchez Guilln

Pgina I-6-9

I) Biomolculas

6) Protenas

que pueden pertenecer a protenas diferentes o ser partes de una misma molcula. De esta manera pueden establecerse puentes de hidrgeno entre grupos C=O y -N-H. Los restos van quedando alternativamente hacia arriba y hacia abajo. No obstante, si la molcula presenta prximos entre s restos muy voluminosos o con las mismas cargas elctricas se desestabilizar.

Fig. 22 Visin superior de una hlice alfa. Los nmeros indican los aminocidos.

Fig. 23 Conformacin beta o lmina plegada beta. En la figura se observan dos fragmentos de lmina plegada beta asociados por enlaces de hidrgeno.

Una mol cula no tiene que estar constituida exclusivamente por un tipo de conformacin. Lo normal es que las molculas proteicas presenten porciones con hlices , otras partes con conformaciones y partes que no tienen una conformacin definida y que se llaman zonas irregulares.

III) NIVEL O ESTRUCTURA TERCIARIA- Las protenas no se disponen linealmente en el espacio sino que normalmente sufren plegamientos que hacen que la molcula adopte una estructura espacial tridimensional llamada estructura terciaria. Los pliegues que originan la estructura terciaria se deben a ciertos aminocidos, como: la prolina, la serina y la isoleucina, que distorsionan la hlice generando una curvatura.

La estructura terciaria se va a estabilizar por la formacin de las siguientes interacciones: 1) Enlaces o puentes de hidrgeno. 2) Interacciones cido base. 3) Puentes disulfuro. Estos ltimos se forman entre grupos -SH pertenecientes a dos molculas de cistena que reaccionan entre s para dar cistina. -Cis-SH + HS-Cis- ----- -Cis-S-S-Cis-

Fig. 24 Estructura de una protena. a) hlices alfa; b) conformaciones beta; c) zonas irregulares.

J. L. Snchez Guilln

Pgina I-6-10

I) Biomolculas

6) Protenas

En la estructura terciaria los restos se van a disponer en funcin de su afinidad con el medio. En medio acuoso, los restos hidrfobos se sitan hacia el interior de la molcula mientras que los restos hidrfilos lo hacen hacia el exterior. Bsicamente se distingen dos tipos de estructura terciaria: la filamentosa y la globular, aunque muchos autores consideran que las protenas filamentosas son protenas que carecen de estructura terciaria. Las protenas con conformacin filamentosa suelen tener funcin estructural, de proteccin o ambas a la vez y son insolubles en agua y en soluciones salinas. Por ejemplo, tienen esta conformacin: la beta-queratina, el colgeno y la elastina.

Fig. 25 Estructura terciaria de una protena. a) hlices alfa b) conformaciones beta; c) zonas irregulares.

Las protenas con conformacin globular suelen ser solubles en agua y/o en disoluciones salinas. Son globulares las enzimas, las protenas de membrana y muchas protenas con funcin transportadora. Las protenas globulares suelen tener diferentes fragmentos con alfa-hlices y conformaciones beta, pero las conformaciones beta suelen disponerse en la periferia y las hlices alfa en el centro de la molcula. Adems, las protenas globulares se doblan de tal manera que, en solucin acuosa, sus restos hidrfilos quedan hacia el exterior y los hidrfobos en el interior y, por el contrario, en un ambiente lipdico, los restos hidrfilos quedan en el interior y los hidrfobos en el exterior.

IV) ESTRUCTURA CUATERNARIA- Cuando varias cadenas de aminocidos, iguales o diferentes, se unen para formar un edificio proteico de orden superior, se disponen segn lo que llamamos estructura cuaternaria. Tambin se considera estructura cuaternaria la unin de una o varias protenas a otras molculas no proteicas para formar edificios macromolculares complejos. Esto es frecuente en protenas con masas moleculares superiores a 50.000

Glcido

Glcido

Cada polipptido que interviene en la formacin de este complejo proteico es un protmero y segn el nmero de protmeros tendremos: dmeros, tetrmeros, pentmeros, etc.

Fig. 26 Los anticuerpos tienen estructura cuaternaria pues estn formados por la unin, mediante puentes disulfuro, de cuatro protmeros o dominios; dos de cadena larga y dos de cadena corta

J. L. Snchez Guilln

Pgina I-6-11

I) Biomolculas

6) Protenas

La asociacin o unin de las molculas que forman una estructura cuaternaria, se consigue y mantiene mediante enlaces de hidrgeno, fuerzas de Van der Waals, interacciones electrostticas y algn que otro puente disulfuro. Un ejemplo de estructura cuaternaria es la hemoglobina, formada por las globinas o parte proteica (dos cadenas alfa y dos cadenas beta, con un total de 146 aminocidos) ms la parte no proteica o grupos hemo. O los anticuerpos, formados tambin por cuatro cadenas, dos cadenas cortas y dos largas.

Fig. 27

Modelo de anticuerpo.

PROPIEDADES DE LAS PROTENAS

Las propiedades de una protena, incluso su carga elctrica, dependen de los restos o radicales de los aminocidos que quedan en su superficie y que podrn interaccionar mediante enlaces covalentes o no covalentes con otras molculas. A continuacin veremos las propiedades ms importantes:
Solubilidad. Las protenas solubles en agua, al ser macromolculas, no forman verdaderas disoluciones sino dispersiones coloidales. Cada macromolcula proteica queda rodeada de molculas de agua y no contacta con otras macromolculas gemelas con lo que no puede producirse la precipitacin. Especificidad. La especificidad de las protenas puede entenderse de dos maneras. Por una parte, existe una especificidad de funcin. Esto es, cada protena tiene una funcin concreta, diferente, normalmente, de la del resto de las molculas proticas. Esta es la razn de que tenganos tantas protenas distintas, unas 100 000. Ahora bien, ciertas protenas que realizan funciones similares en los seres vivos, por ejemplo: la hemoglobina de la sangre, presentan diferencias entre las distintas especies. Estas diferencias se han producido como consecuencia del proceso evolutivo y cada especie o incluso cada individuo, puede tener sus propias protenas especficas. No obstante, estas diferencias se producen en ciertas regiones de la protena llamadas sectores variables de las que no depende directamente se funcin. Mientras que otros sectores, de los que si depende la funcin de la protena, tienen siempre la misma secuencia de aminocidos. La especificidad de las protenas depender por lo tanto de los sectores variables y a ellos se deben, por ejemplo, los problemas de rechazos en los transplantes de rganos.

Por ejemplo: La insulina consta de 51 aminocidos en todos los mamferos, que estn distribuidos en dos cadenas, de 21 y 30 aminocidos respectivamente, unidas mediante dos enlaces disulfuro; de stos 51 aminocidos, la mayora son los mismos en todas las especies, pero unos pocos (tres de la cadena corta) varan de unas a otras.

J. L. Snchez Guilln

Pgina I-6-12

I) Biomolculas

6) Protenas

Los diferentes papeles biolgicos de stas molculas van a depender de la forma que adopten en su conformacin espacial.
Especies Cerdo A8 Thr Thr Thr Ala His Ala

Aminocidos A9 Ser Ser Gly Gly Asn Ser A10 Ile Ile Ile Val Thr Val B30 Ala Thr Ala Ala Ala Ala

DESNATURALIZACIN DE LAS PROTENAS

Hombre Caballo Carnero

Actividad enzimtica

Las alteraciones de la concentracin, del grado de acidez, de la temperatura (calor); pueden provocar la desnaturalizacin de las protenas. La desnaturalizacin es una prdida total o parcial de los niveles de estructura superiores al primario y se debe a la desaparicin de los enlaces dbiles tipo puente de hidrgeno, Van der Waals, etc. y en realidad no afecta a los enlaces peptdicos y por tanto a la estructura primaria. Sin embargo al alterarse su conformacin espacial, la protena perder su funcionalidad biolgica. En las protenas globulares, solubles en agua, la desnaturalizacin est acompaada de una prdida de la solubilidad y la consiguiente precipitacin de la disolucin. Puede existir una renaturalizacin casi siempre, excepto cuando el agente causante de la desnaturalizacin es el calor (coagulacin de la leche, huevos fritos, "permanente" del cabello, etc.).

Pollo Vaca

Fig. 28 Diferencias en la estructura primaria de la insulina de diferentes vertebrados.

Temperatura ptima

Fig. 29 Variacin de la actividad de una enzima con la temperatura. A partir de 451C la enzima se desnaturaliza, por alterarse su conformacin, y al destruirse el centro activo deja de actuar.

La funcin de las protenas depende de su conformacin. Algunas protenas, particularmente las enzimas, tienen una o varias zonas en su molcula de las que depende su funcin llamadas: centro activo o locus. El centro activo de la protena acta unindose a la molcula sobre la que se va a realizar la tranformacin, molcula que llamaremos ligando, que debe encajar en el centro activo.

Variacin de la actividad enzimtica

RELACIN ENTRE LA CONFORMACIN Y LA ACTIVIDAD DE LAS PROTENAS

tiempo

Fig. 30 Variacin en la actividad de una enzima medida en funcin de la cantidad de substrato (ligando) transformado a 37oC. En t se ha aumentado la temperatura hasta 70oC.

El ligando y el centro activo interaccionan mediante fuerzas qumicas. Estas interacciones se deben a que ciertos radicales de los aminocidos de la protena, que estn en el centro activo de la molcula, tienen afinidad qumica por determinados grupos funcionales presentes en el ligando. Algunas veces la unin protena-ligando es irreversible como ocurre con las reacciones antgeno-anticuerpo. Otras veces es perfectamente reversible.

J. L. Snchez Guilln

Pgina I-6-13

I) Biomolculas

6) Protenas

Los aminocidos cuyos restos constituyen el centro activo pueden estar muy distantes unos de otros en la secuencia primaria de la protena, pero que debido a los pliegues y repliegues de la estructura terciaria, quedan localizados, espacialmente, muy prximos unos de otros y, sobre todo, formando una especie de hueco donde encajar el ligando. El resto de los aminocidos de la protena tienen como misin mantener la forma y la estructura que se precisa para que el centro activo se encuentre en la posicin correcta. Para que una protena y un ligando se unan o se reconozcan deben establecerse entre ambas molculas varios puntos de interaccin del tipo enlaces dbiles, especialmente fuerzas de Van der Waals, puentes de hidrgeno, etc.

Ligando o sustrato

sustrato coenzima enzima centro activo

Fig. 31 Ajuste entre el ligando y el La conformacin de una protena y por lo centro activo de una enzima. tanto su centro activo y su funcin pueden alterarse si se producen cambios en las estructura primaria. As, por ejemplo, en la anemia falciforme, el 61 aminocido de una de las cadenas proteicas que forman la hemoglobina, el glutmico, ha sido sustitudo por valina. Como consecuencia la hemoglobina pierde su funcionalidad y no puede transportar convenientemente el oxgeno y los heritrocitos (glbulos rojos) adquieren forma de hoz.

Como ya hemos visto, la conformacin puede tambin alterarse si la protena se desnaturaliza por la accin de agentes como el calor y los cidos y las bases fuertes. La desnaturalizacin irreversible destruye el centro activo y la prote na no puede ya realizar su funcin.

J. L. Snchez Guilln

Pgina I-6-14

II) La clula

1) Origen de los seres vivos. Teora celular

BLOQUE II FISIOLOGA CELULAR

1a-EL ORIGEN DE LOS SERES VIVOS


CONDICIONES INICIALES Uno de los aspectos ms sorprendentes del origen de la vida sobre la Tierra es el de la rapidez con la que se llev a cabo. Los estudios de datacin basados en los meteoritos indican todos ellos una edad de 4500 millones de aos para el Sistema Solar. Si aceptamos que el Sol, los planetas, los meteoritos y el resto de los componentes del Sistema Solar se formaron al mismo tiempo a partir de una nube de polvo primitiva, 4500 millones de aos ser tambin la edad de nuestro planeta. Algunas rocas sedimentarias con una edad de 3400 a 3200 millones de aos contienen microfsiles similares a bacterias. Por lo tanto, slo 1000 millones de aos despus de que se originase la Tierra ya exista sobre ella una vida primitiva. Debemos de tener tambin en cuenta que las condiciones que existan antes de la aparicin de los seres vivos sobre la Tierra eran muy diferentes de las actuales. Sin entrar en cuestiones tales como la presin o la temperatura, la composicin de la atmsfera primitiva de la Tierra era muy distinta de la actual. Se piensa que estaba formada fundamentalmente por una mezcla de metano (CH4), amonaco (NH3), hidrgeno (H2) y vapor de agua (H2O). Al no haber oxgeno, la atmsfera no era oxidante como la actual sino reductora, y la falta de ozono (O 3) haca posible que los rayos ultravioleta pudiesen atravesar la atmsfera. EL ORIGEN DE LA VIDA. TEORA DE OPARIN-HALDANE La generacin espontnea: teora segn la cual los seres vivos pueden originarse a partir de la materia inanimada, fue una idea corriente y ampliamente aceptada hasta el siglo XIX. Se basaba en la observacin de que si se pona en un recipiente cualquier clase de materia orgnica, al cabo de un cierto tiempo, apareceran en ella los organismos ms diversos. Se crea que estos organismos se formaban espontneamente, sin necesidad de que otros los hubiesen engendrado. El origen de la vida sobre la Tierra no planteaba por lo tanto ningn tipo de dificultad, pues era claro que podra haberse originado tambin de manera espontnea. En 1860 Louis Pasteur realiz cuidadosos experimentos mediante los cuales demostr que todo ser vivo procede de otros seres vivos semejantes a l. Estas experiencias, al destruir la generacin espontnea, plantearon de nuevo el problema de cmo se haban originado en un principio los seres vivos. En 1924 el bioqumico ruso A.I. Oparin y en 1929 el ingls J.B. Haldane, emitieron, independientemente el uno del otro, una teora segn la cual las radiaciones ultravioleta o las descargas elctricas producidas por las tormentas, al atravesar la atmsfera, originaron los componentes bsicos de los seres vivos. La ausencia de oxgeno y de organismos, hizo posible que estas sustancias orgnicas, que se haban formado al azar, se fuesen acumulando en las aguas de mares y lagos. Se form as lo que se llam "el caldo primigenio". Las

J. L. Snchez Guilln

Pgina II-1-1

II) La clula

1) Origen de los seres vivos. Teora celular

molculas se fueron asociando hasta que en algn momento adquirieron la capacidad de autorreplicarse y de formar nuevas molculas orgnicas que les sirviesen de fuente de materiales y energa. La hiptesis de Oparin y Haldane no se trataba de una nueva edicin de las viejas teoras de la generacin espontnea. Para ellos la vida se origin en un momento muy concreto con unas condiciones que ya no existen en la actualidad. Pues la atmsfera con O 2 y los seres vivos hacen imposible que esto pueda darse ahora.

Fig. 1 Alexandr I. Oparin (1894 -1980).

PRIMERAS ETAPAS DEL ORIGEN DE LOS SERES VIVOS


1) El punto de partida, hace 3800 m.a. La atmsfera primitiva estaba formada por: metano (CH4), amonaco (NH3), hidrgeno (H2) y vapor de agua (H2O), era reductora y anaerobia. No obstante en estas sustancias estaban los principales bioelementos que forman la materia viva: carbono (C), nitrgeno (N), hidrgeno (H) y oxgeno (O).

2) Cmo se formaron las biomolculas? Las radiaciones solares y las descargas elctricas proporcionaron la energa suficiente para que los componentes de la atmsfera reaccionasen y se formasen las biomolculas, compuestos orgnicos sencillos como los que ahora forman los principales compuestos de los seres vivos.

3) Cules fueron estas biomolculas? Se formaron as, azcares, grasas simples, aminocidos y otras molculas sencillas que reaccionaron entre s para dar lugar a molculas ms complejas: proteinas, grasas complejas, polisacridos y cidos nuclicos.

4) Cmo se form el "caldo primitivo" Segn Oparn, los compuestos orgnicos que se formaron en la atmsfera fueron arrastrados hacia los mares por las lluvias y all, a lo largo de millones de aos, se concentraron formando una disolucin espesa de agua y molculas orgnicas e inorgnicas que l llam "caldo primitivo".

J. L. Snchez Guilln

Pgina II-1-2

II) La clula

1) Origen de los seres vivos. Teora celular

5) Los precursores de las bacterias En este "caldo primitivo" algunas molculas formaron membranas, originndose unas estructuras esfricas llamadas coacervados. Algunos coacervados pudieron concentrar en su interior enzimas con las que fabricar sus propias molculas y obtener energa. Por ltimo, algunos pudieron adquirir su propio material gentico y la capacidad de replicarse (reproducirse). Se formaron as los primitivos procariotas.

EL EXPERIMENTO MILLER En 1952 H.C. Urey volvi a expresar la tesis de Oparin-Haldane en su libro "Los planetas". Tanto l como S.L. Miller iniciaron en la Universidad de Chicago una serie de experiencias para averiguar si era posible que las fuentes de energa que haba en un principio en la Tierra, hubiesen podido generar compuestos orgnicos a partir de los componentes que se encontraban en la atmsfera del planeta. Para ello montaron un dispositivo consistente en un baln de vidrio de 5 l conectado a otro ms pequeo de 0,5 l. En el primero introdujeron una mezcla formada por H2, NH3, CH4 y H2O. En el matraz mayor situaron unos electrodos y sometieron la mezcla a una serie de descargas elctricas. La mezcla de gases era posteriormente introducida en el matraz pequeo que contena agua hirviendo. Las sustancias que se formaban en el matraz grande se disolvan en el agua del pequeo, y los gases que an no haban reaccionado se volvan al matraz grande por medio de un circuito cerrado. Al cabo de unos das Miller analiz el contenido del agua del recipiente menor y encontr una gran variedad de compuestos orgnicos y entre ellos descubri los 20 aminocidos que forman las protenas (en la tabla siguiente se relacionan los compuestos obtenidos por Miller en su experiencia). Esta experiencia permiti dar una base experimental a la hiptesis de Oparin-Haldane sobre el origen de la vida.

Fig. 2

Stanley Miller (1930-).

Electrodos

Entrada de gases

Gases

Condensador

Toma de muestras

Calor

Fig. 3 Dispositivo del experimento de Stanley Miller.

J. L. Snchez Guilln

Pgina II-1-3

II) La clula

1) Origen de los seres vivos. Teora celular

ETAPAS EN EL ORIGEN Y EVOLUCIN DE LOS SERES VIVOS La evolucin fue un proceso que transcurri de una manera continua. No obstante, vamos a dividirlo para su estudio en una serie de etapas: 1 La evolucin qumica. Los primeros organismos. 2 La evolucin de los organismos procariticos. 3 Origen de las clulas eucariotas 4 Orgenes de la clula vegetal y animal. 5 Origen y evolucin de los organismos pluricelulares. 6 La evolucin en los vegetales. 7 La evolucin en los animales.

PRIMERAS ETAPAS DE LA EVOLUCIN BIOLGICA 1) LA EVOLUCIN QUMICA La evolucin qumica de los primeros organismos a partir de la materia inanimada se dio siguiendo los siguientes pasos: 1 Sntesis y concentracin de los monmeros biolgicos: aminocidos, azcares y bases orgnicas. 2 Polimerizacin de los monmeros y formacin de los primeros polmeros: protenas, polisacridos y cidos nuclicos. 3 Segregacin a partir de la "sopa de Haldane" de pequeas gotitas y formacin de "protobiontes" diferentes qumicamente del medio que les rodeaba y con una identidad propias. 4 Desarrollo de algn tipo de maquinaria reproductora que permitiese a las "clulas hijas" adquirir las caractersticas de las "clulas paternas". 1-1 Sntesis y concentracin de los monmeros biolgicos. 1 La experiencia de Miller nos ha permitido demostrar que es posible la formacin al azar de los monmeros bsicos que constituyen los compuestos de los seres vivos a partir de las sustancias existentes en la Tierra primitiva. La energa necesaria pudo muy bien provenir de las radiaciones o de los rayos producidos por las tormentas. No obstante, las cantidades que se obtienen son muy pequeas y adems enseguida quedaran diluidas en las grandes masas de agua de los mares y lagos. De alguna manera debieron de existir mecanismos que permitieron su concentracin. Se han propuesto algunos muy sencillos como la concentracin por evaporacin o por congelacin del agua de los lagos. Otros son ms complejos; as, por ejemplo, se ha propuesto que las sustancias pudieron concentrarse al ser absorbidas selectivamente por ciertos minerales.
1

Los textos en cursiva son de ampliacin y deben leerse pero no estudiarse.

J. L. Snchez Guilln

Pgina II-1-4

II) La clula

1) Origen de los seres vivos. Teora celular

1-2 Polimerizacin de los monmeros. Es de destacar que las reacciones de polimerizacin se encuentran desplazadas normalmente en el sentido de los monmeros. En los seres vivos, la formacin de polmeros es posible al encontrarse catalizada por enzimas. Pero las enzimas son tambin polmeros. Cmo pudieron formarse entonces los polmeros constituyentes de los seres vivos? Se ha observado que cuando los adenilaminocidos quedan absorbidos por ciertos minerales arcillosos, se polimerizan espontneamente formando cadenas peptdicas de 50 o ms elementos. Tambin se ha observado en mezclas secas de aminocidos una cierta tasa de polimerizacin espontnea a temperaturas entre los 60 oC y los 130oC. En ciertas condiciones los polmeros as formados pueden llegar a tener hasta 200 aminocidos. Muy probablemente se produjo uno de estos mecanismos u otro similar. Los polmeros, una vez formados, pudieron difundirse hacia las disoluciones acuosas e irse concentrando a lo largo de millones de aos por un mecanismo similar a los estudiados en el punto anterior. 1-3 Formacin de los coacervatos Las clulas se caracterizan por mantener un medio interno qumicamente diferente del medio externo. Esto se consigue por la presencia de una membrana limitante entre ambos medios. Esta membrana impide que los componentes de la clula se diluyan y desaparezcan. Oparin estudi durante muchos aos la tendencia a aislarse de las disoluciones acuosas de polmeros para formar coacervatos: pequeas gotitas ricas en polmeros y separadas del medio acuoso por una membrana. Existen varias combinaciones de polmeros que dan lugar a la formacin de coacervatos. Por ejemplo: las de protena-hidratos de carbono, las de protena solas y las de protena-cido nuclico. Las gotitas de coacervatos son no obstante inestables. Tienen tendencia a descender hacia el fondo de la disolucin donde forman una capa no acuosa. Oparin descubri que si dotaba a los coacervatos de molculas que les permitiesen llevar un cierto metabolismo celular, se hacan ms estables. As, al aadir al medio la enzima fosforilasa, sta se concentraba en el interior de las gotitas. Si posteriormente se aada glucosa-1-fosfato, sta se difunda haca el interior y la enzima la polimerizaba formando almidn. El almidn se va aadiendo a la membrana de la gotita con lo que aumenta de tamao. Cuando el coacervato es excesivamente grande se divide espontneamente dando lugar a varias gotitas "hijas". La energa necesaria proviene del enlace rico en energa de la glucosa-1-fosfato. Si se le aaden al medio otras enzimas, los coacervatos se van transformando en estructuras con un metabolismo y una individualidad qumica que realizan intercambios de materiales y energa. Los coacervatos no son seres vivos pero poco les falta para serlo. Podramos pensar que en el origen de la vida pudo pasar un proceso parecido y que poco a poco las "gotitas de vida" que tuviesen un metabolismo ms adecuado "sobreviviran" ms tiempo y pudieron aumentar en tamao y nmero. 1-4 Adquisicin de la maquinaria gentica. Se trata de algo para lo que no disponemos de modelos de laboratorio. Adems, la complejidad del material gentico y su gran diversidad no nos dan muchas pistas acerca de como pudo suceder el proceso. Es posible que los primeros coacervatos estuviesen constituidos por ADN u otros polinucletidos que fuesen capaces de autoduplicarse y de traducirse a protenas. Aunque la secuencia primaria de sta fuese al azar, pudieron formar una membrana protectora que envolviese al ADN. Se pudo establecer as una relacin mutua: el ADN se traduca a protenas y stas protegan al ADN formando una membrana a su alrededor. A partir de aqu ambas sustancias pudieron seguir una evolucin conjunta. Esta hiptesis presenta la dificultad de que la traduccin de las protenas necesita en la actualidad

J. L. Snchez Guilln

Pgina II-1-5

II) La clula

1) Origen de los seres vivos. Teora celular

de una compleja maquinaria qumica: varios tipos de ARN, ribosomas, enzimas, etc. Esto es, se necesitan protenas para sintetizar el ADN y ADN para sintetizar las protenas. Esta moderna versin de la paradoja del "huevo y de la gallina" puede resolverse contestando que la maquinaria gentica debi de evolucionar conjuntamente a partir de mecanismos ms simples que no existen en la actualidad, al haber sido eliminados por competencia con otros ms perfeccionados. En resumidas cuentas, en algn momento se form una asociacin ADN, codificador de una protena, que a su vez catalizaba la formacin de un cido nuclico y ambos evolucionaron conjuntamente. 2 - LA EVOLUCIN DE LOS ORGANISMOS PROCARITICOS Los distintos pasos descritos hasta ahora debieron de dar lugar a los primeros seres vivos. Posiblemente se trat de organismos similares a las bacterias fermentadoras, como las actuales del gnero Clostridium, aunque naturalmente su maquinaria bioqumica sera mucho ms simple. Estos organismos debieron de sobrevivir a base de fermentar los componentes orgnicos que se haban formado a lo largo de millones de aos de evolucin qumica. La disminucin de la cantidad de materia orgnica, como consecuencia de los propios procesos de fermentacin, debi de estimular el desarrollo de los primeros organismos fotosintticos. Parece ser que la fotosntesis basada en el SH2 como fuente de hidrgeno y electrones, como lo hacen en la actualidad las bacterias del azufre, es anterior a la fotosntesis basada en el H2O. Esta hiptesis se fundamenta en el hecho de que la atmsfera primitiva de la Tierra era rica en SH2. Adems, la maquinaria bioqumica que se necesita para la fotosntesis basada en el SH2 es menos compleja que la fotosntesis basada en la fotolisis del H2O. No obstante, la abundancia de H2O trajo este tipo de fotosntesis. Los primeros organismos en dar este gran paso debieron ser similares a las cianobacterias, llamadas tambin algas verde-azuladas. Las cianobacterias actuales, como las del gnero nostoc, son organismos procariotas que forman colonias multicelulares de aspecto filamentoso. Durante 2000*106 aos siguientes (hasta hace 1500*10 6 aos) estos organismos revolucionaron la composicin qumica de la atmsfera. La produccin de oxgeno transform la atmsfera reductora en una atmsfera oxidante y se form adems una capa de ozono (O3) que filtr considerablemente los rayos ultravioleta. El oxgeno comenz a concentrarse en la atmsfera en un porcentaje superior al 1% hace unos 2000*106. Esto se sabe porque los granos del mineral de uranio llamado uraninita se oxidan rpidamente si la concentracin de oxgeno es superior al 1%. El xido de uranio as formado se disuelve en el agua y es arrastrado hacia los mares donde se mantiene en disolucin. Efectivamente, slo encontramos depsitos de uraninita en sedimentos que tiene una antigedad superior a los 2000*10 6 aos y no se encuentran cuando los estratos son ms jvenes. Un resultado similar lo proporcionan los estudios basados en la formacin de los depsitos de xido de hierro. 3 - EL ORIGEN DE LOS EUCARIOTAS Es difcil distinguir entre los microfsiles de hace miles de millones de aos si son procariotas o eucariotas. Sabemos que ambos tipos de clulas se diferencian en su aspecto, tamao, morfologa, bioqumica, etc.

J. L. Snchez Guilln

Pgina II-1-6

II) La clula

1) Origen de los seres vivos. Teora celular

Los eucariotas, tal y como los conocemos ahora, no pudieron aparecer antes de hace 1500*106 aos (3500*106 aos despus del origen de la Tierra). Con los eucariotas apareci la reproduccin sexual. No olvidemos que las principales caractersticas de los eucariotas son la presencia de un ncleo separado del citoplasma y la estructuracin del ADN en cromosomas. Todo esto se desarroll posiblemente para poder intercambiar ms fcilmente el material gentico. Es cierto que los procariotas actuales pueden tambin intercambiarlo, pero en ellos priman sobre todo los mecanismos de reproduccin asexual sobre los de reproduccin sexual. La reproduccin sexual fue lo que permiti la diversificacin de los seres vivos, la aparicin de los organismos megascpicos y que estos alcanzasen la gran complejidad que tiene en la actualidad. Segn la Teora de la Simbiognesis (Lynn Margulis. Chicago 1938) las clulas eucariotas seran el resultado de la simbiosis de diferentes organismos procariotas. Esto se basa en el hecho de que muchos orgnulos y estructuras celulares (mitocondrias y plastos,) poseen su propio ADN, e incluso sus propios ribosomas, ambos de tipo bacteriano.

J. L. Snchez Guilln

Pgina II-1-7

II) La clula

1) Origen de los seres vivos. Teora celular

1b- LA TEORA CELULAR

1) ORGANIZACIN CELULAR DE LOS SERES VIVOS


TEORA CELULAR En 1665, Robert Hooke, al observar al microscopio, muy rudimentario en aquella poca, un fragmento de corcho, descubre que est compuesto por una serie de estructuras parecidas a las celdas de los panales de las abejas, por lo que las llam clulas. El posterior desarrollo de la microscopa permiti que en 1838 Scheleiden y en 1839 Schwan, uno para los vegetales y el otro para los animales, planteasen la denominada TEORA CELULAR, que, resumidamente, indica: 11- Todos los organismos son clulas o estn constituidos por clulas. 21- Las unidades reproductoras,los gametos y esporas, son tambin clulas. 31- Las clulas no se crean de nuevo, toda clula proviene siempre de otra clula. 41- Existen seres unicelulares y seres pluricelulares. En pocas palabras, segn la TEORA CELULAR, la clula es la unidad estructural, fisiolgica y reproductora de los seres vivos; pues todo ser vivo est constituido por clulas:UNIDAD ANATMICA, su actividad es consecuencia de la actividad de sus clulas:UNIDAD FISIOLGICA y se reproduce a travs de ellas: UNIDAD REPRODUCTORA. La TEORA CELULAR ha sido de gran importancia y supuso un gran avance en el campo de las Biologa pues sent las bases para el estudio estructurado y lgico de los seres vivos.
Fig. 5 Clulas de la corteza de Quercus suber (alcornoque) vistas al microscopio x300.

Fig. 4 Robert Hooke.

J. L. Snchez Guilln

Pgina II-1-8

II) La clula

1) Origen de los seres vivos. Teora celular

UNICELULARES Y PLURICELULARES Como consecuencia del cuarto punto de la teora celular, vamos a dividir los seres vivos en dos grandes grupos: -Unicelulares: con una sola clula. -Pluricelulares: con muchas clulas. No todos los seres vivos estn constituidos por clulas. Un claro ejemplo son los virus, a estos organismos que no son clulas se les conoce como acelulares. EUCARIOTAS Y PROCARIOTAS Por su estructura se distinguen dos tipos de clulas: procariticas y eucariticas: -PROCARITICAS. Muy simples y primitivas. Apenas tienen estructuras en su interior. Se caracterizan por no tener un ncleo propiamente dicho; esto es, no tienen el material gentico envuelto en una membrana y separado del resto del citoplasma. Adems, su ADN no est asociado a ciertas protenas como las histonas y est formando un nico cromosoma. Son procariotas, entre otras: las bacterias y las cianofceas. -EUCARITICAS: Clulas caractersticas del resto de los organismos unicelulares y pluricelulares, animales y vegetales. Su estructura es ms evolucionada y compleja que la de los procariotas. Tienen orgnulos celulares y un ncleo verdadero separado del citoplasma por una envoltura nuclear. Su ADN est asociado a protenas (histonas y otras) y estructurado en numerosos cromosomas. ESTRUCTURA GENERAL DE LA CLULA EUCARITICA En toda clula eucaritica vamos a poder distinguir la siguiente estructura: - Membrana plasmtica - Citoplasma - Ncleo
Fig. 6 Con este primitivo microscopio Antony van Leeuwenhoek (1632-1723) realiz las primeras observaciones microscpicas.

1m

1m

Fig. 7 A) Clula procariota. B) Clula eucariota. La primera est representada a un aumento mucho mayor que la segunda (ver escala).

El aspecto de la clula es diferente segn se observe al microscopio ptico (MO) o al electrnico (MET). Al MO observaremos la estructura celular y al MET la ultraestructura.

Fig. 8 Dibujo esquemtico de una clula eucariota vista al MET (P.A.U. junio de 1999).

J. L. Snchez Guilln

Pgina II-1-9

II) La clula

1) Origen de los seres vivos. Teora celular

DIFERENCIAS ENTRE LAS CLULAS VEGETALES Y ANIMALES Por lo general las clulas vegetales son de mayor tamao que las animales, tienen plastos y estn envueltas en una gruesa pared celular, tambin llamada pared celulsica o membrana de secrecin. Sus vacuolas son de gran tamao y no tienen centriolos.

ULTRAESTRUCTURA DE LA CLULA
CLULA VEGETAL 1 Membrana plasmtica 2 Retculo endoplasmtico granular 3 Retculo endoplasmtico liso 4 Aparato de Golgi 5 Mitocondria 6 Ncleo 7 Ribosomas 8 Cloroplasto 9 Pared celulsica 10 Vacuola
Fig. 9 Dibujo esquemtico de la ultraestructura de una clula eucariota vegetal.

CLULA ANIMAL 1 Membrana plasmtica 2 Retculo endoplasmtico granular 3 Retculo endoplasmtico liso 4 Aparato de Golgi 5 Mitocondria 6 Ncleo 7 Ribosomas 8 Centrosoma (Centriolos) 9 Lisosomas 10 Microtbulos (citoesqueleto)

Fig. 10 Dibujo esquemtico de la ultraestructura de una clula eucariota animal.

J. L. Snchez Guilln

Pgina II-1-10

II) La clula

1) Origen de los seres vivos. Teora celular

BREVE DESCRIPCIN DE LA ESTRUCTURA Y FUNCIN DE LOS ORGNULOS CELULARES


MEMBRANA Membrana plasmtica: Delgada lmina que recubre la clula. Est formada por lpidos, protenas y oligosacridos. Regula los intercambios entre la clula y el exterior. Pared celular: Gruesa capa que recubre las clulas vegetales. Est formada por celulosa y otras sustancias. Su funcin es la de proteger la clula vegetal de las alteraciones de la presin osmtica.

CITOPLASMA Hialoplasma: Es el citoplasma desprovisto de los orgnulos. Se trata de un medio de reaccin en el que se realizan importantes reacciones celulares, por ejemplo: la sntesis de protenas y la glicolisis. Contiene los microtbulos y microfilamentos que forman el esqueleto celular. Retculo endoplasmtico: Red de membranas intracitoplasmtica que separan compartimentos en el citoplasma. Hay dos clases: granular y liso. Sus funciones son: sntesis de oligosacridos y maduracin y transporte de glicoprotenas y protenas de membrana. Ribosomas: Pequeos grnulos presentes en el citoplasma, tambin adheridos al retculo endoplasmtico granular. Intervienen en los procesos de sntesis de protenas en el hialoplasma. Aparato de Golgi: Sistema de membranas similar, en cierto modo, al retculo pero sin ribosomas. Sirve para sintetizar, transportar y empaquetar determinadas sustancias elaboradas por la clula y destinadas a ser almacenadas o a la exportacin. Lisosomas: Vesculas que contienen enzimas digestivas. Intervienen en los procesos de degradacin de sustancias. Vacuolas: Estructuras en forma de grandes vesculas. Almacenamiento de sustancias. Mitocondrias: En ellas se extrae la energa qumica contenida en las sustancias orgnicas (ciclo de Krebs y cadena respiratoria). Centrosoma: Interviene en los procesos de divisin celular y en el movimiento celular por cilios y flagelos. Plastos: Orgnulos caractersticos de las clulas vegetales. En los cloroplastos se realiza la fotosntesis.

NCLEO Contiene la informacin celular. Nucleoplasma: En l se realizan las funciones de replicacin y transcripcin de la informacin celular. Esto es, la sntesis de ADN y ARN. Nucleolo: Sntesis del ARN de los ribosomas. Envoltura nuclear: Por sus poros se realizan los intercambios de sustancias entre el ncleo y el hialoplasma.

J. L. Snchez Guilln

Pgina II-1-11

II) La clula

2) Membranas

II-2A) LAS MEMBRANAS BIOLGICAS.


LA MEMBRANA UNITARIA

Muchas estructuras de la clula estn formadas por membranas. Las membranas biolgicas constituyen fronteras que permiten no slo separar sino tambin poner en comunicacin diferentes compartimentos en el interior de la clula y a la propia clula con el exterior. La estructura de todas las membranas biolgicas es muy parecida. Las diferencias se establecen ms bien al nivel de la funcin particular que tienen los distintos orgnulos formados por membranas; funcin que va a depender de la composicin que tengan sus membranas. Este tipo de membranas se denomina, debido a esto, unidad de membrana o membrana unitaria. La membrana plasmtica de la clula y la de los orgnulos celulares est formada por membranas unitarias.
ORGNULOS Y OTRAS ESTRUCTURAS FORMADOS POR MEMBRANAS UNITARIAS

Fig. 1 Membrana celular vista a gran aumento al microscopio electrnico. Se destacan dos capas oscuras y una intermedia clara.

Membrana plasmtica Retculo endoplasmtico granular y liso Aparato de Golgi Lisosomas Peroxisomas Mitocondrias Plastos Vacuolas Envoltura nuclear
Fig. 2 Sistemas de membranas celulares.

CARCTER ANFIPTICO DE LOS LPIDOS.

Ciertos lpidos, y en particular los fosfolpi dos, tienen una parte de la molcula que es polar: hidrfila y otra (la correspondiente a las cadenas hidrocarbonadas de los cidos grasos) que es no polar: hidrfoba. Las molculas que presentan estas caractersticas reciben el nombre de anfipticas. A partir de ahora representaremos la parte polar (hidrfila) y la no polar (hidrfoba) de los lpidos anfipticos como se indica en la figura 3.

Parte hidrfila Fosfolpido Parte hidrfoba

Fosfolpidos

agua

Fig. 3 Monocapa de lpidos anfipticos (fosfolpidos, por ejemplo) en agua.

J. L. Snchez Guilln

Pgina II-2-1

II) La clula

2) Membranas

FORMACIN DE BICAPAS LIPDICAS

Si se dispersa por una superficie acuosa una pequea cantidad de un lpido anfiptico, se puede formar una capa de una molcula de espesor: monocapa. Esto es debido a que las partes hidrfilas se disponen hacia el interior y los grupos hidrfobos hacia el exterior de la superficie acuosa. Pueden tambin formarse bicapas, en particular entre dos compartimentos acuosos. Entonces, las partes hidrfobas se disponen enfrentadas y las partes hidrfilas se colocan hacia la solucin acuosa. Los lpidos anfipticos forman este tipo de estructuras espontneamente. Las bicapas pueden formar compartimentos cerrados denominados liposomas. Las bicapas lipdicas poseen caractersticas similares a las de las membranas celulares: son permeables al agua pero impermeables a los cationes y aniones y a las grandes molculas polares. En realidad, las membranas celulares son, esencialmente, bicapas lipdi cas.
ESTRUCTURA EN MOSAICO DE LAS MEMBRANAS BIOLGICAS

agua

bicapa lipdica

agua

Fig. 4 Bicapa lipdica.

Fig. 5 Estructura de una membrana biolgica. 1) Protena integral; 2) protenas perifricas; 3) Doble capa lipdica.

Las membranas biolgicas estn constituidas por una doble capa de fosfolpidos con prote nas. Las protenas se pueden encontrar adosadas a la membrana pero sin penetrar en la doble capa lipdica: protenas perifricas, o empotradas: prote nas integrales. Las protenas forman as una especie de mosaico (estructura en mosaico). Las partes hidrfilas de las prote nas integrales quedan hacia el interior o hacia el exterior de la capa lipdica y las partes lipfilas (hidrfobas) se sitan en su seno. Las prote nas integrales atraviesan completamente la membrana.

CARACTERSTICAS DE LAS MEMBRANAS BIOLGICAS

Las molculas que constituyen las membranas se encuentran libres entre s pudiendo desplazarse en el seno de ella, girar o incluso rotar, aunque esto ltimo ms raramente. La membrana mantiene su estructura por uniones muy dbiles: Fuerzas de Van der Waals e interacciones hidrofbicas. Esto le da a la membrana su caracters tica fluidez. Todos estos movimientos se realizan sin consumo de energa. Los lpidos pueden presentar una mayor o menor movilidad en funcin de factores internos: cantidad de colesterol o de cidos grasos insaturados, o externos: temperatura, composicin de molculas en el exterior, etc. As, una mayor cantidad de cidos grasos insaturados

3 1

Fig. 6 Membrana plasmtica. 1) Doble capa lipdica; 2) protena integral transmembranar; 3) protena perifrica; 4) oligosacridos del glicoclix

J. L. Snchez Guilln

Pgina II-2-2

II) La clula

2) Membranas

o de cadena corta hace que la membrana sea ms fluida y sus componentes tengan una mayor movilidad; una mayor temperatura hace tambin que la membrana sea ms fluida. Por el contrario, el colesterol endurece la membrana y le da una mayor estabilidad y por lo tanto una menor fluidez. Otra caracterstica de las membranas biolgicas es su asimetra , debida a la presencia de protenas distintas en ambas caras. Por lo tanto, las dos caras de la membrana realizarn funciones diferentes. Estas diferencias son de gran importancia a la hora de interpretar correctamente las funciones de las estructuras constituidas por membrana.

J. L. Snchez Guilln

Pgina II-2-3

II) La clula

2) Membranas

II-2B) FLUJO DE SUSTANCIAS ENTRE LA CLULA Y EL EXTERIOR


LA MEMBRANA PLASMTICA. CONCEPTO

Es una fina membrana que limita y relaciona el interior de la clula, el protoplasma, con el exterior. Como toda membrana biolgica est constituida sobre todo por lpidos y prote nas. En la membrana plasmtica encontramos muchas protenas diferentes, hasta 50 clases diferentes. Tambin hay oligosacridos asociados a las protenas y a los lpi dos.

ESTRUCTURA EN MOSAICO FLUIDO DE LA MEMBRANA PLASMTICA

La membrana plasmtica es extraordinariamente delgada, teniendo un espesor medio de aproximadamente 10 nm (100 ), por lo que slo se ve con el microscopio electrnico.
1

4 2 3

La estructura de la membrana plasmtica es 6 la misma que la de cualquier membrana biolgica. Est formada por una doble capa lipdica con protenas integrales y perifricas Fig. 7 Esquema tridimensional de la que se encuentran dispuestas formando una membrana plasmtica. 1) Doble capa estructu ra en mosaico fluido. En su cara lipdica. 2) Oligosacricos del glicoclix; 3) externa presenta una estructura fibrosa, que protena integral; 4) glicoprotena; 5) no se encuentra en las membranas de los microtbulo; 6) microfilamento. orgnulos celulares: el glicoclix, constituido por oligosacridos. Los oligosacridos del glicoclix estn unidos tanto a los lpidos, glicolpidos, como a las protenas, glicoprotenas. En la cara interna las protenas estn asociadas a microtbulos, a microfilamentos y a otras protenas con funcin esqueltica.

MECANISMOS DE FUSIN DE MEMBRANAS

La fluidez de los componentes de la membrana plasmtica permite su crecimiento por fusin con membranas provenientes de otros orgnulos celulares, como las llamadas vesculas de exocitosis. stas van a poder fusionarse con la membrana. De esta manera las sustancias que puedan contener las vesculas pasan al exterior y al mismo tiempo los componentes de la membrana de la vescu la se integran en la membrana plasmtica hacindola crecer.

Fig. 8

Fusin de membranas.

J. L. Snchez Guilln

Pgina II-2-4

II) La clula

2) Membranas

DIFERENCIACIONES DE LA MEMBRANA PLASMTICA La membrana plasmtica puede tener las siguientes diferenciaciones morfolgicas: MICROVELLOSIDADES. Las clulas que por su funcin requieren una gran superficie, por ejemplo, las que realizan la absorcin de los nutrientes en el tubo digestivo, tienen una membrana con una gran cantidad de repliegues que reciben el nombre de microvellosidades. DESMOSOMAS. Se dan en clulas que necesitan estar fuertemente soldadas con sus vecinas; por ejemplo: las clulas de la Fig. 9 1) Microvellosidades; 2) epidermis de las mucosas. En ellas, el Desmosomas. espacio intercelular se ampla en la zona de los desmosomas y por la parte interna de ambas membranas se dispone una sustancia densa asociada a finos filamentos (tonofilamentos), lo que da a estas uniones una gran solidez. UNIONES IMPERMEABLES. Se dan entre clulas que forman barreras que impiden el paso de sustancias, incluso del agua. En ellas, el espacio intercelular desaparece y las membranas de ambas clulas se sueldan. FUNCIONES DE LA MEMBRANA PLASMTICA INTERCAMBIOS. La membrana es, bsicamente, una barrera selectiva (permeabilidad selectiva). Limita a la clula e impide el paso de sustancias, no de todas, pero s de muchas, tanto del exterior al interior como en sentido inverso. No obstante, y a pesar de esta funcin limitante, la clula va a necesitar intercambios constantes con el medio que la rodea. Necesita sustancias nutritivas y tiene que eliminar productos de desecho, que sern transportados a travs de la membrana y por la propia membrana. La membrana es un elemento activo que "escoge" lo que entrar o saldr de la clula. RECEPTORA. Algunas protenas de la membrana plasmtica van a tener esta funcin, por ejemplo: receptoras de sustancias hormonales. Muchas hormonas regulan la actividad de la clula fijndose en determinados puntos de protenas receptoras espec ficas. La protena receptora va a liberar en el interior de la clula una mol cula orgnica: el mediador hormonal. Esta sustancia va a actuar regulando ciertos aspectos del metabolismo celular, por ejemplo, activando determinadas enzimas o desencadenando la activacin de determinados genes. Al existir diferentes prote nas receptoras en la membrana celular y al tener las clulas diferentes receptores, la actividad de cada clula ser diferente segn sean las hormonas presentes en el medio celular. RECONOCIMIENTO. Se debe a las glicoprotenas de la cara externa de la membrana. As, las clulas del sistema inmunolgico, clulas que nos defienden de los agentes patgenos, van a reconocer las clulas que son del propio organismo diferencindolas de las extraas a l por las glicoprotenas de la membrana. Estas sustancias constitu yen un verdadero cdigo de identidad.

J. L. Snchez Guilln

Pgina II-2-5

II) La clula

2) Membranas

DIFUSIN Es el fenmeno por el cual las part culas de un soluto se distribuyen uniformemente en un disolvente de tal forma que en cualquier punto de la disolucin se alcanza la misma concentracin. As, si ponemos un grano de azcar en un recipiente que contenga 1 litro de agua destilada y esperamos el tiempo suficiente, el azcar se disolver y en cualquier parte de la Fig. 10 Difusin de un soluto (glucosa) en disolucin un volumen dado de sta el seno de un disolvente (agua). contendr la misma cantidad de molculas que cualquier otro. Esto es debido a que las molculas del soluto se comportan, en cierto modo, como las de un gas encerrado en un recipiente desplazndose en todas las direcciones. CLASES DE MEMBRANAS En los medios orgnicos la difusin est dificultada por la existencia de membranas. Las clulas estn separadas del medio intercelular y de las otras clulas por la membrana plasmtica y determinados orgnulos celulares estn tambin separados del hialoplasma por membranas biolgicas. En general, las membranas pueden ser: Fig. 11 Clases de membranas. permeables, impermeables y semipermeables. Las membranas permeables permiten el paso del soluto y del disolvente, las impermeables impiden el paso de ambos y las semipermeables permiten pasar el disolvente pero impiden el paso de determinados solutos. Esto ltimo puede ser debido a diferentes causas. As, por ejemplo, muchas membranas tienen pequeos poros que permiten el paso de las pequeas molculas y no de las que son mayores; otras, debido a su composicin, permiten el paso de las sustancias hidrfilas y no de las lipfilas, o a la inversa. LA PERMEABILIDAD SELECTIVA Las membranas biolgicas se comportan en cierto modo como membranas semipermeables y van a permitir el paso de pequeas molculas, tanto las no polares como las polares. Las primeras se disuelven en la membrana y la atraviesan fcilmente. Las segundas, si son menores de 100 u tambin pueden atravesarla. Por el contrario, las molculas voluminosas o las fuertemente cargadas, iones, quedarn retenidas. La membrana plasmtica es permeable al agua y a las sustancias lipdicas. No obstante, como veremos ms adelante, determinados mecanismos van a permitir que atraviesen la membrana algunas molculas que por su composicin o tamao no podran hacerlo. Esto es, las membranas biolgicas tienen permeabilidad selectiva. De este modo la clula asegura un medio interno diferente del exterior.

J. L. Snchez Guilln

Pgina II-2-6

II) La clula

2) Membranas

SMOSIS

Si a ambos lados de una membrana semipermeable se ponen dos disoluciones de concentracin diferente el agua pasa desde la ms diluida a la ms concentrada. Este proceso se denomina smosis y la presin necesaria para contrarrestar el paso del agua se llama presin osmtica. La smosis se debe a que la membrana semipermeable impide el paso del soluto del medio ms concentrado al menos concentrado, pero si puede pasar el disolvente, el agua, en la mayora de los casos, en sentido inverso. Si se trata de un compartimento cerrado, este aumento de la cantidad de disolvente a un lado de la membrana semipermeable es el responsable de la presin osmtica. Al medio que tiene una mayor concentracin en partcu las que no pueden atravesar la membrana (soluto), se le denomina hipertnico, mientras que al menos concentrado en solutos se le llama hipotnico. Si dos disoluciones ejercen la misma presin osmtica, por tener la misma concentracin de partculas que no se pueden difundir a ambos lados de la membrana semipermeable, diremos que son isotnicas. Es de destacar que podemos tener dos disoluciones diferentes a ambos lados de una membrana semipermeable y, sin embargo, ambas ser isotnicas entre s. As, por ejemplo, si a un lado de una membrana semipermeable tenemos una disolucin 0,1 molal de glucosa y al otro lado una disolucin 0,1 molal de fructo sa, ambas disoluciones son diferentes, pero como tienen el mismo nmero de partcu las de soluto por unidad de volumen, ambas ejercern la misma presin osmtica.

Fig. 12 smosis a travs de una membrana semipermeable. La sustancia representada por los crculos mayores no puede pasar a travs de los poros de la membrana.

Fig. 13 a) Turgescencia y b) plasmolisis de una clula vegetal normal (c).

LAS CLULAS Y LA PRESIN OSMTICA

El interior de la clula es una compleja disolucin que, normalmente, difiere del medio extracelular. La membrana de la clula, membrana plasmtica, se comporta como una membrana semipermeable.

Fig. 14 a) Plasmolisis y c) turgescencia de un glbulo rojo normal (b).

Cuando una clula se encuentra en un medio hipertnico, el hialoplasma y el interior de los orgnulos formados por membranas, por ejemplo: las vacuolas de las clulas

J. L. Snchez Guilln

Pgina II-2-7

II) La clula

2) Membranas

vegetales, pierden agua, producindose la plasmolisis del contenido celular. Por el contrario, si la clula se introduce en una disolucin hipotnica se producir una penetracin del disolvente y la clula se hinchar: turgencia o turgescencia. En las clulas vegetales la turgencia no suele presentar un grave problema pues estn protegidas por una gruesa pared celular. En las clulas animales la turgencia puede acarrear la rotura de la membrana plasmtica. As, los glbulos rojos introducidos en agua destilada primero se hinchan y despus explotan (hemolisis) liberando el contenido celular1 .

TRANSPORTE DE SUSTANCIAS A TRAVS DE LA MEMBRANA PLASMTICA

La clula necesita sustancias para su metabolismo. Como consecuencia de ste se van a producir sustancias de desecho que la clula precisa eliminar. As pues, a travs de la membrana plasmtica se va a dar un continuo transporte de sustancias en ambos sentidos. Segn la direccin de este y el tipo de sustancia tendremos: - Ingestin:Es la entrada en la clula de aquellas sustancias necesarias para su metabolismo. - Excrecin: Salida de los productos de desecho. - Secrecin: Si lo que sale no son productos de desecho sino sustancias destinadas a la exportacin. Aunque vamos a referirnos nicamente al transporte a travs de la membrana plasmtica, deber tenerse en cuenta que los fenmenos de transporte que estudiaremos a continuacin se dan tambin a travs de las membranas biolgicas de los orgnulos formados por membranas: retculo, aparato de Golgi, lisosomas, vacuolas, mitocondrias y plastos. Mediante estos fenmenos la clula asegura un medio interno diferente y funciones distintas en cada uno de los orgnulos formados por membranas.

Curiosidades: La presin osmtica de nuestras clulas est entre 7 y 8 atm, que se corresponde con la que ejercera una disolucin conteniendo 9,596 g/l de NaCl. En nuestro organismo existe un rgano especializado en regular la presin osmtica, se trata del rin. Su misin, entre otras, es la de extraer agua y sales del plasma sanguneo para mantener estable la concentracin de solutos y por lo tanto la presin osmtica. La presin osmtica interviene en muchos otros procesos biolgicos; por ejemplo en los que determinan la absorcin y transporte de la savia en los vegetales o en el movimiento en ciertos animales. Ciertos organismos unicelulares de las aguas dulces, por ejemplo, el paramecio, al vivir en agua dulce, su citoplasma es hipertnico con respecto al exterior, por lo que se produce una entrada continua de agua. No obstante disponen de ciertos orgnulos, las vacuolas pulstiles, que extraen el agua del citoplasma y la expulsan al exterior.

J. L. Snchez Guilln

Pgina II-2-8

II) La clula

2) Membranas

A) EL TRANSPORTE DE SUSTANCIAS EN FORMA MOLECULAR A TRAVS DE LAS MEMBRANAS

Ext. 1 2 3

En el caso de sustancias disueltas, segn se consuma o no energa, distinguiremos los siguientes tipos de transporte: I) Transporte pasivo. Se trata de un transporte a favor del gradiente de concentracin, por lo que no requiere un aporte de energa. Puede ser: a) Transporte pasivo simple o difusin de molculas a favor del gradiente. a) Difusin a travs de la bicapa lipdica. Pasan as sustancias lipdicas como las hormonas esteroideas, los frmacos liposolubles y los anestsicos, como el ter. Tambin sustancias apolares como el oxgeno y el nitrgeno atmosfrico y algunas molculas polares muy pequeas como el agua, el CO2 , el etanol y la glicerina. b) Difusin a travs de canales proticos. Se realiza a travs de protenas canal. Protenas que forman canales acuosos en la doble capa lipdica. Pasan as ciertos iones, como el Na+ , el K+ y el Ca+ + . b) Transporte pasivo facilitado (difusin facilitada). Las mol culas hidrfilas (glcidos, aminocidos...) no pueden atravesar la doble capa lipdica por difusin a favor del gradiente de concentracin. Determinadas protenas de la membrana, llamadas permeasas, actan como "barcas" para que estas sustancias puedan salvar el obstculo que supone la doble capa lipdi ca. Este tipo de transporte tampoco requiere un consumo de energa, pues se realiza a favor del gradiente de concentracin. II) Transporte activo: Cuando el transporte se realiza en contra de un gradiente qumi co (de concentracin) o elctrico (ver nota 1). Para este tipo de transporte se precisan transportadores especfi cos instalados en la

Int.

ATP

ADP

Fig. 15 1 y 2) Transporte pasivo. 3) Transporte activo.

2 2 2 2 2 2 2 2 2 2 2

Ext.

2 2

Int.

Fig. 16 Transporte pasivo simple de iones a travs de una protena canal. 1) glucosa; 2) in sodio.
Medio ms concentrado

glucosa

naveta
Medio menos concentrado

Fig. 17 Transporte pasivo facilitado de molculas de glucosa a travs de permeasas.


Medio menos concentrado

Medio ms concentrado

Fig. 18 Transporte activo. La molcula pasa del medio menos concentrado al ms concentrado con gasto de energa(E).

J. L. Snchez Guilln

Pgina II-2-9

II) La clula

2) Membranas

membrana, siempre prote nas, que, mediante un gasto de energa en forma de ATP, transportan sustancias a travs de sta. Con este tipo de transporte pueden transportarse, adems de pequeas part culas, molculas orgnicas de mayor tamao, siempre en contra del gradiente de concentracin o elctrico.
Nota 1 : Puede darse el caso de que el interior y el exterior de la clula sean isotnicos pero que exista una diferencia en el potencial elctrico que impida el paso de los iones. As, por ejemplo, entre el interior y el exterior de la neurona hay una diferencia de potencial de -70 mV, estando el interior cargado negativamente respecto al exterior. En este caso, los iones positivos tendrn dificultades para salir de la clula, incluso si esta salida se realiza a favor de la presin osmtica.

receptor

sustancia membrana

clatrinas

Vescula de endocitosis

Fig. 19 La endocitosis mediada por receptor implica la presencia en la membrana de receptores especficos de la sustancia que va a ser ingerida.

B) TRANSPORTE CITOQU MICO Permite la entrada o la salida de la clula de partculas o grandes molculas envueltas en una membrana. Se trata de un mecanismo que slo es utilizado por algunos tipos de clulas, por ejemplo: amebas, macrfagos o las clulas del epitelio intestinal.

Fig. 20

Ameba.

I) ENDOCITOSIS. Las sustancias entran en la clula envueltas en vesculas formadas a partir de la membrana plasmtica. Cuando lo que entra en la clula son part culas slidas o pequeas gotitas lquidas el transporte se realiza por mecanismos especiales e incluso se hace perceptible. Estos mecanismos implican una deformacin de la membrana y la formacin de vacuolas. Este tipo de transporte puede ser de gran importancia en ciertas clulas, como por ejemplo, en los macrfagos y en las amebas. Distinguiremos dos tipos de endocitosis: la fagocitosis y la pinocitosis a) Fagocitosis: Es la ingestin de grandes part culas slidas (bacterias, restos celulares) por medio de seudpodos. Los seudpodos son grandes evaginaciones de la membrana plasmtica que envuelven a la part cula. sta pasa al citoplasma de la clula

Fig. 21 A, B y C) Ameba fagocitando bacterias. 1) Seudpodo. 2) Bacteria. 3) Vacuola digestiva. 4) Ncleo.

Fig. 22

Pinocitosis.

J. L. Snchez Guilln

Pgina II-2-10

II) La clula

2) Membranas

en forma de vacuola fagoctica. Este tipo de ingestin la encontramos, por ejemplo, en las amebas o en los macrfagos. b) Pinocitosis. Es la ingestin de sustancias disueltas en forma de pequeas gotitas lqui das que atraviesan la membrana al invaginarse sta. Se forman as pequeas vacuolas llamadas vacuolas pinocticas que pueden reunirse formando vacuolas de mayor tamao. II) EXOCITOSIS: Consiste en la secrecin o excrecin de sustancias por medio de vacuolas, vesculas de exocitosis, que se fusionan con la membrana plasmtica abrindose al exterior y expulsando su contenido. Las vacuolas provienen de los sistemas de membranas o de la endocitosis. La membrana de la vacuola queda incluida en la membrana celular, lo que es normal teniendo en cuenta que ambas membranas poseen la misma estructura. En todos los mecanismos de endocitosis hay una disminucin de la membrana plasmtica al introducirse sta en el citoplasma. Esta disminucin es compensada por la formacin de membranas por exocitosis. La membrana plasmtica est en estas clulas en un continuo proceso de renovacin. En un macrfago, por ejemplo, toda su membrana es ingerida en 30 min.

Fig. 23 Exocitosis: Secrecin de moco en una clula mucosa de la pared intestinal.

J. L. Snchez Guilln

Pgina II-2-11

II) La clula

3) Hialoplasma

3) EL MEDIO INTERNO CELULAR


EL HIALOPLASMA Si retiramos los orgnulos del citoplasma obtendremos una disolucin constituida por agua, sales minerales y mol culas orgnicas, protenas, fundamentalmente. Esta disolucin es el hialoplasma. Entre las protenas, unas son enzimticas y otras estructurales. Estas ltimas forman el citoesqueleto. En el hialoplasma se van a realizar gran cantidad de procesos qumicos: la sntesis de prote nas, la glucolisis y las primeras fases de la degradacin de las grasas y de algunos aminocidos. El hialoplasma es un medio de reaccin.
Estado de sol Estado de gel

Fig. 1 Ameba. Los cambios sol-gel en el hialoplasma estn relacionados con el movimiento ameboide.

El hialoplasma, al tener grandes mol culas, va a sufrir transformaciones en el estado sol-gel. Estas transformaciones darn lugar al movimiento ameboide y a los fenmenos de ciclosis.

Fig. 2

Estados de sol y gel.

EL CITOESQUELETO Es un verdadero armazn interno celular. Est constituido por unos finos tubos: los microtbulos. El citoesqueleto es el responsable de la forma de la clula y del movimiento celular. Los microtbulos son pequeos cilindros huecos. Estn unidos a la membrana celular a los orgnulos y a la envoltura nuclear, formando una compleja red bajo la membrana plasmtica y alrededor del ncleo celular. Los microtbulos se forman a partir de unas protenas globulares denominadas tubulinas. En el hialoplasma vamos a encontrar tambin otros tipos de estructuras filamentosas.
Fig. 4 Microfotografa en la que se observan dos microtbulos.

Fig. 3 1) Membrana plasmtica. 2) Microtbulo. 3) Mitocondria. 4) Microtrabcula. 5) Retculo endoplasmtico granular. 6) Ribosomas.

J. L. Snchez Guilln

Pgina II-3-1

II) La clula

3) Hialoplasma

FUNCIONES DEL CITOESQUELETO Los microtbulos juegan un papel de gran importancia en el movimiento celular. La capacidad de estas estructuras para formarse y destruirse (polimerizarse y despolimerizarse) con gran rapidez es la responsable de fenmenos tales como la variacin de la forma celular o los movimientos celulares tanto intra como extracitoplasmticos. A) Movimientos intracelulares de los orgnulos. Los microtbulos pueden constituir un soporte sobre el que los orgnulos (mitocondrias, plastos, vescu las, cromosomas, etc.) van a poder desplazarse por el interior del citoplasma. B) Movimientos extracelulares. Cilios y flagelos son prolongaciones citoplasmticas que aseguran los movimientos de la clula o de los fluidos alrededor de sta. Estas estructuras reciben el nombre de orgnulos vibrtiles de la clula. Ambos tienen la misma estructura, pero los cilios son cortos y numerosos, mientras los flagelos son largos y poco numerosos. Los vamos a encontrar en organismos unicelulares y pluricelulares, tanto animales como vegetales. As, el interior de nuestros rganos respiratorios se encuentra recubierto por clulas con cilios que forman el epitelio vibrtil o ciliado, y lo mismo ocurre en las trompas de Falopio del aparato genital femenino. Tienen flagelos muchos organismos unicelulares, la mayora de los gametos masculinos de los animales y muchos de los vegetales (algas, musgos, helechos). Si hacemos un corte transversal a un flagelo o a un cilio y lo observamos a gran aumento al MET, veremos que presenta 9 pares de microtbulos. En el interior se encuentran dos microtbulos centrales y todo ello est rodeado por la membrana. En la base de cada cilio o flagelo hay una estructura denominada corpsculo basal. Los corpsculos basales tienen una estructura similar, en cierto modo, a la de los centriolos.
Espermatozoide

Tubulina

Tubulina

Fig. 5

Ultraestructura de un microtbulo.

Ciliado

Fig. 6

1) Ciliado; 2) flagelado.

Fig. 7 Esquema del corte transversal de un cilio o de un flagelo: a) Pares de microtbulos; b) membrana c) Microtbulos centrales.

Fig. 8 El centrosoma en una clula animal. 1) Aparato de Golgi; 2) ribosomas; 3) ncleo; 4) nucleolo; 5 envoltura nuclear; 6) centrosoma; 7) R.E.G; 8) mitocondria; (examen de P.A.U. de sept. 1998).

J. L. Snchez Guilln

Pgina II-3-2

II) La clula

3) Hialoplasma

ster

Dato: Los microtbulos de cilios y flagelos se deslizan unos sobre otros rpidamente, batiendo a un ritmo de 500 a 1000 veces por minuto.
centrolo

EL CENTROSOMA Se trata de un centro organizador de microtbulos. Se encuentra tanto en las clulas animales como en las vegetales. En las clulas animales encontramos adems unas estructu ras denominadas centriolos que no se encuentran en las clulas vegetales. Los centriolos son elementos permanentes de la clula animal. Vistos al microscopio electrnico de transmisin (MET) tienen forma de barril. Son dos estructuras cilndricas de 0.5 m situadas perpendicularmente una a la otra. Estn constituidos por 9 tripletas de cortos microtbulos que se disponen paralelamente unos a otros formando una hlice. El centrosoma es muy importante en los procesos de divisin celular. En la divisin celular a partir del centrosoma se originar una estructura llamada huso acromtico responsable del desplazamiento de los cromosomas a polos opuestos de la clula.

Fig. 9 Esquema del centrosoma de una clula animal.

Fig. 10 Microfotografa de una pareja de centrolos.

Fig. 11 Ultraestructura del corte transversal de un centrolo.

centrosoma

Huso acromtico

Cromosomas (cromtida)

centriolos

Fig. 12

Clula en divisin.

J. L. Snchez Guilln

Pgina II-3-3

II) La clula

4) Sis. de membranas

4) SISTEMAS DE MEMBRANAS DEL CITOPLASMA


El citoplasma se encuentra compartimentado por un complejo sistema de estructuras formadas por membranas biolgicas relacionadas entre s tanto fsicamente como por la funcin que realizan, por lo que las estudiaremos conjuntamente. Estos orgnulos son: Retculo endoplasmtico granular (REG) Retculo endoplasmtico liso (REL) Aparato de Golgi (AG) Lisosomas y peroxisomas Vacuolas

Fig. 1 Esquema de una clula visto al M.E.T. en el que se observan diferentes estructuras constitudas por membranas. (P.A.U. de septiembre de 1997).

RETCULO ENDOPLASMTICO (RE) Es un complejo sistema de tubos, sacos y cisternas constituidos por membranas biolgicas y que pueden ocupar una gran parte de la clula. Existen dos tipos de retculo endoplasmtico: el retculo endoplasmtico liso (REL) y el retculo endoplasmtico rugoso o granular (REG). En el REG se observan adheridos a las membranas unos grnulos: los ribosomas. En el REL no existen stos grnulos y sus estructuras tienen formas ms tubulares. Tambin se diferencian en la funcin. Las estructuras que forman el retculo endoplasmtico granular se disponen generalmente en capas concntricas paralelas al ncleo celular (como las hojas del bulbo de una cebolla). Es de destacar que la envoltura nuclear es en realidad una estructura derivada del retcu lo endoplasmtico. El retcu lo endoplasmtico granular (REG) est muy desarrollado en las clulas que por su funcin deben de realizar una activa labor de snte sis, como es el caso de las clulas del pncreas y las clulas hepticas. Si un animal es sometido a un ayuno prolongado, el REG de sus clulas pancreticas se reduce

Fig. 2 Elementos del retculo endoplasmtico.

Fig. 3 Microfotografa al microscopio electrnico de elementos del retculo endoplasmtico granular.

J. L. Snchez Guilln

Pgina II-4-1

II) La clula

4) Sis. de membranas

considerablemente. Por el contrario, si se le suministra una rica dieta alimenticia, el REG se recupera. Esta recuperacin se realiza a partir de zonas prximas a la envoltura nuclear.

RIBOSOMAS

Son pequeos orgnulos invisibles al microscopio ptico y poco visibles al electrnico, no pudindose casi ni adivinar su estructu ra. Invaden en gran nmero el citoplasma y pueden estar libres o adheridos a las membranas del retculo endoplasmtico granular. Los que estn adheridos al REG intervienen en la sntesis de las protenas de las membranas o de aquellas destinadas al exterior. Los ribosomas estn constituidos bsicamente por prote nas y ARN-r (40% de protenas y 60% de ARN ribosomal). Estn formados por dos subunidades: la subunidad mayor y la subunidad menor. En el citoplasma ambas estn separadas pero pueden volver a unirse en el momento de la sntesis de prote nas.

Fig. 4

Ribosomas y polirribosomas.

2 3

Fig. 5 Ultraestructura del ribosoma. 1) Subunidad menor (40S). 2) Subunidad mayor (60S). 3)Ribosoma completo (80S).

EL APARATO DE GOLGI (AG) Est formado por unos conjuntos de sacos concntricos muy apretados, mucho ms concentrados y de menor tamao que los del retculo endoplasmtico granular y sin ribosomas. Cada conjunto de sacos es un dictiosoma. El nmero de dictiosomas por clula vara entre 5 6 a algunas decenas, en funcin del tipo de clula y de su estado funcional. Todos ellos se encuentran relacionados fsica y funcionalmente. Los dictiosomas presentan dos caras: una convexa, la cara de formacin, y otra cncava, la cara de maduracin. De esta ltima se van desprendiendo pequeas vacuolas que se independizan y que reciben el nombre de vesculas de secrecin. El AG se encuentra en permanente trans-

Fig. 6

Dictiosoma del aparato de Golgi.

Fig. 7 Esquema de un dictiosoma del aparato de Golgi. 1) Vesculas de secrecin. 2) Sculos. 3) Vesculas de transicin. 4) Retculo endoplasmtico granular.

J. L. Snchez Guilln

Pgina II-4-2

II) La clula

4) Sis. de membranas

formacin. Sus sculos se forman de manera continua por su cara de formacin a partir de vescu las que se desprenden del REG y se desintegran por la cara de maduracin para formar las vescu las de secrecin. El aparato de Golgi se encuentra muy desarrollado en las clulas que realizan funciones de secrecin, como las clulas secretoras de mucus del epitelio intestinal. Los dictiosomas son el sistema de empaquetamiento de ciertas sustancias qumicas, sobre todo de protenas, para su almacenamiento o secrecin.

LOS LISOSOMAS

Fig. 8 Clula vegetal. 1) pared celular; 2) dictiosoma de aparto de Golgi; 3) vacuola; 4) envoltura nuclear; 5) nucleolo; 6) retculo endoplasmtico granular; 7 mitocondria; 8) cloroplasto.

Los lisosomas son pequeas vesculas constituidas por membranas provenientes de los sistemas de membranas (AG y, ocasionalmente, REG). Se caracterizan por tener en su interior enzimas hidrolti cas, enzimas que rompen los enlaces de los polmeros por adicin de H2 O. Estas enzimas estn empaquetadas e inactivas en los lisosomas y as se evita que puedan destruir las propias estructuras celulares. Los lisosomas se originan en los dictiosomas del aparato de Golgi y, en algunos casos, en ciertas regiones del retculo endoplasmtico granular a partir de vescu las que se destacan de los sculos de los dictiosomas. Slo se encuentran en las clulas animales.

LOS PEROXISOMAS Parecidos a los lisosomas, diferencindose de estos en que contienen enzimas que degradan los cidos grasos y los aminocidos. Como estos procesos generan perxidos, contienen tambin catalasa, enzima que descompone los perxidos y en particular el H2 O2 en H2 O y O2 .

LAS VACUOLAS Son estructuras celulares variables en nmero y forma. En general estn constituidas por una membrana y un contenido interno. Hay diferencias entre las vacuolas de las clulas vegetales y las de las clulas animales. Las clulas vegetales es frecuente
Fig. 9 Clula del peciolo de una hoja de remolacha. 1) Pared celular. 2) Vacuola. 3) Cloroplastos. 4) Ncleo. 5) Citoplasma.

J. L. Snchez Guilln

Pgina II-4-3

II) La clula

4) Sis. de membranas

que presenten una nica o unas pocas vacuolas de gran tamao. Las clulas animales, en el caso de tener vacuolas, son de pequeo tamao. Las vacuolas se originan por la agregacin de las pequeas vesculas formadas a partir de los dictiosomas de aparato de Golgi o por invaginacin de la membrana plasmtica (endocitosis). Las vacuolas, en general, tienen funcin de almacenamiento de sustancias de reserva y, en ciertos casos, de almacenamiento de sustancias txicas. Existen otras estructuras que se llaman tambin vacuolas pero cuya funcin es muy diferente. As: - Las vacuolas pulstiles, como las que se observan en muchos organismos unicelulares de las aguas dulces, por ejemplo, el paramecio. Este organismo, al vivir en agua dulce, su citoplasma es hipertnico con respecto al exterior, por lo que se produce una entrada continua de agua. Las vacuolas pulstiles extraen el agua del citoplasma y la expulsan al exterior por tansporte activo. - Las vacuolas digestivas. Se dan en las clulas que capturan alimentos del medio y los engloban en una membrana formando una vacuola llamada vacuola digestiva. En esta vacuola es donde se va a producir la digestin de esas sustancias nutritivas. Una vez digeridas pasan al interior de la clula y los productos de desecho son eliminados hacia el exterior.

Fig. 10 vegetal.

Vc) gran vacuola en una clula

Fig. 11 Paramecios en los que se observan vacuolas digestivas.

vp

cil

Mn mn

vp

vd
Fig. 12 Paramecio, ciliado de las aguas dulces. vp) Vacuola pulstil. vd) Vacuola digestiva. cil) Cilios. Mn) Macroncleo. mn) Microncleo.

J. L. Snchez Guilln

Pgina II-4-4

II) La clula

4) Sis. de membranas

FUNCIONES DE LOS SISTEMAS DE MEMBRANAS

> Maduracin de protenas: Los sistemas de membranas estn relacionados con la sntesis, maduracin y transporte de protenas y glicoprotenas. Intervienen, sobre todo, en los procesos subsiguientes a la sntesis de las protenas de secrecin, las protenas de las membranas y las enzimas de los lisosomas. Muchas de estas protenas son glicoprotenas. La parte protica se sintetiza en el hialolplasma y de aqu pasa al interior del REG y del A. Golgi donde unas enzimas les aaden los oligosacridos (maduracin de las glicoprotenas). Despus se dirigirn, por medio de las vesculas de secrecin que se desprenden del Golgi, a formar los lisosomas, a integrarse en la membrana plasmtica o a la exportacin.
Glicosiltransferasa Ribosoma ( enzima) ARNm

Cisterna del REG

Glicoprotenas Membrana del REG

Fig. 13

Maduracin y transporte de glicoprotenas en el REG.

> Funcin de los lisosomas: Hemos visto que ciertas clulas tienen la capacidad de ingerir sustancias por medio de fenmenos de endocitosis. Las sustancias son englobadas por la membrana plasmtica que, a continuacin, se invagina formando una vescula denominada fagosoma. El fagosoma se fusiona con los lisosomas formando los fagolisosomas. Las grandes mol culas contenidas en el fagosoma: polisacridos, prote nas, cidos nucleicos, etc., son sometidas a la accin del medio cido de los lisosomas y a las enzimas, que en este momento ya son activas. Los polme ros son hidrolizados y transformados en mol culas menores: monosacridos, aminocidos, etc., que se difunden a travs de la membrana hacia el citoplasma. Quedan en el lisosoma los productos no degradados. Un lisosoma que ya ha actuado recibe el nombre de lisosoma secundario y conserva an la capacidad de unirse a

Fig. 14 1) Endocitosis; 2) lisosomas; 3) fagolisosoma; 4) lisosoma secundario; 5) cuerpos residuales; 6 y 7) exocitosis (excrecin); 8 digestin de una mitocondria por un lisosoma (autofagia).

J. L. Snchez Guilln

Pgina II-4-5

II) La clula

4) Sis. de membranas

nuevos fagosomas. Las sustancias no degradadas se van acumulando progresivamente en el interior de los lisosomas secundarios. En ciertos organismos, estos lisosomas secundarios pueden fusionarse con la membrana plasmtica y expulsar su contenido al exterior (exocitosis). En los organismos pluricelulares lo normal es que los lisosomas secundarios se transformen en cuerpos residuales. Esta acumulacin de cuerpos residuales en una clula a lo largo de su vida es un signo de degeneracin celular. La membrana de los lisosomas puede englobar tambin orgnulos celulares que de esta manera son digeridos. Por este sistema la clula renueva sus estructuras celulares.
Fig. 15 Relaciones entre el 1) REG, 2) el aparato de Golgi y las protenas de membrana o la secrecin de protenas u otras sustancias (3).

> Sntesis de los polisacridos de la pared celular En el aparato de Golgi se produce la sntesis de los polisacridos y en particular la sntesis de la celulosa que constituye la sustancia fundamental de las paredes de las clulas vegetales.

Pared celular de la clula contigua

plasmodesmos

Pared primaria Pared

secundaria Las clulas vegetales disponen de una estructura que las envuelve denominada pared celular, constituida, fundamentalmente, por celulosa. La celulosa est formada por mol culas de glucosa unidas entre s mediante enlaces (1-4). Esto hace que las molculas Fig. 16 Fragmento de una clula vegetal de celulosa adopten una conformacin lineal mostrando la pared celular y los plasmodesmos. y que se puedan establecer puentes de hidrgeno entre mol culas dispuestas en paralelo formando microfibrillas entre las que se sitan entrecruzadas mol culas de otras sustancias, como la lignina, que le da a la pared una gran rigidez, o ceras, que la impermeabilizan. La pared celular no es un orgnulo celular sino un producto de secrecin de la clula que deposita en su exterior estas sustancias concntricamente. La pared celular aparece adems atravesada por una gran cantidad, hasta 20 000 en ciertos casos, de finsi mos conductos denominados plasmodesmos. Los plasmodesmos comunican el protoplasma de las clulas contiguas que, en cierto modo, forman una unidad.

En la pared celular distinguiremos, del interior al exterior de la clula, la pared secundaria, la pared primaria y la laminilla media.

La pared secundaria. Ms gruesa y resistente, crece bajo la primera y se la

J. L. Snchez Guilln

Pgina II-4-6

II) La clula

4) Sis. de membranas

encuentra principalmente en clulas que estn ya diferenciadas.

La pared primaria. Formada por microfibrillas de celulosa ms desordenadas y es la nica que est presente en clulas jvenes y en clulas que se dividen activamente. La laminilla media. Difcil de ver al microscopio. Est formada por sustancias pcticas y mantiene unidas a las clulas contiguas.

> Funciones del retculo endoplasmtico liso (REL)

El retculo endoplasmtico liso est relacionado con el metabolismo (sntesis, degradacin y transporte) de los lpi dos. Las hormonas estero dicas son sintetizadas en el REL. Se ha observado que tambin interviene en los procesos para metabolizar ciertos medicamentos y determinadas sustancias txicas.

J. L. Snchez Guilln

Pgina II-4-7

II) La clula

5) Enzimas

5) EL METABOLISMO CELULAR: GENERALIDADES. ENZIMAS


EL METABOLISMO: CONCEPTO La nutricin de las clulas supone una serie de complejos procesos qumicos catalizados por enzimas que tienen como finalidad la obtencin de materiales y/o energa. Este conjunto de procesos recibe el nombre de metabolismo.

ANABOLISMO Y CATABOLISMO El metabolismo va a poder descomponerse en dos series de reacciones: Anabolismo. Son aquellos procesos qumicos que se producen en la clula y que tienen como finalidad la obtencin de sustancias orgnicas complejas a partir de sustancias ms simples con un consumo energa. Son anablicos, por ejemplo, la fotosntesis, la sntesis de protenas o la replicacin del ADN. Catabolismo. En estos procesos las molculas complejas son degradadas formndose molculas ms simples. Se trata de procesos destructivos generadores de energa; como por ejemplo: la glucolisis.
Sales minerales

CO2

H2O
Fotosntesis
Compuestos orgnicos

Glcidos Glucosa

Prtidos
aminocidos

Lpidos

Gluclisis

Compuestos intermediarios Nitrgeno inorgnico

Fermentacin cido Lctico Etanol

Respiracin

CO2

H2O

anabolismo catabolismo

Fig. 1

Principales rutas del metabolismo.

TIPOS DE METABOLISMO Los organismos no se diferencian en la manera de procurarse compuestos inorgnicos del medio, todos los obtienen de una manera directa. En cambio, si se van a

J. L. Snchez Guilln

Pgina II-5-1

II) La clula

5) Enzimas

diferenciar en cmo van a obtener las sustancias orgnicas. Ciertos organismos las obtienen a partir de sustancias inorgnicas, como el CO2 , H2 O, NO3 -, PO4 -3 , etc. A estos organismos se les llama auttrofos. Otros son incapaces de elaborar los compuestos orgnicos a partir de compuestos inorgnicos y deben obtenerlos del medio, son los organismos hetertrofos. Los organismos adems de materiales necesitan tambin energa. Cuando la fuente de energa es la luz, el organismo recibe el nombre de fotosinttico. Cuando la energa la obtienen a partir de sustancias qumicas, tanto orgnicas como inorgnicas, los llamaremos quimiosintticos.

Las enzimas son protenas o asociaciones de protenas y otras molculas orgnicas o inorgnicas que actan catalizando los procesos qumicos que se dan en los seres vivos.
A

energa

LAS ENZIMAS. CONCEPTO DE CATLISIS

Energa total 305, 14 KJ

Sin enzima

Energa de activacin sin enzima 292,6KJ

con enzima Id. con enzima Energa neta 12,54 KJ

desarrollo de la reaccin

Esto es, actan facilitando las transformaciones qumicas; acelerando considerablemente las reacciones y disminuyendo la energa de activacin que muchas reacciones requieren.
As, por ejemplo:

Fig. 2 Energa de activacin necesaria para que A se trasforme en B, con y sin enzima.

I) La descomposicin del agua oxigenada (perxido de hidrgeno) en agua y oxgeno, segn la reaccin:

2H2O2 ----------> 2H2O + O2 es una reaccin que puede transcurrir espontneamente pero es extraordinariamente lenta. En condiciones normales se descomponen 100 000 molculas cada 300 aos por cada mol de H2O2 (6,023*1023 molculas). Sin embargo, en presencia de una enzima que hay en nuestras clulas, la catalasa, el proceso se desarrolla con extraordinaria rapidez (el burbujeo que se produce al echar agua oxigenada en una herida es debido a esto). II) La reaccin de desfosforilacin de la glucosa:

Glucosa-6-P + H2O ----------> Glucosa + Pi es exergnica, pero se necesitan 292,6 kJ/mol para romper el enlace fosfoster. Esto significa que para poder obtener 305,14 kJ/mol de glucosa, deberemos suministrar primero 292,6 kJ/mol (rendimiento neto 12,54 kJ/mol de glucosa). Esta energa (292,6 kJ) recibe el nombre de energa de activacin (EA).

J. L. Snchez Guilln

Pgina II-5-2

II) La clula

5) Enzimas

Las enzimas, como catalizadores que son, no modifican la constante de equilibrio y tampoco se transforman, recuperndose intactas al final del proceso. La rapidez de actuacin de las enzimas y el hecho de que se recuperen intactas para poder actuar de nuevo es la razn de que se necesiten en pequesimas cantidades.

ESPECIFICIDAD DE LAS ENZIMAS Es de destacar que las enzimas son especficas. Esto es, una enzima puede actuar sobre un substrato o un grupo de substratos relacionados (especificidad de substrato) pero no sobre otros; por ejemplo:la sacarasa, que hidroliza la sacarosa. Otras enzimas, sin embargo, tienen especificidad de accin al realizar una accin determinada pero sobre mltiples substratos; por ejemplo: las lipasas que hidrolizan los enlaces ster en los lpidos. Debido a esta especificidad de las enzimas existen en la clula miles de enzimas diferentes. La especificidad de las enzimas ha llevado a comparar a stas con llaves y a los substratos con cerraduras (modelo de la llave y la cerradura).
Centro activo

Fig. 3

Estructura de una enzima.

CONSTITUCIN QUMICA DE LAS ENZIMA Y MODO DE ACTUACIN


Fig. 4

Centro regulador

En el pasado las enzimas se conocan con estructura de una enzima. el nombre de fermentos, porque los primeros enzimas estudiados fueron los fermentos de las levaduras y de las bacterias. En la actualidad el trmino fermento se aplica sustrato nicamente a las enzimas que las bacterias, hongos y levaduras vierten al exterior para realizar determinadas trasformaciones: las coenzima fermentaciones. Las enzimas son, en general, prtidos. Algunas son protenas en sentido estricto. Otras poseen una parte proteica (apoenzima) y una parte no proteica, ambas estn ms o menos ligadas qumicamente. La conformacin espacial de la parte proteica es la responsable de la funcin que realiza la enzima. Para ello la sustancia o

Representacin esquemtica de la

productos

Centro activo Centro regulador

Fig. 5 Trasformaciones de un sustrato por la accin de una enzima.

J. L. Snchez Guilln

Pgina II-5-3

II) La clula

5) Enzimas

sustancias que van a reaccionar y transformarse se unen a la enzima en una zona que llamaremos centro activo y son las interacciones qumicas entre los restos de los aminocidos presentes en el centro activo y el substrato o los substratos las responsables de la transformacin; ya que estas interacciones producen reordenamientos de los electrones que debilitan ciertos enlaces y favorecen la formacin de otros desencadenando la transformacin qumica. MECANISMO DE ACCIN ENZIMTICA

sustrato

coenzima

sustrato coenzima enzima


Centro activo

enzima

1) En primer lugar, se forma un complejo: enzimasubstrato o substratos.

2) El sustrato o los sutratos y la coenzima, si es necesaria, se unen al centro activo de la enzima.

Productos

Productos

coenzima enzima enzima

3) Los restos de los aminocidos que configuran el centro activo catalizan el proceso. Para ello debilitan los enlaces necesarios para que la reaccin qumica se lleve a cabo a baja temperatura y no se necesite una elevada energa de activacin.

4) Los productos de la reaccin se separan del centro activo y la enzima se recupera intacta para nuevas catlisis. Las coenzimas colaboran en el proceso; bien aportando energa (ATP), electrones (NADH/NADPH) o en otras funciones relacionadas con la catlisis enzimtica.

Actividad enzimtica

La parte proteica o apoenzima es tambin, y por las mismas razones, la que determina la especificidad de la enzima. As, la sacarasa acta sobre la sacarosa por ser esta la nica molcula que se adapta al centro activo. Muchas enzimas precisan para su actuacin la presencia de otras sustancias no proteicas: los cofactores. Qumicamente son sustancias muy variadas. En algunos casos se trata de simples iones, cationes en particular, como el Cu+ + o el Zn+ + . En otros, son sustancias orgnicas mucho ms complejas, en cuyo caso se llaman coenzimas. Muchas vitaminas son coenzimas o

Nivel de saturacin de la enzima

Concentracin de sustrato

Fig. 6 Grfica de Michaelis_Menten que muestra la variacin de la actividad enzimtica con la concentracin de sustrato. Esta grfica demuestra la formacin de un complejo enzimasustrato.

J. L. Snchez Guilln

Pgina II-5-4

II) La clula

5) Enzimas

forman parte de coenzimas. Las coenzimas son imprescindibles para que la enzima acte. Suelen, adems, ser las responsables de la actividad qumica de la enzima. As, muchas reacciones de oxidacin precisan + del NAD , que es el que capta los electrones y sin su presencia la enzima no puede actuar. Otro ejemplo lo tenemos en las reacciones que necesitan energa en las que acta como coenzima el ATP. Por ltimo, indicar que las enzimas se nombran aadiendo la terminacin asa, bien al nombre del substrato sobre el que actan (sacarasa), al tipo de actuacin que realizan (hidrolasas), o ambos (ADN polimerasa).
Fig. 7 Esquema del NAD+ -NADP+ . X es un hidrgeno en el NAD+ y un grupo fosfato en el NADP+ .

ALGUNAS COENZIMAS IMPORTANTES i) Coenzimas que intervienen en las reacciones en las que hay transferencias de energa: *ATP (adenosina-5'-trifosfato): Adenina-Ribosa-P-P-P *ADP (adenosina-5'-difosfato): Adenina-Ribosa-P-P.

Enlace rico en energa

Fig. 8

Esquema del ATP.

ii) Coenzimas que intervienen en las reacciones en las que hay transferencias de electrones: * NAD+ (Nicotinamn adenn dinucletido). Se trata de un dinucletido formado por: Nicotinamida-Ribosa-P-P-Ribosa-Adenina. * NADP+ (Nicotinamn adenn dinucletido fosfato). Similar NAD + pero con un grupo fosfato ms esterificando el HO- del carbono 2 de la ribosa unida a la adenina. * FAD (Flavn adenn dinucletido). Similar al NAD pero conteniendo riboflavina (otra de las vitaminas del complejo B2 ) en lugar de nicotinamida. iii) Coenzimas que intervienen como transportadores de grupos acilo.

Coenzima A. Coenzima de estructura compleja y de la que forma parte el cido pantotnico (otra de las vitaminas del complejo B2 ).

J. L. Snchez Guilln

Pgina II-5-5

II) La clula

5) Enzimas

EL ATP Y EL TRANSPORTE DE ENERGA En los procesos metablicos que se dan en la clula, algunas reacciones son endergnicas: necesitan energa para producirse y en caso contrario no se producen. Otras son exergnicas: producen energa y si sta no se emplea en realizar un trabajo fsico o una reaccin qumica se perder en forma de calor.

Fig. 9 El ATP transporta energa (E) Ciertas coenzimas, como el ATP y otras, desde los procesos exergnicos (A>B) a los actan transportando energa desde los endergnicos (C>D). procesos exergnicos a los endergnicos. Pues el ATP se puede transformar en ADP y Pi (fosfato inorgnico) al hidrolizarse el ltimo de sus enlaces ster-fosfato, desprendindose ms de 7 kcal por mol de ATP. Por el contrario, en aquellas reacciones en las que se produce energa esta es acumulada al sintetizarse ATP a partir de ADP y fosfato inorgnico (Pi).

LAS COENZIMAS TRANSPORTADORAS DE ELECTRONES Muchos procesos qumicos celulares de gran importancia: fotosntesis, respiracin celular, etc. Son procesos de oxidacinreduccin. As, por ejemplo: la respiracin celular, en la que la glucosa se oxida al perder electrones, mientras que el oxge no los capta reducindose. Ciertas coenzimas actan transportando estos electrones desde las sustancias que se oxidan a las que se reducen: son los transportadores de electrones.

e-

e-

Fig. 10 Transporte de electrones (e-) por el NAD+ /NADH desde una sustancia que se oxida (O) a otra que se reduce (G).

As, por ejemplo, el NAD + es capaz de captar dos electrones, y dos protones (H+ ), reducindose y transformndose en NADH+H + . Mientras que el NADH +H + puede ceder estos dos electrones all donde se necesiten para reducir a un compuesto qumico, transformndose de nuevo en NAD + .

FACTORES QUE CONDICIONAN LA ACTIVIDAD ENZIMTICA Las enzimas, como sustancias proteicas que son, van a ver condicionada su actuacin por determinados factores fsicos y qumicos. Algunos de estos factores son: La temperatura. Como toda reaccin qumica, las reacciones catalizadas enzimtica-

J. L. Snchez Guilln

Pgina II-5-6

II) La clula

5) Enzimas

mente siguen la regla de Van t'Hoff. Segn la cual, por cada 101C de aumento de temperatura, la velocidad de la reaccin se duplica. No obstante, las enzimas tienen una temperatura ptima. En el hombre, y en los animales homeotermos como el hombre, esta Temperatura ptima temperatura ptima coincide con la temperatura normal del organismo. Los enzimas, como prote nas que son, se desnaturalizan a elevadas temperaturas. El pH, que al influir sobre las cargas elctricas, podr alterar la estructura del centro activo y por lo tanto tambin influir sobre la actividad enzimtica. Los inhibidores. Determinadas sustancias van a poder actuar sobre las enzimas disminuyendo o impidiendo su actuacin. Estas sustancias son los inhibidores. Se trata de molculas que se unen a la enzima impidiendo que sta acte sobre el substrato.
Actividad enzimtica

Fig. 11 Variacin de la actividad enzimtica en funcin de la temperatura.

Actividad enzimtica

pH ptimo

Inhibicin competitiva: Cuando el inhibidor se une al centro activo de la enzima impidiendo que el sustrato se una a l. Se trata de una inhibicin que depende de la concentracin de sustrato y de inhibidor. Inhibicin no competitiva: Cuando el inhibidor se une reversiblemente a un punto diferente del centro activo pero con su actuacin lo modifica lo suficiente para que, aunque se puedan unir la enzima y el sustrato, la catlisis no se produzca o la velocidad de sta disminuya. Este tipo de inhibicin no depende de la concentracin de sustrato. Inhibicin alostrica: El inhibidor se une tambin reversiblemente a un punto diferente al centro activo, pero con su actuacin lo modifica de tal manera que impide la unin de la enzima y el substrato.

10

11

12

13

14

pH

Fig. 12 Variacin de la actividad enzimtica en funcin del pH de dos enzimas.

sustrato

inhibidor

Enzima

Fig. 13 Inhibicin competitiva. El inhibidor se une al centro activo, reversiblemente, y con ello impide que el sustrato se una a l.

Es frecuente que el inhibidor sea el propio producto de la reaccin enzimtica o el producto final de una cadena de reacciones. Cuando se trata del producto final,

J. L. Snchez Guilln

Pgina II-5-7

II) La clula

5) Enzimas

recibe el nombre de retrorregulacin o feedback. Envenenadores: Son molculas que se unen irreversiblemente al centro activo de la enzima impidiendo pernanentemente que esta acte. Muchos txicos y venenos tienen este modo de actuacin. Los activadores. Son sustancias que se unen a la enzima, que se encuentra inactiva, cambiando su estructura espacial activndola.

Enzima inactiva

inhibidor

Fig. 14 Inhibicin no competitiva. El inhibidor se une reversiblemente a la enzima en un punto diferente del centro activo y, modifica este de tal manera, que aunque el sustrato se una no se realiza la catlisis.

sustrato

Enzima

inhibidor

Fig. 15 Inhibicin alostrica. El inhibidor se une a la enzima en un punto diferente del centro activo y modifica este de tal manera que el sustrato no se puede unir a l.

sustrato envenenador

Enzima

Fig. 16 Envenenador. Los envenenadores son sustancias que se unen al centro activo mediante enlaces fuertes en un proceso irreversible, con lo que impiden de manera definitiva la catlisis.

J. L. Snchez Guilln

Pgina II-5-8

II) La clula

5a) Fotosntesis

5A) METABOLISMO: OBTENCIN DE ENERGA 5A-1) OBTENCIN DE ENERGA Y SNTESIS DE COMPUESTOS ORGNICOS EN LA CLULA VEGETAL (FOTOSNTESIS)
LOS PLASTOS Son orgnulos citoplasmticos exclusivos y caractersti cos de las clulas vegetales. Existen diversos tipos de plastos: cloroplastos, cromoplastos y leucoplastos. Todos tienen un origen comn en unas estructu ras celulares llamadas proplastos. Algunas caractersticas de las diferentes clases plastos son: - Cloroplastos. Plastos verdes ya que contiene, entre otros pigmentos foto sintticos, clorofila. En ellos se realiza la foto snte sis. - Cromoplastos plastos de color amarillo o anaranjado por acumulacin de carotenoides, como los del tomate o la zanahoria. - Leucoplastos plastos de color blanco. Se encuentran en las partes no verdes de la planta. As, por ejemplo, en las clulas de la patata encontramos un tipo de leucoplastos, los amiloplastos, llamados as por contener almidn. Debido a su importancia para todos los seres vivos, haremos a continuacin un estudio particular de los cloroplastos.
a

d d

Fig. 1 Corte transversal de una hoja: a) epidermis del haz; b y d) parnquima cloroflico; c) epidermis del envs; e) estoma.

Fig. 2 Cromoplastos en clulas vegetales vistos al microscopio ptico.

O2

CO2 Savia bruta

LOS CLOROPLASTOS Caractersticas: Son orgnulos muy variables en cuanto a nmero, forma y tamao. As, por ejemplo, las clulas de ciertas algas filamentosas tienen uno o dos nicos cloroplastos; otras, como la planta acutica elodea, tienen numerosos cloroplastos. Su forma es, normalmente, de lente biconvexa, pero pueden ser tambin estrellados o con

Savia elaborada

Sales minerales

H2O

Fig. 3 Intercambios de sustancias entre la planta y el medio durante el da.

J. L. Snchez Guilln

Pgina II-5a-1

II) La clula

5a) Fotosntesis

forma de cinta enrollada en hlice. Ultraestructura: Es difcil observar su estructura al microscopio ptico. Al MET (microscopio electrnico de transmisin) se observa una membrana externa y otra interna separadas por un espacio intermembrana. En el interior se ven unas estructuras alargadas formadas por membranas llamadas lminas o lamelas. Sobre ellas se ven los grana, que son unos repliegues, formados tambin por membranas, que se disponen unos encima de otros. Todo este conjunto de membranas internas recibe el nombre de tilacoides; pudindose distinguir los tilacoides de los grana y los tilacoides de las lminas. Existe adems un contenido interno: el estroma, en el que hay ADN similar al de las clulas procariotas, ribosomas (plastorribosomas) y acumulaciones de almidn, protenas y lpidos. Funcin: En los cloroplastos se va a realizar la fotosntesis. En los tilacoides se realiza una de las fases de la fotosntesis: la fase luminosa. La otra fase de la fotosntesis: la fase oscura, se realiza en el estroma del cloroplasto. Origen evolutivo: Es de destacar que los plastos tienen una estructura similar a los organismos procariticos. Segn la " Teora endosimbitica" la clula eucaritica se habra formado por simbiosis de diferentes organismos procariotas, uno de ellos el plasto, que proporcionara al conjunto compuestos orgnicos que sintetizara usando como fuente de energa la luz solar.
Fig. 6 Ultraestructura de un cloroplasto. 1) Membrana externa. 2) Membrana interna. 3) Grana. 4) Lminas. 5) Estroma.

Fig. 4 Clulas vegetales vistas al microscopio electrnico en las que pueden observarse numerosos cloroplastos.

Fig. 5 Cloroplasto visto al microscopio electrnico. me) membrana externa; mi) membrana interna; gr) grana; la) lminas; es) estroma; pg) plastoglbulos; al) almidn.

LA FOTOSNTESIS: CONCEPTO

La fotosntesis puede definirse como un proceso anablico que se produce en los cloroplastos y en el que la energa luminosa es transformada en energa qumica que posteriormente ser empleada para la fabricacin de sustancias orgnicas a partir de sustancias inorgnicas.

J. L. Snchez Guilln

Pgina II-5a-2

II) La clula

5a) Fotosntesis

PROCESOS QUE SE DAN EN LA FOTOSNTESIS En la fotosntesis se van a producir los siguientes procesos: 11) Captacin por las clorofilas y otros pigmentos fotosintticos de la energa luminosa y su transformacin en energa qumica contenida en el ATP. 21) Obtencin de electrones a partir del agua. Estos electrones, convenientemente activados por la energa luminosa, servirn para reducir NADP+ . 31) Incorporacin del carbono del CO2 a las cadenas carbonadas. 41) Reduccin por el NADPH del carbono incorporado y sntesis de compuestos orgnicos. 51) Reduccin de otras sustancias inorgnicas (nitratos, nitritos, sulfatos, etc.) para su incorporacin a las cadenas carbonadas.

ECUACIN GLOBAL DE LA FOTOSNTESIS La fotosntesis en su conjunto es un proceso redox en el que el CO2 y otras sustancias inorgnicas son reducidas e incorporadas en las cadenas carbonada. Aunque son muchas las sustancias orgnicas que se forman en el cloroplasto, la que se forma en mayor cantidad es la glucosa. Por esto la ecuacin global de la sntesis de glucosa en el cloroplasto se considera como la ecuacin global de la fotosntesis.

6 CO 2 + 6 H 2O
Fig. 7 Ecuacin global de la fotosntesis.

C 6 H 12 O 6 + 6 O 2

CONSECUENCIAS DE LA FOTOSNTESIS Las consecuencias de la fotosntesis son de gran importancia para los seres vivos. As: 1) Todos o casi todos los seres vivos dependen, directa o indirectamente, de la fotosntesis para la obtencin de sustancias orgnicas y energa. 2) A partir de la fotosntesis se obtiene O2 . Este oxgeno, formado por los seres vivos, transform la primitiva atmsfera de la Tierra e hizo posible la existencia de los organismos hetertrofos aerbicos1 .
1

Aerbicos son los organismos que necesitan en su metabolismo el oxgeno para los procesos de

oxidacin.

J. L. Snchez Guilln

Pgina II-5a-3

II) La clula

5a) Fotosntesis

FASES DE LA FOTOSNTESIS La fotosntesis es un proceso muy complejo. Se ha demostrado que slo una parte requiere energa luminosa, a esta parte se le llama fase luminosa; mientras que la sntesis de compuestos orgnicos no necesita la luz de una manera directa, es la fase oscura. Es de destacar que la fase oscura, a pesar de su nombre, se realiza tambin durante el da, pues precisa el ATP y el NADPH que se obtienen en la fase luminosa.

Fig. 8 Fase luminosa y fase oscura de la fotosntesis: visin de conjunto.

ATP asa

Phs 1

Phs 2

Cit b/f

A) FASE LUMINOSA
Se realiza en la membrana de los tilacoides. Consiste en un transporte de electrones, desencadenado por fotones, con sntesis de ATP y de NADPH+H + .

Fig. 9 Disposicin de los fotosistemas (Phs) de los citocromos (Cit) y de las ATPasas en los tilacoides de los granas.

ESTRUCTURA DE LA MEMBRANA DE LOS TILACOIDES La membrana de los tilacoides tiene una estructura de doble capa o membrana unitaria. Integradas en esta doble capa estn determinadas sustancias muy importantes en el proceso de la fotosntesis y en particular los fotosistemas I y II, ATPasas y citocromos. Cada fotosistema contiene carotenos, clorofilas y protenas. Estas molculas captan la energa luminosa y la ceden a las Fig. 10 La clorofila a. molculas vecinas presentes en cada fotosistema hasta que llega a una molcula de clorofila-a denominada molcula diana. Los diferentes carotenos y clorofilas captan fotones de unas determinadas longitudes de onda. De esta manera, el conjunto de las molculas del fotosistema captan gran parte Fig. 11 El grupo fitol de las clorofilas. de la energa luminosa incidente, slo determinadas longitudes de onda son reflejadas y, por lo tanto, no utilizadas. En particular, son reflejadas las radiaciones correspondientes a las longitudes de onda del verde y el amarillo.

J. L. Snchez Guilln

Pgina II-5a-4

II) La clula

5a) Fotosntesis

En el fotosistema II (Phs II) la molcula diana es la clorofila aII que tiene su mximo de absorcin a 680 nm (P 680). Cuando esta clorofila capta un fotn pasa a un estado excitado (P 680 ) y su potencial redox se hace ms negativo hacindose muy reductora. En el fotosistema I (Phs I), la molcula diana es la clorofila aI, cuyo mximo de absorcin se encuentra a 700 nm (P 700), que tambin se excita (P 700 ) al captar un fotn. La disminucin de los potenciales redox permite que se establezca un transporte de electrones que pueden seguir dos vas: - La fotofosforilacin acclica - La fotofosforilacin cclica

Molcula diana

Fotosistema

Fig. 12 Captacin de la energa luminosa por un fotosistema.


Clorofila a
150

Clorofila b Caroteno

100

50

0 400 500 600 700

Longitud de onda en nm (nanometros)

LA FOTOFOSFORILACIN ACCLICA La luz va a desencadenar un transporte de electrones a travs de los tilacoides con produccin de NADPH y ATP. Los electrones ser aportados por el agua. En esta va se pueden distinguir los siguientes procesos: I) Reduccin del NADP+ : La clorofila-aII y otras sustancias del fotosistema II captan foto nes (luz) pasando a un estado ms energ tico (excitado). Esta energa les va a permitir establecer una cadena de electrones a travs de los tilacoides en la que intervienen diferentes transportadores y en particular el fotosistema I que tambin es activado por la luz. El aceptor final de estos electrones es el NADP+ que se reduce a NADPH+H + al captar los dos electrones y dos protones del medio.

Fig. 13 Absorcin de los diferentes pigmentos del cloroplasto en funcin de la longitud de onda. La menor absorcin se corresponde con los colores verde (492 a 577 nm) y amarillo (577 a 597 nm).

700

Rojo Naranja Amarillo Verde Azul Ail Violeta

(622-770) (597-622) (577-597) (492-577) (455-492) (430-455) (390-430)


500 600

400

Fig. 14 Longitudes de onda de los colores del espectro de la luz visible.

II) Fotolisis del agua y produccin de oxgeno: Los electrones transportados a travs de los tilacoides y captados por el NADP+ proceden de la clorofila aII (P680). Esta molcula va recuperarlos sacndolos del agua. De esta manera podr iniciar una nueva cadena de electrones. En este proceso la molcula de agua se descompone (lisis) en 2H + , 2e- y un tomo de oxgeno. El tomo de oxgeno, unido a un segundo tomo para formar una molcula de O2 , es eliminado al exterior. El oxgeno producido durante el da por las plantas se origina en este proceso.

J. L. Snchez Guilln

Pgina II-5a-5

II) La clula

5a) Fotosntesis

NADPH ATP
NADP+ Luz estroma Luz

3H+
ADP

H+

PhsII
e

PhsI

H2 O

3H+
Interior del tilacoide

O2

Fig. 15

Esquema de la fotofosforilacin accliclica.

III) Obtencin de energa. Sntesis de ATP (Teora quimiosmtica): El transporte de electrones a travs de los fotosistemas produce un bombeo de protones desde el estroma hacia el interior del tilacoide, pues los fotosistemas actan como transportadores activos de protones extrayendo la energa necesaria para ello del propio transporte de electrones. La lisis del agua tambin genera protones (H+ ). Todos estos protones se Fig. 16 Sntesis de ATP en los tilacoides. acumulan en el espacio intratilacoide, pues la membrana es impermeable a estos iones y no pueden salir. El exceso de protones genera un aumento de acidez en el interior del tilacoide y, por lo tanto, un gradiente electroqumico -exceso protones y de cargas positivas. Los protones slo pueden salir a travs de unas molculas de los tilacoides: las ATPasa. Las ATPasas actan como canal de protones y de esta manera cataliza la sntesis de ATP. Es la salida de protones (H+ ) a travs de las ATPasas la que acta como energa impulsora para la sntesis de ATP. IV) Balance de la fotofosforilacin acclica: Teniendo en cuenta nicamente los productos iniciales y finales, y podemos hacerlo porque el resto de las sustancias se recuperan en su estado inicial, en la fotofosforilacin acclica se obtienen 1 NADPH+H + y 1 ATP. A su vez, la fotolisis del agua va a generar tambin un tomo de oxgeno.

LA FOTOFOSFORILACIN CCLICA En esta va la luz va a desencadenar un transporte de electrones a travs tilacoides con produccin slo de ATP. de los

Mecanismo: El proceso parte de la excitacin de la molcula diana del fotosistema I (clorofila-aI, P700) por la luz. Ahora bien, en este caso, los electones no irn al NADP+ sino que seguirn un proceso cclico pasando por una serie de transportadores para volver a la clorofila aI. En cada vuelta se sintetiza una molcula

J. L. Snchez Guilln

ATPasa

Pgina II-5a-6

II) La clula

5a) Fotosntesis

de ATP de la misma forma que en la fotofosforilacin acclica.

ATP
Luz

ADP

3H+

estroma
e e e

PhsI

e e

3H+
Interior del tilacoide

Fig. 17

Esquema de la fotofosforilacin ccliclica.

Balance de la fotofosforilacin cclica: En esta va se produce una snte sis continua de ATP y no se requieren otros substratos que el ADP y el Pi y, naturalmente, luz (fotones). Es de destacar que no es necesaria la fotolisis del agua pues los electrones no son cedidos al NADP+ y que, por lo tanto, no se produce oxgeno.

REGULACIN DE AMBOS PROCESOS En el cloroplasto se emplean ambos procesos indistintamente en todo momento. El que se emplee uno ms que otro va a depender de las necesidades de la clula o lo que en realidad es lo mismo, de la presencia o ausencia de los substratos y de los productos que se generan. As, si se consume mucho NADPH+H + en la sntesis de sustancias orgnicas, habr mucho NADP+ , y ser ste el que capte los electrones producindose la fotofosforilacin acclica. Si en el tilacoide hay mucho ADP y Pi y no hay NADP+ , entonces se dar la fotofosforilacin cclica. Ser el consumo por la planta de ATP y de NADPH+H + , o, lo que es lo mismo, la existencia de los substratos ADP y NADP+ , la que determinar uno u otro proceso.

J. L. Snchez Guilln

Pgina II-5a-7

II) La clula LA FOTOFOSFORILACIN: EXPLICACIN DETALLADA


NOTA: Se expone aqu una explicacin ms en detalle de ciertos objetivo de comprensin interesados. A) FOTOFOSFORILACIN AC CLI CA. Al captar un aspectos que en de la fotofosforilacin contribuir alumnos a que una con el pueda aquellos mejor

5a) Fotosntesis

estroma Luz H+ Luz NADP+ NADPH Cit b6 Cit f PC H2O 2H+ + H+ O2 3H+ PhsI P700 Fd Rd ADP

3H+

ATP

P680

estn ms

Interior del tilacoide

Fig. 18

Fotofosforilacin acclica

fotn, la clorofila a II (P680) se excita y aumenta su poder reductor. Esto le va a permitir reducir, por cesin de 2e -, a la plastoquinoma (PQ). Estos dos electrones son cedidos sucesivamente a otros transportadores: Citocromo b6 (Cit b6 ), citocromo f (Cit f) y
PQ Cit b6 Cit f PC 3H+ Interior del tilacoide 3H+ PhsI P700 3H+ estroma ATPasa Fd Luz ADP 3H+ ATP

plastocianina (PC), hasta llegar a la clorofila aI (P 700) del fotosistema I. Se establece en consecuencia una cadena de electrones. La clorofila aI (P 700) recibe la energa de otro fotn y se origina una nueva cadena redox: P 700, Ferredoxina (Fd), Reductasa (Rd); en la que el aceptor final es el NADP+ que se reduce a NADPH+H + al captar los dos electrones y dos protones del medio.

Fig. 19

Fotofosforilacin cclica.

II) LA FOTOFOSFORILACIN C CLICA: El proceso parte de la excitacin de la molcula diana (clorofila P 700) del fotosistema I. La diferencia con el proceso estudiado anteriormente est en que, en este caso, la ferredoxina (Fd), en lugar de ceder los 2e- a la reductasa (Rd), los cede a la plastoquinona (PQ). Se establece un proceso cclico en el que los mismos 2e - estn pasando continuamente por los mismos transportadores: Plastoquinona (PQ), citocromo b6 (Cb6 ), citocromo f (Cf), plastocianina (PC), clorofila aI, etc. En cada vuelta se sintetiza una molcula de ATP de la misma forma que en la fotofosforilacin acclica .

P700 Fd Fd Rd P680 PQ
Cb6

NADP+

2e-

ADP

NADPH

2e-

Cf

P700 ATP

fotones

H2O P680
Fig. 20 Fase luminosa de la fotosntesis.

fotones

J. L. Snchez Guilln

ATPasa

PhsII

PQ

Pgina II-5a-8

II) La clula

5a) Fotosntesis

B) FASE OSCURA (CICLO DE CALVIN2 )


En el estroma de los cloroplastos, y como consecuencia de la fase luminosa, se van a obtener grandes cantidades de ATP y NADPH+H + , metabolitos 3 que se van a utilizar en la sntesis de compuestos orgnicos. Esta fase recibe el nombre de Fase Oscura4 porque en ella no se necesita directamente la luz, sino nicamente las sustancias que se producen en la fase luminosa. Durante la fase oscura se dan, fundamentalmente, dos procesos distintos:

ATP NADPH+H+

+ 6 H2 O

Fig. 21

Ciclo de Calvin.

-Sntesis de glucosa mediante la incorporacin del CO2 a las cadenas carbonadas y su reduccin, ciclo de Calvin 5 propiamente dicho. - Reduccin de los nitratos y de otras sustancias inorgnicas, base de la sntesis de los aminocidos y de otros compuestos orgnicos.

DESCRIPCIN DEL CICLO DE CALVIN6 1) La ribulosa-5-P (RuP), monosacrido con cinco tomos de carbono (C5 ) fosforilada en posicin cinco, es fosforilada de nuevo por el ATP en el carbono 1, pasando a Ribulosa-1-5-difosfato (RuBP). 2) La RuBP reacciona con el CO2 obtenindose dos molculas de cido-3fosfoglicrico (PGA). Este compuesto contiene una cadena carbonada de tres tomos de carbono (C3 ). El proceso podra esquematizarse: 1 (C5 ) + CO2 -------> 2 (C3 ) 3) El PGA (C3 ) es reducido por el NADPH+H +
2

a gliceraldehdo-3-fosfato

En honor a su descubridor, el bioqumico norteamericano Melvin Calvin, premio Nobel de qumica en el ao 1961 por descubrir los mecanismos de la fotosntesis.
3

Productos que se originan en el metabolismo.

Es de destacar, que a pesar de su nombre, la fase oscura se produce tambin por el da; pues, aunque no precisa luz, s precisa ATP y NADPH y estos slo se originan durante el da en la fase luminosa.
5

Ciertas plantas tropicales, como la caa de azcar, pueden emplear, adems del ciclo de Calvin, otras vas que son incluso de mayor rendimiento cuando la temperatura es elevada y la planta debe tener cerrados los estomas. Es la llamada va del C4 o Ciclo de Hatch y Slach. En esta va, el CO2 es incorporado formando un cido dicarboxlico de cuatro tomos de carbono.
6

Lo que viene a continuacin, se expone a los efectos de que los alumnos puedan interpretar los esquemas y extraer las consecuencias que se derivan de ellos. No parece conveniente que el alumno deba saberlo de memoria.

J. L. Snchez Guilln

Pgina II-5a-9

II) La clula

5a) Fotosntesis

(PGAL), la tambin ATP.

reaccin

necesita

H H-C-O-H C=O H-C-O-H H-C-O-H H-C-O- P H


RuP ATP ADP

H H-C-O- P C=O H-C-O-H H-C-O-H H-C-O- P H


RuBP

CO2

Como consecuencia de los procesos 1, 2 y 3, estudiados hasta ahora, vemos que, partiendo de una mol cula con cinco tomos de carbono (C5 ) y por adicin de una molcula de CO2 , se obtienen dos mol culas con tres tomos de carbono cada una (C3 ). Esto es: C5 + C1 -----> 2 C3

H C=O H-C-O-H H-C-O- P H


PGAL

NADP+

NADPH+H+

OH C=O H-C-O-H H-C-O- P H


PGA 2X

ADP

ATP

Fig. 22

Primeras etapas del ciclo de Calvin.

El CO2 ha sido integrado en una molcula orgnica, una triosa, el llamado gliceraldeh do-3-fosfato (PGAL). Si en lugar de una mol cula de RuP, partimos de seis molculas, obtendremos 12 molculas de PGAL.

Fig. 23

Ciclo de Calvin.

4) De cada 12 molculas de PGAL obtenidas, 2 se unen dando una molcula de glucosa (C6 H12 O6 ) y el resto entra en un complejo proceso que tiene como objetivo la recuperacin de las 6 molculas de RuP (C5 ). stas, una vez recuperadas, entran de nuevo en el Ciclo de Calvin. 5) La glucosa as obtenida es polimerizada formndose almidn.

J. L. Snchez Guilln

Pgina II-5a-10

II) La clula

5a) Fotosntesis

CICLO DE CALVIN O FASE OSCURA DE LA FOTOSNTESIS (Estudio detallado)


Se representa aqu el desarrollo del ciclo de Calvin con sus ecuaciones qumicas, con la finalidad de que aquellos alumnos ms interesados puedan estudiarlo con ms detalle.

CH2O- P C=O H- C-OH H- C-OH CH2O- P


RUBP

CO CO22

COOH H- C-OH CH2O- P


PGA +

COOH H- C-OH CH2O- P


PGA

COOH H- C-OH CH2O- P

NADPH+H+ NADPH+H+

ATP ATP

CHO H- C-OH CH2O- P

NADP+ NADP+
PGA

ADP+Pi ADP+Pi
PGAL

1) Incorporacin del CO2 a la cadena carbonada de la RUBP. El CO2 reacciona con la ribulosa-1-5 difosfato (RUBP) para dar dos molculas de cido-3fosfoglicrico (PGA).
12NADPH+H+ 12NADPH+H+ 6CO 6CO22 12 ATP 12 ATP

2) Reduccin del carbono del CO2 incorporado: Cada una de las molculas de cido-3- fosfoglicrico (PGA) es reducida por el NADPH a aldehdo-3-fosfoglicrico (PGAL). El proceso es endergnico y precisa del ATP.
CHO

CH2O- P C=O 6 H- C-OH H- C-OH CH2O- P


RUBP

CHO 12 H- C-OH CH2O- P


PGAL

H- C-OH CHO H- C-OH CH2O- P


PGAL +

CHO H- C-OH CH2O- P


PGAL

HO- C-H H- C-OH 2P H- C-OH CH2OH


GLU

12NADP+ 12NADP+

12ADP+12Pi 12ADP+12Pi

3) Si los procesos 1 y 2 anteriores se repiten 6 4) Sntesis de glucosa: Dos de estas molculas de veces obtendremos 12 molculas de aldehdo-3- aldehdo-3-fosfoglicrico (PGAL) se condensan para fosfoglicrico (PGAL). dar una molcula de glucosa (GLU). Se obtienen, adems, dos molculas de fosfato inorgnico (P).
CH2OH CHO 10 H- C-OH CH2O- P
PGAL

CH2OH C=O 6 H- C-OH H- C-OH CH2O- P


RUP

C=O 6 H- C-OH H- C-OH CH2O- P


RUP

6 ATP 6 ATP

CH2O- P C=O 6 H- C-OH H- C-OH CH2O- P


RUBP

6 ADP 6 ADP

5) Recuperacin de la ribulosa 1-5 difosfato: Las otras 10 molculas de aldehdo-3-fosfoglicrico (PGAL) reaccionan entre s para dar 6 molculas de ribulosa-5-fosfato (RUP).

6) Recuperacin de la ribulosa 1-5 difosfato: Las 6 molculas de ribulosa-5-fosfato (RUP) reaccionan con 6 de ATP para dar 6 de ribulosa-1-5 difosfato (RUBP), cerrndose el ciclo.

J. L. Snchez Guilln

Pgina II-5a-11

II) La clula

5a) Fotosntesis

REDUCCIN DE NITRATOS Y SULFATOS Las plantas pueden obtener el nitrgeno que necesitan a partir de los nitratos (NO3 -), por ejemplo. Los nitratos son absorbidos por las races y transportados por los vasos leosos hacia el parnquima cloroflico de la hoja. En los nitratos el nitrgeno se encuentra en una forma muy oxidada, mientras que en los compuestos orgnicos se encuentra en forma reducida. La reduccin es realizada por el NADPH y la energa necesaria para el proceso es aportada por el ATP. Ambos productos, como ya sabemos, se obtienen en grandes cantidades en la fase luminosa de la fotosnte sis. Esta es la razn por la que la reduccin del nitrgeno y su incorporacin en las sustancias orgnicas se realiza en los cloroplastos, y no porque el proceso necesite de una manera directa la luz.
Nota: Para ello, los nitratos son primero reducidos a nitritos y estos a in amonio. El in amonio es integrado en una cadena carbonada para formar el aminocido glutmico. Es este aminocido el que servir posteriormente para donar el nitrgeno a aquellas molculas orgnicas que lo precisen.

Por ltimo, indicar que el azufre es absorbido por las races en forma de sulfatos (SO4 -2 ) u otras sales y, una vez reducido, es incorporado en otras sustancias orgnicas de una manera similar a la que hemos visto con el nitrgeno.

FACTORES QUE INFLUYEN EN LA FOTOSNTESIS El rendimiento de la fotosntesis puede ser medido fcilmente por la cantidad de CO2 absorbido por la planta. En l influyen: La Intensidad y longitud de onda de la luz. Ya sabemos que los carotenos y las clorofilas de los fotosistemas absorben fotones de una determinada longitud de onda. Por lo tanto, si se ilumina una planta con luz de longitud de onda inadecuada o con una intensidad insuficiente, la fotosntesis no podr realizarse y la planta no se desarrollar. Temperatura. La fotosntesis, como todo proceso qumico, est influenciada por la temperatura, ya que por cada 10 o C de aumento de temperatura, la velocidad se duplica. Ahora bien, un aumento excesivo de la temperatura desnaturalizar las enzimas que catalizan el proceso y se producir un descenso del rendimiento fotosinttico.

Tasa de consumo de CO2

Intensidad de la luz en u.a.

Fig. 24 Variacin en el rendimiento de la fotosntesis con la intensidad de la luz.

Concentracin de CO2 . Si el resto de los factores se mantiene constante, un aumento en la cantidad de CO2 existente aumentar el rendimiento de la fotosn tesis hasta llegar a un valor mximo por encima del cual se estabilizar.

J. L. Snchez Guilln

Pgina II-5a-12

II) La clula

5a) Fotosntesis

Tasa de consumo de CO2

Concentracin de O2 . Un aumento en la concentracin de O2 inhibe la fotosntesis, ya que el oxgeno inhibe la enzima que incorpora el CO2 a la Ribulosa-1-5-difosfato (RuBP).

Temperatura de desnaturalizacin

Temperatura en C

Fig. 25 Variacin en el rendimiento de la fotosntesis con la temperatura.

J. L. Snchez Guilln

Pgina II-5a-13

II) La clula

5a) Fotosntesis

REPRESENTACIN SIMPLIFICADA DE LOS PROCESOS QUE SE DAN EN EL CLOROPLASTO

Fase luminosa

Fase oscura

LA FASE OSCURA
6 6 6 12 NADPH 12 ATP
PGA

RuBP

6 ADP

6 ATP 12 NADP+ 12 ADP 12


PGAL

10

6
RuP

+ 6 H2 O

J. L. Snchez Guilln

Pgina II-5a-14

II) La clula

5a) Fotosntesis

5A-2) QUIMIOS NTESIS


LA QUIMIOSNTESIS COMO OTRA FORMA DE NUTRICIN AUTTROFA La quimiosntesis es tambin una forma de nutricin auttrofa en la que, a diferencia de la fotosntesis, la energa y los electrones (ATP y NADPH) necesarios para los procesos de anabolismo van a proceder de la oxidacin de sustancias inorgnicas. Se trata de una forma de nutricin tpicamente bacteriana. En la que las diferentes especies se han especializado en la oxidacin de distintos substratos. Segn el substrato oxidado tendremos: a) Bacterias nitrosificantes. Como las del gnero nitrosomonas que obtienen energa en forma de ATP y coenzimas reducidas por medio de la oxidacin de sales amoniacales (NH4 + ) presentes en los excrementos y en la materia orgnica en descomposicin. b) Bacterias nitrificantes. Como las del gnero nitrobacter que oxidan los nitritos (NO2 -) a nitratos (NO3 _). Entre las bacterias nitrosificantes y las nitrifi cantes, el nitrgeno incorporado en los compuestos orgnicos es transformado de nuevo en nitrgeno contenido en compuestos inorgnicos que van a parar a los suelos o las aguas. De aqu podr ser absorbido nuevamente por las plantas, cerrndose as el ciclo del nitrgeno en la naturaleza.
Compuestos inorgnicos

NH4+

H2S

FeCO3

Bacterias

ATP y NADPH

Compuestos orgnicos

Fig. 26 Esquema simplificado de la quimiosntesis.

c) Bacterias del azufre incoloras. Estas bacterias oxidan los sulfuros a azufre y el azufre a sulfitos o a sulfatos. d) Bacterias del hierro. Oxidan los compuestos ferrosos a frricos. Estos dos ltimos tipos de bacterias medran, sobre todo, en los yacimientos de azufre y hierro de origen volcnico y en particular en los llamados humeros negros. Es de destacar, que las bacterias quimiosintticas son los nicos seres vivos no dependientes, ni directa ni indirectamente, de la luz solar.

J. L. Snchez Guilln

Pgina II-5a-15

II) La clula

5b) Respiracin celular

5B) OBTENCIN DE ENERGA A PARTIR DE COMPUESTOS ORGNICOS EN LAS CLULAS VEGETALES Y ANIMALES (CATABOLISMO DE LA GLUCOSA)
V AS DEL CATABOLISMO

Glucosa

Los organismos auttrofos fijan la energa solar en forma de energa qumica contenida en los compuestos orgnicos, glucosa, en particular. Esta energa, convenientemente liberada, ser utilizada posteriormente por las partes de la planta que no tienen cloroplastos, como suele ser el caso de las races y tallos no verdes, o por toda la planta cuando falta la energa solar. Es tambin esta energa la que permite la vida de los organismos hetertrofos. La respiracin celular y las fermentaciones son las vas catablicas ms corrientes para la obtencin de la energa contenida en las sustancias orgnicas. Ambas vas, no obstante, tienen una primera fase comn: la glucolisis.

Glucolisis

O2 Pirvico

Respiracin

Fermentacin

CO2 y H2 O

Etanol - Lctico

Fig. 1 Principales vas para el catabolismo de la glucosa.

GLUCOLISIS1
La definiremos como el conjunto de reacciones que degradan la glucosa (C6 ) transformndola en dos mol culas de cido pirvico (PYR) (C3 ). Estas reacciones se realiza en el hialoplasma de la clula. Es un proceso anaerobio, que no necesita oxge no, y en el que por cada mol cula de glucosa (GLU) se obtienen 2 ATP y 2 NADH+ H+ . Consta de las siguientes reacciones: 10 Fosforilacin de la glucosa (GLU) por el ATP, formndose glucosa-6-fosfato (G-6P). 20 La glucosa-6-fosfato (G-6-P) se isomeriza2 a fructosa-6-fosfato (F-6-P). 30 Nueva fosforilacin por el ATP de la fructosa-6-fosfato (F-6-P) que pasa a fructosa 1,6-difosfato (F-1,6-P). 40 Rotura de la molcula de F-1,6-P en dos mol culas: el aldeh do-3-fosfoglicrico (PGAL) y la dihidroxiacetona fosfato (DHA). Ambas sustancias son ismeras y se transforman espontneamente una en otra (el equilibrio se alcanza cuando hay un 95% de DHA y un 5% PGAL).
1

Fig. 2 Ecuacin global de la glucolisis

Lo que viene a continuacin, se expone a los efectos de que los alumnos puedan interpretar los esquemas y extraer las consecuencias que se derivan de ellos. No parece conveniente que el alumno deba saberlo de memoria.
2

Isomerizacin: transformacin de un compuesto qumico-orgnico en otro que sea su ismero.

J. L. Snchez Guilln

Pgina II-5b-1

II) La clula

5b) Respiracin celular

Es de destacar que, hasta ahora, no slo no se ha producido energa, sino que, incluso, se han consumido dos mol culas de ATP. 50 El aldehdo-3-fosfoglic rico (PGAL) se oxida por el NAD+ ; al mismo tiempo se produce una fosforilacin en la que interviene el fosfato inorgnico3 (H-P), formndose cido 1,3-difosfoglic rico (1,3-DPGA). Cada mol cula de glucosa (GLU) dar dos molculas de 1,3-DPGA y dos de NADH+H + . 60Fosforilacin del ADP por el 1,3-DPGA, formndose ATP y cido 3-fosfoglicrico (3-PGA). Es el primer ATP formado; dos, si tenemos en cuenta la rotura de la cadena carbonada de la glucosa en dos cadenas de tres tomos de carbono. Hasta este momento el balance energ tico es nulo: dos ATP consumidos, dos obtenidos. 70 El cido 3-fosfoglicrico (3-PGA) se transforma en cido pirvico (PYR), sinteti zndose una nueva molcula de ATP (dos por cada mol cula de glucosa).
CARACTERSTICAS Y SIGNIFICADO BIOLGICO DE LA GLUCOLISIS

- Se realiza tanto en procariotas como en eucariotas. - En los eucariotas se realiza en el hialoplasma. - Se trata de una degradacin parcial de la glucosa. - Es un proceso anaerobio que permite la obtencin de energa a partir de los compuestos orgnicos en ausencia de oxgeno. - La cantidad de energa obtenida por mol de glucosa es escasa (2 ATP). - La glucolisis fue, probablemente, uno de los primeros mecanismos para la obtencin de energa a partir de sustancias orgnicas en la primitiva atmsfera sin oxgeno de la Tierra.
CH2OH H H OH OH H OH O H H H H OH OH H OH H OH HO CH2O - P O H P - O - CH2 O CH2OH

OH

OH

OH

Glucosa (GLU)
O P - O - CH2 CH2 O - P

Glucosa 6 fosfato (G6P)

Fructosa 6 fosfato (F6P)

CHO
H H OH HO

CH2OH C=O CH2O P Dihidroxiacetona fosfato (DHA)

H C-OH CH2O P Aldehido 3 fosfoglicrico (PGAL)

Fructosa 1, 6 difosfato (F1,6P)

OH

COO- P H C-O-H CH2O P

COOH H C-O-H CH2O P cido 3 fosfoglicrico (3PGA)

COOH C=O CH3 cido Pirvico (PYR)

cido 1,3 difosfoglicrico (1,3DPGA)

Fig. 3 Compuestos intermediarios de la glucolisis.

GLUCOLISIS
3

Es de los pocos casos en los que la fosforilacin se produce por el fosfato inorgnico y no por el ATP.

J. L. Snchez Guilln

Pgina II-5b-2

II) La clula
P O- CH2 H OH O H OH H H OH

5b) Respiracin celular

CH 2OH H OH O H OH H H OH H OH

ATP

ADP

H OH

GLU

G-6-P

CH2 -O-P H H OH

O
CH2 O- P OH OH

ADP

ATP

CH 2O- P H H

O
CH OH 2 OH OH

H OH H

F-1,6-P

F-6-P

CHO H- C - OH CH - O - P
2

NAD +

NADH

O C -O- P H - C - OH CH2 - O - P

PGAL

H-P

1,3-DPGA

CH2OH C=O CH - O - P
2

X2

ADP

DHA

ATP ATP ADP

O C-OH C=O CH 3 PYR

O C - OH H - C - OH CH2 - O - P

3-PGA

J. L. Snchez Guilln

Pgina II-5b-3

II) La clula

5b) Respiracin celular

GLUCOLISIS

CH2O-H H H OH OH H OH O H

ATP
H

CH2O - P O H H OH OH H OH

CH2O - P H H H OH OH H OH H H OH HO O H P - O - CH2 O CH2OH

ADP
H OH H OH

OH

OH

Glucosa

Glucosa-6-P

Glucosa-6-P

Fructosa-6-P

1) Fosforilacin de la glucosa (GLU) por el ATP, for- 2) La glucosa-6-fosfato (G-6-P) se isomeriza a frucmndose glucosa-6-fosfato (G-6-P). tosa-6-fosfato (F-6-P).
CH2 OH C=O
ATP
O P - O - CH2 CH2OH OH H HO P - O - CH2 O CH2O -P OH

O P - O - CH2 CH2O -P OH HO

CH2O - P
Dihidroxiacetonafosfato

H H

H H
HO HO

OH

ADP

OH

OH

CHO H C-OH

Fructosa-6-P

Fructosa-1,6-P

Fructosa-1,6-P

CH2O - P
Aldehido 3 fosfoglicrico

3) Nueva fosforilacin por el ATP de la fructosa-6- 4) La fructosa 1,6 difosfato se rompe para dar lugar fosfato (F-6-P) que pasa a fructosa 1,6-difosfato (F- al aldehdo 3 fosfoglicrico y la dihidroxiacetona1,6-P). fosfato.
NAD+ ADP Pi

CHO H C-OH CH2O - P


Aldehido 3 fosfoglicrico

COO- P H C-OH CH2O - P


cido 1,3-difosfoglicrico

COO- P H C-OH CH2O - P


cido 1,3-difosfoglicrico

COOH H C-OH CH2O - P


ATP
cido -3-fosfoglicrico

NADH+H+

5) El aldehdo 3 fosfoglicrico se oxida por el NAD+ y 6) El cido1,3 difosfoglicrico reacciona con el ADP se fosforila por el cido fosfrico para dar el cido1,3 para dar ATP y cido 3-fosfoglicrico. difosfoglicrico.
ADP

COOH H C-OH CH2O - P


cido -3-fosfoglicrico

COOH C=O CH3


ATP
cido pirvico

7) El cido3 fosfoglicrico reacciona con el ADP para dar ATP y cido pirvico.

J. L. Snchez Guilln

Pgina II-5b-4

II) La clula

5b) Respiracin celular

V AS DEL CATABOLISMO DEL PIRVICO

Para evitar que la glucolisis se detenga por un exceso de cido pirvico (PYR) y NADH+H + o por falta de NAD + , se necesitan otras vas que eliminen los productos obtenidos y recuperen los substratos imprescindibles. Esto va a poder realizarse de dos maneras: 10) Respiracin aerobia (catabolismo aerobio). Cuando hay ox geno, el pirvico es degradado completamente obtenindose dixido de carbono (CO2 ). El NADH+H + y otras coenzimas reductoras obtenidas son oxidadas y los electrones transportados hacia el oxgeno (O2 ), recuperndose el NAD+ y obtenindose H2 O. Este proceso se realiza en los eucariotas en las mitocondrias. 20) Fermentacin (Catabolismo anaerbico). Cuando no hay oxgeno el cido pirvico se transforma de diferentes maneras sin degradarse por completo a CO2 y H2 O. Este proceso tiene como objetivo la recuperacin del NAD+ . En los eucariotas se realiza en el hialoplasma.

Fig. 4 Esquema de una clula vista al microscopio ptico. 1) mitocondria; 2) ncleo; 3) citoplasma; 4 vacuola.

5 1-2-3 4

EL CATABOLISMO AERBICO (RESPIRACIN AEROBIA)


MITOCONDRIAS Aspecto: Son orgnulos muy pequeos, difci les de observar al microscopio ptico, al que aparecen como palitos o bastoncitos alargados. Son orgnulos permanentes de la clula y se forman a partir de otras mitocondrias preexistentes. Forma y nmero: El nmero de mitocondrias en una clula puede llegar a ser muy elevado (hasta 2000). Normalmente suelen tener forma elpti ca, aunque tambin pueden ser filamentosas u ovoides. Sus dimensiones son muy pequeas (1 a 7 m de longitud por 0.5 m de dimetro). Su forma y tamao dependen mucho de las condiciones fisiolgicas de la clula.

Fig. 5 Mitocondria vista al microscopio electrnico. 1-2-3) membrana externa, espacio intermembrana y membrana interna; 4) creta; 5) matriz.

Fig. 6 Esquema de la ultraestructura de una clula animal: 1) nuclolo; 2) mitocondria; 3) retculo endoplasmtico granular; 4) aparato de Golgi; 5) ncleo/cromatina; 6) poro de la envoltura nuclear; 7) membrana plasmtica.

J. L. Snchez Guilln

Pgina II-5b-5

II) La clula

5b) Respiracin celular

Ultraestructura. Es muy similar en todas las mitocondrias, independientemente de su forma o tamao. Generalmente se observa la presencia de una membrana externa y una membrana interna, ambas similares a las dems membranas de la clula. La membrana interna se prolonga hacia el interior en una especie de lminas llamadas crestas mitocondriales. Entre ambas membranas hay un espacio llamado espacio intermembrana (de unos 100 ). Dentro de la mitocondria, entre las crestas, est la matriz mitocondrial. Las prote nas de la membrana interna y las de las crestas son muy importantes, ya que algunas son las responsables de los procesos respiratorios. El interior de la matriz mitocondrial es una solucin de prote nas, lpi dos, ARN, ADN y ribosomas (mitorribosomas). Es de destacar que el ADN mitocondrial es similar al ADN de los procariotas. Esto es, est formado por una doble cadena de ADN circular asociada a protenas diferentes de las que se encuentran en los eucariotas. Origen evolutivo: Las mitocondrias, igual que los plastos, tienen una estructura similar a los organismos procariticos. Segn la " Teora endosimbintica" seran organismos procariotas que han establecido una simbiosis con las clulas eucariticas a las que proporcionaran energa a partir de sustancias orgnicas.

Fig. 7 Ultraestructura de la mitocondria. 1) Membrana externa, 2) Espacio intermembrana. 3) Membrana interna. 4) Crestas. 5) Matriz. 6) ADN.

Glcidos Lpidos Otros C.O.

O2

Respiracin

ATP

CO2 y H2 O

Fig. 8 Esquema general de la respiracin celular.

DESCARBOXILACIN OXIDATIVA DEL CIDO PIRVICO

En condiciones aerbicas el cido pirvico (PYR) obtenido en la glucolisis y en otros procesos catablicos atraviesa la membrana de la mitocondria y en la matriz mitocondrial va a sufrir un proceso qumico que tiene dos vertientes: 10Descarboxilacin. El cido pirvico (PYR) va a perder el grupo CO2 correspondiente al primer carbono, el carbono que tiene la funcin cido.
Fig. 10 Descarboxilacin oxidativa del pirvico.

J. L. Snchez Guilln

Pgina II-5b-6

II) La clula

5b) Respiracin celular

20Oxidacin. Al perderse el primer carbono, el segundo pasa de tener un grupo cetona a tener un grupo aldeh do. Este grupo se oxidar a grupo cido (cido actico) por accin del NAD+ . En el proceso interviene una sustancia, la coenzima-A (HS-CoA) que se unir al cido actico para dar acetil-coenzima A (ACA).
NADH

CO2 COOH C=O CH3


cido pirvico

NAD+

H C=O CH3

O C-OH CH3
cido actico

CoA-SH

O C S-CoA CH3
Acetil CoA

acetaldehdo

Fig. 11 La descarboxilacin oxidativa del cido pirvico (mecanismo).

Como vemos, se van a formar 2 nuevas molculas de NADH+H + por cada molcula de glucosa (GLU) y, al mismo tiempo, se originan las primeras 2 molculas de CO2 .

EL CICLO DEL CITRATO (CTRICO) O CICLO DE KREBS Krebs (1938), denomin ciclo del cido ctrico, y hoy se conoce tambin como ciclo de Krebs, a la ruta metablica a travs de la cual el cido actico unido a la coenzima-A va a completar su oxidacin en la matriz mitocondrial.

Este ciclo, no slo va a ser la ltima etapa de la degradacin de los azucares, otros compuestos orgnicos (los cidos grasos y determinados aminocidos) van a ser tambin degradados a acetil-CoA (ACA) e integrados en el ciclo de Krebs. El ciclo de Krebs es, por lo tanto, la va fundamental para la degradacin de la mayora de los compuestos orgnicos y para la obtencin coenzimas reductoras. Es la va ms importante para el catabolismo de las sustancias orgnicas.

Fig. 12 Hans Krebs (Hildesheim Alemania -1900-1981).

INCORPORACIN DE OTRAS SUSTANCIAS AL CICLO DE KREBS

Al ciclo de Krebs van a incorporarse, adems de las sustancias resultantes del catabolismo de los glcidos, otras que provienen del catabolismo de otras las sustancias orgnicas. As, por ejemplo, los cidos grasos se degradan en las mitocondrias transformndose en acetilCoA. Este proceso se realiza en la matriz mitocondrial y recibe el nombre de -oxidacin.

J. L. Snchez Guilln

Pgina II-5b-7

II) La clula

5b) Respiracin celular

Polisacridos Glucosa Pirvico

Monosacridos

Protenas

Aminocidos Aminocidos

Glicerina cidos grasos

Lpidos

Acetil-CoA

Ciclo De Krebs

CO2
Fig. 14 Vas metablicas que desembocan en el ciclo de Krebs.

MECANISMO DEL CICLO DE KREBS4

El ciclo de Krebs, como todo proceso ccli co, no tiene ms principio o fin que el que nosotros queramos ponerle. Es alimentado continuamente en substratos y continuamente genera productos. Las sustancias intermediarias se recuperan para ser de nuevo integradas en l. Como una rueda girando sin fin, slo se detendr si faltan los substratos o si, por exceso de productos, se inhiben las enzimas que participan en l. Las diferentes reacciones que se producen en este proceso son: 10 Condensacin de la acetil-CoA (ACA) con el cido oxalactico (OXA ) para formar el cido ctrico (CIT). En este proceso se recupera la CoA-SH. 20 Transformacin del cido ctrico (CIT) en su ismero, el cido isoc trico (ISO). 30 Descarboxilacin oxidativa del cido isoc trico (ISO) que se transforma en cetoglutrico (-KG) con la formacin de CO2 y NADH+H + . 40 Descarboxilacin oxidativa del cido -cetoglutrico (-KG) formndose CO2 , NADH+H + y 1 GTP (ATP). El -cetoglutrico (-KG) se transforma en cido succnico (SUC).
4

Lo que viene a continuacin, se expone a los efectos de que los alumnos puedan interpretar los esquemas y extraer las consecuencias que se derivan de ellos. No parece conveniente que el alumno deba saberlo de memoria.

J. L. Snchez Guilln

Pgina II-5b-8

II) La clula

5b) Respiracin celular

Vemos que en estos momentos ya se ha completado la degradacin del CH3 -CO-CoA (ACA) con la formacin de 2 molculas de CO2 , cuatro por cada molcula de glucosa. Tenemos ya las 6 molculas de CO2 que puede originar la glucosa. Las reacciones que vienen a continuacin van a servir para recuperar el cido oxalactico (OXA ). 50 Oxidacin del cido succnico (SUC) a cido fumrico (FUM). Esta oxidacin se realiza por la formacin de un doble enlace. Los electrones son transferidos al FAD que pasa a FADH2 . 60 Adicin de agua al doble enlace formndose el cido mlico (MAL). 70 Oxidacin por el NAD+ del alcohol del cido mlico, que se transforma en el cido oxalactico (OXA ), completndose el ciclo. Como podemos ver, la cantidad de ATP obtenida en la Glucolisis y en el Ciclo de Krebs es ms bien escasa. Por el contrario, se van a obtener grandes cantidades de coenzimas reducidas: NADH+H + y FADH2 que sern oxidadas en la cadena respiratoria.

O C-S-CoA CH3 Acetil-Co-A

CH2 - COOH HO C - COOH CH2 - COOH cido ctrico

HO - CH - COOH H C - COOH CH2 - COOH cido isoctrico

O = C - COOH H C - H CH2 - COOH

CH2 - COOH CH2 - COOH

CH - COOH CH - COOH

cido cetoglutrico

cido succnico

cido fumrico

HO - CH - COOH CH2 - COOH

O = CH - COOH CH2 - COOH

cido mlico

cido oxalactico

Fig. 15 Compuestos intermediarios del ciclo de Krebs.

J. L. Snchez Guilln

Pgina II-5b-9

II) La clula

5b) Respiracin celular

EL CICLO DE KREBS O DEL CTRICO

J. L. Snchez Guilln

Pgina II-5b-10

II) La clula

5b) Respiracin celular

DESCRIPCIN DEL CICLO DE KREBS O DEL CTRICO

ACA

CH3 -C-S-CoA O = C - COOH CH2 - COOH


OXA CoA-SH CoA-SH

CH2 - COOH
CH2 - COOH HO C - COOH CH2 - COOH
CIT

HO- CH - COOH H C - COOH CH2 - COOH


ISO

HO C - COOH CH2 - COOH


CIT

1) Condensacin de la acetil-CoA (ACA) con el cido 2) Transformacin del cido ctrico (CIT) en su oxalactico (OXA) para formar el cido ctrico (CIT). ismero, el cido isoctrico (ISO). En este proceso se recupera la CoA-SH.
NAD+ NAD+
NAD+ NAD+ GDP GDP

HO- CH - COOH H C - COOH CH2 - COOH


ISO

O= C - COOH HC-H
NADH NADH CO CO22

O= C - COOH HC-H CH2 - COOH


KG

COOH CH2 CH2 - COOH


SUC

CH2 - COOH
KG

NADH NADH

CO CO22

GTP GTP

3) Descarboxilacin oxidativa del cido isoctrico 4) Descarboxilacin oxidativa del cido (ISO) que se transforma en -cetoglutrico (-KG) cetoglutrico (-KG) formndose CO2, NADH+H + y 1 con la formacin de CO2 y NADH. GTP (ATP). El -cetoglutrico (-KG) se transforma en cido succnico (SUC).
FAD FAD H O H22O

COOH CH2 CH2 - COOH


SUC

COOH CH CH - COOH
FADH FADH22
FUM

COOH CH CH - COOH
FUM

COOH H-C-OH CH2 - COOH


MAL

5) Oxidacin del cido succnico (SUC) a cido 6) Adicin de agua al doble enlace formndose el cido fumrico (FUM). Esta oxidacin se realiza por la mlico (MAL). formacin de un doble enlace. Los electrones son transferidos al FAD que pasa a FADH2.
NAD+ NAD+

COOH H-C-OH CH2 - COOH


MAL

COOH C=O
NADH NADH

CH2 - COOH
OXA

7) Oxidacin por el NAD+ del alcohol del cido mlico, que se transforma en el cido oxalactico (OXA), completndose el ciclo.

J. L. Snchez Guilln

Pgina II-5b-11

II) La clula

5b) Respiracin celular

LA FOSFORILACIN OXIDATIVA (CADENA RESPIRATORIA).CONCEPTO Y OBJETIVOS Concepto: Consiste en un transporte de electrones desde las coenzimas reducidas, NADH+H + o FADH2 , hasta el oxgeno. Este transporte se realiza en la membrana de las crestas mitocondriales. Objetivos: Es en este proceso donde se obtendr la mayor parte de la energa contenida en la glucosa y otros compuestos orgnicos, que ser almacenada en forma de ATP. Al mismo tiempo se recuperarn las coenzimas transportadoras de electrones en su forma oxidada, lo que permitir la oxidacin de nuevas molculas de glucosa y de otras sustancias orgnicas. Como producto de desecho se obtendr agua.
GTP GDP

Acetil-CoA

3 NAD+ Ciclo de Krebs o del ctrico 3 NADH

2 CO2

FADH2

FAD

Fig. 16 Balance del ciclo de Krebs.

ESTRUCTURA DE LA MEMBRANA DE LAS CRESTAS MITOCONDRIALES

Las crestas mitocondriales tienen la estructura de toda membrana biolgica. Empotradas en la doble capa lipdica se encuentran diferentes sustancias transportadoras de electrones formando la cadena respiratoria. Estas estn asociadas formando cuatro grandes complejos: - Complejo I (NADH deshidrogenasa) - Complejo II (Succinato deshidrogenasa) - Complejo III (Citocromo bc1) - Complejo IV (Citocromo c oxidasa) Existen, adems, otros transportadores: la coenzima Q (Co-Q) o ubiquinona (UQ), el citocromo c (cit c) y la enzima ATP sintetasa.

Matriz mitocondrial

UQ

IV

Espacio intermembrana
Fig. 17 Componentes de la membrana de las crestas mitocondriales.

J. L. Snchez Guilln

ATPasa
Pgina II-5b-12

II

II) La clula

5b) Respiracin celular

LA FOSFORILACIN OXIDATIVA (CADENA RESPIRATORIA): MECANISMO

En la membrana de las crestas mitocondriales se va a realizar un transporte de electrones desde el NADH o el FADH2 hasta el oxgeno, tal y como se indica en la figura. Este transporte de electrones va a generar un transporte de protones por parte de los complejos I, II y III desde la matriz hacia el espacio intermembrana. Cada complejo ser capaz de bombear dos protones. La salida de estos protones a travs de las ATPasas servir para sintetizar ATP, 1 ATP por cada dos protones, de forma similar a como suceda en los cloroplastos. El NADH es capaz de reducir al Complejo I por lo que se obtendrn 3ATP por cada molcula de NADH. El FADH2 no puede reducir al Complejo I y cede sus dos electrones al Complejo II que los pasa a la Ubiquinona (UQ). Esta es la razn por la que el FADH2 slo genera 2 ATP.
H 2O
Matriz mitocondrial

3ATP

6H+
NAD+ NADH+H+ II

1/2O2

3ADP

UQ

IV

6H+
Espacio intermembrana

Fig. 18 Esquema general de la fosforilacin oxidativa en la cadena respiratoria. Oxidacin del NADH y sntesis de ATP. UQ (Ubiquinona) y Cit-c (citocromo C).

Los electrones sern cedidos finalmente al oxgeno que junto con dos protones del medio darn una molcula de H2 O 2H + + 1/2O 2 + 2e- ---- H2 O

Qu sucede con el NADH de origen hialoplasmtico en los eucariotas?


NADH

ATPasa
NAD+
2e2e-

Hemos visto que cada NADH que se origina en las mitocondrias rinde 3 ATP. Pero, en los eucariotas, el NADH que se origina en el hialoplasma, en la glucolisis, slo puede originar 2 ATP. Esto es debido a que este NADH no puede atravesar la membrana mitocondrial y debe ceder sus electrones a una sustancia intermediaria que a su vez los cede al FAD que hay en el interior de la mitocondria, lo que no sucede en los procariotas.

Hialoplasma

Interior mitocondrial

FAD

FADH2

Fig. 19 El NADH que se origina en el hialoplasma cede los electrones a una sustancia que los cede a su vez al FAD que hay en el interior de la mitocondria. Esta es la razn por la que este NADH slo rinde 2 ATP.

J. L. Snchez Guilln

Pgina II-5b-13

II) La clula

5b) Respiracin celular

LAS FERMENTACIONES ANAERBICAS


La oxidacin del NADH+H + y del FADH2 en la cadena respiratoria tiene como aceptor final de los electrones al oxgeno. De esta manera, el NAD + se recupera y la glucolisis y el ciclo de Krebs pueden mantenerse. Si no hay oxgeno, el NADH+H + y el FADH2 se acumulan y los procesos de obtencin de energa se interrumpen. En estas condiciones, condiciones anaerobias o de falta de oxgeno, ciertos microorganismos y, por ejemplo, nuestras clulas musculares, recuperan las coenzimas oxidadas por diversas vas metablicas conocidas bajo el nombre de fermentaciones anaerbicas. Es ms, para algunos microorganismos, los anaerobios estrictos, las fermentaciones son su nica fuente de energa. Se les llama anaerobios estrictos porque no pueden vivir en un medio que contenga oxgeno ya que ste les es letal. Otros, los anaerobios facultativos, utilizan estas vas como mecanismo de emergencia durante los perodos en los que no disponen de oxgeno. En las fermentaciones, la glucosa no se degrada totalmente a CO2 y H2 O, sino que se produce una degradacin incompleta de la cadena carbonada. Segn el producto obtenido, tendremos las siguientes fermentaciones: a) Fermentacin lctica. b) Fermentacin alcohlica.

A) FERMENTACIN LCTICA La realizan las bacterias del yogur y, por ejemplo, las clulas musculares, cuando no reciben un aporte suficiente de oxgeno, lo que sucede cuando se lleva a cabo un ejercicio fsico intenso. En la fermentacin lctica, el cido pirvico es reducido a cido lctico por medio del NADH+H + . De esta manera el NAD + se recupera y pueden ser degradadas nuevas molculas de glucosa. Nuestras clulas musculares emplean la fermentacin lctica cuando alcanzamos el 90% de la FCM (frecuencia cardiaca mxima). Si este cido lctico no se elimina se puede acumular produciendo fatiga muscular.
Fig. 20 Lactobacillus.

cido pirvico

cido lctico

Fig. 21 Fermentacin lctica.

J. L. Snchez Guilln

Pgina II-5b-14

II) La clula

5b) Respiracin celular

B) FERMENTACIN ALCOHLICA En la fermentacin alcohlica el cido pirvico es transformado en alcohol etlico o etanol. Esta fermentacin la realizan, por ejemplo, las levaduras del gnero Saccharomyces. Se trata de un proceso de gran importancia industrial que, dependiendo del tipo de levadura, dar lugar a una gran variedad de bebidas alcohlicas: cerveza, vino, sidra, etc. En la Fig. 22 Levaduras. fabricacin del pan se le aade a la masa una cierta cantidad de levadura, la fermentacin del almidn de la harina har que CO2 el pan sea ms esponjoso por las burbujas de CO2 . En este ltimo caso el alcohol producido desaparece durante el proceso de coccin. La fermentacin cido pirvico etanal Alcohol etlico alcohlica tiene el mismo objetivo que la fermentacin lctica: la recuperacin del NAD + en condiciones anaerbicas. Fig. 23 Mecanismo de la fermentacin alcohlica. En la fermentacin alcohlica el ac. pirvico se descarboxila trasformndose en acetaldeh do y este es reducido por el NADH a alcohol etlico.

ECUACIONES GLOBALES DE LAS DIFERENTES VAS DE DEGRADACIN DE LA GLUCOSA y RENDIMIENTO ENERGTICO EN MOLES DE ATP POR MOL DE GLUCOSA a) Respiracin oxidativa C6H12O6 + 6O2 6CO2 + 6H2O (36 ATP)

b) Fermentacin lctica C6H12O6 2 C3H6O3 (2 ATP)

c) Fermentacin alcohlica C6H12O6 2 C2H5OH + 2CO2 (2 ATP)

J. L. Snchez Guilln

Pgina II-5b-15

II) La clula

5b) Respiracin celular

ESQUEMA SIMPLIFICADO DE LA RESPIRACIN CELULAR

O2 mitocondria Acetil-CoA H2O

Hialoplasma

Pirvico

H+ e-

NADH NAD

Ciclo de Krebs

Glucolisis

ADP+P ATP

Glucosa

ATP

ADP+P CO2

Reacciones endergnicas

ESQUEMA GENERAL DE LA GLUCOLISIS Y DE LAS FERMENTACIONES

Glucosa
Glucolisis 2 cido lctico

CH2OH CH3
2 Etanol

2NAD+
F. lctica 2ATP

2NAD+
F. alcohlica

2NADH+H+

2NADH+H+

2 CO2
2 cido pirvico

2 Etanal

J. L. Snchez Guilln

Pgina II-5b-16

II) La clula

5b) Respiracin celular

BALANCE DE LOS PROCESOS DE LA RESPIRACIN CELULAR EN EUCARIOTAS Sustancia inicial Sustancia final Coenzimas Reducidas y ATP 2 NADH 2 ATP Moles de ATP (totales)

Proceso

Glucolisis

Glucosa

2 cid. pirvico

4 ATP * 2 ATP

Descarboxilacin 2 cid. del cido pirvico pirvico

2 acetil-Co A 2 CO2

2 NADH

6 ATP

Ciclo de Krebs

2 acetil-Co A

4 CO2

6 NADH 2 FADH2 2 GTP

18 ATP 4 ATP 2 ATP 36 ATP**

Balance global

Glucosa 6 O2

6 CO2 6 H2O

* 6 ATP en procariotas * * 38 ATP en procariotas

J. L. Snchez Guilln

Pgina II-5b-17

III) La informacin celular

1) El ncleo celular

III INFORMACIN CELULAR

POR QU ES NECESARIA LA INFORMACIN CELULAR? En toda clula, tanto procariota como eucariota, se dan complejos procesos metablicos y fisiolgicos con la finalidad de obtener materiales y energa. Para Regulacin de la expresin gnica asegurar estos procesos la clula necesita una gran variedad de protenas, enzimas, particularmente. Se calcula que nuestras clulas precisan a lo largo de su ciclo vital Informacin celular unas 30.000 protenas diferentes. Cada una de estas protenas consta, por trmino expresin medio, de unos 500 aminocidos que deben de estar unidos en su orden correcto. Un slo cambio puede alterar el centro activo Sntesis de de la molcula y hacer que la enzima, si la protenas protena en cuestin es una enzima, no pueda realizar su funcin. Si multiplicamos 30.000 protenas por 500 aminocidos cada una nos da un total de 15x10 6 . sta es la Fig. 1 La informacin celular. informacin necesaria, como mnimo, para poder sintetizar todas las protenas celulares. Si codificsemos esta informacin con un slo carcter y la escribisemos en una hoja de papel, a 60 caracteres por lnea y 50 lneas por pgina (3000 caracteres en total por pgina), necesitaramos un total de 5000 pginas para codificar toda esta informacin. Adems, la clula no slo requiere protenas sino que tambin necesita regular y controlar los procesos que se dan en ella. Toda esta gran cantidad de informacin se encuentra en el ncleo de las clulas eucariotas y en el genoma o cromosoma de las clulas procariotas. Dnde est codificada esta informacin, cmo est codificada, cmo se transcribe, cmo se traduce, cmo pasa de unas clulas a otras en el proceso de divisin celular y de unos organismos a otros en los procesos de reproduccin y las consecuencias de las alteraciones que se producen en ella (mutaciones) es lo que estudiaremos a continuacin.

J. L. Snchez Guilln

Pgina III-1-1

III) La informacin celular

1) El ncleo celular

1) EL NCLEO EL NCLEO EN INTERFASE El ncleo es una estructura caracterstica de las clulas eucariticas. Fue descubierto por Robert BROWN en 1831 y contiene la informacin gentica, esto es, la informacin necesaria para que se puedan realizar las funciones celulares y, ms en concreto, la informacin para la sntesis de las protenas. FUNCIONES QUE SE DAN EN EL NCLEO CELULAR EN INTERFASE 1) La trasmisin de la informacin gentica de los ascendientes a los descendientes y de una generacin celular a la siguiente se realiza a travs del ncleo celular. Debido a esto en el ncleo es necesario que se realice la duplicacin o replicacin del ADN. 2) Los procesos de sntesis del ARN, trascripcin de la informacin gentica para la posterior sntesis de protenas en el hialoplasma, se dan tambin en el ncleo. Por ltimo, esta informacin se traducir en el citoplasma celular, pues en l se realizar la sntesis de protenas.

Fig. 2 A) ncleo en reposo (interfase) y ncleo en divisin (mitosis).

Fig. 3

Clula animal vista al M.E.T.

EL NCLEO EN INTERFASE. CARACTERSTICAS Aspecto. Generalmente se presenta como una esfera de gran tamao que se destaca del citoplasma y que est separada de l por una envoltura nuclear, que es un elemento del retculo endoplasmtico granular que rodea el material nuclear. El contenido del ncleo se revela al microscopio ptico como ms o menos homogneo, salvo por la presencia de pequeas estructuras esfricas llamadas nuclolos. Nmero. Normalmente las clulas slo tienen un ncleo. El paramecio, no obstante, tiene dos ncleos: uno mayor, el macroncleo, y otro menor, el microncleo. Las fibras musculares estriadas y los osteoclastos presentan gran cantidad de ncleos. Tambin pueden tener muchos

Fig. 4

Aspecto tpico del ncleo celular.

J. L. Snchez Guilln

Pgina III-1-2

III) La informacin celular

1) El ncleo celular

ncleos las clulas cancerosas. Forma. Si la clula es isodiamtrica -con dimensiones similares en todas las direcciones del espacio (por ejemplo: esfrica o cbica)- el ncleo, normalmente, es esfrico. En las clulas donde dominan dos dimensiones, clulas aplanadas, el ncleo suele ser discoidal. En las clulas alargadas el ncleo suele ser elptico. Ciertos tipos celulares tienen ncleos irregulares; as, por ejemplo, algunos glbulos blancos tienen un ncleo lobulado muy irregular y el stentor, organismo unicelular ciliado, tiene un ncleo de forma arrosariada. Tamao. El tamao del ncleo es bastante constante en una misma especie celular. El ncleo es muy voluminoso en las clulas indiferenciadas o en las muy activas. Si el ncleo sufre un aumento en su volumen es un indicio de que la clula est prxima a entrar en divisin. EL NCLEO EN INTERFASE. ESTRUCTURA Al MET podemos distinguir en el ncleo las siguientes estructuras: La envoltura nuclear. Constituida por dos membranas unitarias: una exterior y otra interior con un espacio entre ellas llamado espacio perinuclear. La envoltura nuclear proviene del retculo endoplasmtico granular y est conectada con l. Adosados a la membrana exterior hay ribosomas, como ocurre en el retculo endoplasmtico granular. La envoltura nuclear no es continua, pues tiene un gran nmero de poros de 500 a 700 de dimetro con una compleja estructura formada por 8 partculas esfricas de naturaleza protenica. Los poros permiten el paso de grandes molculas (ARN, protenas) e impiden diferencias osmticas entre el ncleo y el citoplasma. En el interior del ncleo y adosada a la membrana interna encontramos una estructura protenica formada por protenas fibrilares: la lmina nuclear, de un espesor de 150 a 500 . Su funcin es inducir la aparicin y desaparicin de la envoltura nuclear y resulta fundamental para la constitucin de los cromosomas a partir de la cromatina.

Fig. 5 M) macroncleo y m) microncleo, del paramecio.

Fig. 6 Ncleo en forma de u de la vorticela.

Fig. 7 Ncleo arrosariado del stentor, organismo unicelular ciliado.

ncleo

Fig. 8

Clula vista al M.E.T.

J. L. Snchez Guilln

Pgina III-1-3

III) La informacin celular

1) El ncleo celular

El nucleoplasma: Es el contenido nuclear indiferenciado. Se trata de un gel de estructura y composicin similar al hialoplasma, pero no tiene ni microt bulos ni microfilamentos. Est formado por agua, protenas, ARN e iones. En l se encuentra inmersa la cromatina y se dan los procesos de sntesis del ARN (transcripcin) y la replicacin del ADN. La cromatina. Llamada as por teirse fuertemente con ciertos colorantes, est constituida por ADN (la mayor parte del ADN celular est en la cromatina), protenas y algo de ARN. Entre las protenas se encuentran las histonas, que tienen un elevado porcentaje de aminocidos bsicos y, aparte de empaquetar el ADN, neutralizan el fuerte carcter cido de los cidos nucleicos. Al parecer, tambin controlan la actividad de los genes. Adems de las histonas, podemos encontrar en la cromatina otras protenas, como la miosina y la actina. Estas protenas son las responsables en el msculo de la contraccin muscular y en el ncleo podran estar relacionadas con la formacin del cromosoma metaf sico y con la separacin de las cromtidas en la divisin celular. La cromatina est estructurada en elementos individuales llamados cromosomas. Hay un nmero constante de cromosomas por ncleo celular, por individuo y por especie. Los cromosomas interf sicos darn lugar, cuando la clula se divida, a los metaf sicos.

nuclolo

REG

Envoltura nuclear

cromatina

Fig. 9 MET.

Fragmento de una clula visto al

Envoltura nuclear REG nuclolo

nucleoplasma cromatina

Fig. 10 Esquema de la ultraestructura del ncleo celular.

El ADN nuclear representa el genoma de las clulas eucariotas

El nuclolo. Es una estructura aproximadamente esfrica, visible incluso al microscopio ptico. Suele destacarse del resto del contenido nuclear por ser ms brillante. Su tamao es de 1 a 3m. Caracter sticas del nucl olo: Aparece con frecuencia asociado a zonas de cromatina densa, los llamados organizadores nucleolares, pues se forma a partir de ellos. Las clulas jvenes tienen por lo general uno o dos nuclolos. Algunas clulas tienen ms de dos, segn el nmero de organizadores nucleolares que tengan. Las clulas viejas tienen uno o ninguno. Su nmero, por lo tanto, depende de la edad y tambin del estado funcional de la clula. Cuando la clula se va a dividir desaparece.

J. L. Snchez Guilln

Pgina III-1-4

III) La informacin celular

1) El ncleo celular

Estructura del nucl olo: No presenta membrana de separacin con el ncleo y al MET tiene un aspecto heterogneo, grumoso, con zonas ms densa y otras menos densas. Est constituido bsicamente por ARN, protenas y ADN asociado. Funciones del nucl olo: Su funcin principal es la sntesis de ARNr (el ARN de los ribosomas) y el ensamblaje de estos mismos ribosomas. El ARN ribosomal se sintetiza en el propio nuclolo y las protenas de los ribosomas provienen del citoplasma y pasa al interior del ncleo a travs de los poros de la envoltura nuclear.

Fig. 11 Ultraestructura del nuclolo: 1) Cromatina del organizador nucleolar; 2) parte granular; 3) parte fibrosa.

J. L. Snchez Guilln

Pgina III-1-5

III) La informacin celular

2) cidos nucleicos

2) LOS CIDOS NUCLEICOS

CONCEPTO Qumicamente, los cidos nucleicos son polme ros constituidos por la unin mediante enlaces qumicos de unidades menores llamadas nucletidos. Los cidos nucleicos son compuestos de elevado peso molecular, esto es, son macromolculas.

Fig. 1

Pirimidina.

FUNCIONES GENERALES Los cidos nucleicos, llamados as porque en un principio fueron localizados en el ncleo celular, son las molculas de la herencia y por lo tanto van a participar en los mecanismos mediante los cuales la informacin gentica se almacena, replica y transcribe. sta no va a ser su nica Fig. 2 Purina. funcin. Determinados derivados de estas sustancias: los nucletidos, van a tener otras funciones biolgicas, entre las que pueden destacarse, como ejemplo, la de servir de intermediarios en las transferencias de energa en las clulas (ATP, ADP y otros) o en las transferencias de electrones (NAD+ , NADP+ , FAD, etc.).

LOS NUCLETIDOS: COMPONENTES Los nucletidos estn formados por: una base nitrogenada (BN), un azcar (A) y cido fosfrico (P); unidos en el siguiente orden: PABN
Adenina

LAS BASES NITROGENADAS Son sustancias derivadas de dos compuestos qumi cos: la purina y la pirimidina. Las que derivan de la purina son las bases pricas. En los nucletidos vamos a encontrar, normalmente, dos base pricas: la adenina (A) y la guanina (G). Las que derivan de la pirimidina se llaman pirimid nicas. Tres son las bases pirimid nicas presentes en los cidos nucleicos: la citosina (C), la timina (T) y el uracilo (U).

Guanina
Fig. 3 Bases pricas.

J. L. Snchez Guilln

Pgina III-2-1

III) La informacin celular

2) cidos nucleicos

En ciertos casos, aunque esto pasa muy raramente, pueden encontrarse en los cidos nucleicos otras bases diferentes de estas cinco, por lo general derivados metilados de ellas.

Fig. 4

Citosina.

Fig. 5

Timina.

Fig. 6

Uracilo.

EL AZCAR (GLCIDO) El azcar que interviene en los nucletidos puede ser o la ribosa (R) o la desoxirribosa (dR). Ambas son aldopentosas y las encontraremos en los nucletidos como furanosas. Conviene destacar que la nica diferencia entre ambas est en que en el carbono 2 de la desoxirribosa hay un hidrgeno (-H) en lugar del grupo alcohol (-OH). LOS NUCLESIDOS El azcar y la base nitrogenada se unen entre s como se indica en las figuras formando un nuclesido. El enlace se forma entre el carbono anomrico del azcar y uno de los nitrgenos de la base nitrogenada, en concreto, el indicado en las figuras. En la unin se forma una molcula de agua. Este enlace recibe el nombre de enlace Nglicosdico.
Desoxirribosa

Ribosa

Fig. 7

La ribosa y la desoxirribosa.

ESTRUCTURA DE LOS NUCLETIDOS Los nucletidos son los monmeros que constituyen los cidos nucleicos. Se forman cuando se unen el cido fosfrico y un nuclesido. Es una unin fosfos ter entre un OH del cido fosfrico y el OH situado en el carbono 5 del azcar, con formacin de una molcula de agua. Segn el azcar sea la

Fig. 8

Nuclesido pirimidnico.

J. L. Snchez Guilln

Pgina III-2-2

III) La informacin celular

2) cidos nucleicos

ribosa o la desoxirribosa, tendremos ribonucletidos o desoxirribonucletidos. La timina nunca forma parte de los ribonucletidos y el uracilo no forma parte de los desoxirribonucletidos.

NUCLETIDOS O DERIVADOS DE NUCLETIDOS DE INTERS BIOLGICO. Algunos nucletidos cumplen funciones por s mismos. As, por ejemplo: a) Nucletidos que intervienen en las transferencias de energa : Se trata de molculas que captan o desprenden energa al transformarse unas en otras. As, el ATP desprende energa cuando se hidroliza, transformndose en ADP y fosfato inorgnico (Pi). Por el contrario, el ADP almacena energa cuando reacciona con el fosfato inorgnico y se transforma en ATP y agua. De esta forma se transporta energa (unas 7 kilocaloras por mol de ADP/ATP) de aquellas reacciones en las que se desprende (exergnicas) a aquellas en las que se necesita (endergnicas).

Fig. 9 Nucletido. Las flechas indican los enlaces fosfoster (roja) y N-glicosdico (verde).

Ejemplos de nucletidos transportadores de energa: AMP (adenosina-5'-monofosfato) A-R-P ADP (adenosina-5'-difosfato) A-R-P-P ATP (adenosina-5'-trifosfato) A-R-P-P-P GDP (guanosidina-5'-difosfato) G-R-P-P GTP (guanosidina-5'-trifosfato) G-R-P-P-P

b) Nucletidos que intervienen en los procesos de xido-reduccin. Estas molculas captan electrones de molculas a las que oxidan y los ceden a otras molculas a las que a su vez reducen. As, el NAD + puede captar 2e - transformndose en su forma reducida, el NADH, y ste puede ceder dos electrones a otras sustancias, reducindolas y volviendo a transformarse en su forma oxidada, el NAD + . As, se transportan electrones de aquellas reacciones en las que se desprende a aquellas en las que se necesitan. Ejemplos de nucletidos transportadores de electrones: - NAD+ /NADH (Nicotinamida-adenina-dinucletido) oxidado y reducido, respectivamente. - NADP+ /NADPH (Nicotinamida-adenina-dinucletido-fosfato), oxidado y reducido. - FAD/FADH2 (Flavina-adenina-dinucletido), oxidado y reducido.

J. L. Snchez Guilln

Pgina III-2-3

III) La informacin celular

2) cidos nucleicos

c) Nucletidos reguladores de procesos metablicos. Algunos nucletidos cumplen funciones especiales como reguladores de procesos metablicos, por ejemplo el AMPc (adenosina-3',5'- monofosfato) o AMP ccli co, en el que dos OH del fosfato esterifican los OH en posiciones 3 y 5 de la ribosa formando un ciclo. Este compuesto qumico acta en las clulas como intermediario de muchas hormonas.

LOS POLINUCLETIDOS Dos nucletidos van a poder unirse entre s mediante un enlace sterfosfato (fosfoster). Este enlace se forma entre un OH del cido fosfrico de un nucletido y el OH (hidroxilo) del carbono nmero 3 del azcar del otro nucletido con formacin de una molcula de agua. La unin de otros nucletidos dar lugar a un polinucletido. Es de destacar que en toda cadena de polinucletidos el nucletido de uno de los extremos tendr libre el OH del azcar en posicin 3, ste ser el extremo 3' de la cadena. El cido fosfrico del nucletido que se encuentre en el extremo opuesto tambin estar libre, ste ser el extremo 5'. Esto marca un sentido en la cadena de polinucletidos. Toda cadena podr considerarse bien en sentido 3' 5' o en sentido 5' 3' y as habr que indicarlo.

3
Fig. 10 Dinucletido.

dR P

A dR P G dR P C dR P 3 T dR P G dR A

ADN Y ARN: QUMICO

DIFERENCIAS

NIVEL

- El ADN (cido desoxirribonucleico) sus nucletidos tienen desoxirribosa como azcar y no tiene uracilo. - El ARN (cido ribonucleico) tiene ribosa y no tiene timina. EL ADN (DNA) Concepto: Qumicamente son polinucletidos constituidos por d-AMP, d-GMP, d-CMP y dTMP. Los nucletidos del ADN no tienen ni uracilo, ni ribosa, como ya se ha dicho. Caractersticas: Los ADN celulares tienen una elevada masa molecular, muchos millones de daltons. As, por ejemplo: el genoma humano est formado por 3x10 9

Fig. 11 tdica.

Ejemplo de cadena polinucleo-

Fig. 12

Modelo de la estructura del ADN.

J. L. Snchez Guilln

Pgina III-2-4

III) La informacin celular

2) cidos nucleicos

pares de nucletidos. Esto hace que sean molculas de una gran longitud; por ejemplo: 1,7 m en el caso del virus de la poliomielitis y 2,36 m si sumamos todo el ADN de todos los cromosomas de una clula humana. El ADN fue aislado por primera vez en 1869, pero hasta 1950 no se empez a conocer su estructura. Se encuentra en el ncleo de las clulas eucariotas asociado a prote nas (histonas y otras) formando la cromatina, sustancia que constitu ye los cromosomas y a partir de la cual se transcribe la informacin gentica. Tambin hay ADN en ciertos orgnulos celulares (por ejemplo: plastos y mitocondrias). ESTRUCTURA DEL ADN Se pueden distinguir 3 niveles estructurales: -Estructura primaria: La secuencia de los nucletidos. -Estructura secundaria: La doble hlice. -Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado. En las clulas eucariotas, a partir de la estructura 30, se dan otros niveles de empaquetamiento de orden superior. ESTRUCTURA PRIMARIA DEL ADN. Es la secuencia de nucletidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucletidos en la hebra o cadena de la molcula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotdica. As, por ejemplo: 5'ACGTTTAACGACAAGGACAAGTATTAA3' La posibilidad de combinar cuatro nucletidos diferentes y la gran longitud que Fig. 15 Modelo de la estructura pueden tener las cadenas polinucleotdicas, secundaria del ADN. hacen que pueda haber un elevado nmero de polinucletidos posibles, lo que determina que el ADN pueda contener el mensaje biolgico o informacin gentica y explica la diversidad del mensaje gentico de todos los seres vivos.

Fig. 13

J. Watson y F. Crick.

Fig. 14 Puentes de hidrgeno (.....) entre bases complementarias en el ADN.

J. L. Snchez Guilln

Pgina III-2-5

III) La informacin celular

2) cidos nucleicos

ESTRUCTURA SECUNDARIA DEL ADN. Datos preliminares: A) A finales de los aos 40 Erwin CHARGAFF y sus colaboradores estudiaron los componentes del ADN y emitieron los siguientes resultados: La concentracin de bases vara de una especie a otra. El porcentaje de A, G, C y T es el mismo en los individuos de la misma especie y no por esto el mensaje es el mismo.

Fig. 16

Doble hlice del ADN.

Tejidos diferentes de la misma especie tienen la misma composicin en bases. La composicin en bases del ADN de una misma especie no vara con la edad del organismo ni con su estado nutricional ni con las variaciones ambientales. Las densidades y viscosidades corresponden a la existencia de enlaces de hidrgeno entre los grupos NH y los grupos CO. La concentracin de Adenina es igual a la de Timina, y la de Citosina a la de Guanina. Las dos primeras establecen dos puentes de hidrgeno entre ellas, y las ltimas tres puentes. La cantidad de purinas es igual a la cantidad de pirimidinas. B) Por medio del mtodo analtico de difraccin de rayos X, FRANKLIN y WILKINS observaron una estructura fibrilar de 20 (Amstrongs) de dimetro con repeticiones cada 3,4 y una mayor cada 34 . C) WATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura del ADN que estaba de acuerdo con todos los datos disponibles anteriores: el modelo de doble hlice. Este modelo, adems de explicar cmo era el ADN, sugera los mecanismos que explicaban su funcin biolgica y la forma como se replicaba.

Segn el modelo de la doble hlice de WATSON y CRICK: 11) El ADN estara constituido por dos cadenas o hebras de polinucletidos enrolladas helicoidalmente en sentido dextrgiro sobre un mismo eje formando una doble hlice. 21) Ambas cadenas seran antiparalelas, una ira en sentido 3' 5' y la otra en sentido inverso, 5' 3'. 31) Los grupos fosfato estaran hacia el

Fig. 17

Doble hlice del ADN.

J. L. Snchez Guilln

Pgina III-2-6

III) La informacin celular

2) cidos nucleicos

exterior y de este modo sus cargas negativas interaccionaran con los cationes presentes en el nucleoplasma dando ms estabilidad a la molcula. 41) Las bases nitrogenadas estaran hacia el interior de la hlice con sus planos paralelos entre s y las bases de cada una de las hlices estaran apareadas con las de la otra asocindose mediante puentes de hidrgeno. 51) El apareamiento se realizara nicamente entre la adenina y la timina, por una parte, Fig. 18 Replicacin del ADN. y la guanina Y la citosina, por la otra1 . Por lo tanto, la estructura primaria de una cadena estara determinada por la de la otra, ambas cadenas seran complementarias.
A T C G A T C G G G C T A G C T A G C C C
T A G

primer

La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se copia -se replica- para ser trasferido a las clulas hijas. Ambas cadenas o hebras se pueden separar parcialmente y servir de molde para la sntesis de una nueva cadena complementaria (sntesis semiconservativa). PROPIEDADES DE LA ESTRUCTURA SECUNDARIA DEL ADN: DESNATURALIZACIN Si una disolucin de ADN se calienta suficientemente ambas cadenas se separan, pues se rompen los enlaces de hidrgeno que unen las bases, y el ADN se desnaturaliza. La temperatura de desnaturalizacin depende de la proporcin de bases. A mayor proporcin de C-G, mayor temperatura de desnaturalizacin, pues la citosina y la guanina establecen tres puentes de hidrgeno, mientras que la adenina y la timina slo dos y, por lo tanto, a mayor proporcin de C-G, ms puentes de hidrgeno unirn ambas cadenas. La desnaturalizacin se produce tambin variando el pH o a concentraciones salinas elevadas. Si se restablecen las condiciones, el ADN se renaturaliza y ambas cadenas se unen de nuevo.

% del par C-G en la muestra

primer

Fig. 19 Temperatura de desnaturalizacin del ADN en funcin del tanto por ciento de citosina-guanina.

ESTRUCTURA TERCIARIA DEL ADN EN LAS CLULAS EUCARIOTAS. Las grandes mol culas de ADN de las clulas eucariotas estn muy empaquetadas ocupando as menos espacio en el ncleo celular y adems como mecanismo para preservar su transcripcin. Como hemos visto, en las clulas eucariotas el ADN se encuentra en el ncleo
1

El par A-G no puede formarse por ser ambas bases demasiado grandes, y el par C-T por estar a demasiada distancia.

J. L. Snchez Guilln

Temperatura en C

A T

A T

Pgina III-2-7

III) La informacin celular

2) cidos nucleicos

asociado a ciertas protenas: nucleoprotenas, formando la cromatina. En la cromatina, la doble hlice de ADN se enrolla alrededor de unas mol culas proteicas globulares, las histonas, formando los nucleosomas. Cada nucleosoma contiene 8 histonas y la doble hlice de ADN da dos vueltas a su alrededor (200 pares de bases). El conjunto, si no est ms empaquetado an, forma una estructura arrosariada llamada collar de perlas. Ahora bien, los nucleosomas pueden empaquetarse formando fibras de un grosor de 30 nm (fibra de 30 nm). Segn el modelo del solenoide las fibras se forman al enrollarse seis nucleosomas por vuelta alrededor de un eje formado por las histonas H1. NIVELES SUPERIORES DE EMPAQUETAMIENTO Los siguientes niveles de empaquetamiento no estn an aclarados del todo pero, parece ser, que cada fibra se volvera a enrollar formando un bucle (cada bucle tendra 50 millones de pares de bases), seis bucles se empaquetaran asocindose a un " esqueleto nuclear" producindose un rosetn, 30 rosetones formaran una espiral y 20 espirales formaran una cromtida. Todo ello producira un gran acortamiento de las largas cadenas de ADN. En los espermatozoides el ADN se encuentra an mucho ms empaquetado, se dice que tiene " estructura cristalina". Los ADN de las bacterias, virus, mitocondrias y plastos no presentan estructuras tan complejas y no estn asociados a histonas, aunque s estn asociados a otras protenas. TIPOS DE ADN Segn su estructura se siguientes tipos de ADN: distinguen los

nucleosoma

ADN espaciador

Histona H1

Fig. 20 perlas.

Fibra nucleosmica en collar de

Histona H1

ADN

Ncleo de histonas del nucleosoma

Fig. 21

Nucleosoma.

Fig. 22 Empaquetamiento de los nucleosomas formando una fibra de 30nm, segn el modelo del solenoide.

- Monocatenarios o de una cadena; por ejemplo los de algunos virus. - Bicatenarios, con dos hebras o cadenas (algunos virus, las bacterias y los eucariotas).

Fig. 23 Cromosomas de una clula en divisin. Cada cromosoma tiene dos cromtidas. En los cromosomas el ADN est fuertemente empaquetado y asociado a protenas.

J. L. Snchez Guilln

Pgina III-2-8

III) La informacin celular

2) cidos nucleicos

A su vez, y en ambos casos, el ADN puede ser: - Lineal, como por ejemplo el del ncleo de las clulas eucariotas y el de algunos virus. - Circular, como el de las mitocondrias, cloroplastos, bacterias y algunos virus. EL ARN (RNA). DIFERENCIAS CON EL ADN El ARN, cido ribonucleico, es un polirribonucletido que, a diferencia del ADN, no contiene ni desoxirribosa ni timina, pero s ribosa y uracilo. El ARN no forma dobles cadenas, salvo en ciertos virus (por ej. los reovirus). Lo que no quita que su estructura espacial pueda ser en ciertos casos muy compleja. CLASES DE ARN Por su estructura y su funcin se distinguen tres clases de ARN: - El ARNm (ARN mensajero) es un polirribonucletido constituido por una nica cadena sin ninguna estructura de orden superior. Su masa molecular suele ser elevada. Este ARN se sinteti za en el ncleo celular y pasa al citoplasma transportando la informacin para la sntesis de prote nas. La duracin de los ARNm en el citoplasma celular es de escasos minutos siendo degradados rpidamente por enzimas espec ficas. - El ARNt (ARN de transferencia) transporta los aminocidos para la sntesis de protenas. Est formado por una sola cadena, aunque en ciertas zonas se encuentra replegada y asociada internamente mediante puentes de hidrgeno entre bases Fig. 24 ARNt. La lnea es la cadena de complementarias. Su peso molecular es del polinucletidos y los rectngulos las bases o orden de 25.000 da. Est formado por entre los pares de bases. 1) brazo aceptor de ami70 y 90 nucletidos y constituye el 15 % nocidos; 2) bucle anticodon. del total del ARN de la clula. Se sintetiza en el ncleo y sale hacia el citoplasma para realizar su funcin. En el ARNt podemos distinguir un brazo aceptor de aminocidos abierto y un bucle anticodon.

El ARNr (ARN ribosomal) es el ARN de los ribosomas, cuya funcin es poco conocida. Los ARN vricos. Algunos virus tienen como material gentico ARN bicatenario.

J. L. Snchez Guilln

Pgina III-2-9

III) La informacin celular

2) cidos nucleicos

ESTRUCTURAS TERCIARIA Y SUPERIOR DEL ADN (SUPERENROLLAMIENTO)

Dos cromtidas 2x10 vueltas de espiral

1 vuelta de espiral (30 rosetones)

1 rosetn (6 bucles)

1 bucle

Fibra de 30 nm

Collar de perlas (nucleosoma)

ADN

J. L. Snchez Guilln

Pgina III-2-10

III) La informacin celular

3) El gen

3) EL ADN COMO PORTADOR DE LA INFORMACIN GENTICA. )QU ES LA GENTICA MOLECULAR?


Definiremos la Gentica como la parte de la Biologa que se ocupa del estudio de la herencia biolgica, intentando explicar los mecanismos y circunstancias mediante los cuales se rige la transmisin de los caracteres de generacin en generacin. La gentica molecular estudia estos procesos desde un punto de vista qumico.

)CUL ES LA NATURALEZA DEL MATERIAL GENTICO I) LOS EXPERIMENTOS DE GRIFFITH: La bacteria Diplococcus pneumoniae es un pneu-mococo, una bacteria causante de enfermedades. Existen dos cepas, la S (Smooth = lisa), virulenta, y la R (rough = rugosa), no virulenta. Las bacterias S, vivas, producen la muerte en los ratones, pero no la producen si estn muertas. Las segundas no son capaces de desarrollar la enfermedad. En 1928 Griffith realiz con estas bacterias las siguientes experiencias:

Experiencia 1: Al inyectar en ratones (2) bacterias del tipo S (virulentas) (1) se produce la muerte de los animales rior (4) por neumona la (3). Un cultivo postedetectaba presencia de bacterias S en el animal muerto.

Experiencia inyeccin bacterias efectos animales cultivo animal la

2: (2) R sobre (3).

La de no los Un

Experiencia 3: Al inyectar bacterias S virupor calor no lentas (2), los muertas, con ratones

Experiencia 4: Al inyectar a los ratones (2) una mezcla de bacterias no virulentas R y S, virulentas, por calor ratones muertas (1), los la

virulentas (1) no tena

tratamiento

de tejidos del despus de la de bac-

desarrollaban la enfermedad (3). Un culti vo de tejidos (4). del animal no detectaba bacterias

desarrollan

enfermedad y mueren (3). En los cultivos se observan bacterias de tipo S y R (4).

inyeccin no detectaba presencia terias de ninguna de

las cepas (4).

J. L. Snchez Guilln

Pgina III-3-1

III) La informacin celular

3) El gen

II) LOS EXPERIMENTOS DE AVERY y colaboradores.: En 1944. AVERY, MCLEOD y MCCARTY, se propusieron encontrar cul era el componente que transmita el carcter heredable y llegaron a la conclusin de que era el ADN de las bacterias S muertas por el calor el que transformaba las bacterias R en S. Demostraron as que el ADN era la molcula que contena la informacin necesaria para que las bacterias S fueran virulentas y que, a pesar de estar muertas, su ADN no estaba destruido y poda pasar al medio y de aqu a las bacterias de cepa R, integrndose en el genoma de stas y transformndolas en virulentas.

Fig. 1

Oswald Avery (1877 1955).

CONCEPTO CLSICO Y MOLECULAR DE LOS GENES


Para Mendel (1822-1884) los genes eran considerados como factores hereditarios que determinaban las caracters ticas externas de los seres vivos. En su poca se ignoraba su composicin qu mica o su localizacin. Para poder referirse a ellos fueron denominados mediante letras. As, en los guisantes, el gen A determina que las semillas sean de color amarillo y el gen a hace que sean verdes. Pero nadie saba qu era lo que haca que los guisantes fueran verdes o amarillos ni cmo lo haca. Esto es, no se saba la naturaleza de los factores hereditarios ni cul era su mecanismo de actuacin. En 1901 los estudios de GARROD sobre la alcaptonuria permitieron empezar a conocer cmo actuaban los genes y las experiencias de GRIFFITH (en 1928) y AVERY (en 1943), que ya hemos estudiado, descubrieron que los genes estaban localizados en el ADN.

Fig. 2 Imagen de un cromosoma. Al lado, esquema del cromosoma nmero 9 humano mostrando la posicin aproximada del gen que determina los grupos sanguneos ABO.

III) LOS ESTUDIOS DE GARROD: La alcaptonuria es una enfermedad hereditaria recesiva debida a una alteracin en el metabolismo celular que determina la aparicin del cido homogent sico. Este cido provoca al oxidarse el ennegrecimiento de la orina y

Fig. 3

A. E. Garrod

J. L. Snchez Guilln

Pgina III-3-2

III) La informacin celular

3) El gen

un color grisceo en los cartla gos y ligamentos, tambin puede llegar a producir artritis. El cido homogentsico aparece en el metabolismo del aminocido fenilalanina. Por la accin de diversas enzimas la fenilalanina se transforma en tirosina, otro aminocido, despus, en cido polihidroxifenilpirvico y, finalmente, en cido homogentsico.
Fig. 4 cido homogentsico.

Fenilalanina Tirosina cido polihidroxifenilpirvico cido Homogentsico


En las personas sanas el cido homogent sico es transformado por la enzima homogentsi co-oxidasa en el cido 4-maleil-acetoactico que, posteriormente, se transformar en acetil-CoA, que ser degradada en el Ciclo de Krebs a CO2 y H2 O. GARROD lleg a la conclusin de que el gen normal (A) produce la enzima necesaria, mientras que el gen (a) recesivo no la produce. sta era la primera vez que se relacionaba un gen con una enzima y, por tanto, con una reaccin. De aqu surgi la hiptesis: un gen-una enzima. Ahora bien, debido a que hay enzimas formadas por dos o ms cadenas polipept dicas, la hiptesis se reformul como: un gen-un polipeptido.

ADN

T A C G T T A C G A A T G C T T A A A T C HMet Gln Cys Leu Arg - Ile-OH pptido

Fig. 5 Colinealidad entre un fragmento de ADN y un pptido.

EL DOGMA CENTRAL DE LA BIOLOGA MOLECULAR

ADN

ARN

Polipptido
HIPTESIS DE LA COLINEALIDAD DE CRICK
Una vez establecido el paralelismo entre genes y enzimas y tras ser propuesto, en 1.953, el modelo de doble hlice por Watson y Crick, este ltimo propuso la denominada Hiptesis de colinealidad de CRICK:

Carcter

Fig. 6 Dogma central de la biologa molecular.

" Existe una correspondencia entre la secuencia de nucletidos del gen y la secuencia de aminocidos de la enzima codificada".

J. L. Snchez Guilln

Pgina III-3-3

III) La informacin celular

3) El gen

3) EL ADN COMO PORTADOR DE LA INFORMACIN GENTICA. )QU ES LA GENTICA MOLECULAR?


Definiremos la Gentica como la parte de la Biologa que se ocupa del estudio de la herencia biolgica, intentando explicar los mecanismos y circunstancias mediante los cuales se rige la transmisin de los caracteres de generacin en generacin. La gentica molecular estudia estos procesos desde un punto de vista qumico.

)CUL ES LA NATURALEZA DEL MATERIAL GENTICO I) LOS EXPERIMENTOS DE GRIFFITH: La bacteria Diplococcus pneumoniae es un pneu-mococo, una bacteria causante de enfermedades. Existen dos cepas, la S (Smooth = lisa), virulenta, y la R (rough = rugosa), no virulenta. Las bacterias S, vivas, producen la muerte en los ratones, pero no la producen si estn muertas. Las segundas no son capaces de desarrollar la enfermedad. En 1928 Griffith realiz con estas bacterias las siguientes experiencias:

Experiencia 1: Al inyectar en ratones (2) bacterias del tipo S (virulentas) (1) se produce la muerte de los animales rior (4) por neumona la (3). Un cultivo postedetectaba presencia de bacterias S en el animal muerto.

Experiencia inyeccin bacterias efectos animales cultivo animal la

2: (2) R sobre (3).

La de no los Un

Experiencia 3: Al inyectar bacterias S virupor calor no lentas (2), los muertas, con ratones

Experiencia 4: Al inyectar a los ratones (2) una mezcla de bacterias no virulentas R y S, virulentas, por calor ratones muertas (1), los la

virulentas (1) no tena

tratamiento

de tejidos del despus de la de bac-

desarrollaban la enfermedad (3). Un culti vo de tejidos (4). del animal no detectaba bacterias

desarrollan

enfermedad y mueren (3). En los cultivos se observan bacterias de tipo S y R (4).

inyeccin no detectaba presencia terias de ninguna de

las cepas (4).

J. L. Snchez Guilln

Pgina III-3-1

III) La informacin celular

3) El gen

II) LOS EXPERIMENTOS DE AVERY y colaboradores.: En 1944. AVERY, MCLEOD y MCCARTY, se propusieron encontrar cul era el componente que transmita el carcter heredable y llegaron a la conclusin de que era el ADN de las bacterias S muertas por el calor el que transformaba las bacterias R en S. Demostraron as que el ADN era la molcula que contena la informacin necesaria para que las bacterias S fueran virulentas y que, a pesar de estar muertas, su ADN no estaba destruido y poda pasar al medio y de aqu a las bacterias de cepa R, integrndose en el genoma de stas y transformndolas en virulentas.

Fig. 1

Oswald Avery (1877 1955).

CONCEPTO CLSICO Y MOLECULAR DE LOS GENES


Para Mendel (1822-1884) los genes eran considerados como factores hereditarios que determinaban las caracters ticas externas de los seres vivos. En su poca se ignoraba su composicin qu mica o su localizacin. Para poder referirse a ellos fueron denominados mediante letras. As, en los guisantes, el gen A determina que las semillas sean de color amarillo y el gen a hace que sean verdes. Pero nadie saba qu era lo que haca que los guisantes fueran verdes o amarillos ni cmo lo haca. Esto es, no se saba la naturaleza de los factores hereditarios ni cul era su mecanismo de actuacin. En 1901 los estudios de GARROD sobre la alcaptonuria permitieron empezar a conocer cmo actuaban los genes y las experiencias de GRIFFITH (en 1928) y AVERY (en 1943), que ya hemos estudiado, descubrieron que los genes estaban localizados en el ADN.

Fig. 2 Imagen de un cromosoma. Al lado, esquema del cromosoma nmero 9 humano mostrando la posicin aproximada del gen que determina los grupos sanguneos ABO.

III) LOS ESTUDIOS DE GARROD: La alcaptonuria es una enfermedad hereditaria recesiva debida a una alteracin en el metabolismo celular que determina la aparicin del cido homogent sico. Este cido provoca al oxidarse el ennegrecimiento de la orina y

Fig. 3

A. E. Garrod

J. L. Snchez Guilln

Pgina III-3-2

III) La informacin celular

3) El gen

un color grisceo en los cartla gos y ligamentos, tambin puede llegar a producir artritis. El cido homogentsico aparece en el metabolismo del aminocido fenilalanina. Por la accin de diversas enzimas la fenilalanina se transforma en tirosina, otro aminocido, despus, en cido polihidroxifenilpirvico y, finalmente, en cido homogentsico.
Fig. 4 cido homogentsico.

Fenilalanina Tirosina cido polihidroxifenilpirvico cido Homogentsico


En las personas sanas el cido homogent sico es transformado por la enzima homogentsi co-oxidasa en el cido 4-maleil-acetoactico que, posteriormente, se transformar en acetil-CoA, que ser degradada en el Ciclo de Krebs a CO2 y H2 O. GARROD lleg a la conclusin de que el gen normal (A) produce la enzima necesaria, mientras que el gen (a) recesivo no la produce. sta era la primera vez que se relacionaba un gen con una enzima y, por tanto, con una reaccin. De aqu surgi la hiptesis: un gen-una enzima. Ahora bien, debido a que hay enzimas formadas por dos o ms cadenas polipept dicas, la hiptesis se reformul como: un gen-un polipeptido.

ADN

T A C G T T A C G A A T G C T T A A A T C HMet Gln Cys Leu Arg - Ile-OH pptido

Fig. 5 Colinealidad entre un fragmento de ADN y un pptido.

EL DOGMA CENTRAL DE LA BIOLOGA MOLECULAR

ADN

ARN

Polipptido
HIPTESIS DE LA COLINEALIDAD DE CRICK
Una vez establecido el paralelismo entre genes y enzimas y tras ser propuesto, en 1.953, el modelo de doble hlice por Watson y Crick, este ltimo propuso la denominada Hiptesis de colinealidad de CRICK:

Carcter

Fig. 6 Dogma central de la biologa molecular.

" Existe una correspondencia entre la secuencia de nucletidos del gen y la secuencia de aminocidos de la enzima codificada".

J. L. Snchez Guilln

Pgina III-3-3

III) La informacin celular

5) Replicacin del ADN

5) LA REPLICACIN DEL ADN

)CMO ES EL PROCESO DE REPLICACIN DEL ADN? El ADN es una molcula formada por dos hebras complementarias y antiparalelas. Una de las primeras dudas que se plantearon fue la de cmo se replicaba el ADN. A este respecto haba dos hiptesis: 10) El ADN se replica de manera conservativa. Esto es, cada hebra de ADN forma una copia y una clula hija recibe la molcula original y la otra clula recibe la copia. 20) El ADN se replica de manera semiconservativa. Cada hebra de ADN forma una hebra complementaria y cada clula hija recibe una molcula de ADN que consta de una hebra original y de su complementaria sintetizada de nuevo. Esta controversia fue MESELSON y STAHL con elegantes experiencias. resuelta por una serie de
ADN original

Replicacin

ADN original

ADN copia

Fig. 1

Replicacin conservativa.

Replicacin

ADN original

ADN copia y original

ADN original y copia

Fig. 2

Replicacin semiconservativa.

EXPERIENCIAS DE MESELSON Y STAHL.

3
3

15 N- 15N

15 N- 15N

14 N- 14N

Se cultivan bacterias E. coli en un medio con formado por dos hebras de


15

15

N (nitrgeno

A continuacin, se cultivan las bacterias en nitrgeno 14 (14N)


ms ligero durante 30 minutos, lo que dura un ciclo de replicacin. Si la hiptesis de la sntesis conservativa fuese la correcta, se debera obtener lo que se ve en la figura, una banda de ADN pesado (15 N-15 N) y otra con ADN ligero (14 N-14 N) pero...

pesado) durante cierto tiempo para que todo el ADN est N (15 N-15 N) ms pesadas. Si se centrifu ga, este ADN ms pesado migra hacia el fondo del tubo y se obtiene el resultado que se observa en la figura.

14N -15N

15N -14N

14N -15N

14N- 14N

14N- 14N

15N -14N

.. lo que se obtiene en realidad es lo que se observa en la figura: una sola banda en posicin intermedia, pues est formada por ADN mixto (15 N-14 N). Esto es, todas las clulas hijas tienen un ADN con una hebra con
15

Adems, si se da otro ciclo de replicacin en


14 15

14

N, se obtiene

una banda de ADN mixto ( N- N) y otra de ADN (14 N-14 N), lo que tambin est de acuerdo con la hiptesis de la sntesis semiconservativa.

N y otra con

14

N. La

hiptesis de la sntesis semiconservativa es la correcta.

J. L. Snchez Guilln

Pgina III-5-1

III) La informacin celular

5) Replicacin del ADN

LA REPLICACIN SEMICONSERVATIVA DEL ADN EN EUCARIOTAS Cuando una clula se divide, o cuando se originan los gametos, las nuevas clulas que se forman deben contener la informacin gentica que les permita sintetizar todas las enzimas y el resto de las prote nas necesarias para realizar sus funciones vitales. sta es la principal razn por la que el ADN debe replicarse. La replicacin del ADN es el proceso segn el cual una molcula de ADN de doble hlice da lugar a otras dos molculas de ADN con la misma secuencia de bases. En la clula procaritica la replicacin parte de un nico punto y progresa en ambas direcciones hasta completarse. En la clula eucaritica el proceso de replicacin del ADN no empieza por los extremos de la molcula sino que parte de varios puntos a la vez y progresa en ambas direcciones formando los llamados ojos de replicacin. Primero se separan las dos hebras y, una vez separadas, van entrando los nucletidostrifosfato complementarios de cada uno de los de las hebras originales del ADN. Las enzimas ADN polimerasas los unen entre s formando una hebra de ADN complementaria de cada una de las hebras del ADN original. Se dice que la sntesis de ADN es semiconservativa porque cada una de las molculas de ADN " hijas" est formada por una hebra de ADN original y otra complementaria sintetizada de nuevo. Es de destacar que la direccin en la que progresa la replicacin es la misma en ambas hebras. Ahora bien, las enzimas que unen los nucletidos slo pueden efectuar la unin en direccin 5' 3'. Esto nos indica que ambas hebras, al ser antiparalelas, deben de sintetizarse de diferente manera. a) Sntesis continua de la hebra en direccin 5' 3'. La sntesis de esta hebra no plantea ningn problema. As, una vez separadas ambas hebras, la ADN pol. III (una de las

Cromosoma: arriba, en procariotas, abajo, en eucariotas.

Fig. 3 Replicacin del ADN en procariotas y en eucariotas. En procariotas slo hay un ojo de replicacin, mientras que en eucariotas hay varios.

Fig. 4 Microfotografa al MET de un fragmento de la doble hlice de un cromosoma de eucariota replicndose.

Ojos de replicacin

Cromosoma (doble hlice de ADN) replisomas

Fig. 5 Cromosoma de eucariota replicndose. El replisoma es un complejo formado por todas las enzimas que intervienen en el proceso de replicacin.

Hebra de ADN
A C T

ATP asa Helicasa

Topoisomerasa
A G T

Protenas estabilizadoras ADN polimerasas

Fig. 6 Enzimas y otras protenas que forman el replisoma. Se muestra en este esquema un detalle del recuadro de la figura anterior.

J. L. Snchez Guilln

Pgina III-5-2

III) La informacin celular

5) Replicacin del ADN

enzimas que unen los nucletidos) va a elongar la cadena en direccin 5' 3' a partir de un primer o fragmento de ARN que despus ser eliminado. b) Sntesis discontinua. La hebra complementaria no se va a replicar en sentido 3' 5' sino que se replica discontinuamente en direccin 5' 3'. Los diferentes fragmentos sintetizados, llamados fragmentos de Okazaki, son posteriormente unidos entre s. El proceso es complejo y consiste en lo siguiente: En primer lugar se sintetiza un pequeo fragmento de ARN, fragmento denominado primer. Partiendo de este primer se sintetiza un fragmento de ADN en direccin 5' 3'. Al llegar al primer del fragmento anteriormente sintetizado, ste es degradado y se rellena el hueco con ADN. Se dice que la replicacin es discontinua porque el ADN se va a ir sintetizando en fragmentos que, posteriormente, son soldados uno al otro.

A U

T A

C G

G C

A T

A T

C G

C G

G C

T A

T A

G C

C G

A T

C G

Fig. 7

Sntesis continua.

A T

T A

A T

A U

C G

G C

C G

A T

G C

T A

T A

G C

G C

G G

1er fragmento sintetizado

2 fragmento sintetizado

Fig. 8

Sntesis discontinua.

A T

T A

C G

G C

A T

T A

C G

G C

G C

G C

C G

A T

T A

C G

G C

A T

T A

C G

G C

G C

A T

U A

C G

G C

A T

T A

C G

G C

G C

G C

Fig. 9

Replicacin del ADN. Acontecimientos que se dan en un replisoma.

J. L. Snchez Guilln

Pgina III-5-3

III) La informacin celular

6) Ciclo celular. Mitosis.

6) EL CICLO CELULAR. LA MITOSIS La vida de una clula consta de dos etapas diferentes: interfase y divisin La interfase es una etapa muy larga en la cual tiene lugar el crecimiento de la clula y el desarrollo de las actividades metablicas normales. La divisin es una etapa corta. El conjunto de ambas componen el ciclo celular. PERIODOS DE LA INTERFASE La interfase es de gran importancia para la clula. No es un momento de reposo, pues en ella tiene lugar una gran actividad metablica. La interfase se puede subdividir para su estudio en tres periodos: G1 , S y G2 . El periodo G1 sigue a la mitosis anterior y corresponde a la fase de desarrollo de la clula. Los cromosomas se encuentran esparcidos en el interior del ncleo celular asociados a las histonas formando las fibras nucleosmicas. Los genes se transcriben de acuerdo con las necesidades metablicas que presenta la clula en cada momento. En el citoplasma se suceden los diferentes procesos metablicos y los orgnulos celulares se forman tambin en este periodo. El periodo S es el de sntesis de ADN. En l, la doble hlice se abre en diversos puntos llamados ojos de replicacin, es en ellos donde se produce la snte sis del ADN. Simultneamente se transcriben los genes necesarios. El periodo G2 es el que antecede a la mitosis. En este periodo los cromosomas estn ya duplicados, es decir, estn formados por dos cromtidas con uniones a nivel del centrmero.
P ro fa se
fas e

Meta

Anafase

Telofase

Interfase

Divisin

Fig. 1 1995).

El ciclo celular (P.A.U. de junio de

Ciclo celular

Fig. 2 celular.

Aspecto de la clula durante el ciclo

Interfase Cantidad de ADN en pg

Mitosis

10 Tiempo en u.a.

15

Fig. 3 Variacin de la cantidad de ADN de una clula durante un ciclo celular completo.

Fig. 4 Figuras de mitosis. 1) profase, 2) metafase, 3) anafase, 4) telofase.

J. L. Snchez Guilln

Pgina III-6-1

III) La informacin celular

6) Ciclo celular. Mitosis.

LA DIVISIN CELULAR La divisin celular es un proceso biolgico que en los seres unicelulares permite su multiplicacin y en los pluricelulares el crecimiento, el desarrollo, la regeneracin de rganos y tejidos y las funciones de reproduccin. En una divisin celular tpica, la clula inicial, clula madre, divide su ncleo en dos ncleos hijos con la misma informacin gentica que, adems, es la misma que la de la clula madre. Al dividirse la clula, el citoplasma y los diferentes orgnulos celulares quedan repartidos y durante la posterior interfase se producirn nuevos orgnulos a partir de los que cada clula hija ha recibido. Por consiguiente, en una divisin celular hay que distinguir dos aspectos distintos: -Divisin del ncleo: cariocinesis o mitosis. -Divisin del citoplasma: citocinesis o citodi resis.
Fig. 5 Clulas del meristemo de la raz de ajo: 1) Profase; 2) Anafase; 3) Metafase; 4) Interfase; 5) Telofase (citocinesis).

A partir de la fase M o de mitosis, la clula puede entrar de nuevo en la fase G1 y dividirse otra vez o en entrar en la llamada fase G0 en Ia que sufre una serie de trasformaciones que conducen a Ia diferenciacin celular. Por ejemplo, las clulas epiteliales se dividen continuamente pero las clulas que dan lugar a las neuronas entran en fase G0 se diferencian, se transforman en neuronas y ya no se dividen. Otros tipos celulares como los hepatocitos estn en fase G0 pero si son debidamente estimulados pueden recuperar la capacidad de divisin y pasar de G0 a G1.

DURACIN DEL CICLO CELULAR La duracin de los periodos G1 , S, G2 y de la mitosis (M) depende del tipo de clula que se trate. As, en clulas del epitelio humano la duracin es de 8 horas, en otros tipos de clulas puede ser de varios das o incluso meses. Tambin depende de las condiciones fisiolgicas y de determinados factores y, en particular, la temperatura. Un caso tpico de duracin de un ciclo celular es el de los cultivos de clulas HeLa en las que un ciclo celular dura 20 horas y cada fase tiene la siguiente duracin: G1..... 8 horas S ..... 6 horas G2..... 5 horas M...... 1 hora

J. L. Snchez Guilln

Pgina III-6-2

III) La informacin celular

6) Ciclo celular. Mitosis.

Trasformaciones del cromosoma durante el ciclo celular.


NOR Ojo de replicacin Trascripcin

Cromosoma

S
Centrmero

G1 M

G2

Cromtidas

Te

f lo

as

Pro

fas

e
5

Anafase

Metafase

LA MITOSIS. FASES Aunque la mitosis es un proceso continuo se acostumbra a dividirlo, para su estudio y reconocimiento, en cuatro fases distintas llamadas: profase, metafase, anafase y telofase. Es de destacar, que, aunque el estudio lo haremos en una clula animal, este proceso se produce de una manera similar en las clulas vegetales. Las diferencias se irn indicando a lo largo de la explicacin.

Fig. 6 Fases de la mitosis vistas al microscopio ptico. A, profase; B, metafase (visin polar); C, metafase (visin ecuatorial); D, anafase; E, telofase.

J. L. Snchez Guilln

Pgina III-6-3

III) La informacin celular

6) Ciclo celular. Mitosis.

PROFASE Es la fase ms larga (1 a 2 horas en el pice de raz) y en ella se suceden una serie de fenmenos tanto en el ncleo como en el citoplasma. La envoltura nuclear empieza a fragmentarse y los nucleolos van desapareciendo progresivamente. Debido al superenrollamineto de la cromatina se produce una condensacin del material gentico y los cromosmas se van haciendo cada vez ms visibles. Puesto que el ADN se replic en el periodo S de la interfase, cada cromosoma est formado por dos cromtidas unidas por el centromero. En las clulas animales el par de centriolos se ha dividido en interfase y ha dado lugar a dos pares de centriolos que constituirn los focos de unas ordenaciones radiales de microtubulos: los steres. Los dos steres que al principio estn juntos se separan a polos opuestos de la clula y los haces de microtubulos que surgen de ellos se alargan y forman un huso mittico o huso acromtico bipolar. Las clulas vegetales no tienen centriolos y el huso acromtico se forma a partir del centrosoma. Estos husos sin centriolo se llaman husos anastrales y estn menos centrados en los polos. Los tbulos del huso se forman a partir de las molculas del citoesqueleto. ste se desorganiza y la clula adquiere una forma ms redondeada.
Fig. 7 Clulas en diversas fases del ciclo celular (M.O.).

Fig. 8 Interfase.

Fig. 9 Inicio de la profase.

METAFASE Es una fase corta (5 a 15 minutos en el pice de la raz del ajo). El huso mittico ya est perfectamente desarrollado. Los cinetcoros de los cromosomas interaccionan por medio de unos microtbulos con los filamentos del huso y los cromosomas son Fig. 10 Metafase. alineados en la placa ecuatorial de la clula o placa metafsica. En esta fase los cromosomas se encuentran todos en la zona

J. L. Snchez Guilln

Pgina III-6-4

III) La informacin celular

6) Ciclo celular. Mitosis.

ecuatorial, orientados perpendicularmente a los microtbulos que forman el huso acromtico constituyendo la denominada placa ecuatorial. Esta es la fase ms adecuada para la observacin de los cromosomas. Para ello se rompe la clula, por ejemplo: mediante choque osmtico, si ello es posible, y los cromosomas se tien, se aplasta para que se extiendan y a continuacin se foto grafan.

ANAFASE Es la fase ms corta (2 a 10 minutos en el pice de raz). Los cinetcoros se separan y cada cromtida es arrastrada hacia un polo de la clula. El movimiento parece ser que se produce por un desensamblaje de los microtbulos. Al desplazarse cada cromtida, sus brazos se retrasan formando estructu ras en V con los vrtices dirigidos hacia los polos.

Fig. 11 Anafase.

TELOFASE Su duracin en el pice de raz de ajo es de 10 a 30 minutos. Los cromosomas son revestidos por fragmentos del retculo endoplasmtico que terminarn soldndose para constituir la envoltura nuclear. Poco a poco los cromosomas van descondensndose y se desfiguran adquiriendo el ncleo un aspecto cada vez ms interfsico, los nucleolos comienzan a reaparecer. Los microtbulos del huso se agrupan en haces por la aparicin en la regin media de cilindros de una sustancia densa y pierden sus conexiones con los polos. Finalmente los cilindros se fusionan en un solo haz y la clula se divide en dos.

Fig. 12 Telofase.

J. L. Snchez Guilln

Pgina III-6-5

III) La informacin celular

6) Ciclo celular. Mitosis.

ESQUEMA GENERAL DE LA MITOSIS

1) Interfase

2) Profase

3) Metafase

4) Anafase

5) Telofase

6) Interfase

J. L. Snchez Guilln

Pgina III-6-6

III) La informacin celular

6) Ciclo celular. Mitosis.

CITOCINESIS La divisin del citoplasma se inicia ya al final de la anafase y contina a lo largo de la telofase. Se produce de manera distinta en las clulas animales y en las vegetales. En las clulas animales tiene lugar por simple estrangulacin de la clula a nivel del ecuador del huso. La estrangulacin se lleva a cabo gracias a prote nas ligadas a la membrana que formarn un anillo contrctil. En las c lulas vegetales aparece un sistema de fibras formado por microtbulos en forma de barril: el fragmoplasto. En su plano ecuatorial se depositan pequeas vescu las que provienen de los dictiosomas del aparato de Golgi. Estas vesculas contienen sustancias pcticas que formarn la lmina media. Todo ello crece de dentro a fuera. La divisin no es completa entre ambas clulas hijas, mantenindose algunos poros de comunicacin: los plasmodesmos, al quedar capturados entre las vesculas elementos del retculo. Posteriormente se depositan el resto de las capas que forman la pared celular. Es ms, cada clula hija depositar a su alrededor una nueva pared celular. Las paredes celulares de las clulas vegetales se estiran y se rompen permitiendo a las clulas hijas crecer. Por ltimo indicar que en algunos hongos a la cariocinesis no le sucede la citodiresis. Se forman as masas, llamadas plasmodios, que contienen una gran cantidad de ncleos envueltos en una sola membrana.

Fig. 13 Citocinesis en una clula animal.

Fig. 14 Citocinesis en una clula animal.

Fig. 15 Citocinesis en una clula vegetal. a) Fragmoplasto; b) disctiosoma; c) lmina media.

Profase

Metafase

Metafase

SIGNIFICADO BIOLGICO DE LA MITOSIS


Telofase

- A nivel gentico representa un sistema de reparto equitativo e idntico de la informacin gentica. Ambas clulas hijas tendrn la misma informacin gentica, que es la misma que posea la clula madre.

Citocinesis

Fig. 16 Figuras de mitosis.

J. L. Snchez Guilln

Pgina III-6-7

III) La informacin celular

6) Ciclo celular. Mitosis.

- A nivel celular la mitosis permite la perpetuacin de una estirpe celular y la formacin de colonias de clulas (clones celulares). - A nivel orgnico la mitosis permite el crecimiento y desarrollo de los tejidos y de los rganos de los seres pluricelulares y la reparacin y regeneracin de los mismos. De esta manera, todas las clulas de un organismo pluricelular, a excepcin de las clulas sexuales, dispondrn de idntica informacin gentica.

Interfase Metafase

Anafase

Profase

Fig. 17 Figuras de mitosis.

J. L. Snchez Guilln

Pgina III-6-8

III) La informacin celular

7) Cromosomas

7) LOS CROMOSOMAS MITTICOS


Durante la mitosis las cromtidas se repliegan sobre s mismas en tal grado que surgen pequeos cuerpos dobles perfectamente visibles al microscopio: son los cromosomas metafsicos. Normalmente, los cromosomas son difci les de observar, pues se presentan en la clula en gran nmero. Pero haciendo preparaciones adecuadas pueden aislarse y fotografiarse. Su tamao es variable: segn las clulas, el cromosoma de que se trate, del momento funcional, etc. No obstante, oscila, aproximadamente, entre 0,2 a 50 de longitud por 0,2 a 2 de dimetro. En la especie humana entre 4 y 6.
Fig. 2 Cromosoma.

Fig. 1 Clulas de raz de ajo en proceso de divisin.

CARACTERSTICAS CROMOSOMA
En cada distinguir:

MORFOLGICAS
mittico

DEL

cromosoma

podemos

Las cromtidas.- son estructuras idnticas en morfologa e informacin ya que contienen cada una una molcula de ADN. Las cromtidas estn unidas por el centrmero. Morfolgicamente se puede decir que el cromosoma es el conjunto de dos cromtidas y genticamente cada cromtida tiene el valor de un cromosoma. Estructuralmente, cada cromtida est constituida por un esqueleto proteico, situado en el interior, alrededor del cual se disponen muy apelotonados el ADN y las prote nas que forman el cromosoma. El centrmero.- Es la regin que se fija al huso acromtico durante la mitosis. Se encuentra en un estrechamiento llamada constriccin primaria, que divide a cada cromtida del cromosoma en dos brazos. En el centrmero se encuentran los cinetocoros: zonas discoidales situadas a ambos lados del centrmero que durante la divisin celular tienen como funcin hacer que los microtbulos del huso se unan a los cromosomas. Los cinetocoros son tambin centros organizadores de microtbulos, igual que los

Fig. 3 Estructura de un cromosoma metafsico: 1) centrmero; 2 brazo; 3) cromtida; 4) telmeros; 5) satlite; 6) zona del organizador nucleolar (NOR). (P.A.U. sep. 97 y jun. 98).

Fig. 4 Morfologa de un cromosoma. a) brazo corto; b) centrmero; c) brazo largo; d) telmero; e) cinetocoro; f) bandas; g) NOR; h) satlite (SAT).

J. L. Snchez Guilln

Pgina III-7-1

III) La informacin celular

7) Cromosomas

centriolos o el centrosoma de las clulas vegetales.

Los telmeros.- Al extremo de cada brazo del cromosoma se le denomina telmero. El ADN de los telmeros no se transcribe y en cada proceso de divisin celular se acorta. Cuando los telmeros desaparecen el cromosoma sigue acortndose y la clula pierde informacin gentica til y degenera. Los telmeros seran, por lo tanto, una suerte de "reloj celular" que determinara el nmero de ciclos celulares que puede tener una clula. En las clulas cancerosas, una enzima, la telomerasa, regenera los telmeros; esta es la razn, al parecer, de que estas clulas puedan dividirse indefinidamente. El organizador nucleolar.- En algunos cromosomas se encuentra la regin del organizador nucleolar (NOR). En ella se sitan los genes que se transcriben como ARNr, con lo que se promueve la formacin del nuclolo y de los ribosomas. Esta zona no se espiraliza tanto y por eso se ve ms clara. EI satlite (SAT).- Es el segmento del cromosoma entre el organizador nucleolar y el telmero correspondiente. Slo poseen satlite aquellos cromososmas que tienen NOR. CLASIFICACIN DE LOS CROMOSOMAS POR LA POSICIN DEL CENTRMERO
Los cromosomas son orgnulos constantes en nmero, forma y caractersticas. Pero los cromosomas de una clula pueden ser diferentes unos de otros. Esta diferencia est, sobre todo, en la posicin del centrmero, que es variable, lo que permite clasificar a los cromosomas metafsicos en metacn tricos, submetacn tricos, acrocn tricos y telocn tricos, segn tengan el centrmero en medio, desplazado hacia uno de los brazos, casi en el extremo o en el extremo, respectivamente.

Metacntrico

Submetacntrico

acrocntrico

Telocntrico

Fig. 5 Clasificacin de los cromosomas por la posicin del centrmero.

EL CARIOTIPO
Se llama cariotipo al nmero, forma y tamao de los cromosomas de una determinada especie. Esto es, al conjunto de los cromosomas de una clula. Los cromosomas de una clula pueden ser observados al microscopio ptico, foto grafiados y sobre estas fotografas pueden contarse y medirse con toda facilidad. Los cromosomas pueden recortarse de la foto grafa y ordenarse por su tamao, de mayor a menor, y por la posicin del centrmero. Esta distribucin ordenada de los cromosomas recibe el nombre de ideograma. El estudio de los cariotipos ha permitido descubrir los siguientes aspectos importantes:

Fig. 6 Placa metafsica obtenida a partir de una clula humana en divisin.

J. L. Snchez Guilln

Pgina III-7-2

III) La informacin celular

7) Cromosomas

1 1) El nmero de cromosomas es fijo para cada especie animal o vegetal (Ley de la constancia de los cromosomas). As, por ejemplo, las clulas humanas tienen 46 cromosomas, 48 las del chimpanc, 12 las de la mosca comn, 2 las de la lombriz intestinal del caballo, etc. El nmero de cromosomas oscila en los seres vivos entre 2 y varios cientos. Es de destacar que este nmero no est en relacin con la mayor o menor complejidad evolutiva del organismo. 2 1) El nmero de cromosomas de las clulas somticas (no reproductoras) de la mayora de los animales, plantas y hongos es siempre par, excepto si se tienen anomalas en el nmero de cromosomas, ya que cada clula somtica dispone de dos juegos de cromosomas y cada cromosoma de una serie tiene su homlogo en la otra. En los ideogramas los cromosomas se agrupan por parejas de homlogos. Los cromosomas homlogos provienen cada uno de un progenitor. Es por esto que contienen informacin para los mismos caracteres pero no necesariamente la misma informacin, pues uno de los progenitores ha podido aportar un gen para un carcter y el otro progenitor otro gen diferente. 3 1) El nmero de cromosomas de cada serie recibe el nombre de nmero haploide o n y, como ya se ha dicho, ha sido heredado de uno de los progenitores. En la especie humana n=23. El nmero total de cromosomas es el nmero diploide o 2n. As, en la especie humana 2n= 46. Siendo n y 2n las frmulas cromosmicas haploide y diploide respectivamente.
Fig. 7 mujer. Ideograma del cariotipo de una

Fig. 8 hombre.

Ideograma del cariotipo de un

Especie

4 1) En muchos grupos de seres vivos, por ejemplo en los mamferos, los cariotipos del macho y de la hembra son diferentes. As la mujer tiene dos cromosomas X (XXhomogamtica) y el hombre tiene un Fig. 9 Nmero de cromosomas de clulas cromosoma X y otro Y (heterogamtico- XY). diploides de diferentes especies. Estos cromosomas que determinan el sexo se llaman, por ser distintos, heterocromosomas. En las aves es al contrario, el macho es homogamtico (ZZ) y la hembra heterogamtica (ZW). El resto de los cromosomas que no determinan el sexo son los autosomas. El estudio del cariotipo tiene un gran inters en medicina porque algunos sndromes

La especie humana... 46 El chimpanc. 48 El perro... 78 Toro/vaca... 60 Gallo/gallina... 78 Rana.... 26 Mosca.. 12 Maz. 20 Trigo. 46 Algodn 52

J. L. Snchez Guilln

Pgina III-7-3

III) La informacin celular

7) Cromosomas

son debidos a cromosomas de ms, de menos o a cromosomas incompletos. En particular, la llamada trisoma 21 o sndrome de Down en la que el individuo afectado presenta tres cromosomas 21 en lugar de dos y por lo tanto, su cariotipo tiene 47 cromosomas en lugar de los 46 de la frmula diploide normal. Estas alteraciones en el nmero de cromosomas del cariotipo y sus causas sern estudiadas ms adelante.

J. L. Snchez Guilln

Pgina III-7-4

III) La informacin celular

8) Meiosis

8) LA MEIOSIS

LA MEIOSIS: CONCEPTO La meiosis es un mecanismo de divisin celular que permite la obtencin de clulas haploides (n) a partir de clulas diploides (2n) con diferentes combinaciones de genes.

Fig. 1 La meiosis consta de dos divisiones celulares sucesivas con una sola replicacin del material gentico.

OBJETIVOS DE LA MEIOSIS

La meiosis no es un tipo de divisin celular diferente de la mitosis o una alternativa a sta. La meiosis tiene objetivos diferentes. Uno de estos objetivos es la reduccin del nmero de cromosomas. Otro de sus objetivos es establecer reestructuraciones en los cromosomas homlogos mediante intercambios de material gentico. Por lo tanto, la meiosis no es una simple divisin celular. La meiosis est directamente relacionada con la sexualidad y tiene, como veremos ms adelante, un profundo sentido para la supervivencia y evolucin de las especies.

Fig. 2 Evolucin de los cromosomas de una clula durante la meiosis (P.A.U. de junio y septiembre de 1995).

MECANISMO DE LA MEIOSIS

La meiosis consta de dos divisiones sucesivas de la clula con una nica replicacin del ADN. El producto final son cuatro clulas con n cromosomas.

Fig. 3 Figuras de meiosis desordenadas (P.A.U. de junio de 1997).

J. L. Snchez Guilln

Pgina III-8-1

III) La informacin celular

8) Meiosis

DIVISIN I PROFASE I

En esta fase suceden los acontecimientos ms caractersticos de la meiosis. La envoltura nuclear se conserva hasta el final de la fase que es cuando se desintegra, al mismo tiempo desaparece el nucleolo y se forma el huso. Dada su duracin y complejidad se subdivide en cinco etapas: leptoteno, zigoteno, paquiteno, diploteno y diacinesis. Leptoteno: Los cromosomas aparecen como largos filamentos que de trecho en trecho presentan unos grnulos: los crommeros. Cada cromosoma ya est constituido por dos cromtidas, pero an no se observan bien diferenciadas al microscopio ptico, y se encuentran unidos en diversos puntos a la envoltura nuclear. Zigoteno: En esta etapa los cromosomas homlogos se aparean punto por punto en toda su longitud. Este apareamiento puede comenzar bien por el centro o por los extremos y continuar a todo lo largo. Cuando los homlogos se aparean cada gen queda yuxtapuesto con su homlogo. Paquiteno: Los pares de cromosomas homlogos aparecen ntimamente unidos: bivalentes. Se puede ya observar que cada cromosoma tiene sus dos cromtidas. Mientras estn estrechamente unidos tienen lugar roturas entre cromtidas prximas de cromosomas homlogos que intercambian material cromosmico. Este intercambio se llama entrecruzamiento o sobrecruzamiento (crossing-over) y supone una redistribucin cromosmica del material gentico. Aunque los sobrecruzamientos se producen en esta fase no an visibles y se apreciarn ms tarde en forma de quiasmas.
Fig. 6 Intercambio de fragmentos entre cromtidas homlogas por sobrecruzamiento entre cromosomas homlogos. Fig. 4 Profase I: Leptoteno.

Fig. 5 Profase I: Zigoteno.

quiasma

Fig. 7 Quiasmas entre cromosomas homlogos.

J. L. Snchez Guilln

Pgina III-8-2

III) La informacin celular

8) Meiosis

Diploteno: Los bivalentes inician su separacin, aunque se mantienen unidos por los puntos donde tuvo lugar el sobrecruzamiento, estas uniones reciben ahora el nombre de quiasmas y permiten ver los puntos en los que hubo sobrecruzamientos. En cada par de cromosomas homlogos pueden persistir uno o varios quiasmas, todo depende de cuntos sobrecruzamientos hayan tenido lugar a lo largo del bivalente.

Fig. 8 Profase I: Diacinesis.

Diacinesis: Las cromtidas aparecen muy condensadas preparndose para la metafase. La separacin entre bivalentes persiste y permanecen los quiasmas. Al final de la profase la envoltura nuclear ha desaparecido totalmente y ya se ha formado el huso acromtico.

Fig. 9 Figuras de la profase de la primera divisin de la meiosis (P.A.U. de sept. de 1999).

METAFASE I Los bivalentes se disponen sobre el ecuador del huso, pero lo hacen de tal forma que los dos cinetocoros que tiene cada homlogo se orientan hacia el mismo polo, que es el opuesto hacia el que se orientan los dos cinetocoros del otro homlogo.
Fig. 10 Meiosis: Metafase I.

ANAFASE I Los cromosomas slo presentan un centrmero para las dos cromtidas. Debido a esto, se separan a polos opuesto cromosomas completos con sus dos cromtidas. No se separan 2n cromtidas, sino n cromosomas dobles. Esta disyuncin o separacin de los cromosomas da lugar a una reduccin cromosmica. Como consecuencia, desaparecen los quiasmas.

J. L. Snchez Guilln

Pgina III-8-3

III) La informacin celular

8) Meiosis

La distribucin al azar de los cromosomas es una de las fuentes de variabilidad, ya que pueden producirse como consecuencia de este proceso una gran cantidad de gametos (2 n, siendo n el nmero haploide).
TELOFASE I

Es una telofase normal pero que da lugar a dos clulas hijas cuyos ncleos tienen cada uno n cromosomas con dos cromtidas.

Fig. 11 Meiosis: Anafase I.

INTERFASE

Puede ser variable en su duracin, incluso puede faltar por completo de manera que tras la telofase I se inicia sin interrupcin la segunda divisin. En cualquier caso, nunca hay sntesis de ADN; es decir, es una interfase sin periodo S.
Fig. 12 Meiosis: Anafase I. ( P.A.U. de junio de 1998).

B) DIVISIN II

Es una mitosis normal en la que las dos clulas anteriores separan en la anafase II las cromtidas de sus n cromosomas. Surgen as 4 clulas con n cromtidas cada una.

Profase II

Metafase II

Anafase II

Telofase II

Fig. 13 Segunda divisin de la meiosis.

J. L. Snchez Guilln

Pgina III-8-4

III) La informacin celular

8) Meiosis

SIGNIFICADO BIOLGICO DE LA MEIOSIS

A nivel gentico. El sobrecruzamiento da lugar a nuevas combinaciones de genes en los cromosomas, es responsable de la recombinacin gentica. Por otra parte, cada una de las cuatro clulas finales dispone de un conjunto de n cromtidas que no es idntico al de las otras. Tanto el sobrecruzamiento como el reparto de las cromtidas dependen del azar y dan lugar a que cada una de las cuatro clulas resultantes tenga una coleccin de genes diferentes. Estas colecciones de genes se vern ms adelante sometidas a las presiones de la seleccin natural de tal forma que solamente sobrevivirn las mejores. A nivel gentico, la meiosis es una de las fuentes de variabilidad de la informacin. A nivel celular. La meiosis da lugar a la reduccin cromosmica. Las clulas diploides se convierten en haploides. A nivel orgnico. Las clulas haploides resultantes de la meiosis se van a convertir en las clulas sexuales reproductoras: los gametos o en clulas asexuales reproductoras: las esporas. La meiosis es un mecanismo directamente implicado en la formacin de gametos y esporas. En muchos organismos los gametos llevan cromosomas sexuales diferentes y son los responsables de la determinacin del sexo, en estos casos la meiosis est implicada en los procesos de diferenciacin sexual.

DIFERENCIAS ENTRE LA MITOSIS Y LA MEIOSIS (CUADRO RESUMEN)

MITOSIS A nivel gentico

MEIOSIS

Reparto exacto del material gentico.

Segregacin al azar de los cromosomas homlogos y sobrecruzamiento como fuente de variabilidad gentica.

A nivel celular Como consecuencia de lo anterior se forman clulas genticamente iguales. Produce una reduccin del juego de cromosomas a la mitad exacta de los cromosomas homlogos

A nivel orgnico
Se da este tipo de divisin en los organismos unicelulares para su reproduccin asexual y en pluricelulares para su desarrollo, crecimiento y la reparacin y regeneracin de tejidos y rganos. Sirve para la formacin de las clulas reproductoras sexuales: los gametos, o las clulas reproductoras asexuales: las esporas.

J. L. Snchez Guilln

Pgina III-8-5

III) La informacin celular

8) Meiosis

PRIMERA DIVISIN DE LA MEIOSIS

1) Interfase

2) Profase I. Leptoteno

3) Profase I. Zigoteno

4) Profase I. Diacinesis.

5) Metafase I

6) Anafase I

7) Telofase I

8) Interfase

J. L. Snchez Guilln

Pgina III-8-6

III) La informacin celular

8) Meiosis

SEGUNDA DIVISIN DE LA MEIOSIS

9) Profase II

10) Metafase II

11) Anafase II

12) Telofase II

J. L. Snchez Guilln

Pgina III-8-7

III) La informacin celular

9) Mutaciones

9) LAS MUTACIONES

MUTACIONES Son cambios en la informacin hereditaria. Pueden producirse en clulas somticas o en clulas germinales (las ms trascendentales). La mutacin es un cambio en el material gentico. Por lo tanto, slo son heredables cuando afectan a las clulas germinales; si afectan a las clulas somticas se extinguen, por lo general con el individuo, a menos que se trate de un organismo con reproduccin asexual. Pueden ser: naturales (espontneas) o inducidas (provocadas artificialmente con radiaciones, sustancias qumicas u otros agentes mutgenos).
A T A C G A T A T

Fig. 1 Drosophila. Mutante con alas vestigiales (izd.) y mosca normal (dch.).

ADN original C G C G T T G C C G A T C G

Se distinguen tres tipos de mutaciones segn la extensin del material gentico afectado: -Gnicas o puntuales -Cromosmicas estructurales -Cromosmicas numricas o genmicas 1) Mutaciones gnicas: Son aquellas que producen alteraciones en la secuencia de nucletidos de un gen. Existen varios tipos: a) Sustituciones de pares de bases. stas pueden ser: - Transiciones: Es el cambio en un nucletido de una base prica por otra prica o de una pirimidnica por otra pirimidnica. - Transversiones: Es el cambio de una base prica por una pirimidnica o viceversa. b) Perdida o insercin de nucletidos, lo que induce a un corrimiento en el orden de lectura. Pueden ser:

G C

G C

A A

Agente fsico o qumico

A T

T A

A T

A T

C G

G C

C G

A T

C G

G C

G A

A A

ADN con mutacin gnica

Fig. 2 Mutacin gnica.

1) Transicin

Nuevas cadenas

2) Transversin

Nuevas cadenas

Fig. 3 Mutaciones gnicas por sustitucin: transicin y transversin.

J. L. Snchez Guilln

Pgina III-9-1

III) La informacin celular

9) Mutaciones

- Adiciones gnicas: Es la insercin de nucletidos en la secuencia del gen. - Deleciones gnicas: Es la prdida de nucletidos. Las sustituciones provocan la alteracin de un nico triplete y, por tanto, salvo que indiquen un triplete de parada, o un aminocido del centro activo de una enzima, pueden no ser perjudiciales. Sin embargo, las mutaciones que impliquen un corrimiento en el orden de lectura, adiciones o deleciones, salvo que se compensen entre s, pueden alterar la secuencia de aminocidos de la protena codificada y sus consecuencias suelen ser graves.

Fig. 4 Glbulos rojos de una persona con anemia falciforme.

Consecuencias de una adicin: Corrimiento en el orden de lectura.

Consecuencias de una sustitucin


ADN Original Mutado Original Mutado Original Mutado -A-C-A-A-C-G-A-C-A-A-C-C-A-C-A-A-C-TARNm -U-G-U-U-G-C-U-G-U-U-G-G-U-G-U-U-G-AAminocido Cys Cys Cys Trp Cys Stop Consecuencias Ninguna, pues el codn codifica el mismo aminocido. Sustitucin de un aminocido por otro, pues el codn codifica un aminocido distinto. Generacin de una seal de stop.
C T A C G T T A C G T T A C G

ADN original A A T G C T T A A A T A

G C

-Met-Gln-Cys-Leu-Arg-Ile-Tyr-

ADN mutado T A A C G A A T G C T T A A A T

G C

U A G

-Met-Gln-Leu-Leu-Thr-Asn-Leu-

Fig. 6 Consecuencias de una sustitucin.

Fig. 5 Consecuencias de una adicin.

2) Mutaciones cromosmicas estructurales: Son los cambios en la estructura interna de los cromosomas. Se pueden agrupar en dos tipos: a) Las que suponen prdida o duplicacin de segmentos: - Delecin cromosmica: Es la prdida de un segmento de un cromosoma. - Duplicacin cromosmica: Es la repeticin de un segmento del cromosoma. b) Las que suponen variaciones en la distribucin de los segmentos de los cromosomas. - Inversiones: Un segmento cromosmico de un cromosoma se encuentra situado en posicin invertida. - Translocaciones: Un segmento cromosmico de un cromosoma se encuentra situado en otro cromosoma.

J. L. Snchez Guilln

Pgina III-9-2

III) La informacin celular

9) Mutaciones

a b c d e f g h i

a b c d e f g

a b c d e f

a b c d e f d e f

Deficiencia o delecin
a b c d e f g h i 1 2 3 4 5 6 7 a b c d e f g 6 7 1 2 3 4 5 h i

Duplicacin
a b c d e f g h i a b c d h g f e i

Traslocacin

Inversin

ORIGEN DE ALGUNAS MUTACIONES CROMOSMICAS ESTRUCTURALES Todos los cambios estructurales que se producen en los cromosomas pueden explicarse por la rotura y reunin de sus fragmentos. Podemos considerar 3 casos posibles, el primero se refiere a un solo cromosoma y los dos ltimos a parejas de cromosomas. a) Roturas que afectan a un cromosoma:

Delecin

Inversin

Fig. 7 1er caso.

Duplicacin

Delecin

1er caso.- Si la rotura se produce dentro de un brazo del cromosoma los fragmentos pueden reunirse dando lugar a una delecin o a una inversin ms un fragmento sin centrmero (acntrico) que se pierde. b) Roturas que afectan a cromosomas distintos: 21 caso.- Si la rotura afecta a dos cromosomas homlogos simultneamente. Despus de la rotura la reunin de los fragmentos puede producir una duplicacin ms una delecin.

Fig. 8 2 caso.

Traslocacin

Fig. 9 3er caso.

J. L. Snchez Guilln

Pgina III-9-3

III) La informacin celular

9) Mutaciones

3er caso.- Afecta a dos cromosomas no homlogos. Despus de la rotura se produce un intercambio de fragmentos dando lugar a una translocacin entre cromosomas no homlogos: translocacin recproca.

Efecto fenotpico de las mutaciones cromosmicas estructurales: Las deleciones y duplicaciones producen un cambio en la cantidad de genes y por tanto tienen efectos fenotpicos, por lo general deletreos. Sin embargo las inversiones y translocaciones no suelen tener efecto fenotpico, pues el individuo tiene los genes correctos, aunque de las translocaciones pueden derivarse problemas de fertilidad por apareamiento defectuoso de los cromosomas durante la gametognesis o la aparicin de descendientes con anomalas.
Ejemplo de mutacin cromosmica estructural: En la especie humana, una delecin particular en el cromosoma 5 provoca el sndrome " cri du chat" (grito de gato) que se caracteriza por microcefalia, retraso mental profundo y detencin del crecimiento.

Importancia evolutiva de las mutaciones cromosmicas estructurales.- La delecin apenas tiene importancia evolutiva, mientras que la duplicacin en cambio posee una importancia evolutiva grande. A su vez, las inversiones y translocaciones estn tambin asociadas de una forma importante a la evolucin, por ejemplo la fusin de dos cromosomas acrocntricos puede dar lugar a uno metacntrico, como ha ocurrido con el cromosoma 2 de la especie humana, que es el resultado de la fusin de dos cromosomas de un mono antepasado antropomorfo. Distintos genes de hemofilia se han adquirido por duplicaciones en el transcurso de la evolucin. 3) Mutaciones cromosmicas numricas: Son alteraciones en el nmero de los cromosomas propios de la especie. Pueden ser: Euploidas y Aneuploidas a) Euploida: Cuando afecta al nmero de juegos completos de cromosomas con relacin al nmero normal de cromosomas de la especie. Las euploidas se pueden clasificar por el nmero de cromosomas que se tengan en: -Monoploida o haploida: Si las clulas presentan un solo juego (n) de cromosomas. -Poliploida: Si presentan ms de dos juegos; pudiendo ser: triploides (3n), tetraploides (4n), etc. Tambin se pueden clasificar por la procedencia de los cromosomas en: -Autopoliploida. Si todos los juegos proceden de la misma especie. -Alopoliploida. Si los juegos proceden de la hibridacin de dos especies. Origen de las euploidas.- Si durante la meiosis se produce en algunas clulas la no disyuncin de todos los cromosomas homlogos se originarn dos gametos con 2n cromosomas y dos gametos sin cromosomas (0). La unin de estos gametos entre s o con gametos n, puede producir zigotos haploides, triploides o tetraploides (n+0, n+2n, 2n+2n). En las plantas pueden conseguirse tetraploides, experimentalmente, por tratamientos con colchicina. Efectos fenotpicos de las euploidas.- En general, las anomalas en los euploides son menores que en los aneuploides, en los que los efectos fenotpicos son mayores al no mantenerse equilibradas las dosis relativas de genes.

J. L. Snchez Guilln

Pgina III-9-4

III) La informacin celular

9) Mutaciones

8 Cromosomas

12 Cromosomas

16 Cromosomas

Cariotipo

Cariotipo

Cariotipo

3 Diploide 2n

3 Triploide 3n

3 Tetraploide 4n

Fig. 10 Autopoliploidas en una especie con 2n=8 cromosomas.

b) Aneuploidias: Se dan cuando est afectada slo una parte del juego cromosmico y el zigoto presenta cromosomas de ms o de menos. Las aneuploidas pueden darse tanto en los autosomas (por ejemplo: el Sndrome de Down), como en los heterocromosomas o cromosomas sexuales (por ejemplo: el sndrome de Turner o el sndrome de Klinefelter). stas alteraciones se denominan: - Monosomas: si falta uno de los cromosomas de la pareja de homlogos. - Trisomas: si se tienen tres cromosomas en lugar de los dos normales. - Tetrasomas: si se tienen 4. Etc.
Ejemplo de trisoma: el Sndrome de Down o trisoma 21. Existe un tipo de trisoma particularmente corriente en la especie humana, es la llamada trisoma 21 o sndrome de Down (tambin conocida como mongolismo). Las personas que presentan este sndrome se caracterizan por tener retraso mental, cuerpo corto, dedos cortos y gruesos, lengua hinchada y un pliegue en el prpado parecido al de las razas monglicas. Est demostrada la relacin entre el sndrome de Down y una avanzada edad en la madre. En ciertos casos de mongolismo el individuo presenta una placa metafsica normal con 46 cromosomas, pero uno de los cromosomas del grupo 13-15 es mayor, por lo que se cree que lo que ha sucedido es una translocacin de uno de los cromosomas 21 en exceso a uno de los cromosomas del grupo 13-15.

Fig. 11 Ideograma del cariotipo de una clula de una persona con trisoma 21.

J. L. Snchez Guilln

Pgina III-9-5

III) La informacin celular

9) Mutaciones

Parece ser que las trisomas se originan por una no disyuncin de los cromosomas en la primera divisin de la meiosis (ver figura).
No disyuncin del par 21.

par 21

DI 21 21

Importancia evolutiva de las aneuploidas.Tienen ms importancia evolutiva que las anteriores de cara a la obtencin de nuevas especies.
21 21 21

D II

21 21 21

Formacin de un zigoto con trisoma 21 por unin entre un espermatozoide con un 21 y un vulo con dos 21, originado por una no disyuncin del par 21 en la primera divisin de la meiosis.

Fig. 12 Trisoma 21 originada por una no disyuncin del par 21 en la anafase de la 1 divisin de la meiosis del ovocito primario.

Las aneuploidas y sus consecuencias en la meiosis


Cariotipo normal Nulismico

Contenido cromosmico de los gametos o de las esporas: n cromosomas. Monosmico

Contenido cromosmico de los gametos o de las esporas: n-1 cromosomas. Trismico

Contenido cromosmico de los gametos o de las esporas: n y n-1 cromosomas. Tetrasmico

Contenido cromosmico de los gametos o de las esporas: n y n+1 cromosomas. Doble trismico

Contenido cromosmico de los gametos o de las esporas: n+1 cromosomas.

Contenido cromosmico de los gametos o de las esporas: n, n+1 y n+2 cromosomas.

J. L. Snchez Guilln

Pgina III-9-6

III) La informacin celular

9) Mutaciones

LAS ANEUPLOIDAS MS IMPORTANTES EN LA ESPECIE HUMANA Y SUS EFECTOS

Aneuploidas en los autosomas Sndrome Sndrome de Down Sndrome de Edwards Mutacin Trisoma del par 21 Trisoma del par 18 Caractersticas fenotpicas Ojos oblicuos, retraso mental, cabeza ancha y cara redondeada. Boca y nariz pequeas, deficiencia mental, lesiones cardacas, membrana interdigital. Poca viabilidad. Labio leporino, paladar hendido, deficiencias cerebrales y cardiovasculares. Poca viabilidad.

Sndrome de Patau

Trisoma del par 13

Aneuploidas en los cromosomas sexuales Sndrome Sndrome de Klinefelter Mutacin Uno o ms cromosomas X en exceso (XXY, XXXY,..). Caractersticas fenotpicas Sexo masculino. Esterilidad, deficiencias mentales y algunos caracteres sexuales secundarios femeninos. Sexo femenino con un slo cromosoma X, esterilidad, baja estatura, trax ancho. Varones de estatura elevada, se relaciona con una mayor agresividad, bajo coeficiente mental. Sexo femenino.Rasgos fsicos similares a otras mujeres de su edad, aunque ms altas de lo normal. Problemas de lenguaje. Frtiles

Sndrome de Turner

Monosoma del cromosoma X.

Sndrome de doble Y

Dos cromosomas Y (XYY)

Sndrome de triple X

Tres cromosomas X

J. L. Snchez Guilln

Pgina III-9-7

III) La informacin celular

9) Mutaciones

AGENTES MUTGENOS Un agente mutgeno es todo factor capaz de aumentar la frecuencia de mutacin natural. Existen diversos factores, tanto fsicos como qumicos, capaces de actuar como agentes mutgenos. En realidad, actuarn como agentes mutgenos todos aquellos agentes capaces de alterar el material gentico y en particular, aquellos que alteren la secuencia del ADN. Los principales agentes mutgenos son: a) Agentes fsicos: -Las radiaciones electromagnticas como los rayos X y los rayos gamma. -Las radiaciones corpusculares como los rayos , los rayos y los flujos de protones o neutrones que generan los reactores nucleares u otras fuentes de radiactividad natural o artificial. -Ciertos factores fsicos como los ultrasonidos, los choque trmicos, la centrifugacin, etc. b) Agentes qumicos: - Los anlogos de las bases nitrogenadas. - El cido nitroso (HNO2), porque desamina ciertas bases nitrogenadas. - Los alcaloides como la cafena, la nicotina, etc. - El gas mostaza, el agua oxigenada (H2O2), el ciclamato, etc.

MUTACIONES Y EVOLUCIN La evolucin se debe a aquellos procesos por los que las poblaciones cambian sus caractersticas genticas a lo largo del tiempo. Se llama "pool" gnico de una poblacin al conjunto de genes de la misma, formado por todos los alelos de los genes que tienen los individuos que la constituyen. Una combinacin favorable de alelos en un individuo favorece su supervivencia y por tanto su reproduccin y su extensin en la poblacin. La mutacin es la fuente primaria de variacin, pero no la nica. La recombinacin gnica incrementa la variabilidad. La mayora de los cambios evolutivos se producen por acumulacin gradual de mutaciones en los genes y por variaciones en su nmero y organizacin. Ahora bien, la mayor parte de las mutaciones gnicas son deletreas (mortales) y las que se han mantenido es porque producen una mejora y son las esenciales para la evolucin.

Fig. 13 Las aves gigantes provienen todas ellas de antepasados comunes.

La separacin entre los miembros de una poblacin impide el intercambio gentico entre los mismos. Esto produce cada vez ms diferenciacin al tener que adaptarse a ambientes distintos. Cuando con el tiempo se acumulan diferencias que impiden la reproduccin entre los miembros de esos grupos decimos que se trata de especies distintas. Parece ser que los seres, a lo largo del tiempo, han ido aumentando la cantidad de genes

J. L. Snchez Guilln

Pgina III-9-8

III) La informacin celular

9) Mutaciones

(duplicaciones) lo que ha supuesto que sobre estos genes duplicados pudieran generarse mutaciones con un menor riesgo y favorecer el proceso de creacin de variabilidad. As, en eucariotas, la cantidad de ADN es mayor que en otros grupos y mayor que la necesaria para contener la informacin gentica.

EL CNCER: ENFERMEDAD GENTICA CONCEPTO DE CNCER Y SU RELACIN CON EL ADN Se desarrolla un tumor cuando se produce una multiplicacin y crecimiento irregular de las clulas. En general, los tumores pueden ser: -Tumores benignos: Localizados y sin crecimiento indefinido. -Tumores malignos: Son aquellos tumores que crecen invadiendo y destruyendo a los dems tejidos. El cncer es una enfermedad o un conjunto de ellas que consiste en la multiplicacin de ciertas clulas alteradas que forman tumores malignos y pueden emigrar a otros puntos a travs del sistema linftico o circulatorio: metstasis. Las clulas cancerosas crecen a gran velocidad, tienen protenas de membrana distintas, presentan alteraciones en la forma e invaden a los tejidos prximos. El paso de clula normal a cancerosa se denomina transformacin cancerosa. Puede deberse a: - Mutaciones. - Influencia de factores ambientales. - Presencia de ciertos genes (protooncogenes) que pasan a oncogenes al sufrir una mutacin. - Presencia de ciertos genes (antioncogenes) o genes inhibidores o supresores de la divisin celular. 1) Cncer producido por virus Se conocen virus que favorecen o facilitan la aparicin de clulas cancergenas, debido a que producen mutaciones y algunas de estas mutaciones pueden ser cancergenas. 2) Cncer producido por sustancias qumicas o por radiaciones. En humanos, la mayora de los cnceres estn fundamentalmente relacionados con agentes cancergenos como: Radiaciones UV, X y nucleares Alquitrn Ahumados Pan tostado chamuscado Amianto Cloruro de vinilo Anilinas Algunos conservantes y edulcorantes artificiales Bebidas alcohlicas (sobre todo de alta graduacin) Tabaco (pulmn)

Cncer de piel

Cncer de pulmn

Fig. 14 Agentes fsicos y qumicos productores de cncer.

J. L. Snchez Guilln

Pgina III-9-9

III) La informacin celular

9) Mutaciones

Los agentes mutgenos pueden ser cancergenos. No son de efectos inmediatos. Es necesario que acten repetidamente y que se presenten otros factores para que se produzca la transformacin de una clula normal en cancerosa.

J. L. Snchez Guilln

Pgina III-9-10

III) La informacin celular

10) Herencia gentica

10) LA HERENCIA GENTICA

CONCEPTO DE GENTICA

Definiremos la gentica como la parte de la Biologa que se ocupa del estudio de la herencia biolgica, intentando explicar los mecanismos y circunstancias mediante los cuales se rige la transmisin de los caracteres de generacin en generacin.

ALELOS

Para un gen pueden existir a veces diferentes variedades que pueden dar lugar a caractersticas distintas en el individuo. As, por ejemplo, en el guisante, el gen A determina que los guisantes sean de color amarillo y el gen a determina que sean de color verde. Se llaman alelos a las distintas variedades de un gen para un carcter; A y a son genes alelos para el carcter que determina el color en los guisantes.

RELACIONES ALLICAS: HOMOCIGOSIS Y HETEROCIGOSIS

Los individuos diploides poseen en sus clulas dos juegos de cromosomas homlogos, uno aportado por el gameto masculino y el otro por el gameto femenino. Dado que los genes residen en los cromosomas, resulta evidente que para cada carcter el individuo tendr dos genes. Si en ambos cromosomas homlogos reside el mismo alelo diremos que el individuo es homocigtico para ese carcter. Por ejemplo, un guisante que tenga como genes para el color AA, es homocigtico, tambin lo es el que tenga aa. Por el contrario, si en cada homlogo hay un alelo distinto, el individuo ser heterocigtico para ese carcter. Por ejemplo, los guisantes Aa seran heterocigticos.

Homocigticos

Heterocigtico

Fig. 1 Homocigosis y heterocigosis.

DOMINANCIA Y RECESIVIDAD. CODOMINANCIA

Los individuos homocigticos manifestarn el carcter externo que viene definido por sus genes. As, los guisantes AA sern amarillos y los aa sern verdes.

J. L. Snchez Guilln

Pgina III-10-1

III) La informacin celular

10) Herencia gentica

Sin embargo, cuando tratamos del fenmeno de la heterocigosis se plantea la pregunta de ) cul ser la resultante de ambos alelos? Generalmente, en los heterocigticos slo se manifiesta el carcter definido por uno de los dos alelos. Dicho alelo se dice que es el dominante, mientras que le otro, que slo se manifiesta en homocigosis, se dice que es el alelo recesivo. En el caso del color de los guisantes, A, el que determina el color amarillo, es dominante sobre el alelo a, que determina el color verde. El heterocigoto Aa presenta color amarillo. Vemos que el efecto de la dominancia enmascara uno de los genes en el heterocigtico. Hay algunos caso en los que ambos alelos se hacen patentes en el heterocigtico; se dice entonces que son codominantes. Por ejemplo, en el hombre, el alelo IA determina el grupo sanguneo A y el alelo IB el grupo B. Un individuo IAIA pertenece al grupo A, IBIB al grupo B y el heterocigtico IAIB al AB. IA IA ....... Homocigtico ...... Grupo A IBIB ....... Homocigtico ...... Grupo B IA IB ....... Heterocigtico ..... Grupo AB En otros casos, como en el del color de las flores del dondiego de noche (Mirabilis jalapa), los heterocigticos RB (R, rojo y B, blanco) para el color de las flores, son rosas. Se dice que ambos genes presentan herencia intermedia, pues el heterocigtico manifiesta una mezcla de ambos genes.

AA

aa

Aa

Fig. 2 Dominancia en el color de la piel de los guisantes. El hbrido, Aa, es de color amarillo.

Fig. 3 Dondiego de noche (Mirabilis jalapa).

RR

BB

RB

Fig. 4 Herencia intermedia en el color de las flores del dondiego de noche (Mirabilis jalapa).

CMO SE REPRESENTAN LOS GENES?

Como hemos visto, los genes se representan mediante letras. En el caso de ser slo dos los alelos de un gen, uno dominante y otro recesivo, lo que es lo ms corriente, le asignaremos una letra mayscula al gen dominante, por ejemplo (A), y la misma letra en

Fig. 5 Drosophila. Izquierda, mutante con alas vestigiales (vg) y derecha, mosca de alas normales (vg+ ).

J. L. Snchez Guilln

Pgina III-10-2

III) La informacin celular

10) Herencia gentica

minsculas al recesivo (a). Cuando los genes que se conocen en una especie son numerosos, como es el caso de la mosca del vinagre, Drosophila, se pueden asignar una o dos letras minsculas seguidas del signo ms (+) para el dominante (por ejemplo vg +, alas normales) y la misma o las mismas letras sin el signo ms (+) al recesivo (vg, alas vestigiales). En el caso de herencia intermedia, ambos genes se representan mediante la inicial en maysculas (R, color rojo de la flor en el dondiego y B, color blanco de la flor). En el caso de codominancia, como es el de los grupos sanguneos A y B, se indican mediante una letra en maysculas (I) para ambos y un superndice que los distinga (IA para el que determina el grupo A e IB para el B).

GENOTIPO Y FENOTIPO

Los caracteres externos que exhibe un individuo constituyen su fenotipo mientras que los genes que determinan ese fenotipo son su genotipo. En los guisantes, el color amarillo de las semillas es el fenotipo, que est determinado por el genotipo AA o el Aa, el fenotipo verde est determinado por el genotipo aa. El fenotipo de un individuo no depende solamente de su genotipo, sino tambin de las circunstancias ambientales. Se puede afirmar que el fenotipo es el resultado de la accin de los genes expresada en un ambiente determinado.
FENOTIPO = GENOTIPO + AMBIENTE

Las flores de la hortensia pueden ser azules, si las plantas son cultivadas en tierra cida, y de color rosa si la tierra es alcalina. El pH del suelo incide, en este caso, sobre el fenotipo. Otro curioso ejemplo de la accin del ambiente lo tenemos en los conejos de la raza Himalaya. Si estos conejos son criados en su ambiente natural, fro, desarrollan un pigmento negro en la punta de la nariz y en los extremos de las orejas y de las patas. Los mismos conejos criados en una temperatura clida pierden todo el pigmento y son totalmente blancos. Se ha demostrado que si una regin del cuerpo de estos conejos es enfriada artificialmente durante algunos das aparece en ella la pigmentacin. En la raza Himalaya, el gen para el color del pelo determina la presencia de una enzima que hace posible la aparicin del pigmento; esta enzima es, sin embargo, muy sensible a la temperatura, siendo inactivada por las altas temperaturas, lo que conduce a la falta de pigmentacin. Las partes ms fras del cuerpo de estos animales son siempre las extremidades, lo que explica la curiosa distribucin del pigmento. Es de destacar que a la hora de escribir el genotipo, en el caso del heterocigtico, siempre se indica primero el gen dominante y despus el recesivo y nunca al revs (Aa, Nn o vg + vg y no aA, nN o vvg + ). Cuando uno de los genes del genotipo no se conozca, lo indicaremos

J. L. Snchez Guilln

Pgina III-10-3

III) La informacin celular

10) Herencia gentica

mediante una raya. Por ejemplo, si en los cobayas el pelo negro (N) domina sobre el blanco (n), si tenemos un cobaya de pelo negro, podr ser, si no tenemos ms datos, tanto NN como Nn. Esto es, su genotipo ser N-.

HERENCIA DE UN SOLO CARCTER

A) 1 LEY DE MENDEL. LEY DE LA UNIFORMIDAD DE LOS HBRIDOS DE LA PRIMERA GENERACIN FILIAL. Cuando se cruzan dos variedades, individuos de raza pura, ambos para un determinado carcter (homocigotos), todos los hbridos de la primera generacin son iguales fenotpica y genotpicamente. Mendel lleg a esta conclusin al cruzar variedades puras (homocigticas) de guisantes amarillas y verdes, pues siempre obtena de este cruzamiento variedades de guisante amarillas.

AA

aa

Progenitores

Gametos

Aa

F1

Fig. 6 1 Ley de Mendel.

Aa
B) 2 LEY DE MENDEL. LEY DE LA SEGREGACIN DE LOS GENES QUE FORMAN LA PAREJA DE ALELOS DE LA F1. Mendel tom plantas procedentes de las semillas de la primera generacin (F1 ) del experimento anterior, amarillas, Aa, y las poliniz entre s. Del cruce obtuvo semillas amarillas y verdes en la proporcin 3:1 (75% amarillas y 25% verdes). As pues, aunque el alelo que determina la coloracin verde de las semillas pareca haber desaparecido en la primera generacin filial, vuelve a manifestarse en esta segunda generacin.

Aa

F1

a
F2

Gametos

A A a AA Aa

a Aa aa

Fig. 7 2 Ley de Mendel.

RETROCRUZAMIENTO

El retrocruzamiento permite determinar si un individuo que exhibe el fenotipo del gen dominante es homocigtico (AA) o heterocigtico (Aa). El nombre de retrocruzamiento se debe a que para saber si los descendientes de la F2 son homocigticos o heterocigticos se

J. L. Snchez Guilln

Pgina III-10-4

III) La informacin celular

10) Herencia gentica

cruzan con el parental homocigtico recesivo (aa). As, para saber si una planta de guisantes amarilla es AA o Aa, la cruzaremos con una planta verde (aa). Si los descendientes son todos amarillos, esto querr decir que la planta problema es homocigtica (AA) y si la mitad son amarillos y la otra mitad verdes, la planta ser heterocigtica (Aa).

F1

Amarillo
A?

Verde aa

Gametos

?=A

?=a

a A

Amarillo
AA

Amarillo Aa 50% Verde aa

Amarillo
A Aa

HERENCIA DE DOS CARACTERES SIMULTANEAMENTE A) GENES LOCALIZADOS EN PARES DE CROMOSOMAS HOMLOGOS DISTINTOS

Fig. 8 Retrocruzamiento.

En los guisantes, los genes A y a determinan el color y los genes B y b determinan la textura de la piel (B, lisa y b, rugosa). El locus (locus= lugar, localizacin) para los genes que determinan estos dos caracteres se encuentra en pares de cromosomas homlogos distintos. Cuando los genes no alelos, genes que determinan dos caracteres distintos, se encuentran en pares de cromosomas homlogos diferentes, como es el caso del color y de la textura de los guisantes, se transmiten a la F2 independientemente unos de otros. A esta conclusin lleg Mendel en su 3 Ley contabilizando los descendientes de los cruzamientos de la autopolinizacin de una planta amarillo, lisa, doble heterocigtica (Aa,Bb), al obtener una segregacin: 9:3:3:1.

Fig. 9 Gametos que forma un dihbrido (Aa,Bb) cuando los genes que determinan ambos caracteres son independientes.

AaBb

AaBb

AB Ab aB ab

AB Ab aB ab

AB AB Ab aB AA,BB AA,Bb Aa,BB Aa,Bb

Ab

aB

ab

AA,Bb Aa,BB Aa,Bb AA,bb Aa,Bb Aa,bb Aa,Bb aa,BB Aa,bb aa,Bb aa,Bb aa,bb

9, 3, 3, 1,

amarillos, lisos; amarillos, rugosos; verdes, lisos; verde, rugoso.

ab

Fig. 10 3 Ley de Mendel. Segregacin 9:3:3:1 que demuestra que ambos caracteres, color de la piel y textura, son independientes.

J. L. Snchez Guilln

Pgina III-10-5

III) La informacin celular

10) Herencia gentica

Esto hoy se entiende porque sabemos que los cromosomas emigran aleatoriamente a los polos y durante la anafase I se separan los cromosomas homlogos de cada par. Despus, en la anafase II, se separan las cromtidas de cada cromosoma y se forman cuatro clases de gametos, cada uno de los cuales posee n cromosomas. Puesto que su distribucin se realiza totalmente al azar, una planta que sea (Aa,Bb) podr agrupar los genes de cuatro formas diferentes (Fig. 9) y formar cuatro tipos de gametos: (A,B), (A,b), (a,B) y (a,b), todos ellos en el mismo porcentaje: 25%.
B) GENES LOCALIZADOS EN EL MISMO PAR DE CROMOSOMAS HOMLOGOS. LIGAMIENTO Y RECOMBINACIN.

A B

a b

A B

a b

Fig. 11 Gametos que forma un dihbrido (Aa,Bb) cuando los genes que determinan ambos caracteres se encuentran ligados con ligamiento absoluto.

Los genes que se encuentran en el mismo cromosoma se dice que son genes ligados. Todos los genes que se encuentran en un mismo cromosoma constitu yen un grupo de ligamiento.
B1) LIGAMIENTO ABSOLUTO

p) parentales r) recombinantes

Si los genes ligados estn muy prximos, lo ms probable ser que durante la profase I de la meiosis no se produzca ningn sobrecruzamiento entre ellos y pasarn juntos a los gametos sin separarse. En este caso diremos que el ligamiento es absoluto. As, supongamos dos genes ligados a y b, y un individuo diheterocigtico Aa,Bb en el que los genes A y B estn en un cromosoma y a y b en el homlogo. Podremos representar los genes en los cromosomas como se indica en la Fig. 11 . Estos genes, al estar muy prximos, lo ms probable ser que no haya sobrecruzamiento entre los loci a y b, los gametos recibirn o el cromosoma con A,B o el que porte a,b. Por lo tanto, se formarn slo dos clases de gametos: A,B y a,b (ver Fig. 11 ).

Fig. 12 Gametos que forma un dihbrido (Aa,Bb) cuando los genes que determinan ambos caracteres se encuentran ligados con ligamiento relativo y hay recombinacin entre ellos.

Fig. 13 Gametos que forma un dihbrido (Aa,Bb) cuando los genes que determinan ambos caracteres se encuentran ligados con ligamiento relativo y no hay recombinacin entre ellos.

J. L. Snchez Guilln

Pgina III-10-6

III) La informacin celular

10) Herencia gentica

B2) LIGAMIENTO RELATIVO: ENTRECRUZAMIENTO CROMOSMICO Y RECOMBINACIN

Si los loci ligados se encuentran lo suficientemente separados, en la profase I de la meiosis, podr producirse un sobrecruzamiento entre ellos, lo que dar lugar a que se formen cuatro tipos de gametos (ver Fig. 12 ), mientras que en otras no se producir, y slo se formarn dos tipos de gametos (ver Fig. 13 ). Obsrvese que, de los cuatro gametos surgidos de la meiosis con sobrecruzamiento, dos de ellos tienen los genes ligados de la misma manera que en los cromosomas de los progenitores, son los gametos parentales (p), los otros dos gametos llevan las cromtidas producto del sobrecruzamiento y se les llama gametos recombinantes (r). La probabilidad de que se produzca un sobrecruzamiento entre genes ligados depende de la distancia que separa los loci en el cromosoma. Entre loci muy prximos ser difcil que se produzca recombinacin y la probabilidad de que los gametos lleven las cromtidas recombinantes ser baja. Por el contrario, entre dos loci muy alejados el sobrecruzamiento ser muy probable por lo que la cantidad de gametos recombinantes se acercar al 50% del total de los gametos producidos. Es de destacar que en el macho de Drosophila no se producen sobrecruzamientos.

FRECUENCIA DE RECOMBINACIN. MAPAS CROMOSMICOS

La probabilidad de los gametos recombinantes para un par de genes ligados es un valor constante que depende, principalmente, de la distancia a la que se encuentren los genes en el cromosoma. Esta probabilidad recibe el nombre de frecuencia de recombinacin. La frecuencia de recombinacin entre dos genes ligados es igual a la suma de las frecuencias de los gametos recombinantes. La unidad de medida de la frecuencia de recombinacin es el centimorgan (). 1 = 1% de recombinacin Si dos genes ligados se encuentran alejados en un cromosoma su frecuencia de recombinacin ser alta, prxima al 50%, y baja si se encuentran prximos.

eb

20

44

cu

24

se

Fig. 14 Distancias relativas de los genes ligados en Drosophila: eb (cuerpo bano); cu (alas curvadas); se (ojos color sepia). Estas distancias se han establecido en base a la frecuencia de recombinacin entre estos tres genes.

Veamos un ejemplo con los siguientes genes en Drosophila: el gen cu, que da lugar a alas

J. L. Snchez Guilln

Pgina III-10-7

III) La informacin celular

10) Herencia gentica

anormales curvadas, el gen se, que produce ojos de color sepia, frente a los normales de color rojo, y el gen eb que produce una coloracin bano del cuerpo. Todos ellos son genes ligados. Las frecuencias de recombinacin son respectivamente: se con cu ...... 24% ...... 24 se con eb ...... 44% ...... 44 cu con eb ...... 20% ...... 20 Lgicamente, esto nos indica que se y eb son los ms alejados entre s y que cu se encuentra entre ambos (ver Fig. 14). De acuerdo con esto podremos establecer el orden en que se encuentran estos tres genes en el cromosoma y tambin las distancias relativas medidas en centimorgan. Las frecuencias de recombinacin han permitido elaborar mapas cromosmicos. Estos mapas indican la situacin y la distancia relativa a la que se encuentran los genes en el cromosoma.

LA DETERMINACIN DEL SEXO

Es sabido que en la especie humana el sexo viene determinado por la pareja cromosmica XY. Ahora bien, en la naturaleza, existen diferentes mecanismos para la determinacin del sexo. As: a) Determinacin sexual debida a un par de genes; como ocurre, por ejemplo, en las plantas dioicas. b) Determinacin sexual por cromosomas sexuales. En este caso, el sexo depende de la presencia o ausencia de determinados cromosomas. En el reino animal, los sistemas ms frecuentes de determinacin sexual son:
- Sistema XX-XY . Como el del hombre y el resto de los mamferos. En el que el sexo femenino tiene dos cromosomas iguales XX (homogamtico); por lo que todos los gametos llevarn el cromosoma X. El sexo masculino posee un conjunto XY (heterogamtico); por lo que dar lugar a dos tipos de gametos, la mitad con el cromosoma X y la otra mitad con el cromosoma Y.

Mujer

Hombre

XX

XY

XX

XY

Fig. 15 Determinacin del sexo en la especie humana.

- Sistema ZZ-ZW. Se da en aves, reptiles, etc. En este caso el macho es el sexo homogamtico (ZZ) y la hembra el heterogamtico (ZW).

J. L. Snchez Guilln

Pgina III-10-8

III) La informacin celular

10) Herencia gentica

- Sistema XX-XO. La hembra es homogamtica XX y el macho heterogamtico (XO) posee un slo cromosoma X y no tiene cromosoma Y. Se da en liblulas, saltamontes...

c) Sexo por haploidia: Los huevos fecundados (diploides) dan lugar a hembras y los no fecundados (haploides) a machos. Ejemplo: las abejas. d) Sexo debido al equilibrio gentico: Drosophila posee un sistema XX-XY pero el cromosoma Y no determina el sexo masculino, aunque sea necesario para la fertilidad. La determinacin sexual se encuentra en los autosomas y depende de la relacin numrica entre el nmero de cromosomas X y el de juegos autosmicos (A). X/A X/A X/A X/A X/A < 0,5.................Supermacho = 0,5 ................Macho entre 0,5 y 1.......Intersexo = 1.....................Hembra > 1.....................Superhembra

e) Sexo debido a factores ambientales. En ciertos casos, por ejemplo, en ciertas especies de cocodrilos, el sexo se determina en funcin de la temperatura de incubacin de los huevos. f) Inversin sexual. El sexo depende de la proporcin de machos y hembras existentes en la poblacin o de la edad. As, ciertos peces cuando son jvenes tienen un sexo y de adultos tienen otro.

LA HERENCIA LIGADA AL SEXO EN LA ESPECIE HUMANA

Los cromosomas sexuales, adems de los genes que determinan el sexo, tienen tambin otros genes que no tienen nada que ver con los caracteres sexuales. Estos genes son los genes ligados al sexo. En la especie humana, el cromosoma Y, al ser de menor tamao, posee menos informacin que el cromosoma X. Esta es la razn de que la mayora de los caracteres ligados al sexo que se conocen sean caracteres ligados al cromosoma X. As, en el cromosoma X se han detectado hasta 150 loci, algunos de ellos portadores de ciertas anomalas.

- Herencia ligada al cromosoma Y Un gen ligado al cromosoma Y se manifestar en todos los hombres que lo lleven y slo en los hombres, independientemente de que sea dominante o recesivo. Entre los pocos casos que se conocen de anormalidad hereditaria ligada al cromosoma Y tenemos la hipertricosis del pabelln auricular. Se trata de un carcter cuyo gen determina la aparicin de pelo en el pabelln de la oreja.

J. L. Snchez Guilln

Pgina III-10-9

III) La informacin celular

10) Herencia gentica

- Herencia ligada al cromosoma X


Mujer Hombre

Los genes dominantes ligados al cromosoma X son muy poco frecuentes. Se trata de un tipo de herencia que se caracteriza por que los varones afectados transmiten el carcter a todas sus hijas y a ninguno de sus hijos. Las mujeres afectadas lo transmiten a la mitad de sus hijos y a la mitad de sus hijas. Un ejemplo de este tipo de herencia es la hipofosfatemis (raquitismo que no cede con la administracin de vitamina D). Los genes recesivos ligados al cromosoma X slo se manifiestan en la mujer, en el caso de que estn en homocigosis, en el hombre se manifestarn siempre. Un ejemplo tpico es el de la hemofilia. Se trata de una enfermedad hereditaria caracterizada por ausencia en la sangre de las personas que la padecen de un factor necesario para su coagulacin. Las personas hemoflicas, sin un tratamiento adecuado, estn expuestas a graves hemorragias. Esta grave enfermedad es bien conocida debido a que la reina Victoria de Inglaterra (que era portadora del gen) lo transmiti a uno de sus hijos (muerto de una hemorragia tras una cada) y a dos de sus hijas, responsables de que la enfermedad se extendiera entre varias casas reales europeas. El gen de la hemofilia, que representaremos como X h, es recesivo respecto al gen normal, X H. Se han conocido muy pocos casos de mujeres hemoflicas, y esto por dos razones:

XHXh

XHY

XH

Xh

XH

XH XH Xh XHXH XHXh

Y XHY XhY

Fig. 16 Herencia de la hemofilia en la especie humana. Posible descendencia entre una mujer portadora y un hombre no hemoflico.

Mujer

Hombre

XHXH

Xh Y

XH

Xh

Xh XH XHXh

Y XH Y

Fig. 17 Herencia de la hemofilia en la especie humana. Posible descendencia entre una mujer normal, no portadora y un hombre hemoflico.

- En primer lugar, porque para que se produzca una mujer hemofli ca es necesario que el padre sea homoflico y la madre portadora o hemoflica. El gen de la hemofilia no es muy frecuente en la poblacin humana, lo que hace raras estas uniones. - Por otra parte, algunos autores indican que el gen de la hemofilia podra tener efectos letales, mortales, en homocigosis. Aunque estudios recientes parecen desmentirlo. A pesar de todo se han citado algunos caso de mujeres hemofli cas. Una de ellas lleg

J. L. Snchez Guilln

Pgina III-10-10

III) La informacin celular

10) Herencia gentica

incluso a tener descendencia y sobrevivi a la hemorragia postparto. Esto se interpreta como una consecuencia de los distintos grados de expresividad (capacidad para manifestarse fenotpicamente) que puede tener un gen. El cuadro siguiente nos informa respecto a los genotipos y fenotipos posibles y en las figuras 16 y 17 tenemos dos ejemplos de herencia del carcter. Genotipos X HX H X HX h X hX h X HY X hY Fenotipos Mujer normal Mujer portadora Mujer hemoflica )letal? Hombre normal Hombre hemoflico

Otro caso conocido de herencia ligada al cromosoma X es el daltonismo o ceguera para los colores rojo y verde. Las personas que tienen esta anomala se caracterizan por no poder distinguir ambos colores uno del otro. Su herencia se explica considerndolo tambin como un carcter que viene determinado por un gen recesivo ligado al cromosoma X. Otra grave enfermedad hereditaria ligada al cromosoma X y recesiva es la distrofia muscular de Duchenne.
HERENCIA INFLUIDA POR EL SEXO

Existen caracteres, como la calvicie en la especie humana y la presencia o ausencia de cuernos en algunas razas ovinas, que estn determinados por genes situados en la parte homloga de los cromosomas sexuales o bien en los autosomas, y cuya manifestacin depende del sexo. La calvicie, por ejemplo, es dominante en el hombre y recesiva en la mujer.
Genotipos Hombres CC Cc cc Normal Calvo Calvo Fenotipos Mujeres Normal Normal Calva

OTROS TIPOS DE HERENCIA ALELISMO MLTIPLE (ALELOMORFOS MLTIPLES)

Hasta aqu slo se ha contemplado la posibilidad de que existan dos alelos diferentes para cada gen. Pero, puesto que un gen puede ser modificado por el proceso de mutacin, tericamente es posible que en una poblacin de individuos existan varios alelos para un gen. Este fenmeno se denomina alelismo mltiple y el conjunto de alelos pertenecientes el mismo locus constituye una serie allica.

J. L. Snchez Guilln

Pgina III-10-11

III) La informacin celular

10) Herencia gentica

Un caso de alelismo mltiple bien conocido es el de los genes que determinan los grupos sanguneos en la especie humana o sistema ABO. Se trata de tres genes alelos IA , IB e i. IA e IB son codominantes y ambos son dominantes respecto al gen i, que es recesivo. El gen IA da lugar al grupo sanguneo A, el gen IB da lugar al B y el gen i, en homocigosis, da lugar al grupo O. Si IA e IB estn juntos en el mismo individuo, este ser del grupo AB. Los diferentes fenotipos y genotipos posibles para estos tres genes alelos se encuentran en el cuadro.
CUADRO

GENOTIPOS IAIA , IAi IBIB, IBi IAIB ii

FENOTIPOS A B AB O

ALELOS LETALES (FACTORES LETALES)

En ciertos casos las mutaciones que se producen dan lugar a genes que, por la razn que sea, hacen que el individuo no sea viable. Esto es, producen su muerte bien en el periodo prenatal o postnatal, antes de que el individuo alcance la madurez y pueda reproducirse. Estos genes se denominan genes letales. Un alelo letal dominante nunca ser heredable porque el individuo que lo posee nunca llegar a la madurez y no podr dejar descendencia. Los alelos letales dominantes se originan por mutacin de un gen normal y son eliminados en la misma generacin en la que aparecen. Por el contrario, los genes letales recesivos quedan enmascarados bajo la condicin de heterocigosis y en un cruzamiento entre heterocigotos la cuarta parte de los descendientes morirn. Por ejemplo, supongamos que del gen L, normal, existe un alelo l, letal. En un cruce entre dos individuos heterocigticos para este gen, obtendremos el siguiente cuadro gamtico:
CUADRO GAMTICO

/ L l

L normal LL normal Ll

l normal Ll morirn ll

POLIGENIA (HERENCIA MULTIFACTORIAL)

Cuando estudiamos el carcter color de la piel del guisante, vimos que slo caban dos fenotipos posibles: verde y amarillo. Esto es debido a que el carcter viene determinado nicamente por un par de genes alelos.

J. L. Snchez Guilln

Pgina III-10-12

III) La informacin celular

10) Herencia gentica

No obstante, la mayora de los caracteres presentan una variacin continua del fenotipo sin que podamos establecer grupos claramente distinguibles. Los ejemplos son numerosos: estatura, peso, color del pelo o de los ojos, produccin de leche en el ganado vacuno, etc. Si cuantificamos estos caracteres, si ello es posible, veremos que sus valores siguen una distribucin normal, tambin llamada campana de Gauss, con unos pocos individuos en los valores extremos y un gran nmero en los centrales. Esto suele ser debido a que estos caracteres, que llamaremos mtricos o cuantitativos, estn controlados por un gran nmero de genes no alelos situados en el mismo o en distinto par de cromosomas. Los caracteres controlados por varios genes no alelos se llaman polig nicos.

Nmero de individuos

Peso en Kg

Fig. 18 Campana de Gauss.

Un ejemplo de carcter polignico es el de la pigmentacin de la piel en la especie humana que se explica por la accin de alelos con efecto acumulativo. En principio se pens que el color de la piel era controlado por dos pares de genes. -N1 N1 ,N2 N2 (piel muy oscura) -n1 n1 ,n 2 n2 (piel muy clara) Otras combinaciones daran pieles intermedias. Ejemplo: N1 n1 , N2 n2 . Un carcter polignico determina la formacin de un gran nmero de fenotipos. As, por ejemplo, en el caso de que un carcter venga determinado por tres genes: A, B, C y sus correspondientes alelos recesivos: a, b, c; un individuo triheterocigtico Aa,Bb,Cc podr formar 8 tipos de gametos diferentes. Si lo cruzamos con una hembra tambin triheterocigtica el nmero de genotipos posibles ser de 27. El nmero de gametos que puede producir un heterocigoto es igual a 2 n siendo n el nmero de loci que controlan el carcter. Por ltimo, indicar que la accin del ambiente modifica la expresin del genotipo y suaviza las discontinuidades entre los fenotipos. Debido a todo esto los caracteres que vienen determinados por varios genes no alelos presentan una distribucin que sigue la forma de la curva de Gauss.

LA HERENCIA NO NUCLEAR

No debemos olvidar que los plastos y las mitocondrias poseen material gentico. Este ADN

J. L. Snchez Guilln

Pgina III-10-13

III) La informacin celular

10) Herencia gentica

no nuclear contiene informacin que tambin ser transmitida a la descendencia. Ahora bien, tanto en los animales como en los vegetales, las mitocondrias y los plastos son transmitidos nicamente por el gameto femenino, ya que del espermatozoide slo pasan al zigoto el ncleo y en ciertos casos el citocentro. El ADN no nuclear dar lugar a una herencia materna o de influencia exclusivamente materna. Por ejemplo, en el dondiego de noche (Mirabilis jalapa), la distribucin de la clorofila vara de una rama a otra y por lo tanto el color ms verde o ms blanco de las hojas. Algunas ramas tienen hojas de color blanco por no tener clorofila en sus cloroplastos, otras son slo verdes y otras variegadas (verdes y blancas). Si fecundamos flores de una rama verde, la descendencia ser verde; independientemente de la procedencia del polen. Si fecundamos flores de ramas de hojas blancas, la descendencia ser blanca. Si la rama es de hojas variegadas, saldrn plantas verdes, blancas o, la mayora, variegadas. La explicacin se encuentra en que en los sacos embrionario que se producen en las flores de las ramas de hojas blancas no hay cloroplastos con la capacidad para fabricar clorofila. En las flores de las ramas variegadas hay dos tipos de cloroplastos: unos que fabrican clorofila y otros no. Segn se repartan entre las clulas hijas, unas llevarn un tipo de cloroplastos, otras el otro tipo y la mayora una mezcla de ambos. Las flores de ramas de hojas slo verdes poseen cloroplastos con la capacidad de fabricar la clorofila y no tienen cloroplastos del otro tipo; por lo tanto, los descendientes que se produzcan a partir de flores de estas ramas tendrn hojas exclusivamente verdes.

GENTICA HUMANA
MTODOS DE EXAMEN GENTICO

La transmisin de los caracteres hereditarios en el hombre sigue las mismas leyes que las que son aplicables con carcter general al resto de los seres vivos. Algunos caracteres son dominantes, y otros recesivos; existen caracteres monognicos y, la mayora, polignicos; genes letales, y alteraciones genticas tanto gnicas como cromosmicas de lo ms diversas. En el hombre, no obstante, todas estas alteraciones tienen casi siempre una gran importancia por las graves consecuencias que pueden tener para la descendencia.

II
1 2 3 4

II II
5 6 7 8 9 10

III III
11 12 13

Fig. 19 Ejemplo de genealoga.

Como en el hombre no pueden hacerse experiencias como las que hizo Mendel se necesitan otras tcnicas para el estudio de la gentica humana. Los principales mtodos son: - Examen del rbol genealgico: El estudio de los ascendientes y de los descendientes de un

J. L. Snchez Guilln

Pgina III-10-14

III) La informacin celular

10) Herencia gentica

individuo puede darnos una informacin muy valiosa. Se trata en particular de un mtodo inestimable para la deteccin de las enfermedades hereditarias y para poder predecir su aparicin en los hijos. Veamos el siguiente caso: El Epiteloma adenoides cysticun es una enfermedad hereditaria que produce en el rostro pequeos ndulos coloreados, en el resto del cuerpo hay tambin tumores de dimensin variable. El rbol genealgico de una familia en la que varios individuos presentaban la enfermedad se representa a continuacin.

I
1 2

II
1 2 3 4 5 6 7 8 9

Sanos

III
1 2 3 4 5 6

Enfermos

Fig. 20 rbol genealgico de una familia con epiteloma.

El anlisis de la informacin proporcionada por este rbol nos va a permitir sacar las siguientes conclusiones: 1) El gen responsable de la enfermedad es dominante, pues en el caso de ser recesivo, 1 y 2 tendran que ser homocigticos y sus descendientes seran todos enfermos. 2) Si mediante T representamos el gen que determina la enfermedad y con t el gen normal, tendremos los siguientes genotipos (G).

TABLA
Generacin I G 1 2 Tt Tt 1 2 3 4 5 6 7 8 9 Generacin II G tt Tt o TT tt Tt o TT Tt o TT tt tt Tt tt 1 2 3 4 5 6 Generacin III G Tt o TT tt Tt o TT Tt o TT tt Tt o TT

En un rbol genealgico, los hombres (o los machos en las especies animales o vegetales) se representan mediante un cuadrado, las mujeres (o las hembras si se trata de otras especies diferentes de la especie humana) se representan mediante un crculo. Los

J. L. Snchez Guilln

Pgina III-10-15

III) La informacin celular

10) Herencia gentica

cruzamientos se indican mediante una lnea horizontal y los hijos por lneas que parten del trazo horizontal. Los integrantes de cada generacin se numeran correlativamente y las diferentes generaciones se indican al margen mediante nmeros romanos.

Ejemplos de caracteres genticos mendelianos en la especie humana

Algunos fenotipos en la especie humana. A y a) Lengua plegada y recta; D y d) lbulo de la oreja libre y pegado; E y e) lnea frontal del pelo en pico y recto; F y f) pulgar curvado y recto.

- Gemeologa : Los gemelos procedentes de un mismo zigoto, gemelos univitelinos, tienen en sus cromosomas la misma informacin gentica, son genticamente idnticos, y si se han criado juntos, las diferencias que presenten sern debidas a factores ambientales. Por el contrario, si se han criado separados, las similitudes que tengan podran ser debidas a factores genticos. Estos estudios son importantes, sobre todo, para aquellos rasgos psicolgicos en los que es muy difcil delimitar lo que es heredable y lo que es ambiental o cultural. - Exmenes citogenticos: Estn basados en el estudio del cariotipo. Estos exmenes pueden permitir la deteccin de anomalas cromosmicas an antes de que se manifiesten. En particular, son fcilmente detectables las aneuploidas (sndromes de Down, Turner y Klinefelter) y las mutaciones debidas a la alteracin de la estructura de los cromosomas. Estas ltimas se detectan por los apareamientos anormales que se producen en la meiosis. Sobre todo es interesante el estudio cromosmico de las clulas que se encuentran en las vellosidades de la placenta y en el lquido amnitico, tcnica esta ltima que se conoce como amniocentesis, pues permite la deteccin precoz de las anomalas cromosmicas.

J. L. Snchez Guilln

Pgina III-10-16

III) La informacin celular

10) Herencia gentica

La amniocentesis consiste en una puncin que se realiza durante el embarazo a travs del abdomen hasta llegar al lqui do amnitico. Se extrae con una jeringuilla una cierta cantidad de lquido. ste contiene clulas fetales que, sometidas a cultivo en un medio adecuado, entran en divisin. El tratamiento con colchicina bloquea las divisiones celulares en metafase. Preparaciones microscpicas de estas clulas son fotografiadas y sus cariotipos analizados.
Fig. 21 Amniocentesis.

J. L. Snchez Guilln

Pgina III-10-17

III) La informacin celular

11) Gentica aplicada

11) GENTICA APLICADA INGENIERA GENTICA

Se trata de una serie de tcnicas que se basan en la introduccin de genes en el genoma de un individuo que no los presente.
1 2

Estas tcnicas fundamentalmente son:


a) Transferencia de genes de una especie a otra: Hay tcnicas por las que se pueden transferir genes de una especie a otra. As, mediante un vector apropiado, que puede ser un plsmido o un virus, se puede introducir un gen de una especie en otra diferente. Con estas tcnicas se pueden pasar genes de eucariotas a eucariotas, de eucariotas a procariotas y de procariotas a procariotas. Por ejemplo: se puede introducir en bacterias el gen que produce la insulina humana. De esta manera las bacterias producen fcilmente y en abundancia esta hormona. b) Tcnica de la PCR: Tambin existen mtodos para amplificar una determinada secuencia o fragmento de ADN. La ms conocida es la tcnica de la reaccin en cadena de la polimerasa PCR. As se consigue multiplicar un determinado fragmento de ADN millones de veces para poder tener una cantidad suficiente para estudiarlo. Sin esta tcnica seran imposibles los estudios de ADN para el reconocimiento de la paternidad o en caso de delito, pues la cantidad de ADN presente en las clulas es tan pequea, del orden de picogramos, que se necesitara una gran cantidad de material celular para tener una cantidad apreciable de ADN.
4

Fig. 1 Transferencia de genes mediante el uso de un plsmido de una bacteria. 1) Extraccin de un plsmido de una bacteria; 2) unin del plsmido y el gen de otra especie que se quiere introducir; 3) introduccin del gen en clulas del organismo receptor usando el plsmido como vector; 4) transferencia de las clulas con el nuevo gen al organismo receptor.

Fig. 2 Tcnica de la PCR. Replicacin en cadena del ADN para su obtencin en cantidades adecuadas para posteriores anlisis.

Todo esto ha servido para el desarrollo de la ingeniera gentica, ya que aparte de conocer los aspectos moleculares ms ntimos de la actividad biolgica, se han encontrado numerosas aplicaciones en distintos campos de la industria, la medicina, la farmacologa, la agricultura, la ganadera, etc...

LA INGENIERA GENTICA Y LA TERAPIA DE ENFERMEDADES HUMANAS

Hay en los humanos numerosas enfermedades de carcter hereditario o relacionadas con alteraciones genticas. En la mayora de los casos ni siquiera se han identificado los genes responsables y en muy pocos casos se dispone del mecanismo para incorporar el gen correcto a las clulas del individuo afectado. No obstante existen varias lneas de

J. L. Snchez Guilln

Pgina III-11-1

III) La informacin celular

11) Gentica aplicada

investigacin que se basan en: 11) Transferir un gen humano normal a una bacteria, obteniendo de ella la sustancia necesaria para luego inocularla en el enfermo. 21) Transferir un gen correcto a las clulas de una persona: terapia de clulas somticas. 31) En el futuro, si el gen se hiciera llegar a un vulo, un espermatozoide o el zigoto, todas las clulas del individuo tendran el gen normal: Terapia de clulas germinales (no es legal). Todas estas terapias estn sometidas a cambios muy rpidos. Veamos algunos ejemplos en los que ya en la actualidad se emplean estas tcnicas o estn en fase de ensayo o investigacin.
1) Sustancias humanas producidas por bacterias

En la actualidad, una de las tcnicas de ingeniera gentica ms empleada consiste en la produccin de sustancias humanas por bacterias a las que se les ha introducido el gen correspondiente. Entre las sustancias que ya se obtienen mediante esta tcnica estn:
- La insulina.- Es una hormona formada por dos pptidos. El pptido A (21 aminocido) y el pptido B (30 aminocidos). Los genes que codifican ambos pptidos se aslan de clulas humanas y se introducen en estirpes bacterianas diferentes. Cada clon sintetiza uno de los polipptidos. stos se aslan, se purifican, se activan los grupos -SH para que se unan los dos pptidos y obtenemos insulina humana. - La hormona del crecimiento.- Es un polipptido de 191 aminocidos. Se utiliza una tcnica similar al ejemplo anterior. - El interfern.- Es una protena de peso molecular entre 16.000 y 20.000, con una cadena glucosdica. En la actualidad se ha conseguido aislar el ADN responsable del interfern en leucocitos y linfoblastos infectados. El problema es que se obtiene una produccin baja a causa de la inestabilidad de la molcula. - El factor VIII de la coagulacin. 2) La ingeniera gentica en humanos

Esta tcnica se basa en la introduccin de un gen correcto en las clulas humanas para sustituir un gen deficiente. Algunos casos en los que esta tcnica est en estudio o en proceso de ensayo son: * La Talasemia.- Grupo de enfermedades relacionadas con la presencia de hemoglobina distinta de la normal. - Tratamiento: retirar clulas de la mdula sea del enfermo, introducir en ellas el gen correcto mediante un virus, volverlas al torrente circulatorio. - Dificultades: La seleccin de las clulas que producen hemoglobina entre todas las clulas de la mdula, es difcil.

J. L. Snchez Guilln

Pgina III-11-2

III) La informacin celular

11) Gentica aplicada

- Los genes introducidos se expresan poco. - Las alteraciones en su manifestacin son peligrosas. * La carencia de la enzima Adenosin Desaminasa (ADA).- Fallo en los leucocitos. Enfermedad de los nios burbuja o inmunodeficiencia combinada grave (SCID). - Tratamiento: semejante al de la Talasemia.
3) Enfermedades sometidas a ensayos clnicos de terapia gnica

* Cncer: melanoma, rin, ovario, neuroblastoma, garganta, pulmn, cerebro, hgado, mama, colon, prstata, leucemia, linfoma... * Fibrosis qustica * Hemofilia * Artritis reumatoide

LA INGENIERA GENTICA Y LA PRODUCCIN AGRCOLA Y ANIMAL

Llamamos organismos transgnicos a aquellos que se desarrollan a partir de una clula en la que se han introducido genes extraos. El objetivo de estas tcnicas es obtener caractersticas "tiles" de otros organismos. Estas caractersticas pueden ser muy variadas. Fue una tcnica difcil por la impermeabilidad de las membranas de las clulas eucariotas animales y por la pared celulsica de las vegetales, aunque cada vez hay mejores tcnicas para resolver estos problemas. La tcnica ms empleada es la de microinyeccin (introduccin de ADN mediante microjeringa y micromanipulador). 1) Ejemplos del empleo de estas tcnicas en la produccin agrcola: Las tcnicas ms empleadas en las plantas son: * Uso de pistolas con microbalas de metal recubiertas de ADN. * Uso como vector de un plsmido de una bacteria simbionte que produce tumores. Mediante estas tcnicas se han obtenido o se est en vas de obtener: a) Variedades transgnicas del maz que:

Bacteria con el plsmido transportador del gen

Planta transgnica

Fig. 3 Uso como vector de un plsmido de una bacteria simbionte.

J. L. Snchez Guilln

Pgina III-11-3

III) La informacin celular

11) Gentica aplicada

* Resisten heladas.- incorporacin de un gen de un pez resistente al fro. * Resisten plagas.- incorporacin de un gen del trigo. * Resisten herbicidas.- incorporacin de un gen bacteriano. b) Variedades transgnicas del trigo que: * Son ms nutritivas. * Resistentes a plagas y herbicidas. Incorporacin de varios genes de insectos y bacterias. c) Variedades de tomate que maduran ms lentamente por anulacin de un gen que regula la maduracin por haberlo introducido en sentido contrario, se producen dos ARNm complementarios que hibridan y no se traducen. d) Plantas de tabaco transgnicas: Se est trabajando en la insercin de "genes nif" que posibilitaran el aprovechamiento directo del N2 atmosfrico. Se usa esta planta porque es una planta muy maleable. 2) Ejemplos del empleo de estas tcnicas en la produccin animal: En los animales estas tcnicas se emplean ms en peces porque la fecundacin es externa. Las tcnicas ms comunes son: * La microinyeccin de los genes en el zigoto. * Campos elctricos que hacen permeable la membrana y permiten la entrada de material gentico. Mediante estas tcnicas se han obtenido o se est en vas de obtener: * Carpas transgnicas que crecen de un 20 a un 40% ms rpido. Se consiguen introduciendo el gen de la hormona del crecimiento de la trucha arco iris. Se estimula aadiendo Cinc a la dieta. * Salmones transgnicos.- Resisten mejor las temperaturas bajas. Se consigue por incorporacin de un gen de
Planta de maz en la que se ha introducido un gen que produce la protena Cry El barrenador del tallo del maz ingiere la planta modificada.

Microbala recubierta de ADN

Fig. 4 Transferencia de genes mediante disparo de microbalas impregnadas en ADN

La protena causa la lisis de los tejidos del barrenador del maz.

Dos o tres das despus el barrenador del maz muere.

Fig. 5 Bacillus thuringiensis es una bacteria que se encuentra en los suelos en todo el mundo. Esta bacteria produce una protena Cry) que mata en forma selectiva un grupo especfico de insectos. La protena Cry es txico para el aparato digestivo de los insectos sensibles. Una vez ingeridas, las enzimas digestivas del insecto activan la frmula txica de la protena. Las protenas Cry se ligan a "receptores" especficos del revestimiento interno de los intestinos y daan las clulas. Los insectos dejan de comer dos horas despus de haber ingerido el primer bocado y, si han comido suficiente cantidad de toxina, mueren dos o tres das despus. Durante ms de treinta aos se han aplicado con xito en una serie de cultivos diversas frmulas lquidas y granuladas de Bt contra lepidpteros (orugas). La insercin en el maz del gen procedente de Bacillus thurigiensis, que codifica esta protena txica para el insecto, que provoca la enfermedad conocida como taladro del maz, hace que esta planta se vuelva resistente al insecto.

J. L. Snchez Guilln

Pgina III-11-4

III) La informacin celular

11) Gentica aplicada

una especie de platija del rtico. * En mamferos se han conseguido ratones que carecan de la hormona del crecimiento por mutacin del gen productor de la misma por introduccin en el zigoto de estos ratones del gen de la hormona del crecimiento de la rata. Los ratones transgnicos conseguidos producen 800 veces ms hormona que los normales. El gen de la rata no se introduce en el lugar propio, sino en otro.

ADN a transferir.

Microinyeccin del ADN en la clula receptora.

Fig. 6 Microinyeccin de genes en el interior de un zigoto receptor.

RIESGOS Y ASPECTOS TICOS DE LAS TCNICAS DE INGENIERA GENTICA * BIOSANITARIOS.- La mayora de los productos se destinan al consumo humano y an no se puede afirmar que no sean perjudiciales para la salud. * BIOTICO.- )Hay derecho a monopolizar el uso de la informacin gentica presente en la naturaleza? * BIOTECNOLGICO.- )Qu pasara si el material gentico de un virus tumoral terminara formando parte del genoma de alguna bacteria simbionte del ser humano? )Y si los genes que permiten la resistencia a los antibiticos entraran en el genoma de los patgenos? )O si los microorganismos inocuos adquirieran los genes para producir toxinas potentes como la difteria, el clera, el botulismo o el ttanos? EL PROYECTO GENOMA HUMANO

El estudio del Genoma Humano comenz en EEUU en 1990, pero hoy hay centros en numerosos pases implicados en el proceso. El objetivo es secuenciar completamente el ADN. Ahora bien, esto representa un enorme trabajo pues el genoma humano se compone de 3X10 9 de pares de bases. Si representsemos cada base por un carcter (A, T, C, G), para poder escribirlo en un libro (a 80x50 = 4000 caracteres por pgina), necesitaramos un libro de 750 000 pginas.
LMITES A LOS RIESGOS E IMPLICACIONES TICAS DE LA INGENIERA GENTICA

Existe un Comit Internacional de Biotica de la Unesco fundado en 1993 por Federico Mayor Zaragoza. Los criterios establecidos son: * * * * Lmites Lmites Lmites Lmites por motivos por motivos por motivos por motivos ecolgicos y de sanidad. ticos y morales. sociales. polticos.

La organizacin HUGO defiende que slo se puedan patentar las secuencias de ADN de las que se sepa su funcin.

J. L. Snchez Guilln

Pgina III-11-5

IV) Microbiologa

1) Microbiologa

IV 1-MICROBIOLOGA y BIOTECNOLOGA

1. CONCEPTO DE MICROORGANISMO

Los microorganismos o microbios son organismos de pequeo tamao, observables nicamente con la ayuda del microscopio. La Microbiologa es la rama de la Biologa que se encarga del estudio de los microorganismos.
TIPOS DE MICROORGANISMOS Y CLASIFICACIN

Los microorganismos se clasifican en:


CLASES DE MICROORGANISMOS

a) Microorganismos con organizacin celular


- Poseen membrana celular - Tienen como cidos nucleicos tanto ADN como ARN).

Procariotas

Arqueobacterias Eubacterias

Eucariotas

Protozoos Algas microscpicas Hongos microscpicos Virus Viroides Priones

b) Microorganismos sin organizacin celular


- No poseen membranas - Nunca estn presentes los dos cidos nucleicos juntos (ADN o ARN). - Son parsitos estrictos de los que tienen organizacin celular, pues carecen de metabolismo.

Fig. 1 1) Procariota (bacteria); 2, 3, 4 y 5) Protozoos; 6) Alga microscpica; 7) Hongo microscpico (levadura); 8 y 9) Virus. Cada organismo est a un aumento diferente.

J. L. Snchez Guilln

Pgina IV-1-1

IV) Microbiologa

1) Microbiologa

2. LAS BACTERIAS

CLASIFICACIN, MORFOLOGA, FISIOLOGA Y ECOLOGA BACTERIANAS 1) ARQUEOBACTERIAS: Bacterias consideradas "fsiles vivientes" pues viven en hbitats que parecen corresponder con los que existieron en la Tierra primitiva, por ejemplo, se encuentran en ambientes termales donde se alcanzan temperaturas por encima del punto de ebullicin del agua, en fumarolas, etc. Un ejemplo es el de Pyrococcus furiosus que tiene su ptimo de crecimiento a 104 1C. Tambin pueden vivir en medios halfilos (muy salados), por ejemplo: Halobacterium, que son halfilos estrictos. 2) EUBACTERIAS: Son las bacterias tpi cas. Por ejemplo Escherichia coli. Se trata de microorganismos unicelulares procariotas, cuyo tamao oscila entre 1 y 10 micras (como son muy pequeas no necesitan citoesqueleto), adaptados a vivir en cualquier ambiente, terrestre o acutico, pues en las diferentes estirpes bacterianas pueden observarse todas las formas de nutricin conocidas. Las hay auttrofas: fotosintticas y quimiosintticas, y hetertrofas: saprfitas, simbiticas y parasitarias. Esta notable diversidad de funciones convierte a las bacterias en organismos indispensables para el mantenimiento del equilibrio ecolgico, ya que, como se ver ms adelante, contribuyen al mantenimiento de los ciclos biogeoqumicos que permiten el reciclaje de la materia en la biosfera.

Fig. 2 Ejemplo de organismo procaritico (bacteria) muy aumentada.

Fig. 3 1) Cocos. 2) Bacilos. 3) Vibrios. 4) Espirilos.

Fig. 4 Bacilos (x2000).

La mayor parte de las bacterias adoptan formas caractersticas, aunque en ocasiones la configuracin puede verse influida por las condiciones del medio de cultivo. Son unicelulares, pero tambin aparecen agrupadas cuando se mantienen unidas tras la biparticin. Entre las formas ms comunes destacan las siguientes:
Fig. 5 Bacilos (muy aumentados) .

* Cocos, de aspecto redondeado, que aparecen aislados o en grupos de dos: diplococos, otras veces forman cadenas arrosariadas: estreptococos, grupos arracimados: estafilococos, o masas cbicas: sarcinas. Esta diversidad

J. L. Snchez Guilln

Pgina IV-1-2

IV) Microbiologa

1) Microbiologa

depende de que la divisin de las clulas se d a lo largo de uno, dos o tres ejes. Las bacterias con forma de cocos tienen una relacin superficie/volumen mnima, son bacterias con poca relacin con el exterior, muy resistentes y se transmiten por el aire. Son pequeas y exigentes con el medio de cultivo. Suelen ser patgenas: Streptococcus, Staphylococcus, etc. * Bacilos, alargados y cilndricos, en forma de bastn; a veces se presentan en cadenas lineales o ramificadas. Presentan mayor relacin superficie/volumen que los cocos y obtienen nutrientes con mucha mayor efectividad, por lo que pueden vivir en lugares pobres en nutrientes (vas urinarias, agua ....). Por el contrario, son menos resistentes, susceptibles a los cambios ambientales y no pueden transmitirse por el aire, slo lo hacen por lquidos o superficies hmedas. Los ms grandes (Baccillus y Clostridium) desarrollan endosporas para resistir los perodos de condiciones precarias. * Espirilos, con forma de hlice o espiral; las espiroquetas tienen un aspecto similar, pero con la espiral ms acusada. Las formas espirales se mueven en medios viscosos avanzando en tornillo. Su dimetro es muy pequeo, lo hace que puedan atravesar las mucosas; por ejemplo: Treponema pallidum, causante de la sfilis. Son ms sensibles a las condiciones ambientales que los bacilos, por eso cuando son patgenas se transmiten por contacto directo (va sexual) o mediante vectores, normalmente artrpodos hematfagos. * Vibrios, que son muy cortos y curvados, en forma de coma. Ejemplo: Vibrio cholerae.
Fig. 6 Asociaciones de cocos (bacterias esfricas).

Informacin: El estudio de las bacterias se realiza mediante cultivos, que consisten en esencia, en extractos nutritivos estriles, ya sean lquidos o slidos. Los lqui dos, preparados en tubos de ensayo debidamente tapados con algodn graso y esterilizados, suelen ser caldo de carne, suero sangu neo y sangre, enriquecidos con ciertas sustancias sin las cuales no pueden reproducirse (aminocidos, peptona, etc.). Los slidos se obtienen a partir de los lquidos mediante adicin de agar-agar o gelatina en caliente, luego se vierte sobre tubos de ensayo inclinados o sobre cajas de Petri; posteriormente se esterilizan, se siembran utilizando el asa de platino y se colocan en la estufa de cultivo a la temperatura adecuada que favorezca su multiplicacin.

Fig. 7 Cultivos de bacterias en cpsula de Petri y en tubo de ensayo.

J. L. Snchez Guilln

Pgina IV-1-3

IV) Microbiologa

1) Microbiologa

ESTRUCTURA DE UNA BACTERIA TIPO


1

3 4

La ultraestructura y la actividad fisiolgica de las bacterias solo se puede apreciar con el microscopio electrnico en conjuncin con las tcnicas bioqumicas y citolgicas adecuadas, como la ultracentrifugacin, tcnicas isotpicas de marcaje, utilizacin de medios de cultivo diferenciales, etc. Los componentes estructurales bsicos de las bacterias son: * Pared bacteriana: Estructura presente en todas las bacterias. Es una envoltura rgida exterior a la membrana. Da forma a la bacteria y sobre todo soporta las fuertes presiones osmticas de su interior.

Fig. 8 1) Cpsula; 2) pared; 3) membrana; 4) mesosomas; 5) ribosomas; 6) flagelo; 7) ADN, cromosoma o genoma; 8) plsmidos.

Polisacridos

Pptido glucano

Los componentes fundamentales de la pared son los peptidoglucanos o murenas, formados por anillos de polisacridos complejos enlazados con oligopptidos. Adems contiene otros elementos diferentes segn pertenezca al grupo de las Gram negativas o al de las Gram positivas: En las Gram negativas hay una sola capa de pptidoglucanos sobre la que se dispone una membrana externa constituida por una capa de fosfol pidos y otra de glicolpi dos asociados, estos ltimos, a polisacridos que se proyectan hacia el exterior. En las bacterias Gram positivas la red de peptidoglucanos origina varias capas superpuestas, es gruesa y homognea y no hay membrana externa. * Cpsula bacteriana. En numerosas bacterias se forma en la parte externa de la pared una cpsula viscosa compuesta por sustancias glucdi cas. Esta envoltura, que se presenta en casi todas las bacterias patgenas, las protege de la desecacin y de la fagocitosis por los leucocitos del hospedador, as como del ataque

Membrana plasmtica

Membrana externa

1) Glicolpidos. 2) Fosfolpidos y otros lpidos

Fig. 9 Estructura de la pared de una bacteria Gram negativa.

Pptidoglucano

Anillo de polisacrido

Oligopptido

Membrana plasmtica

Fig. 10 Estructura de la pared de una bacteria Gram positiva.

Polisacrido Oligopptido

Fig. 11 Los pptidoglucanos de la pared bacteriana estn formados por anillos de un polisacrido complejo enlazados por un oligopptido.

J. L. Snchez Guilln

Pgina IV-1-4

IV) Microbiologa

1) Microbiologa

de los anticuerpos, lo que aumenta la virulencia de las bacterias encapsuladas. La presencia de la cpsula no es, sin embargo, un carcter diferenciador, pues determinadas bacterias pueden o no formarla en funcin de los medios de cultivo.
Informacin: Algunos antibiticos actan sobre los componentes moleculares de la pared; por ejemplo, la lisozima (presente en las lgrimas, moco nasal y en la mayora de los tejidos y secreciones) que acta rompiendo los enlaces glucos dicos de los pptidoglucanos, lo que provoca la lisis por smosis de la bacteria; otros, como la penicilina, son antibiticos bacteriostti cos porque inhiben la sntesis de los pptidoglucanos y, por ello, interrumpen el crecimiento bacteriano.

INFORMACIN Observacin de microorganismos. Tincin de Gram: Fundamento INTRODUCCIN

* Membrana. Es una envoltura que rodea al citoplasma. Est constituida por una membrana de tipo unitario de 75 de espesor. Su estructura es idntica a la de las clulas eucariotas, variando slo en algunas de las molculas que la componen; por ejemplo, en la membrana bacteriana no hay esteroides. Una particularidad que presenta la membrana bacteriana es la existencia de unos repliegues internos que reciben el nombre de mesosomas. Las funciones de la membrana plasmtica bacteriana son las mismas que en la clula eucariota, es decir, limitan la bacteria y regulan el paso de sustancias nutritivas. Los mesosomas incrementan la superficie de la membrana plasmtica y adems tienen gran importancia en la fisiologa bacteriana, puesto que en ellos hay gran cantidad de enzimas responsables de importantes funciones celulares, entre las que destacan las siguientes: - Transporte de los electrones, mediante el conjunto de transportado-

El tamao de la mayora de las clulas bacterianas es tal que resultan difciles de ver con el microscopio ptico. La principal dificultad es la falta de contraste entre la clula y el medio que la rodea. El modo ms simple de aumentar el contraste es la utilizacin de colorantes. Si se desea simplemente aumentar el contraste de las clulas para la microscopa, son suficientes los procedimientos que usan un solo colorante llamados de tincin simple. Sin embargo, a menudo se utilizan mtodos que no tienen de igual modo todas las clulas, es el proceso denominado tincin diferencial. Uno muy usado en microbiologa es la tincin Gram. Basndose en su reaccin a la tincin Gram, las bacterias pueden dividirse en dos grupos: grampositivas y gramnegativas. Esta tincin tiene gran importancia en taxonoma bacteriana ya que indica diferencias fundamentales de la pared celular de las distintas bacterias. Para explicar el mecanismo de la tincin de gram se han propuesto varias hiptesis fundadas en la naturaleza qumica de las paredes celulares de los microorganismos.
TINCIN DE GRAM. Mtodo. Extensin: En un porta bien limpio (con alcohol, papel de filtro y flameado) se coloca una gota de agua destilada a la que, con el asa de siembra, previamente esterilizada a la llama, se lleva una pequea cantidad de suspensin de bacterias o, en su caso, de una colonia. Con el asa se extiende la gota y las bacterias sobre el porta y se fija la extensin por el calor, calentando suavemente a la llama del mechero hasta que se seque. Coloracin: a) 1 minuto en cristal violeta de Hucker (colorante inicial) b) se lava con agua destilada c) 1 minuto en lugol (mordiente) d) se decolora con alcohol de 951 (decolorante) e) se lava con agua destilada f) 1 minuto en fucsina (colorante de contraste) g) se lava con agua corriente h) se seca suavemente y sin frotar con papel de filtro Una vez que la preparacin est totalmente seca, poner una gota muy pequea de aceite de cedro y observar al microscopio con el objetivo de inmersin. Observacin: Las bacterias que aparecen coloreadas de violeta son Gram+ y las que aparecen coloreadas de rojo ms o menos intenso, son Gram-.

J. L. Snchez Guilln

Pgina IV-1-5

IV) Microbiologa

1) Microbiologa

res de la cadena respiratoria, y fosforilacin oxidativa. - Sntesis de diversos componentes de la membrana, la pared y la cpsula. - Contienen los pigmentos fotosintticos y dems componentes de los fotosistemas. - La ADN polimerasa de los mesosomas regula el proceso de duplicacin del ADN. * Ribosomas. Son corpsculos similares a los de las clulas eucariticas, aunque de menor tamao (su velocidad de sedimentacin es de 70 S), compuestos por una subunidad pequea de (30 S) y otra mayor de (50 S). Se encuentran dispersos en el protoplasma bacteriano, aislados o asociados en cadenas de ARNm (polirribosomas), y se encargan de la snte sis de protenas. * Cromosoma bacteriano. El ADN de la bacteria est constituido por una sola molcula en doble hlice (esta molcula es muy grande en comparacin con el tamao de la bacteria), circular, superenrollada y asociada a protenas no histonas. Suele estar unida a los mesosomas. En las clulas bacterianas puede haber tambin una o varias molculas de ADN circular extracromosmico de menor masa molecular que el cromosoma denominadas plsmidos. Estos plsmidos, en algunas bacterias, pueden tener genes que las protegen de los antibiticos o tambin genes que intervienen en los procesos de reproduccin (plsmido F). * Inclusiones. En el protoplasma bacteriano se encuentra una gran variedad de granulaciones, que cumplen, generalmente, la funcin de depsitos de sustancias de reserva. * Flagelos. Son apndices filiformes de mayor longitud que la bacteria que permiten su locomocin. Se presentan en nmero y disposicin variable y estn formados por fibrillas proteicas compuestas de una prote na llamada flagelina. * Fimbrias o pili. Son filamentos huecos, delgados y rectos, situados en la superficie de determinadas bacterias y cuya funcin no est relacionada con la locomocin, sino con la adherencia a los substratos y el intercambio de fragmentos de ADN durante la conjugacin.
Flagelo

Fig. 12 Estructura del motor flagelar de una bacteria.

Fig. 13 Fimbrias o pili en una bacteria.

J. L. Snchez Guilln

Pgina IV-1-6

IV) Microbiologa

1) Microbiologa

FUNCIONES DE NUTRICIN EN LAS BACTERIAS

La mayor parte de las bacterias son hetertrofas y deben tomar el alimento orgnico sintetizado por otros organismos. La obtencin del alimento la hacen por diversos caminos: * Las bacterias de vida libre suelen ser saprfitas, viven sobre materia orgnica muerta. * Muchas viven en relacin estrecha con otros organismos. De ellas, la mayora son comensales y no causan daos ni aportan beneficios a su husped; algunas son parsitas (producen enfermedades) y otras son simbiontes (establecen relaciones con otros organimos con beneficio mutuo). Otras bacterias son auttrofas y utilizan compuestos inorgnicos para su nutricin: * Las auttrofas fotosintticas, como las bacterias sulfurosas verdes y purpreas. No utilizan agua como dador de electrones en la fotosntesis, sino otros compuestos, como el sulfuro de hidrgeno, y por lo tanto no producen oxgeno. Al poseer pigmentos que absorben luz casi infrarroja, pueden realizar la fotosntesis prcticamente sin luz visible. * Las auttrofas quimiosintticas, a diferencia de las fotosintticas, utilizan la energa que desprenden ciertos compuestos inorgnicos al oxidarse. Independientemente del tipo de nutricin, las bacterias pueden necesitar el oxgeno atmosfrico (bacterias aerobias) o no (bacterias anaerobias). Para algunas bacterias anaerobias el oxgeno es un gas venenoso (anaerobias estrictas), otras lo utilizan cuando est presente, aunque pueden vivir sin l (anaerobias facultativas).

FUNCIONES DE RELACIN EN LAS BACTERIAS

Las bacterias responden a un nmero elevado de estmulos ambientales diversos mediante modificaciones de su actividad metablica o de su comportamiento. Ciertas clases, ante los estmulos adversos del ambiente, provocan la formacin de esporas de resistencia, que, al ser intracelulares, se denominan endosporas. Las endosporas bacterianas son estructuras destinadas a proteger el ADN y el resto del contenido protoplasmtico, cuya actividad metablica se reduce al estado de vida latente; pueden resistir temperaturas de hasta 801C y soportan la accin de diversos agentes fsicos y qumicos. En condiciones favorables germinan y dan lugar a una nueva bacteria (forma vegetativa). Pero la respuesta ms generalizada consiste en movimientos de acercamiento o distanciamiento respecto a la fuente de los estmulos (taxias) que pueden ser de varios tipos: flagelar, de reptacin o flexuosos (parecido al de las serpientes, pero en espiral).

J. L. Snchez Guilln

Pgina IV-1-7

IV) Microbiologa

1) Microbiologa

FUNCIONES DE REPRODUCCIN Y GENTICA BACTERIANA

* Reproduccin por biparticin: Generalmente las bacterias se multiplican por biparticin o divisin binaria; tras la replicacin del ADN, que est dirigida por la ADN polimerasa de los mesosomas, la pared bacteriana crece hasta formar un tabique transversal separador de las dos nuevas bacterias. Ahora bien, adems de este tipo de reproduccin asexual, las bacterias poseen tambin un conjunto de mecanismos, definidos como parasexuales, mediante los cuales se intercambian fragmentos de ADN; esta transferencia de informacin gentica de una bacteria a otra puede realizarse por conjugacin, transformacin o transduccin: * Conjugacin. Es un mecanismo mediante el cual una bacteria donadora (bacteria F+ por tener un plsmido llamado plsmido F) transmite a travs de las fimbrias o pili el plsmido F o tambin un fragmento de su ADN a otra bacteria receptora (a la que llamaremos Fpor no tener el plsmido F). La bacteria F- se convertir as en F+ al tener el plsmido F e incluso podr adquirir genes de la bacteria F+ que hayan pasado junto con el plsmido F. * Transformacin. Consiste en el intercambio gentico producido cuando una bacteria es capaz de captar fragmentos de ADN de otra bacteria que se encuentran dispersos en el medio donde vive. Slo algunas bacterias pueden ser transformadas. Las que pueden serlo se dice que son competentes. * Transduccin.. En este caso la transferencia de material gentico de una bacteria a otra, se realiza a travs de un virus bacterifago que por azar lleva un trozo de ADN bacteriano y se comporta como un vector intermediario entre las dos bacterias (ver ciclo ltico de un fago). El virus, al infectar a otra bacteria, le puede transmitir parte del genoma de la bacteria anteriormente infectada.

cromosoma

mesosoma Replicacin

divisin

Fig. 14 Ciclo de reproduccin asexual por biparticin de un bacteria.

Informacin: La transformacin bacteriana fue descrita en primer lugar por Griffith (1920) y ms tarde por Avery, McLeod y McCarty en 1944, y es responsable, por ejemplo, en el caso de Streptococcus pneumoniae, de la transformacin de cepas bacterianas no virulentas (cepas R) en virulentas (cepas S), cuando se cultivan en medios que contienen fragmentos bacterianos procedentes de la cepa S destruida previamente por el calor.

plsmido F

cromosoma

plsmido F

cromosoma

F+ pili

F+

Fcromosoma plsmido F

F+

Fig. 15 Conjugacin entre una bacteria F+ y otra F-. El factor F (crculos pequeos) pasa a travs de un pili.

Fig. 16 Transduccin: 1) Fijacin del fago a la bacteria; 2) Respuesta ltica; 3) Transduccin del fragmento de ADN a otra bacteria; 4) Integracin del ADN en el genoma.

J. L. Snchez Guilln

Pgina IV-1-8

IV) Microbiologa

1) Microbiologa

Mecanismos parasexuales de reproduccin bacteriana

Informacin: Las bacterias donadoras son las que poseen, adems del cromosoma bacteriano, pequeas cadenas de ADN de doble hlice y circulares, denominadas episomas o factores F. Estas bacterias se denominan F+ cuando el factor F est separado del cromosoma; pero, en ocasiones, este factor puede integrarse en el cromosoma, que se abre y se transforma en una cadena lineal, con lo que la bacteria F+ queda convertida en Hfr (alta frecuencia de recombinacin). Las bacterias receptoras carecen de episomas y se denominan F- .

Durante la conjugacin uno de los factores F de una bacteria F+ pasa a travs de las fimbrias a una bacteria F- , que se cambia en F+ y adquiere la capacidad de formar estos pili sexuales, mientras que la bacteria F+, como posee varias copias del episoma no pierde su condicin de donadora. Las bacterias Hfr, sin embargo, pueden transferir la totalidad o parte de su ADN cromosmico a travs de las fimbrias a una bacteria F- . Para ello, previamente, deben duplicar su ADN cromosmico, junto con el episoma que lleva integrado, y una de las copias del cromosoma puede trasladarse a una bacteria F- (generalmente slo pasan fragmentos cromosmicos debido a la fragilidad de las fimbrias). El factor F suele permanecer en la bacteria Hfr, ya que se encuentra inserto en la regin terminal del cromosoma que casi nunca circula a travs de las fimbrias, porque stas se destruyen antes de que les de tiempo a pasar. Los genes que han logrado atravesar el pili se integran en el cromosoma de la bacteria F-, que de esta forma adquiere caracteres de la Hfr (se producen fenmenos de sobrecruzamiento y recombinacin gnica entre el cromosoma y los fragmentos).

J. L. Snchez Guilln

Pgina IV-1-9

IV) Microbiologa

1) Microbiologa

3. MICROORGANISMOS SIN ORGANIZACIN CELULAR: LOS VIRUS LOS VIRUS: CONCEPTO

Los virus son organismos dotados de extraordinaria simplicidad, pertenecen a un nivel de organizacin subcelular, y marcan la barrera entre lo vivo y lo inerte. No se nutren, no se relacionan, carecen de metabolismo propio y para reproducirse utilizan la maquinaria metablica de la clula a la que parasitan; su simplicidad estructural y funcional los convierte en parsitos intracelulares obligados, tanto de bacterias (bacterifagos o fagos), como de las clulas animales y vegetales. Las partculas vricas, llamadas tambin viriones, estn constituidas por una molcula de ADN o ARN, nunca los dos en un mismo virus, contenida en el interior de una cpsula proteica y, en ocasiones, una envoltura membranosa.

Informacin: En realidad, los virus pueden considerarse como fragmentos independizados del genoma celular que han adquirido los genes necesarios para rodearse de una envoltura protectora y poseen la capacidad de desplazarse de una clula a otra. Mientras que los transposones son genes que se desplazan de un sitio a otro del cromosoma de una clula , los virus representaran a otro grupo de genes similares, pero que por haber adquirido la cpsula protectora se aventuraron a dar "saltos" mayores.

La destruccin celular es la consecuencia de la infeccin provocada por el virus, y las repercusiones para el organismo dependen de la importancia del tejido lesionado; as, mientras el virus de la gripe causa la destruccin de clulas de la mucosa respiratoria y " no reviste gravedad", el virus de la rabia, sin embargo, destruye neuronas y puede ser mortal si alcanza los centros vitales del encfalo; otros, como el virus del SIDA, destruyen el sistema inmunitario, y el organismo queda expuesto a todo tipo de infecciones oportunistas que terminan por causar la muerte.

ESTRUCTURA Y CARACTERSTICAS DE LOS VIRUS

Como ya se ha dicho, todo virus est formado por una envuelta proteica: la cpsida y por un cido nucleico; adems, algunos virus ms complejos pueden tener una envoltura membranosa de lpidos y protenas. Los virus son muy pequeos y slo son visibles mediante microscopa electrnica. Su tamao oscila desde los 10 nm, en los pequeos virus de la poliomielitis, hasta los 300 nm en el virus de la viruela, el mosaico del tabaco -TMV- y otros. Se diferencian entre ellos, adems de por el tamao, por las caractersticas estructurales de la cubierta (la cpsida), por la naturaleza de su cido nucleico, el modo de penetracin en la clula hospedadora y el mecanismo de replicacin.
3.1) Constitucin y morfologa de la cpsida

Todos los virus presentan, sin excepcin, una envoltura proteica, denominada, cpsida, compuesta por el ensamblaje de una o varias subunidades proteicas llamadas capsmeros, dispuestas a menudo en varias capas concntricas. La geometra de la cpsida es uno de los criterios que permite clasificar los virus en cuatro grupos: icosadricos, helicoidales, complejos y con envoltura.

J. L. Snchez Guilln

Pgina IV-1-10

IV) Microbiologa

1) Microbiologa

* Icosadricos: son los virus de aspecto esfrico, cuya cpsida adopta la estructura de un icosaedro (poliedro de 20 caras triangulares, 30 aristas y 12 vrtices); por ejemplo: los adenovirus, el virus de la polio y los picornavirus. * Helicoidales o cilndricos: estn representados por el virus del mosaico del tabaco y el virus de la rabia; presentan un aspecto alargado, que en realidad corresponde a un cilindro hueco, donde los capsmeros se ensamblan siguiendo un ordenamiento helicoidal, similar a los peldaos de una escalera de caracol. * Complejos, como bacterifagos (virus parsitos de bacterias) que parecen adoptar las dos estructuras anteriores. Al igual que los icosadricos poseen una regin icosadrica llamada cabeza donde se aloja el ADN y una cola formada por una banda de simetra helicoidal en cuyo interior se encuentra un eje tubular. La cola est terminada en un conjunto de fibras y espinas caudales que constituyen el sistema de anclaje del virus a la bacteria a la que infecta. * Virus con envoltura membranosa: La mayora de los virus animales, como los de la gripe, la viruela, la hepatitis, el virus del SIDA, etc. poseen, adems de la cpsida, una envoltura membranosa que no es mas que un fragmento de la membrana plasmtica de la clula hospedadora que el virus arrastra al abandonarla mediante un proceso de gemacin. La bicapa lipdica que forma esta envoltura posee un conjunto de glucoprote nas codificadas por el virus y dispuestas hacia el exterior, a modo de espculas, que constituyen su sistema de anclaje en los receptores de membrana de las clulas hospedadoras y, por tanto, median en el mecanismo de penetracin por endocitosis o por fusin de membranas. La envoltura membranosa es muy importante desde el punto de vista inmunolgico

Fig. 17 Virus. 1 y 2) Virus icosadricos; 3) Virus complejo; 4) Virus helicoidal; 5) Virus con envoltura.

Fig. 18 Virus helicoidal. Virus del mosaico del tabaco. 1) ARN viral; 2) cpsida;

Fig. 19 Virus helicoidal. Virus del mosaico del tabaco.

cabeza genoma cola fibras

placa basal

Fig. 20 Virus con cpsida compleja: Bacterifago.

J. L. Snchez Guilln

Pgina IV-1-11

IV) Microbiologa

1) Microbiologa

3.2) El cido nucleico

Es el componente esencial del virus y puede ser ADN monocatenario, por ejemplo, en el fago O-X-174, o ADN bicatenario, como el fago T4 y los adenovirus; pero tambin existen virus con ARN bicatenario (los reovirus) y otros portadores de ARN monocatenario, como es el caso de los virulentos retrovirus, entre los que se encuentran el de la gripe, el sarampin, la rabia, el SIDA y determinados virus oncgenos causantes de ciertos tipos de cncer (sarcoma de Rous, determinadas leucemias, etc.). Este ltimo grupo contiene, adems de los otros componentes mencionados, un enzima particular llamado retrotranscriptasa o transcriptasa inversa, que le va a permitir transcribir su ARN en un ADN dentro de la clula infectada.
El material gentico viral

Tipo de Virus
Virus vegetales

cido nucleico
ARN monocatenario

Cpsida

Envoltura

Ejemplo

Helicoidal

No

Mosaico del tabaco

Bacterifagos

ADN bicatenario De todos los tipos

Compleja

No

Bacterifago T4 Gripe, SIDA, etc.

Virus animales

Icosadricos

Frecuente

MECANISMOS DE REPLICACIN: CICLO VITAL DE LOS VIRUS

Aunque el genoma de un virus contiene escaso nmero de genes, es suficiente para inhibir la expresin gnica de la clula hospedadora y obligarla a transcribir y traducir su breve mensaje. El modo de penetracin , los mecanismos y los compartimentos celulares utilizados para la replicacin, son diferentes en los distintos tipos de virus. De todos ellos, se pondrn como ejemplo el de los retrovirus y los bacterifagos.
a) Ciclo vital de un retrovirus: El VIH causante del SIDA.

Los retrovirus son un grupo especial de virus animales cuyo cido nucleico es ARN, poseen envoltura y la enzima transcriptasa inversa. EL VIH es un retrovirus relativamente complejo. Est constituido por una membrana lipdica con glucoprotenas dispuestas hacia el exterior a modo de espnas. En el interior encontramos una cpsida proteica que encierra el material gentico, formado por dos molculas de ARN monocatenario y se encuentran ligadas, cada una de ellas, a una molcula de una enzima, la transcriptasa inversa.

Fig. 21 Virus del S.I.D.A.: a) envoltura membranosa; b) cpsida ; c) cido nucleico (ARN); d) espculas proticas.

J. L. Snchez Guilln

Pgina IV-1-12

IV) Microbiologa

1) Microbiologa

Ciclo vital del virus del SIDA

1 2

6a

6b 3

Informacin: El VIH ataca preferentemente a los linfocitos T4. Las fases de este proceso son:

10) Contacto entre las espculas de su envoltura membranosa y los receptores de la clula hospedadora. Estas permiten la fusin de membranas, introduciendo en su interior la cpside con el material gentico. 20) Una vez en el interior, el virus se despoja de su cpsida protica y quedan libres las hebras de ARN y la enzima retrotranscriptasa que transporta. 30) La retrotranscriptasa, tambin llamada transcriptasa inversa, primero hace una copia en ADN de la cadena de ARN, es decir, invierte el proceso normal de transcripcin de ADN a ARN, originando una hlice hbrida ARN-ADN. 40) La hlice hbrida ARN-ADN es utilizada por la misma enzima para generar una doble hlice de ADN (previa degradacin del ARN). 50) Las dobles cadenas de ADN vricas entran en el ncleo y se insertan en el cromosoma celular, donde puede permanecer en estado latente en forma de provirus durante un tiempo ms o menos prolongado. 60) Finalmente se transcriben y se traducen utilizando la maquinaria metablica de la clula y origina nuevas copias de ARN vrico, protenas de la cpsida y de la envoltura y enzimas retrotranscriptasas. 70) Estos componentes se ensamblan, y... 80) los virus abandonan la clula mediante un proceso de gemacin que les permite adquirir de nuevo su recubrimiento membranoso. Todos estos procesos pueden ser lentos, originando tan slo un descenso de la actividad metablica del hospedador, o rpidos, con lo que la salida masiva de virus termina con la lisis de la clula.

J. L. Snchez Guilln

Pgina IV-1-13

IV) Microbiologa

1) Microbiologa

b) Ciclo vital del fago T4.

El bacterifago T4 es un virus complejo con una cabeza icosadrica y una cola en la que hay una placa basal y fibras de fijacin. El genoma se compone de una molcula de ADN bicatenaria que se encuentra profusamente empaquetada dentro de la cabeza. El fago se fija en la pared bacteriana, en las regiones denominadas puntos de adherencia, a travs de los cuales inyecta su ADN mediante la contraccin de la vaina de la cola. Una vez en el protoplasma bacteriano, el ADN puede seguir dos caminos: multiplicarse y originar nuevos virus (va ltica ), con lo que se produce la destruccin de la bacteria, o integrarse en el cromosoma bacteriano y adoptar la forma de profago (va lisognica).
cabeza genoma cola fibras

placa basal

Fig. 22 Fago T4 (bacteriofago).

i) Ciclo ltico.

1) Fijacin y entrada

2) Multiplicacin

3) Lisis y liberacin

1) Fijacin y entrada: El bacterifago fija su cola a receptores espec ficos de la pared de la bacteria, donde una enzima localizada en la cola del virus debilita los enlaces de las mol culas de la pared. A continuacin, el fago contrae la vaina helicoidal, lo que provoca la inyeccin del contenido de la cabeza a travs del eje tubular de la cola del fago: el cido nucleico del virus penetra en la clula. 2) Multiplicacin: Una vez dentro, el ADN del virus, utilizando nucletidos y la enzima ARNpolimerasa de la bacteria, dirige la sntesis de gran cantidad de ARNm viral. Este ARNm viral sirve de base para la snte sis de protenas del virus (capsmeros, endonucleasas, endolisinas). El ADN vrico, utilizando los complejos enzimticos de la bacteria, se replica muchas veces. Tanto los cidos nucleicos replicados como el resto de los componentes vricos que se han sintetizado se ensamblan, dando lugar a nuevos virus. 3) Lisis y liberacin. En una bacteria pueden formarse unos 100 bacterifagos, que salen al exterior debido a la accin de la endolisina, enzima que lisa la pared bacteriana. Debido a ello, se produce la ruptura de la pared bacteriana y la muerte de la clula. Los virus quedan libres para infectar nuevas clulas.

ii) Ciclo lisognico.

No siempre se produce la lisis inmediata de la clula. Hay fagos atemperados o atenuados que se integran en el ADN bacteriano por entrecruzamiento de dos regiones idnticas del fago y de la bacteria, del mismo modo a como ocurre en los plsmidos. Estos fagos integrados se denominan profagos, y se replican pasivamente con el ADN de la bacteria. Las bacterias capaces de establecer esa relacin con los fagos atenuados se denominan lisognicas.

J. L. Snchez Guilln

Pgina IV-1-14

IV) Microbiologa

1) Microbiologa

El ADN del profago puede permanecer en forma latente durante varias generaciones de la bacteria, hasta que un estmulo induzca la separacin del profago, lo que iniciar un ciclo ltico tpico. Mientras la clula posea el ADN profago ser inmune frente a infecciones de este mismo virus. Otros virus que no son bacterifagos pueden tambin tener ciclos lisognicos.

1) Respuesta ltica.

2) Respuesta lisognica.

Fig. 23 Ciclos ltico y lisognico de un fago.

VIROIDES

Son extremadamente sencillos y forman un escaln inferior a los virus. Son simplemente genomas desnudos, ARN de una cadena (pero en forma de horquilla, pues hay complementariedad entre sus bases, simulando un ARN doble para protegerse de los enzimas hidrolti cos celulares que atacan a los ARN simples) y no presentan cpsida proteica. Solamente causan enfermedades en los vegetales. Han producido prdidas econmicas importantes: en cultivos de patata en USA y en cocoteros en Filipinas.

Los viroides son de menor tamao que cualquiera de los genomas vricos conocidos, pero suficiente para poder codificar una protena, pero no se cree que lo hagan, ya que el ARN de los viroides carece de seales que se necesitan para la traduccin del ARN a una protena. Por lo tanto su informacin no se traduce, solo se replica. Parece probable que sea la ARNpolimerasa del hospedador, que est en el ncleo de las plantas, la que replica el genoma del viroide. No est claro cmo se transmiten entre clulas ( dada la pared celular de las clulas vegetales), y mucho menos entre individuos.

LOS PRIONES: De estos "organismos" sabemos an menos. Se descubren en 1983 como agentes causantes de afecciones neuronales espordicas. Ahora aumenta su inters debido al mal de las vacas locas. Es una partcula infecciosa protenica (protena patolgica). Las pruebas obtenidas hasta el momento parecen indicar que el prin carece de cido nuclico. Se conocen dos enfermedades causadas por priones: La Tembladera, una alteracin neurolgica de ovejas y cabras, conocida desde el siglo XVII y la enfermedad de Creutzfeld-Jacob, una rara demencia humana. Los priones tambin se consideran agentes probables de otras enfermedades humanas que afectan al sistema nervioso: el Kuru, observado slo en tribus de Nueva Guinea, asocindose al canibalismo tradicional (la enfermedad fue desapareciendo conforme cesaban las prcticas necrfagas). La enfermedad de Creutzfeld-Jacob en individuos menores de 35 aos se relacion con el consumo de subproductos de vacas enfermas, que estaban alimentadas con piensos fabricados con restos de ovejas con tembladera. La infeccin por priones no provoca una respuesta inmunitaria, debido a que el prin est dentro de nuestras propias clulas. El agente causante es una protena propia de la membrana plasmtica de las neuronas. Se sabe que est codificada por un gen del cromosoma 20. Esta protena sufre una alteracin que la convierte en patolgica (prin) Las protenas defectuosas actan como agentes infecciosos que cambian las protenas normales en defectuosas. La aparicin de la demencia es consecuencia de que se acumulan cristalizadas en las neuronas provocando su destruccin y muerte. Comparando las dos protenas, normal y patolgica, se comprueba que tienen la misma secuencia de aminocidos (estructura primaria), pero tienen un plegamiento distinto. Se han encontrado casos de transmisin hereditaria de la enfermedad, debido a una mutacin puntual que implica modificacin en la estructura primaria de la protena, sustituyndose una prolina por una leucina.

J. L. Snchez Guilln

Pgina IV-1-15

IV) Microbiologa

1) Microbiologa

CLASIFICACIN DE LOS VIRUS (slo para consultar)


Los criterios bsicos de clasificacin son el tipo de cido nucleico que contienen, el tipo de cpsida, la posesin de envolturas membranosas y el tipo de clula a la que parasita. Segn este ltimo criterio existen virus animales, virus vegetales y virus bacterianos o bacterifagos. Las caractersticas ms frecuentes de cada grupo ya se han visto en la pgina . A continuacin, y a modo de consulta veamos los ms importantes grupos de virus animales.

Clasificacin de los virus parsitos de clulas animales

N1

Familia

cido nucleico

Envoltura

Gnero y especie

Enfermedad

Papovaviridae (Papovairus)

ADN-bc circular

Desnudos

Virus del papiloma humano

Verrugas

Poxviridae (Poxvirus)

ADN-bc circular

Envueltos

Virus de la viruela

Viruela

Herpesviridae (Herpesvirus)

ADN-bc lineal

Envueltos

Virus de herpes simple I y II Virus de la varicela zoster

Grietas en los labios y herpes genital Varicela y herpes zoster Infecciones respiratorias, entricas y oftlmicas

Adenoviridae (Adenovirus)

ADN-bc lineal

Desnudos

Adenovirus humano

Parvoviridae (Parvovirus)

ADN-mc lineal

Desnudos

Virus adenoasociados

Infecciones en roedores

Reoviridae (Reovirus)

ARN-bc

Desnudos

Rotavirus

Diarreas infantiles

Orthomixoviridae (Ortomixovirus)

ARN-mc

Envueltos

Virus de la gripe

Gripe

Paramixoviridae (Paramixovirus)

ARN-mc

Envueltos

Virus de la parotiditis

Paperas (parotiditis)

Virus de sarampin 9 Rhabdoviridae (Rabdovirus) 10 Picornaviridae (Picornavirus) ARN-mc Desnudos Enterovirus (virus de la polio, Coxsakie y Echo ARN-mc Envueltos Virus de la rabia

Sarampin Rabia

Polio, miocarditis, pericarditis, gastroenteritis, meningoencefalitis.

11

Togaviridae (Togavirus)

ARN-mc

Envueltos

Virus de la rubola

Rubola

12

Retrovirus (Retrovirus)

ARN-mc

Envueltos

Virus de la inmunodeficiencia humana (VIH-1 y VIH-2) Virus de la leucemia de las clulas T

SIDA

Leucemia de las clulas T

J. L. Snchez Guilln

Pgina IV-1-16

IV) Microbiologa

1) Microbiologa

Forma de los virus que parasitan clulas animales

Leyenda: 1) Papovavirus; 2) Poxvirus; 3) Herpesvirus; 4) Adenovirus; 5) Parvovirus; 6) Reovirus; 7) Ortomixovirus; 8) Paramixovirus; 9) Rabdovirus; 10) Picornavirus; 11) Togavirus; 12) Retrovirus.

J. L. Snchez Guilln

Pgina IV-1-17

IV) Microbiologa

1) Microbiologa

Informacin: Modalidades de transcripcin de los virus animales

Los virus animales pueden clasificarse por su material gentico y por la forma de sintetizar su ARN mensajero.
Grupo I: Tienen como material gentico ADN de cadena doble (hebras + y -). La hebra (-) se transcribe en un ARNm. Ejemplo: virus del herpes. Grupo II: Tienen como material gentico ADN de cadena simple (+ -). La hebra de ADN sintetiza una molcula complementaria de ADN formndose un ADN de cadena doble. De estas dos hebras, la hebra (-) se transcribe en un ARNm. Ejemplo: Parvovirus. Grupo III: Tienen como material gentico ARN de cadena doble (hebras + y -). De estas dos hebras, la hebra (-) sirve de molde para la sntesis de un ARNm complementario. Ejemplo: Reovirus. Grupo IV : Tienen como material gentico ARN de cadena simple (hebra +). Esta hebra de ARN sintetiza una molcula complementaria de ARN: hebra (-) que sirve de molde para sintetizar un ARNm complementario. Ejemplo: Virus de la polio de los primates. Grupo V : Tienen como material gentico ARN de cadena simple (hebra -). Esta hebra de ARN sirve de molde para sintetizar un ARNm complementario. Ejemplo: Gripe. Grupo VI : Tienen como material gentico ARN de cadena simple (hebra +). Esta hebra de ARN sirve de molde para sintetizar un ADN complementario: hebra (-) que a su vez sirve de molde para sintetizar un ADN + . Se forma as un ADN de doble cadena (+ y -). La hebra de ADN (-) se transcribe formndose un ARNm+. Ejemplo: Retrovirus.

Modalidades de transcripcin de los virus de clulas animales

I- Herpes II- Parvovirus III- Reovirus IV- Polio de los primates V- Gripe VI- V.I.H. ADN ARN Lnea fina, cadena que no se transcribe

Fig. 24

J. L. Snchez Guilln

Pgina IV-1-18

IV) Microbiologa

1) Microbiologa

4. MICROORGANISMOS CON ORGANIZACIN CELULAR EUCARIOTA PROTOZOOS


cil

Son organismos formados por una sola clula, es decir, poseen la estructura tpica de una clula eucaritica animal, aunque en ocasiones presentan una mayor complejidad en su organizacin. Tienen una membrana plasmtica que los rodea y delimita, algunos forman un caparazn duro, calizo o silceo, o bien una fina envoltura de quitina.

vp

Mn mn vp

vg

Fig. 25 Paramecio, ciliado de las aguas dulces. vp) Vacuola pulstil. vd) Vacuola digestiva. cil) Cilios. Mn) Macroncleo. mn) Microncleo.

ESTUDIO DE UN PROTOZOO: EL PARAMECIO.

Mirando con el microscopio una infusin o agua de una charca puede observarse fcilmente el paramecio (Paramecium ssp.). Tiene forma de suela de zapato y de su cuerpo salen muchos cilios, dispuestos en filas a lo largo de toda su superficie, que le sirven para nadar. A un lado del cuerpo hay una abertura, la boca o citostoma, que da acceso a un embudo que se estrecha hacia el interior. Sirve para su alimentacin: con los cilios provoca un remolino que arrastra las partculas alimenticias hacia el fondo del embudo, donde se forma un vacuola digestiva que engloba las partculas ingeridas. En su citoplasma podemos distinguir: * Unas pequeas cavidades esfricas, ms o menos numerosas, llamadas vacuolas digestivas. * En cada extremo del cuerpo se halla una vacuola pulstil, de forma estrellada, que presenta movimientos rtmicos de contraccin y cuya misin es expulsar de la clula los productos de deshecho de la digestin y agua. * Un par de ncleos: uno grande (macroncleo) y otro pequeo (microncleo). Se reproducen asexualmente por divisin simple. Se han observado procesos sexuales (conjugacin) en los cuales dos paramecios se unen por el citostoma y a travs de l realizan un intercambio de material nuclear, separndose despus. Aunque en este proceso no haya variacin numrica, se considera una reproduccin sexual por el intercambio de material nuclear, que es lo esencial de la sexualidad. Cuando falta agua, se rodea de una membrana gruesa, donde permanece con vida latente, pudiendo resistir largas temporadas hasta que nuevamente haya agua, este proceso se conoce como enquistamiento.

Los ciliados: Los protozoos como el paramecio que presentan cilios para su movimiento se conocen con el nombre de ciliados. Otros ciliados que abundan en al agua de charcas son:

* Las Vorticelas, con cuerpo en forma de campana y un largo pednculo que puede arrollarse en espiral como un muelle. Forman colonias. * Los Stentor, con forma de trompeta, que pueden medir hasta 1 mm. Se suelen fijar a races, etc. por su extremo puntiagudo.
Otros protozoos: * La Ameba, que vive en las charcas. Forma gruesos pseudpodos para moverse y capturar su alimento: bacterias, algas, etc. Los protozoos que forman pseudpodos se denominan rizpodos. Adems de la ameba existe Entamoeba histolytica que es parsita del hombre donde origina la disentera amebiana * El Trypanosoma, protozoo de forma alargada y con un largo flagelo para su movimiento. Vive parsito en la sangre de algunos mamferos africanos de donde puede pasar al hombre por picadura de la mosca tsets. En el hombre origina la enfermedad del sueo. Los protozoos con flagelos: flagelados. * Plasmodium, que produce en el hombre la enfermedad de la malaria o paludismo. Se introduce en la sangre mediante la picadura de la hembra del mosquito Anopheles , quien a su vez lo toma de otros individuos enfermos. De esta forma la enfermedad se transmite de individuos enfermos a otros sanos por la picadura del mosquito. El plasmodio, una vez en la sangre, pasa al interior de los glbulos rojos donde se divide por esporulacin y destruye las clulas sanguneas.

J. L. Snchez Guilln

Pgina IV-1-19

IV) Microbiologa

1) Microbiologa

Fig. 26 Diferentes especies de protozoos. 1) Paramecio; 2) Stentor; 3) Ciliado sp.; 4) Vorticela; 5) Ameba.

Su forma y tamao son variables, pero casi todos ellos son microscpicos por lo que deben observarse al microscopio. Algunos viven libres en aguas dulce o saladas. Cuando se deseca el medio en que viven forman un caparazn y se enquistan. Otros viven parsitos en animales o vegetales produciendo enfermedades, o bien, simbiosis con ellos. Se suelen reproducir por biparticin simple, aunque algunos tienen otras modalidades e incluso se conocen procesos de reproduccin sexual.

Fig. 27 Euglena.

ALGAS MICROSCPICAS UNICELULARES

Formadas por una sola clula. Viven en el agua y son capaces de realizar la fotosnte sis. Entre ellas podemos citar las Diatomeas, que viven tanto en el mar como en el agua dulce y poseen un caparazn de slice (frstula) constituido por dos piezas que encajan como una caja y su tapadera. Algunas algas unicelulares, como Euglena viridis, tienen flagelos con los que se desplazan en el agua. Las algas unicelulares forman parte importante del llamado plancton.

Fig. 28 Diatomeas.

J. L. Snchez Guilln

Pgina IV-1-20

IV) Microbiologa

1) Microbiologa

HONGOS MICROSCPICOS

Bajo esta denominacin se incluye un amplio grupo de organismos de gran heterogeneidad. Entre las caractersticas comunes a todos los hongos pueden destacarse: a) Estar formados por una o ms clulas eucariotas. b) Encontrarse desprovistos de clorofila u otro pigmento fotosinttico. c) La pared celular no es de celulosa sino de quitina. Los hongos son organismos hetertrofos que necesitan para su nutricin sustancias orgnicas ya elaboradas; la mayora son saprfitos - se desarrollan sobre materia orgnica en descomposicin - y otros son parsitos que producen enfermedades en el hombre y otros animales y vegetales. Dentro de los hongos podemos encontrarlos unicelulares (levaduras) y pluricelulares (mohos), estos tienen una estructura denominada " talo" y que suele estar constituida por una serie de filamentos denominados " hifas", que pueden ser ramificadas y tabicadas, formando, en su conjunto, una estructura denominada " micelio". Su reproduccin puede ser sexual o asexual (gemacin, esporulacin, fragmentacin) y su clasificacin es compleja y se puede realizar atendiendo a diferentes caracteres

esporangios

hifas

Fig. 29 Hifas y esporangios del Mucor, hongo que coloniza el pan hmedo.

Fig. 30 Clula de levadura.

Fig. 31 Clula de levadura dividindose por gemacin.

APLICACIONES Y PAPEL EN EL ECOSISTEMA

conidiforos

El papel que los hongos ejercen en la naturaleza resulta de gran importancia, sobre todo si tenemos en cuenta su actividad descomponedora en los ecosistemas (reciclaje de materia orgnica). Tambin tienen una parte fundamental en la actividad humana. As, es conocido su papel en la alimentacin, la agricultura, silvicultura, industria qumica, enfermedades, etc. Los hongos son capaces de descomponer

hifas

Fig. 32 Hifas y conidiforos de Penicillium. Este hongo aparece sobre pan hmedo y naranjas enmohecidas.

J. L. Snchez Guilln

Pgina IV-1-21

IV) Microbiologa

1) Microbiologa

algunos materiales fabricados y usados por el hombre a partir de materiales de origen orgnicos (vegetal y animal); reciclan por tanto estos materiales como si se tratara de la materia orgnica que forma parte del ecosistema (biodeterioro). Por otra parte, desde hace cientos de aos el hombre ha utilizado diferentes especies de hongos para la transformacin de alimentos, un claro ejemplo son las levaduras utilizadas en la elaboracin de la cerveza y del vino (Saccharomyces), de los quesos (algunas especies de Penicillium), del pan, etc. Los hongos son muy importantes en la industria qumica como productores de numerosas sustancias como vitaminas, cortisonas, cidos orgnicos y sobre todo antibiticos (en este sentido cabe recordar que la penicilina fue descubierta por Fleming a partir de una especie de Penicillium). Los hongos tambin pueden ser agentes patgenos directos sobre el ser humano, son causantes de numerosas micosis superficiales en la piel, uas, pelo, etc. y micosis profundas con mayor riesgo para la salud. Tambin puede haber alergias micgenas provocando molestias respiratorias (por las esporas).
R
1

H N H

S CH3
3

N O COOH

CH3

Fig. 33 Penicilina. 1) Grupo amino libre; 2) Anillo -lactmico; 3) Anillo de tiazolina; R) Radical que determina las propiedades farmacolgicas.

J. L. Snchez Guilln

Pgina IV-1-22

IV) Microbiologa

1) Microbiologa

5. INTERVENCIN DE LOS MICROORGANISMOS EN LAS TRANSFORMACIONES O CICLOS BIOGEOQUMICOS.

Las bacterias y los hongos son los microorganismos que, junto a los productores, permiten la existencia del ciclo de la materia en la biosfera. Su funcin es descomponer la materia orgnica procedente de restos vegetales, cadveres y excrementos, convirtindola en materia inorgnica que vuelve a ser utilizada por los productores. La actividad de los descomponedores en la biosfera permite que la materia se recicle y no se disperse en las sucesivas transferencias, como ocurre con la energa. Muchos de los elementos qumicos que componen los materiales terrestres estn sometidos a unos circuitos cclicos que consisten, bsicamente, en que pasan de formar parte de materia inorgnica inerte a formar parte de materia constitutiva de seres vivos y de stos, posteriormente, de nuevo a materia inorgnica inerte, cerrndose el ciclo. Estos ciclos de la materia son los ciclos biogeoqumicos. Como ejemplos de ciclos biogeoqumicos, y el papel que desempean los microorganismos en ellos, estudiaremos el ciclo del carbono y el ciclo del nitrgeno:
A) EL CICLO DEL CARBONO

Mediante el proceso de fotosntesis, las plantas toman el carbono en forma de CO2 de la atmsfera o del agua, asimilndolo durante la fase oscura de dicho proceso para formar molculas orgnicas. Parte del carbono vuelve al medio inerte en la misma forma de CO2 como resultado de la respiracin tanto de las propias plantas como de los organismos consumidores y descomponedores. Los desechos, restos o cadveres que contienen carbono vuelven tambin al medio inorgnico por accin de los descomponedores (bacterias y hongos).

Combustin

CO2
Vegetales Descomponedores Respiracin
(Bacterias Hongos) Compuestos orgnicos

P e t r l e o

C a r b n

Fotosntesis

Consumidores
Compuestos orgnicos

Fig. 34 El ciclo del carbono.

J. L. Snchez Guilln

Pgina IV-1-23

IV) Microbiologa

1) Microbiologa

Una parte muy importante del carbono, puede tardar millones de aos en incorporarse al medio inerte. Es el caso del carbono que llega a formar parte del petrleo y del carbn mineral. Este carbono puede volver al ciclo por combustin de estos combustibles fsiles.
B) EL CICLO DEL NITRGENO

La fuente principal de nitrgeno es la atmsfera, de la que este gas constituye un 78%; sin embargo, este nitrgeno atmosfrico slo puede ser fijado por un grupo de bacterias fijadoras del nitrgeno que transforman este gas en compuestos nitrogenados utilizados directamente por las plantas. Entre el grupo de bacterias fijadoras del nitrgeno est el gnero Rhizobium que se encuentra en simbiosis con las races de las plantas leguminosas (guisantes, judas, trboles, alfalfa, etc.), estas bacterias se introducen en los tejidos del vegetal, donde proliferan y desarrollan una especie de ndulos fijadores del nitrgeno. El resto de las plantas depende del nitrgeno que se encuentra en el suelo, de donde lo toman en forma de nitratos. Cuando un organismo muere, el nitrgeno de los restos orgnicos, como son las protenas y los cidos nucleicos, por accin de bacterias y hongos presentes en el suelo, se convierte en amoniaco o in amonio (amonificacin). Otros grupos de bacterias del suelo oxidan los iones amonio a nitritos y finalmente las bacterias nitrificantes oxidan los nitritos a nitratos. Los nitratos son ya fcilmente absorbidos por las races de las plantas y utilizados para formar molculas nitrgenadas (protenas y cidos nucleicos). Mediante las cadenas trficas posteriores, el nitrgeno asimilado en estas molculas del vegetal pasa a los animales. Existe un grupo de bacterias desnitrificantes que en condiciones anaerobias y de inundacin, convierten los nitratos del suelo en nitrgeno molecular, que escapa a la atmsfera. Por eso los agricultores drenan las tierras para reducir la desnitrificacin y aaden fertilizantes para incrementar los niveles de nitrgeno del suelo.
Bacterias y hongos Animales

Nitrgeno atmosfrico

Bacterias fijadoras de nitrgeno de los suelos

Suelos Nitratos Nitritos Sales amoniacales

Sustancias nitrogenadas orgnicas: -Protenas - cidos nuclicos

Vegetales Algas

Fig. 35 El ciclo del nitrgeno.

J. L. Snchez Guilln

Pgina IV-1-24

IV) Microbiologa

1) Microbiologa

6. LOS MICROORGANISMOS COMO AGENTES DE ENFERMEDADES INFECCIOSAS

La mayora de los microorganismos son inocuos para los dems seres vivos. Muchos de ellos incluso se han adaptado a las condiciones especiales que tienen los tejidos de los animales viviendo en ellos, en su piel, en sus conductos digestivos o respiratorios; son la denominada flora normal. Sin embargo, los microbios ms conocidos son aquellos que producen enfermedades infecciosas en las plantas, en los animales y en la especie humana. Estos son los microorganismos patgenos. El grado de patogenidad se denomina virulencia y se mide, generalmente, por el nmero de microorganismos necesarios para desarrollar la enfermedad. Hay microorganismos que normalmente no son patgenos pero pueden serlo cuando disminuyen los mecanismos defensivos de un animal: son los microorganismos oportunistas.

Robert Koch (1843- 1910) fue el primero en comprobar que una bacteria era la causante de una enfermedad infecciosa, el carbunco en ovinos. Estableci cuatro postulados que constituyen la base de las investigaciones mdicas para establecer el tratamiento de las infecciones:

1)El organismo especfico ha de encontrarse siempre asociado a la enfermedad. 2)El organismo tiene que ser aislado y obtenido en cultivo puro en el laboratorio. 3)Este cultivo puro inoculado en un animal susceptible de ser infectado produce la enfermedad. 4)Se debe recuperar el organismo del animal infectado experimentalmente en cultivo puro. Otros aportes de la labor investigadora de Koch fueron el descubrimiento de los cultivos en medios slidos y el descubrimiento de los agentes causantes de la tuberculosis (llamado desde entonces bacilo de Koch) y del clera.

V AS DE INFECCIN

El primer paso en una infeccin es la colonizacin por parte de los microorganismos de tegumentos y mucosas corporales, donde deben competir con otros microorganismos comensales. Los que superan esta primera fase con ms xito son los que producen las enfermedades ms contagiosas. La entrada de microorganismos en el cuerpo del hospedador puede tener lugar a travs de distintas vas: - Heridas o abrasiones en los tegumentos. - Roturas microscpicas en las mucosas. - Picaduras de artrpodos (arcnidos e insectos, principalmente). - Adherencia especfica del microorganismo a las clulas del hospedador y paso a travs de clulas epiteliales. - En determinadas circunstancias, algunos microorganismos forman colonias muy numerosas en los tegumentos, las cuales son responsables de una lesin epitelial, producindose inflamacin y rotura, a travs de la cual penetran. Una vez dentro, los microbios tienen que reproducirse, ya sea en una lesin superficial, ya sea en un tejido especfico al que son conducidos por va linftica o sangunea. En esta primera fase tienen que superar los mecanismos defensivos del hospedador, lo que incluye

J. L. Snchez Guilln

Pgina IV-1-25

IV) Microbiologa

1) Microbiologa

la inflamacin, la detencin en los ganglios linfticos y su eliminacin de la sangre por accin de los fagocitos. Si consiguen superarlos, se desarrolla la enfermedad. El tiempo que transcurre desde que penetran hasta la manifestacin de los sntomas de enfermedad se denomina perodo de incubacin. Las infecciones pueden ser superficiales, si el microorganismo se multiplica en las clulas epiteliales de la zona de entrada, o sistmicas si alcanzan los vasos sanguneos y se multiplican en varios rganos a la vez.
Factores de patogenicidad. Toxinas

Segn la infeccin va progresando, se empiezan a manifestar los sntomas de la enfermedad. Esto nos indica que el hospedador ya ha sufrido una lesin por diversas causas:

* La proliferacin de los microorganismos El crecimiento del nmero de clulas microbianas puede conllevar dos clases de peligro: de un lado, se puede crear una competencia entre el microbio y las clulas del hospedador por un determinado nutriente; de otro lado, se puede producir el bloqueo de vasos sanguneos o un dao directo sobre las clulas del hospedador * Produccin de toxinas Las toxinas son sustancias venenosas de bajo peso molecular, que pueden ser excretadas al medio (exotoxinas), como la del botulismo o el ttanos, o retenidas dentro de la clula (endotoxinas). Estas toxinas pueden provocar daos locales, cuando son muy especficas, o difundirse y causar lesin sistmica. * La produccin de enzimas extracelulares como la lecitinasa que hidroliza los lpidos de membrana de las clulas husped; las hemolisinas que lisan los glbulos rojos, liberando al plasma su hemoglobina, etc.

J. L. Snchez Guilln

Pgina IV-1-26

IV) Microbiologa

1) Microbiologa

7. BIOTECNOLOGA

La biotecnologa es el conjunto de procesos industriales que se sirve de microorganismos o de clulas procedentes de animales o vegetales para obtener determinados productos comerciales o para realizar importantes transformaciones qumicas. La biotecnologa se ocupa, entre otros, de procesos tan diferentes como la clonacin, la terapia gnica, la inseminacin in vitro, la obtencin de bebidas alcohlicas, etc. Aunque el trmino es moderno, rene tcnicas y mtodos conocidos desde la antigedad. Por ejemplo, la fabricacin del pan, que ya realizaban los antiguos egipcios, la mejora de las razas de animales y la obtencin de plantas con mayor produccin de frutos. El trmino biotecnologa se comenz a usar a finales de los aos setenta, tras la aparicin de la ingeniera gentica, que se basa en la manipulacin del material gentico de las clulas. En la actualidad, con la expansin de la biotecnologa y los mtodos de manipulacin gentica, los microorganismos han sido modificados para fabricar productos tiles que los microorganismos no producen de manera natural.

BIOTECNOLOGAS APLICADAS A LA MEJORA DEL MEDIO AMBIENTE

Diversas tcnicas biotecnolgicas permiten resolver, de diferentes y novedosas maneras, el problema de la contaminacin ambiental. Se pueden utilizar diversos microorganismos para afrontar problemas de tratamiento y control de la contaminacin qumica de distintos ecosistemas. La ingeniera gentica permite combinar las caractersticas de estos microorganismos para aumentar su eficacia o generar microbios recombinantes con nuevas caractersticas. Aunque muchos microorganismos diferentes juegan un papel esencial en los equilibrios ambientales, la mayora de las aplicaciones biotecnolgicas actuales se realizan con ciertos tipos de bacterias. Algunas de las aplicaciones de la biotecnologa a la mejora del medio ambiente son las siguientes: - Eliminacin de metales pesados. - Eliminacin de mareas negras. - Obtencin de energa no contaminante. - Tratamiento de residuos urbanos e industriales. - Tratamiento de diferentes tipos de contaminacin asociados a la industria del petrleo. - Tratamiento de la contaminacin producida por herbicidas, pesticidas e insecticidas. - Depuracin de aguas residuales.

J. L. Snchez Guilln

Pgina IV-1-27

IV) Microbiologa

1) Microbiologa

Control de mareas negras

Se llama marea negra al vertido masivo de petrleo debido a un accidente durante el transporte del petrleo en grandes barcos. Es posible utilizar bacterias que digieren los hidrocarburos que forman el petrleo y los transforman en sustancias qumicas nada o menos contaminantes. Aunque generalmente cada tipo de bacteria utiliza una clase de hidrocarburo, se intenta combinar las caractersticas de varias bacterias para conseguir una bacteria recombinante capaz de transformar muchos hidrocarburos diferentes.

Eliminacin de metales pesados

Los iones metlicos de los elementos pesados (por ejemplo, mercurio, cinc, nquel, cobre, plomo) movilizados por la accin humana a distintos ecosistemas constituyen el tipo de contaminacin ms grave del planeta. Los efectos contaminantes de los metales pesados superan en cuanta la suma de todos los dems tipos de contaminacin qumica. Gracias a la ingeniera gentica se han desarrollado bacterias que pueden vivir en presencia de metales pesados y eliminarlos mediante diversas reacciones qumicas.

BIOTECNOLOGAS APLICADAS A LA MEJORA DE LA SALUD

La biotecnologa tiene en la salud humana, entre otros, los siguientes campos de aplicacin: - Prevencin de enfermedades hereditarias. - Terapia gnica. - Produccin de vacunas. - Obtencin de anticuerpos monoclonales e interferones. - Produccin de hormonas (por ejemplo insulina y hormona del crecimiento). - Produccin de antibiticos y otros productos farmacuticos.
Antibiticos

La palabra antibitico designa a aquellas sustancias que, producidas por determinados microorganismos, pueden acabar con la vida de otros. En 1929, Alexander Fleming descubri estas sustancias. Estaba trabajando con Staphylococcus aureus y su cultivo se contamin con un hongo del gnero Penicillium, de forma que las colonias rodeadas por ste moran. Fleming supuso que el hongo produca alguna sustancia antibacteriana, por lo que hizo un filtrado, descubriendo as, la penicilina. Fue incapaz de purificarla, dado que era qumicamente inestable, lo que se hizo aos ms tarde, gracias al desarrollo de un proceso industrial adecuado. Desde 1945 se han aislado cientos de antibiticos producidos por hongos del gnero Penicillium y bacterias de los gneros Bacillus y Streptomyces. El gran problema de la actualidad es que han comenzado a desarrollarse a un ritmo alarmante cepas de patgenos resistentes a antibiticos e, incluso, cepas multirresistentes a varios antibiticos simultneamente, por lo que hay que encontrar otros nuevos, o modificar los existentes para que recobren su eficacia, lo que constituye el gran reto de la biotecnologa.

J. L. Snchez Guilln

Pgina IV-1-28

IV) Microbiologa

1) Microbiologa

Hormonas

Las personas que sufren diabetes mellitus deben inyectarse insulina varias veces al da. Hasta 1983 la insulina que utilizaban las personas diabticas era insulina de cerdo purificada (diferente de la humana). Desde esa fecha se utiliza insulina obtenida por ingeniera gentica: se ha introducido el gen de la insulina humana en la bacteria Escherichia coli, que la produce en cantidades masivas y con las mismas caractersticas. La insulina es la primera protena fabricada por ingeniera gentica y comercializada. Tambin por ingeniera gentica se obtiene la hormona del crecimiento. Otras hormonas como la testosterona y progesterona, hormonas sexuales masculina y femenina, utilizada sta ltima en la fabricacin de frmacos anticonceptivos se obtienen de la fermentacin de ciertas levaduras.

BIOTECNOLOGAS DE LOS ALIMENTOS

El hombre desde la antigedad ha obtenido productos alimenticios con la intervencin de los microorganismos, a pesar de desconocer su existencia. Hoy da gracias al conocimiento de sus caractersticas y metabolismo, son explotados industrialmente en la fabricacin de numerosos alimentos y bebidas. Por ejemplo: Pan. Yogur. Queso. Mantequilla. Vinagre. Vino. Cerveza. Encurti dos. Produccin de protenas para piensos de animales domsticos. Sntesis de vitaminas que se aaden a los alimentos o en compuestos farmacuticos. (Por ejemplo la vitamina B12 es producida industrialmente a partir de bacterias y la riboflavina es producida por diversos microorganismos como bacterias y hongos). Sntesis de aminocidos que se utilizan como aditivos alimentarios. (Ejemplos de aminocidos producidos por fermentacin microbiana son el cido glutmico, la lisina, la glicina, la metionina y la alanina).

Fabricacin del yogur Se utiliza leche, que fermenta mediante determinadas cepas de las bacterias Lactobacillus y Streptococcus que transforman la lactosa en cido lctico. El cido lctico es el causante de la precipitacin de las protenas de la leche. Ambos microorganismos necesitan una temperatura de

45C para desarrollarse al mximo, por eso la leche se envasa en caliente para que despus siga el proceso de fermentacin en la estufa a dicha temperatura. El pH del yogur (despus del enfriamiento a 4 C) es alrededor de 4, este medio cido impide el crecimiento de otras bacterias. Actualmente la produccin de yogures se ha especializado en gran cantidad de sabores e incluso en el enriquecimiento de nuevas bacterias.

Fabricacin de cerveza Es un proceso que se conoce desde antiguo, ya que, al parecer, los babilonios fueron los primeros en elaborar la cerveza. Se basa en la fermentacin alcohlica que realizan las levaduras del gnero Saccharomyces. La cerveza se obtiene por fermentacin de la cebada realizada por las levaduras S. cerevisae o S. carlsbergensis. Los granos de cebada se ponen a remojo, de forma que germinan y generan amilasas suficientes que hidrolizan el almidn. Despus se secan, lo que constituye la malta, la cual se puede almacenar hasta su uso. Con la malta se obtiene el mosto de cerveza, al cual se adiciona el lpulo, encargado de dar a la cerveza el sabor amargo y de conservarla del crecimiento bacteriano. Es entonces cuando se aade el inculo, que fermenta durante cinco a diez das a temperatura y pH adecuados.

J. L. Snchez Guilln

Pgina IV-1-29

V) Inmunologa

1) Inmunologa

V INMUNOLOGA

CONCEPTO DE INMUNIDAD

(1)

Conjunto de mecanismos que un individuo posee para enfrentarse a la invasin de cualquier cuerpo extrao y para hacer frente a la aparicin de tumores. Esta cualidad se adquiere antes del nacimiento y se madura y afianza en los primeros aos de vida. En los vertebrados implica que los organismos diferencian lo propio de lo ajeno, es decir reconocen todos sus tipos celulares.
El Sistema Inmune es el responsable de conferir inmunidad. Este sistema, presente en invertebrados, alcanza su mxima complejidad en los primates y seres humanos. La ciencia encargada de estudiar estos procesos se denomina Inmunologa . EL SISTEMA INMUNE

Es un sistema biolgico complejo. Se encuentra distribuido por todos los rganos y fluidos vasculares e intersticiales, excepto el cerebro, concentrndose en rganos especializados como la mdula sea, el bazo, el timo y los ndulos linfticos. Presenta componentes celulares: linfocitos, macrfagos y granulocitos y molculas solubles: anticuerpos, linfocinas y complemento. Es el responsable de conferir la inmunidad al actuar de forma coordinada todos sus componentes. Las clulas y molculas que participan en la defensa inmune llegan a la mayor parte de los tejidos por el torrente sanguneo que pueden abandonar a travs de las paredes de los capilares y al que pueden regresar por el sistema linftico.

adenoides amgdalas ganglios linfticos

timo bazo placas de Peyer (intestino delgado) apndice mdula sea

Fig. 1 Situacin de los rganos del sistema inmune en la especie humana.

(1) Lectura: http://www.ugr.es/~eianez/inmuno/cap_01.htm

J. L. Snchez Guilln

Pgina V-1-1

V) Inmunologa

1) Inmunologa

FUNCIONES DE LOS RGANOS LINFOIDES

rganos rganos linfoides linfoides

Primarios Primarios
Origen, Origen, desarrollo desarrollo yy maduracin de maduracin de las clulas del las clulas del sistema inmune sistema inmune

Secundarios Secundarios
En ellos las En ellos las clulas inmunes clulas inmunes maduras son maduras son activadas por los activadas por los antgenos antgenos

Mdula sea Mdula sea


Origen de las Origen de las clulas del clulas del sistema sistema inmunolgico inmunolgico Maduracin de Maduracin de los linfocitos B los linfocitos B

Timo Timo
Maduracin de Maduracin de los linfocitos T los linfocitos T

Adenoides, Adenoides, amgdalas y amgdalas y placas de placas de Peyer Peyer


Activacin de los Activacin de los linfocitos por los linfocitos por los antgenos antgenos

Ganglios Ganglios linfticos linfticos y bazo y bazo


Activacin de los Activacin de los linfocitos B linfocitos TTyyB

17

Fig. 2 Funcin de los diferentes rganos linfoides del sistema inmunitario.

DEFENSAS DEL ORGANISMO FRENTE A LA INFECCIN

Mecanismos de defensa

Mecanismos Innatos

Mecanismos adquiridos

Mecanismos Innatos externos

Mecanismos Innatos internos

Barreras fsicas Barreras qumicas Flora autctona

Clulas fagocitarias: - Neutrfilo (pus) - Macrfago Clulas asesinas Interfern Complemento

Celulares: linfocitos Moleculares: anticuerpos

Fig. 3 Defensas del organismo.

J. L. Snchez Guilln

Pgina V-1-2

V) Inmunologa

1) Inmunologa

DEFENSAS INESPECFICAS O MECANISMOS INNATOS.

Estn presentes en el organismo de forma natural y se definen como el conjunto de mecanismos que tienden a evitar la invasin de los microorganismos. Son de dos tipos: unos impiden la entrada del agente invasor y otros lo combate una vez que ha penetrado.
MECANISMOS INNATOS EXTERNOS: * Barreras fsicas.

La piel en los animales, que gracias a la capa de queratina, que sufre continuas descamaciones, evita que penetren o proliferen colonias de microorganismos. As, slo los espirilos con su efecto de barrena pueden atravesar las mucosas.
* Barreras qumicas.

- Los orificios naturales estn tapizados por mucosas que segregan mucus con la finalidad de englobar partculas extraas para su expulsin. El moco posee adems sustancias que engaan a ciertos virus, hacindoles creer que ya han penetrado dentro de la clula, el virus suelta su cido nucleico que se pierde en el exterior. - Tambin, la presencia de fluidos en ciertas zonas, por ejemplo: las lgrimas, en los ojos o la saliva en la boca, que lavan y arrastran los microorganismos impidiendo que se instalen o que penetren. Adems, estos fluidos contienen sustancias antimicrobianas; por ejemplo: la saliva contiene lisozima, el semen, espermina, etc. Como curiosidad se puede decir que las infecciones oculares son ms frecuentes en los hombres que en las mujeres. - Las secreciones de sustancias que modifican el pH dificultan la supervivencia de los grmenes. Un ejemplo es el HCl del estmago que no tiene una funcin digestiva sino antimicrobiana o la secrecin de cidos grasos en la piel o de cido lctico.
* Flora autctona.

Los microorganismos presentes de una manera natural en ciertas partes de nuestro organismo, por ejemplo, las bacterias que forman la flora intestinal, impiden que otros se instalen, segregando sustancias o estableciendo competencia por los nutrientes.
MECANISMOS INNATOS INTERNOS

En caso de que el agente extrao logre salvar los anteriores obstculos intervienen respuestas tanto celulares como acelulares.

Clulas asesinas naturales (Natural Killer NK). Son clulas linfoides que se parecen a los linfocitos y que provocan la muerte de los microorganismos, clulas infectadas, clulas tumorales o clulas ajenas. No se sabe cmo Clula Natural killer Clula atacada las reconocen. Las destruyen unindose a Fig. 4 Actuacin de las clulas NK. ellas y fabricando " perforina" una protena que, como su propio nombre indica, crea agujeros en la membrana de las clulas atacadas matndolas. Son pues clulas citolticas.

J. L. Snchez Guilln

Pgina V-1-3

V) Inmunologa

1) Inmunologa

Interfern. Son molculas de naturaleza proteica segregadas por las clulas infectadas por virus, que captadas por las clulas adyacentes, las estimulan a sintetizar enzimas antivirales evitando la proliferacin viral, inhibiendo la replicacin del genoma vrico, inhibiendo la sntesis de protenas o activando a las clulas NK para destruir a las clulas infectadas. El Complemento. Formado por complejos macromoleculares de protenas que se sintetizan en el hgado y circulan por la sangre donde constituyen un 15% de la fraccin de inmunoglobulina del suero. Consta de un conjunto de molculas plasmticas implicadas en una danza bioqumica coordinada, cuya funcin es potenciar la respuesta inflamatoria, facilitar la fagocitosis y dirigir la lisis de clulas, incluyendo la apoptosis (el suicidio celular). Cuando se activa alguno de sus componentes por diversas sustancias como polisacridos o anticuerpos, se originan una serie de reacciones en cadena. El complemento es uno de los componentes fundamentales de la respuesta inmunitaria en la defensa ante un agente hostil. La respuesta inflamatoria es parte de la inmunidad innata y se presenta cuando los tejidos son lesionados por bacterias, traumas, toxinas, calor o cualquier otra causa. Las sustancias qumicas, incluyendo la histamina, bradiquinina, serotonina y otras, son liberadas por el tejido daado y hacen que los vasos sanguneos derramen lquido en los tejidos, lo que deriva en una inflamacin localizada. Esto ayuda a delimitar y aislar la sustancia extraa del contacto con otros tejidos corporales.

Clulas responsables de la inmunidad innata

Macrfago

Clulas natural asesinas (natural killer)

Neutrfilo

-Fagocitosis. -Activacin de los linfocitos T

Citotxicas.

Fagocitosis y eliminacin de microorganismos.

Fig. 5 Clulas responsables de la inmunidad innata interna.

DEFENSAS ESPECFICAS O MECANISMOS ADQUIRIDOS.

A lo largo del proceso evolutivo muchos microorganismos se han hecho parsitos celulares, incluso de las clulas que nos defienden de ellos, los macrfagos. En estas circunstancias, la respuesta innata no es eficaz. Es por esto que se han desarrollado defensas especficas contra ellos. Estas defensas las lleva a cabo el Sistema Inmunitario y al contrario que los mecanismos inespecficos, que siempre estn presentes, nicamente

J. L. Snchez Guilln

Pgina V-1-4

V) Inmunologa

1) Inmunologa

se desarrollan como respuesta a la invasin por un agente extrao concreto. Estas respuestas son celulares: linfocitos y humorales: anticuerpos. La caracterstica de este sistema es que nos defiende especficamente de parsitos, rganos trasplantados, clulas cancerosas, microorganismos y sustancias txicas fabricadas por ellos. Los individuos nacen con un sistema inmunolgico capaz de responder ante lo propio y lo ajeno. Durante las primeras fases del desarrollo este sistema "aprende" a reconocer lo propio y esta capacidad se denomina tolerancia inmunolgica, cuando esta tolerancia se pierde aparecen las enfermedades autoinmunes. En ocasiones pueden producirse reacciones de hipersensibilidad: alergias, que son respuestas del sistema inmunitario a sustancias que en principio son inocuas (por ejemplo: el polen). Las clulas y las sustancias que se comportan como extraas para el organismo y contra las cuales ste desarrolla una respuesta inmune especfica se llaman antgenos. Casi cualquier macromolcula (protena o polisacrido, ms concretamente) con masa molecular de 5000 da o ms puede desencadenar la respuesta inmunitaria, siempre que sea extraa al receptor. Los ndulos linfticos sirven como filtro de la circulacin a los microbios, partculas extraas, restos tisulares y clulas muertas. Contienen linfocitos y macrfagos y es en su interior donde ocurren las interacciones responsables de la respuesta inmune.
LAS CLULAS DEL SISTEMA INMUNITARIO ADQUIRIDO 1) Los linfocitos Son clulas sanguneas que se desarrollan a partir de las clulas madres hematopoyticas, presentes en la mdula roja de ciertos huesos, clulas pluripotenciales que dan lugar a todos los tipos de clulas sanguneas: glbulos rojos (heritrocitos), glbulos blancos (leucocitos) y plaquetas.

Los lifocitos, uno de los tipos de leucocitos, son los responsables de la especificidad inmunitaria. Existen dos clases fundamentalmente:
* Los linfocitos T: Responsables de la inmunidad celular. Se originan a partir de clulas de la mdula sea que emigran al timo. Una vez maduran en el timo lo abandonan y se instalan en los tejidos linfoides. La maduracin en el timo se da poco antes del nacimiento y algunos meses despus. Si se elimina el timo antes de esta transformacin la respuesta inmunitaria celular no se desarrolla.

Cada linfocito T puede reaccionar a un antgeno especfico o un grupo de antgenos sensibilizndose lo que desencadena la respuesta inmunitaria celular. El linfocito T especfico aumenta de volumen, se divide activamente y produce un clon del que se diferencian diversas subpoblaciones de linfocitos: Los lifocitos Tc (citotxicos) que destruyen las clulas infectadas y las clulas tumorales.

Fig. 6 Linfocito T (microscopio de barrido).

J. L. Snchez Guilln

Pgina V-1-5

V) Inmunologa

1) Inmunologa

Los linfocitos Th-2 (linfocitos ayudadores tipo 2) que desencadenan la produccin de anticuerpos por los linfocitos B. Los linfocitos Th-1 (linfocitos ayudadores tipo 1) que desencadenan una de las vas de la respuesta celular. Los linfocitos T supresores (Ts): Inhiben la respuesta inmune cuando esta ya no es necesaria. Los linfocitos T de hipersensibilidad Fig. 7 La interaccin entre un macrfago y un retardada: Juegan un importante linfocitos Th (ayudador), lo trasforma en lifocito papel en las reacciones de Th-1 o linfocito Th-2. hipersensibilidad (alergias). Los linfocitos T amplificadores: Aumentan desmesuradamente la actividad de los linfocitos T (auxiliares y supresores) y de los linfocitos B. Los linfocitos T de memoria: Son responsables de la memoria inmunolgica. Responden rpidamente a nuevas invasiones del antgeno
Receptores T (TCR) Linfocito Th-1 o Th-2 activado Linfocito Th Linfocito Th Macrfago u otra clula presentadora del antgeno

Los linfocitos B. Son las clulas responsables de la inmunidad humoral, Se originan tambin en la mdula sea y al parecer maduran tambin en ella. Se llaman as pues en las aves maduran en la bolsa de Fabricio. Despus de madurar, emigran al tejido linfoide donde se instalan. Se piensa que cada individuo tiene del orden de 100 000 000 de linfocitos B diferentes capaces cada uno de producir un anticuerpo distinto. A lo largo del proceso de respuesta inmunitaria, por la actuacin de los linfocitos Th-2 darn lugar a:

Las clulas plasmticas: responsables de la produccin de anticuerpos responsables de la inmunidad humoral. Las clulas plasmticas de memoria: Capaces de desencadenar una rpida produccin de anticuerpos ante una nueva entrada del antgeno.

2) Los macrfagos: Los macrfagos son clulas que se desplazan con movimiento ameboide entre las clulas de los tejidos fagocitando a los microorganismos, degradndolos y exponiendo molculas del microorganismo o fragmentos de estas en su superficie unidas a unas mol culas glicoproteicas presentes en la membrana de todas las clulas denominadas molculas del Complejo Mayor de Histocompatibilidad (MHC). Es as como los linfocitos T pueden reconocer que un agente extrao ha penetrado en el organismo. Las clulas presentadoras de ant geno pueden ser macrfagos u otras clulas del organismo.

MHC-II

Antgeno

Virus

Macrfago fagocitando un virus

Macrfago presentador del antgeno.

Fig. 8 Macrfago fagocitando un virus y presentando los antgenos unidos al MHC-II (complejo mayor de histocompatibilidad-II).

As pues, puede decirse que el sistema inmunitario slo reconoce lo "ajeno" si es presentado por lo "propio".

J. L. Snchez Guilln

Pgina V-1-6

V) Inmunologa

1) Inmunologa

LOS ANTICUERPOS. ESTRUCTURA DE LOS ANTICUERPOS.


Zona bisagra

Cadena pesada (H) Cadena ligera (L)

Los anticuerpos (Ac) o inmunoglobulinas son prote nas globulares que participan en la defensa contra bacterias y parsitos mayores. Circulan por la sangre y penetran en los fluidos corporales donde se unen espec ficamente al antgeno que provoc su formacin Son prtidos, glucoprotenas (gamma globulinas). Son mol culas formadas por una o varias unidades estructurales bsicas, segn el tipo de anticuerpo. Cada unidad esta formada por cuatro cadenas polipptidicas iguales dos a dos. Dos cadenas pesadas (H) y dos ligeras (L) y una cadena glucdica unida a cada una las cadenas pesadas. Las uniones entre las subunidades proteicas se establecen por puentes disulfuro. Tanto en las cadenas ligeras como en las cadenas pesadas hay dos porciones, la porcin variable (en gris en la figura) diferente en cada anticuerpo y la porcin constante (en blanco). La porcin variable es la encargada de reconocer al antgeno y de unirse a l. Al haber tantos tipos de antge nos, debe de haber tambin muchos tipos de anticuerpos que se distinguirn por su regin variable. Es por esto que esta regin debe de tener una gran posibilidad de variacin.

Glcido

Glcido

Parte variable Parte constante Enlaces disulfuro

Fig. 9 Unidad estructural bsica de un anticuerpo.

Fig. 10 Modelo molecular de la unidad estructural bsica de un anticuerpo.

La regin constante tiene funcin estructural y tiene menos variacin, aunque hay nueve tipos de regiones constantes distintas. De la regin constante va a depender, en cierto modo, la localizacin del anticuerpo. As, segn la regin constante que tengan unos van a localizarse en la saliva, otros pueden pasar la placenta, etc. La regin constante es tambin la parte que desencadena la respuesta celular. As, los anticuerpos se unen a los microorganismos por su parte variable, esto hace cambiar la regin constante y este cambio es detectado por los macrfagos que fagocitarn aquello que lleve anticuerpos pegados, por lo que los anticuerpos libres en la sangre no desencadenarn la respuesta celular. Los anticuerpos tienen adems una zona bisagra. Esta zona es de gran importancia pues debido a ella se pueden adaptar mejor y unirse mejor al antgeno. Ahora bien, al tener en ambos extremos regiones variables va a poder unirse a dos antgenos diferentes.
Tipos de anticuerpos

Hay cinco tipos: Ig M, Ig G, Ig A, Ig D e Ig E . Se diferencian en estructura, momento de la infeccin en el que aparecen, actividad y lugar donde se encuentran (sangre, leche, saliva, etc.)

J. L. Snchez Guilln

Pgina V-1-7

V) Inmunologa

1) Inmunologa

Los de tipo M (Ig M) son los primeros que se producen frente a una infeccin. No tienen regiones bisagra, por lo que no se adaptan bien al antgeno. Ahora bien, al ser tan grandes y tener tantos puntos de unin, si no se unen por una parte, se unir por otra y por eso son eficaces. Aparecen tambin en la superficie de los linfocitos B como "antenas" para recibir los anticuerpos. Los de tipo G (Ig G) se generan despus. Al tener regiones bisagra protegen ms eficazmente que los de tipo M. Pueden atravesar la placenta y proteger al feto de las infecciones pues los fetos no tienen sistema inmunitario especfico, si lo tienen innato. La presencia de anticuerpos G indica que la infeccin es un proceso antiguo. Tipo A (Ig A): Aparecen despus de los M. Son de alta afinidad. No se encuentran en gran cantidad en el suero pero s en las secreciones, saliva y moco, pues atraviesan las mucosas. Pueden tambin pasar a la leche y proteger a los lactantes. La pieza secretora y la especial configuracin que pueden adoptar los protege y evita que sean degradados en ciertas zonas, como en el intestino, donde existen proteasas que podran destruirlos.

Pieza J

Fig. 11 Anticuerpo Ig M, anticuerpos de baja afinidad. Son los primeros que aparecen despus de la infeccin.
Componente secretor

Cadena J

Tipo D (Ig D): Sustituyen a los M. Tienen la misma funcin que estos pero tienen ms afinidad y se unen ms fuertemente. Aparecen tambin como antenas en la superficie de los linfocitos B cuando estos contactan con el antgeno. Tipo E (Ig E): Son de alta afinidad. Tienen tambin la capacidad de salir a las secreciones. Tienen mala fama, pues median en los procesos alrgicos y de anafilaxis (alergia a huevos, mariscos, polen...). Su funcin es la de eliminar parsitos, sobre todo gusanos. Promueven la accin de los mastocitos y de los eosinfilos que producen protenas que vacan a los gusanos. Es de destacar que las infestaciones por protozoos y gusanos son ms corrientes que las infecciones bacterianas.

Fig. 12 Anticuerpo Ig A de alta afinidad, aparecen en las secreciones como la saliva o el moco.

J. L. Snchez Guilln

Pgina V-1-8

V) Inmunologa

1) Inmunologa

LA RESPUESTA INMUNITARIA ADQUIRIDA

Los organismos que desarrollan inmunidad adquirida van a reaccionar desencadenando dos tipos de respuesta: La respuesta inmunitaria humoral: El objetivo de esta respuesta es la produccin de anticuerpos por las clulas plasmticas. Estos se fijarn a los organismos y molculas extraas con capacidad antignica provocando una serie de reacciones que conducirn a la destruccin de los agentes extraos, que sern fagocitados por los macrfagos fundamentalmente. Esta respuesta se dirige sobre todo a los agentes extraos, virus, por ejemplo, que salen de las clulas infectadas para infectar nuevas clulas. La respuesta inmunitaria celular: La respuesta humoral es poco eficaz si se trata de destruir a los agentes extraos que estn en el interior de las clulas del propio organismo. La respuesta celular va dirigida a destruir estas clulas infectadas y a evitar que los agentes extraos puedan seguir reproduciendose en ellas. Ambas respuestas actan coordinadamente contra los agentes patgenos circulantes, los que se encuentran en el interior de las clulas y las toxinas producidas por ellos.

La respuesta inmunitaria

Humoral

Celular

Objetivo: produccin de anticuerpos por las clulas plasmticas.

Dirigida a destruir a clulas infectadas para evitar que puedan seguir generando nuevos agentes infecciosos. Tambin destruyen clulas tumorales.

Dirigida a agentes extraos, virus, por ejemplo, que salen de las clulas infectadas para infectar otras clulas.

Fig. 13 La respuesta inmunitaria adquirida.

J. L. Snchez Guilln

Pgina V-1-9

V) Inmunologa LA RESPUESTA INMUNITARIA I (La respuesta humoral)

1) Inmunologa

1)

Comienza

cuando

un

macrfago

una

clula

MHC-II

Antgeno

emparentada fagocita al microorganismo y lo degrada, presentando partculas del microorganismo o antgenos (Ag) en la superficie de su membrana unidos al MHC-II (complejo mayor de histocompatibilidad) del macrfago.
Macrfago fagocitando un virus Virus

Macrfago presentador del antgeno.


TCR

3) Si un linfocito Th (ayudador) que lleve un receptor (TCR) adecuado, que se adapte al complejo MCH-II-Ag, entra en contacto con el macrfago presentador del antgeno, se activa, se multiplica y se diferencia en dos poblaciones de linfocitos: la Th-1 y la Th-2. La Th-2 ser la que desencadene la respuesta humoral y la Th-1 desencadenar la respuesta celular.

MHC-II-Antgeno

Linfocito Th (ayudador) Linfocito Th-2 activado

3) Si un linfocito B que lleve en su membrana un anticuerpo especfico (BCR o receptor de la clula B) adecuado establece contacto con el antgeno, lo internaliza mediante endocitosis, lo degrada y presenta fragmentos antignicos en su membrana unidos al MHC-II (MHC-II-Ag).

Virus BCR MHC-II-Ag

Linfocito B especfico Linfocito especfico activado

4) Cuando el linfocito Th-2 activado y el linfocito B que lleva el complejo MHC-II-Ag adecuado, por haber estado en contacto con el antgeno, entran en contacto, se desencadena la produccin de interleucinas por parte del linfocito Th-2. Esto transformar al linfocito B en una clula plasmtica.

TCR

Interleucinas

MHC-II-Ag

Linfocito Th-2 activado

Linfocito B Linfocito B activado por Ag

5) La clula plasmtica produce grandes cantidades de anticuerpos. Los anticuerpos se fijan al agente extrao (un virus, en este caso) de manera especfica y lo marcan para que pueda ser localizado, identificado y fagocitado por los macrfagos y otras clulas fagocitarias.
Clula plasmtica

Anticuerpos

Virus Macrfago Macrfago fagocitando los virus

Despus de haber destruido al agente patgeno, la mayor parte de los linfocitos Th-2 y las clulas plasmticas desaparecen quedando slo algunas pocas llamadas clulas B de memoria y linfocitos Th de memoria que pueden permanecer durante largo tiempo, incluso aos, para responder de inmediato a futuras entradas del agente invasor (memoria inmunolgica).

J. L. Snchez Guilln

Pgina V-1-10

V) Inmunologa LA RESPUESTA INMUNITARIA II (La respuesta celular)


TCR MHC-II-Antgeno

1) Inmunologa

1) Si un linfocito Th (ayudador) que lleve un receptor (TCR) adecuado, que se adapte al complejo MCH-II-Ag del macrfago presentador del antgeno, entra en contacto con este, se activa, se multiplica y se diferencia en dos poblaciones de linfocitos Th: la Th-1 y la Th-2. Los Th-1 desencadenarn la respuesta celular.

Macrfago presentador del antgeno.

Linfocito Th (ayudador) Linfocito Th-1 activado

2) Estos linfocitos liberan sustancias que activan a los macrfagos infectadas. para que destruyan a las clulas

Linfocito Th-1

Activacin del Macrfago macrfago

3) Los macrfagos activados (clulas enfadadas) tienen una gran capacidad fagocitaria. Fagocitan a las clulas infectadas y son refractarios al parsito intracelular no infectndose por el microorganismo.

Clula infectada

Macrfago activado

Virus

4) Una segunda va celular parte de los lifocitos T citotxicos. Estos reconocen con sus receptores (TCR) los componentes antignicos que les presentan las celulas infectadas.

Receptores TCR

Linfocito Tc (citotxico)

Clula infectada o tumoral

5) Los linfocitos Tc (citotxicos)

actan entonces

produciendo sustancias que destruyen las clulas infectadas por el virus y tambin clulas tumorales,

Linfocito Tc citotxico

Clula infectada o tumoral

Despus de haber destruido las clulas infectadas, las clulas citotxicas desaparecen, pero algunas clulas citotxicas de memoria permanecen durante ms o menos tiempo para responder de inmediato a futuras entradas del microorganismo invasor (memoria inmunolgica).

J. L. Snchez Guilln

Pgina V-1-11

V) Inmunologa

1) Inmunologa

La respuesta humoral

Antgeno

Macrfago (fagocita a los patgenos) activacin

Linfocito B fagocita al antgeno

activacin

Linfocito Th-2

Interleucinas

Clula plasmtica

Anticuerpos

Linfocito Th-2 de memoria

Clula plasmtica de memoria

Se unen a los patgenos. Los macrfagos los fagocitan

Fig. 14 La respuesta inmunitaria humoral.

La respuesta celular
Macrfago (fagocitan a los patgenos)

Clula infectada Activacin

Activacin

Linfocito Th-1

Linfocito Tc citotxico

Clula infectada Clula enfadada Destruccin de clulas infectadas o tumorales

Clula enfadada de memoria

Fagocitosis de clulas infectadas

Clula citotxica de memoria

Fig. 15 La respuesta inmunitaria celular.

J. L. Snchez Guilln

Pgina V-1-12

V) Inmunologa

1) Inmunologa

LA ESPECIFICIDAD ANTIGNICA Y SELECCIN CLONAL

El Sistema Inmunitario puede distinguir antgenos muy similares entre s, por ejemplo dos protenas que nicamente se diferencien en un aminocido. Por lo tanto el Sistema Inmunitario puede responder a millones de antgenos extraos diferentes de una manera altamente especfica mediante la produccin de anticuerpos que reaccionan slo con el antge no que ha inducido su formacin. )Cmo puede ser que teniendo slo unas decenas de miles de genes en nuestras clulas podamos generar hasta 100.000 .000 anticuerpos diferentes? Esto es debido a que durante el desarrollo, cuando se generan los lifocitos B, se producen combinaciones y recombinaciones entre los genes que producen los protmeros que forman los anticuerpos. De esta manera se generan hasta 100.000.000 de lifocitos B diferentes, cada uno de estos linfocito B tiene en su superficie celular unos receptores que se adaptan espec ficamente a un antge no distinto.

Fig. 16 Especificidad antignica y seleccin clonal.

Posteriormente, si un antgeno se une a uno de estos receptores, el linfocito se activa y se reproduce produciendo un clon de clulas que tendrn todas ellas la misma especificidad antig nica (Teora de la seleccin clonal). Es decir, la llegada de un antge no extrao estimula selectivamente a aquellas clulas que presentan unos receptores complementarios y especfi cos del antgeno y por consiguiente listas para dar una respuesta al mismo.

LA REACCIN ANT GENO ANTICUERPO

Las zonas del antgeno que se unen especfi camente con el anticuerpo o con el receptor de un linfocito, se denominan determinantes antigni os. Cada antgeno puede presentar c varios determinantes antignicos diferentes que estimulan la produccin de anticuerpos y la repuesta de los linfocitos. Estas estructuras qumi cas, los determinantes antigni os, c son los responsables de la especificidad de la respuesta inmunitaria. Al entrar en contacto antgeno y anticuerpo se unen mediante enlaces no covalentes (F. Van der Waals, Uniones hidrofbicas, E. hidrgeno) y se desencadenan una serie de procesos capaces de neutralizarlo y eliminarlo. La unin entre ellos es reversible, depende de sus concentraciones y tambin de la afinidad, cuanto mayor sea sta, ms proporcin de molculas estarn unidas. Las reacciones ms importantes entre antgeno y anticuerpo son las siguientes:

J. L. Snchez Guilln

Pgina V-1-13

V) Inmunologa

1) Inmunologa

Precipitacin: Al unirse ant genos y anticuerpos solubles forman agregados insolubles que precipitan, lo que inacti va a los antge nos.

Antgeno

Anticuerpo

Precipitado

Aglutinacin: El anticuerpo se une a ant genos situados en la superficie de una clula. Como los anticuerpos tienen dos puntos de unin, los microorganismos forman agregados y ya no pueden infectar otras las clulas.

Microorganismo

Anticuerpo

Aglutinado

Neutralizacin: Anti cuerpos situados en la membrana plasmtica bloquean la accin de los ant genos contra la clula. As, los antge nos no se pueden unir a las clulas y matarlas.

Antgenos Antgenos

Anticuerpos

Clula protegida

Clula no protegida (muere)

Opsonizacin: Consiste en la fagocitosis de los

aglutinados de patgenos, de las clulas infectadas o de las clulas tumorales por los macrfagos, que son atrados por la presencia de anticuerpos especficos que se han unido a sus ant genos.
Clula fagocitaria Aglutinado de virus

La unin antgeno-anticuerpo no es suficiente para la eliminacin del agente extrao contra el que luchamos. Se precisa la colaboracin de otros elementos (complemento, clulas fagocitarias y clulas NK). El conglomerado antgeno-anticuerpo puede as ser fagocitado por las clulas del Sistema Retculo Endotelial (S.R.E.) o por las Natural Killer. Las molculas del Complemento, al unirse al complejo formado por antgenos y anticuerpos, pueden estimular la fagocitosis por parte de los macrfagos.

J. L. Snchez Guilln

Pgina V-1-14

V) Inmunologa

1) Inmunologa

LA RESPUESTA PRIMARIA Y SECUNDARIA Respuesta humoral primaria: Se produce la primera vez que se entra en contacto con el antgeno (a los 7 das de la primera infeccin). Las clulas plasmticas producen anticuerpos IgM dosis moderadas hasta que cesa la infeccin. Respuesta humoral secundaria: Si se repite el ataque, al cabo de das, incluso aos, se desencadena la respuesta secundaria, ms rpidamente. Las clulas de memoria producen en poco tiempo (al cabo de unos 3 das) de 100 a 1000 veces ms anticuerpos del tipo IgG (en ciertas situaciones de los tipos IgA e IgE). Tambin dura ms tiempo, y su declive sea ms lento.

Fig. 17 Respuestas primaria y secundaria

INMUNOESTIMULACIN: VACUNAS Y SUEROS

Aunque el Sistema Inmunitario est capacitado para combatir y eliminar clulas o molculas ajenas, las enfermedades infecciosas siguen siendo una de las principales causas de mortalidad, sobre todo en pases subdesarrollados. En los ms industrializados se est produciendo un aumento de enfermedades que se crean controladas como la tuberculosis, o la aparicin de otras como el SIDA. Es pues una preocupacin actual la prevencin de las enfermedades. Denominamos profilaxis al conjunto de medidas tomadas para prevenir la enfermedad. Los mecanismos para conseguir inmunidad los podemos resumir en:

a) La inmunidad adquirida activa. - Natural: Cuando el propio sujeto desarrolla la respuesta frente a antgenos concretos al estar en contacto con el agente.

- Artificial: Como la que se adquiere con la vacunacin.

b) Inmunidad adquirida pasiva.

Se consigue cuando hay transferencia de anticuerpos fabricados activamente por otro individuo. Puede ser: - Espontnea: Cuando el paso de anticuerpos es de la madre al feto a travs de la placenta

J. L. Snchez Guilln

Pgina V-1-15

V) Inmunologa

1) Inmunologa

o por absorcin de la leche materna en los primeros das de lactancia. - Artificial: La inmunidad adquirida pasiva se denomina artificial cuando los anticuerpos se administran en preparados biolgicos, como en el caso de los sueros.

Fig. 18 Tipos de inmunidad

Tipos de inmunidad Inmunoestimulacin


Inmunidad adquirida activa Inmunidad adquirida pasiva

Natural: El propio sujeto la desarrolla al pasar la enfermedad. Artificial: Se adquiere por medio de la vacunacin.

Natural: Como la que adquiere el feto a travs de la placenta o el lactante con la leche materna. Artificial: Administracin de anticuerpos externos (sueros).

Las vacunas son preparados antignicos constituidos por organismos no virulentos destinados a desencadenar la respuesta humoral.

Los sueros son preparados de anticuerpos destinados a desencadenar la respuesta inmune de una manera rpida, aunque no duradera. 57

Fig. 19 Inmunoestimulacin.

VACUNAS

Son preparados antignicos constituidos por microorganismos no virulentos, muertos o por molculas de estos desprovistas de toxicidad. Se obtienen a partir de microorganismos u otros agentes infecciosos e inducen en el individuo una inmunidad adquirida activa frente a esos agentes inoculados, con un mnimo de riesgos y de reacciones locales y generales. Su objetivo es desencadenar la produccin de clulas inmunitarias de memoria.

J. L. Snchez Guilln

Pgina V-1-16

V) Inmunologa

1) Inmunologa

Las vacunas deben tener dos propiedades: - Eficacia, pues tienen que desencadenar la respuesta inmune correcta. - Inocuidad, la vacuna debe estar desprovista de poder patgeno, logrando este objetivo sin interferir en la respuesta inmune.

SUEROS

Mediante los sueros se consigue una inmunidad inmediata ya que los preparados biolgicos que inoculamos contienen los anticuerpos especficos que la urgencia precisa. Es una intervencin rpida menos duradera e intensa que la provocada por la vacunacin. El paciente no participa en la elaboracin de molculas, es por tanto una inmunidad adquirida pasiva. Existen dos tipos de sueros: - Sueros homlogos: Son sueros obtenidos de humanos que poseen anticuerpos para un determinado antgeno. - Sueros heterlogos: Proceden de otras especies pero contienen anticuerpos para patgenos humanos. De esta manera se obtiene, por ejemplo, las antitoxinas, que son sueros frente al veneno de las serpientes, escorpiones, araas, etc.

SEROVACUNACIN

Conjunto de medidas preventivas que combinan la vacunacin con los tratamientos con sueros adecuados. Este procedimiento combina la administracin del suero preciso con la vacunacin. El suero contiene anticuerpos que actan en los primeros momentos de urgencia y, posteriormente, se desencadena la inmunidad activa producida por la vacuna. Se emplea, por ejemplo, en el tratamiento del ttanos, del botulismo y de la rabia.

INMUNOPATOLOGA Descripcin del concepto de enfermedad autoinmune y algunos tipos de ellas.

Las clulas del sistema inmunitario linfocitos, macrfagos y otras han de aprender a tolerar cada clula y cada protena del organismo sin dejar de atacar por ello a los invasores externos. No obstante, se puede dar el caso de que algunos linfocitos inmaduros respondan ante elementos del propio cuerpo. Ahora bien, normalmente, si una clula inmunitaria reacciona ante un producto del propio organismo mientras se est formando en el timo o en la mdula sea, suele ser destruida o, al menos, inactivada por el propio organismo. Sin

J. L. Snchez Guilln

Pgina V-1-17

V) Inmunologa

1) Inmunologa

embargo, a pesar de este mecanismo de seguridad, algunos linfocitos pueden escapar a la inactivacin o destruccin y desencadenar una respuesta inmunitaria contra molculas o clulas del propio organismo generndose una enfermedad autoinmunitaria. Las enfermedades de autoinmunidad pueden afectar a cualquier rgano, si bien algunos se ven afectados con ms frecuencia que otros; por ejemplo: la sustancia blanca del cerebro y de la mdula espinal, en la esclerosis mltiple, los revestimientos de las articulaciones, en la artritis reumatoide, las clulas secretoras de insulina, en la diabetes mellitus juvenil. Ciertas enfermedades autoinmunes destruyen las conexiones entre nervios y msculo (miastenia gravis) y otras producen un exceso de hormona tiroidea en la glndula tiroides (enfermedad de Graves). Las hay que producen ampollas en la piel (pnfigo vulgar) o que destruyen los riones y otros rganos (lupus eritematoso sistmico).
Fenmenos de hipersensibilidad: alergias.

La respuesta alrgica es una intensa reaccin de ciertos componentes del sistema inmunitario contra una sustancia extraa que por lo general es inofensiva.
Nota: )Por qu la seleccin natural ha permitido que la alergia se haya extendido tanto? Se sabe que ciertos rasgos de la alergia solo vuelven a darse cuando el sistema inmunitario intenta erradicar parsitos. As, el cuerpo sintetiza cantidades elevadas de anticuerpos de tipo IgE tanto ante la presencia de alrgenos como ante la de parsitos. Frente a otro tipo de invasores recurre a otro tipo de anticuerpos. Una hiptesis podra ser que el cuerpo desarroll en su origen la respuesta alrgica para hacer frente a los parsitos. Las personas capacitadas por su dotacin gentica para organizar un ataque inmunitario eficaz contra esos organismos sobreviviran mejor que quienes carecieran de ese mecanismo defensivo, habran tenido mayor descendencia y sus hijos habran transmitido a su vez a los suyos esos genes. As se extendera entre la poblacin humana el sistema de defensa contra los parsitos. Esta capacidad de defensa ha permanecido til all donde abundan los parsitos. Sin embargo, el sistema inmunitario de quienes ya no se encuentran con esos organismos reacciona ahora libremente -aunque de forma contraproducente- ante otras sustancias como el polen. En respaldo de esta tesis se ha observado que la alergia es menos comn en las naciones en vas de desarrollo que en las industrializadas pero la investigacin realizada en animales de experimentacin para someter a prueba la hiptesis no ha resuelto nada.

Se sabe que alrgenos diferentes provocan sntomas dispares, en parte porque atacan al sistema inmunitario en diferentes puntos del organismo. En el tracto respiratorio superior la respuesta inmunitaria errnea produce estornudos y congestin nasal: rinitis alrgica. En el tracto respiratorio inferior puede causar constriccin y obstruccin de los bronquios, participando, por lo tanto, en el desarrollo de sntomas asmticos. En el tracto gastrointestinal la actividad inmunitaria provoca a veces nauseas, espasmos abdominales, diarrea y vmitos. Por ltimo, si un alrgeno introducido por cualquier va llega a la circulacin sangunea puede inducir anafilaxis. Aunque las manifestaciones externas de la respuesta alrgica varan, sta siempre se pone en marcha mediante un proceso silencioso de sensibilizacin. Este proceso empieza cuando los macrfagos (2) degradan el alrgeno (1) y muestran los fragmentos resultantes a los linfocitos T (3). Estos segregan interleucinas (4) que hacen que los linfocitos B maduren y se transformen en clulas plasmticas que secretan inmunoglobulinas (5). Estos anticuerpos se unen a sus receptores en los mastocitos (6) -glbulos blancos no circulantes que se encuentran en el tejido conjuntivo- y en los basfilos circulantes en

J. L. Snchez Guilln

Pgina V-1-18

V) Inmunologa

1) Inmunologa

sangre (7).

3 Linfocito T 1 alrgeno Linfocito B 2 macrfago 4 Molculas sealizadoras Vaso sanguneo 5 anticuerpos

7 Basfilos

* *

* * *

6 Mastocitos

Histamina

Fig. 20 La respuesta alrgica.

En posteriores contactos entre el alrgeno y el organismo las molculas de alrgeno se unen a anticuerpos IgE de los mastocitos con lo que se desencadenan una serie de reacciones que llevan a la secrecin por parte de los mastocitos de histamina y otras sustancias que sern los responsables de muchos sntomas alrgicos.

El cncer y la respuesta inmunitaria.

Las clulas cancergenas se parecen a las clulas normales del cuerpo en muchos aspectos. An as, actan como clulas extraas, reproducindose rpidamente e invadiendo los tejidos. Adems, las clulas cancergenas tienen antgenos en su superficie celular que difieren de los antgenos de las clulas normales y pueden ser identificadas como extraas por lo que, quizs, el organismo pueda organizar una respuesta inmunitaria. Cada vez hay ms pruebas que indican que el cncer no slo puede inducir una respuesta inmunitaria sino que es un hecho que sta se podra producir de modo que las clulas cancergenas fuesen suprimidas mucho antes de que se detecte el cncer. Los cnceres que se desarrollan representaran fallos ocasionales del sistema inmunitario. Por lo tanto, si se refuerza la respuesta inmunitaria, se podr avanzar en el proceso de lucha contra el cncer.

J. L. Snchez Guilln

Pgina V-1-19

V) Inmunologa

1) Inmunologa

El S.I.D.A y sus efectos en el sistema inmune. Estructura del V.I.H.

El virus del S.l.D.A. 1 es un retrovirus, conocido como virus de la inmunodeficiencia humana (VIH). Est constituido por dos molculas de RNA acompaadas de dos o ms molculas del enzima retrotranscriptasa (o transcriptasa inversa). Rodeando a la zona central hay dos envolturas proteni cas distintas que, a su vez, estn rodeadas por una bicapa lipdi ca con glucoprotenas insertas. Las porciones proteni cas de las molculas superficiales contienen regiones constantes idnticas de una cepa del virus a otra y regiones variables.

Fig. 21 Virus del S.I.D.A.: a) envoltura membranosa; b) cpsida ; c) cido nucleico (ARN); d) espculas proteicas.

Ciclo del V.I.H.

Cuando el VIH entra en el organismo, las glucoprotenas externas se unen a las molculas CD4 de los linfocitos T cooperadores (tambin puede infectar macrfagos), sin embargo, para entrar en el interior del linfocito necesita fusionarse con la membrana celular (1). En 1996, un equipo de trabajo del Instituto Nacional de Alergias y Enfermedades Infecciosas de EEUU, encabezado por Edward Berger, identific en la cara exterior de la membrana de los linfocitos T una protena, a la que denominaron fusina, que permite la entrada del VIH en la clula2 . Juntamente con la fusina, estos dos ltimos aos se han descubierto otras molculas, de funcin similar, que se denominan correceptores3 . Una vez dentro de la clula, el RNA se libera de la cpsula que lo contiene (2), y la transcriptasa inversa cataliza la transcripcin inversa sintetizando un ADN complementa1

Fue identificado por primera vez en 1981 al observar la aparicin en hombres jvenes de un tumor maligno (Sarcoma de Kaposi) que afecta a los revestimientos endoteliales de los vasos sanguneos y que hasta entonces slo se haba observado en hombres de edad avanzada. En la misma poca y tambin en hombres jvenes se detecta un incremento de neumonas e infecciones fatales del tracto intestinal causadas por protistas ubicuos pero habitualmente inocuos. Anteriormente estas enfermedades se haban observado en pacientes cancerosos y en receptores de transplantes cuyos sistemas inmunes haban sido suprimidos. Estos hechos sugeran que la causa era una supresin masiva del sistema inmune. Las primeras imgenes del virus al microscopio electrnico se identificaron, en febrero de 1983, en el Instituto Pasteur de Pars por el profesor Luc Montaigner.
2

La hipottica funcin normal de esta protena se desconoce, se sabe que est formada por 352 aminocidos y que pertenece al grupo de las protenas receptoras G, conocidas como facilitadoras de la entrada en la clula de los virus y otros agentes patgenos. Se sospecha que los macrfagos tienen una protena similar.
3

Recientemente se ha visto que. entre los mecanismos que explican la resistencia de algunas personas probablemente inmunes a la infeccin, existe tambin una causa gentica. Alrededor de un 1% de la poblacin europea es deficiente para alguno de aquellos correceptores y, por tanto, resistente a la infeccin por VIH.

J. L. Snchez Guilln

Pgina V-1-20

V) Inmunologa

1) Inmunologa

rio del ARN viral (3 y 4). Este ADN se incorpora a un cromosoma de la clula hospedadora (5), en esta etapa el virus es extremadamente sensible a los inhibidores de dicha enzima. A continuacin comienza a replicarse (6) originando nuevas partculas virales que salen del linfocito T (8) e invaden a otros linfocitos u a otras clulas. Frecuentemente el linfocito T resulta destruido.

1 2

6a

6b 3

Fig. 22 Infeccin de una clula por el virus del SIDA (ciclo del VIH).

Se sabe que la replicacin del VIH se produce desde las fases muy precoces de la infeccin y en tasas muy elevadas, por medio de continuados ciclos de infeccin. Si el seropositivo no enferma hasta transcurrido un tiempo es porque el organismo dispone de herramientas eficaces para hacerle frente. En un solo da pueden originarse en una persona infectada del orden de 1000 millones de nuevas partculas vricas, producindose cada 48 a 72 horas la renovacin de buena parte de los virus circulantes y de los linfocitos infectados. Esta situacin se amplifica enormemente la variabilidad gentica del virus, la cual se produce como consecuencia de los errores de copia que tienen lugar durante la transferencia de informacin desde el ARN viral hasta el ADN. Muchas de las variantes genticas originadas por mutacin resultan no ser viables, pero algunas s lo son y llegan a formar un cmulo de variantes que explicara por qu finalmente el sistema inmunitario acaba por fracasar, ante la imposibilidad de mantener una lucha contra un enemigo tan inestable. Algunas de las formas mutantes del virus implican cambios en la estructura de los pptidos que actan como determinantes antignicos. Aunque muchos de estos cambios no parecen afectar a la actividad del sistema inmunitario, distintos investigadores han sugerido que algunos pueden hacer que determinado pptido se vuelva invisible a las defensas del organismo (mutantes elusivos). Este encadenamiento de determinantes

J. L. Snchez Guilln

Pgina V-1-21

V) Inmunologa

1) Inmunologa

antignicos variables y mutantes escurridizos explicara la pervivencia de la infeccin y la dificultad de erradicarla (adems de complicar la bsqueda de vacunas).

Transmisin del V.I.H.

Los estudios epidemiolgicos realizados en Europa, Amrica, frica y Australia han documentado de forma reiterada que solamente hay tres formas de transmisin del V.I.H. - Por relacin sexual (homosexual, bisexual, heterosexual) con personas infectadas - Por contacto con la sangre, hemoderivados, semen y los rganos transplantados de personas infectadas - Por transmisin de madre infectada a hijo. La mayor parte de las veces antes del nacimiento y quizs durante el parto (transmisin perinatal)

Prcticas de riesgo.

- Compartir la misma jeringuilla o agujas sin desinfectar. - Las relaciones sexuales con penetracin anal, sin utilizar preservativos. - Las relaciones sexuales con personas enfermas o portadoras, sin utilizar preservativos. - Otros tipos de relaciones en las que se puedan producir heridas entre las personas con riesgo de contagio.

Rechazo de transplantes.

Desde hace algn tiempo se recurre a la tcnica de transplantes para solucionar situaciones que ponen en peligro la salud de un individuo. En los transplantes se produce la eliminacin del tejido o del rgano daado y la implantacin de otro que rena las condiciones adecuadas para la supervivencia del receptor.

En los autoinjertos el transplante procede del mismo organismo y el tejido simplemente es movido de una posicin a otra. Esta situacin siempre tiene xito si las tcnicas quirrgicas y aspticas son las adecuadas. Tambin tienen xito los transplante en los que el donante y el receptor son gemelos genticamente iguales. Otra posibilidad es entre individuos de la misma especie pero genticamente diferentes. Tambin se realizan en algunas ocasiones transplantes entre individuos de diferente especie, xenoinjerto, como entre el hombre y el cerdo.

En los dos ltimos casos el tejido transplantado generar, por parte del receptor, una respuesta inmune destructiva que se denomina rechazo. Tiene su origen en la existencia de protenas de superficie en las membranas (molculas del CMH), si stas son reconocidas como extraas se desencadena la respuesta inmune especfica.

J. L. Snchez Guilln

Pgina V-1-22

V) Inmunologa

1) Inmunologa

Con el fin de evitar estos problemas, los inmunlogos de transplantes realizan pruebas previas de histocompatibilidad. La experiencia demuestra que algunos lugares anatmicos son privilegiados y, en porcentajes elevados, no generan rechazo. Es el caso del transplante de crnea. Por lo general, en todas las dems intervenciones debe tratarse al paciente con inmunosupresores inespecficos con el consiguiente riesgo de enfermedades infecciosas en el postoperatorio, o tambin se puede aplicar un tratamiento de inmunosupresin especfi ca. En la actualidad se est experimentando para obtener por ingeniera gentica y clonacin cerdos cuyos tejidos no produzcan rechazo en la especie humana y poder tener de esta manera una gran cantidad de rganos para transplantes.

ANTICUERPOS MONOCLONALES

Si una sustancia extraa (un antgeno) se inyecta en el cuerpo de un ratn o un humano, alguna de las clulas B de su sistema inmune se transformarn en clulas plasmticas y empezarn a producir anticuerpos que se unirn a ese antgeno. Cada clula B produce un solo tipo de anticuerpo, pero diferentes linfocitos B producirn anticuerpos estructuralmente diferentes que se unen a distintas partes del antgeno. Esta mezcla fisiolgica natural de anticuerpos es conocida como 'anticuerpos policlonales'. Un anticuerpo monoclonal es un anticuerpo homogneo producido por una clula hbrida producto de la fusin de un clon de linfocitos B descendiente de una sola y nica clula madre y una clula plasmtica tumoral. Los anticuerpos monoclonales (Mab, del ingls monoclonal antibody), son anticuerpos idnticos porque son producidos por un solo tipo de clula del sistema inmune, es decir, todos los clones proceden de una sola clula madre. Es posible producir anticuerpos monoclonales que se unan especficamente con cualquier molcula con carcter antignico. Este fenmeno es de gran utilidad en bioqumica, biologa molecular y medicina. Para producir anticuerpos monoclonales, primero se extraen clulas B del bazo de un animal que ha sido expuesto al antgeno. Estas clulas B son fusionadas con clulas tumorales que pueden crecer indefinidamente en cultivo celular. Estas clulas fusionadas hbridas pueden multiplicarse rpida e indefinidamente, puesto que son clulas tumorales despus de todo y pueden producir gran cantidad de anticuerpos. Los hibridomas son diluidos y cultivados para obtener un nmero diferente de determinadas colonias, las cuales producen slo un tipo de anticuerpo.
Los anticuerpos monoclonales se utilizan en muchos campos como:

La investigacin biomdica, como la identificacin y clonacin de genes, la identificacin y aislamiento de protenas, la activacin de enzimas. Diagnstico: En medicina, gracias a la gran especificidad y capacidad prcticamente ilimitada de los anticuerpos monoclonales para reconocer cualquier estructura qumica,

J. L. Snchez Guilln

Pgina V-1-23

V) Inmunologa

1) Inmunologa

permite la deteccin de hormonas, vitaminas, citocinas; la monitorizacin de drogas, deteccin de enfermedades infecciosas en microbiologa; la deteccin de alergenos en alergia, hematologa, marcadores tumorales e infartos de miocardio, aplicaciones forenses, inmunoescintografa. En las tnicas diagnsticas se emplean diversas herramientas de biologa molecular como ELISA, EIA, citometra, inmunohistoqumica, inmufluorescencia. Los anticuerpos monoclonales son unas de las sustancias ms utilizadas en los laboratorios de diagnstico. Biosensores: Los anticuerpos monoclonales acoplados a transductores electrnicos pueden detectar tanto molculas orgnicas como inorgnicas como la contaminacin de metales pesados en alimentos y agua, deteccin de gases txicos, etc. Un biosensor es un instrumento analtico formado por un material biolgico inmovilizado como una enzima, anticuerpo, clula entera, orgnulo o combinaciones de los mismos, en ntimo contacto con un sistema transductor adecuado que convierta la seal bioqumica en una seal elctrica cuantificable. Tratamiento: Las aplicaciones teraputicas constituyen el campo ms importante de los anticuerpos monoclonales, ya que son capaces de erradicar ciertas infecciones y destruir clulas, incluidas las tumorales, mediante distintos mecanismos. Por esta razn, son excelentes sustancias para el tratamiento de enfermedades infecciosas, enfermedades autoinmunes, el cncer o en trasplantes para evitar el rechazo. Existen varios anticuerpos monoclonales aprobados para su uso en determinadas enfermedades.

J. L. Snchez Guilln

Pgina V-1-24